Error loading sequence information for PPTG_22487 - InterProScan visuals disabled

Ph. parasitica: PPTG_22487

Location

scaffold_17

719089 - 719235 (-)

Protein Sequence

>PPTG_22487
MLDQLKHVMSRPINGNAPTEKHMGMSPQSKLEKADPSTAFERSGWCYI

Gene Sequence

>PPTG_22487
ATGCTCGACCAGCTAAAGCACGTGATGTCTCGCCCGATTAACGGAAATGCCCCTACCGAG
AAGCACATGGGCATGTCCCCACAGTCCAAGTTGGAGAAGGCTGACCCCTCCACGGCCTTC
GAGCGCTCCGGATGGTGCTACATCTAA

Amino Acid Properties