Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
PYIR:scaffold_50247671163612720.0
PYUU:scaffold_2037129794812985045645965e-151
PYIR:scaffold_2249141419945935409e-136
PYIR:scaffold_81070941075204323142e-74
PHSO:scaffold_1279140827919585613112e-73
PHCA:scaffold_79014909018954152554e-58
PYVX:scaffold_275758680644842402e-54
PHSO:scaffold_148188318192994812333e-52
PYAP:scaffold_560806885785192222e-49
PHRA:scaffold_267928698125362222e-49
PYIW:scaffold_711349238503822206e-49
PHSO:scaffold_3518147185494122143e-47
PHSO:scaffold_56820006824024122143e-47
PHCA:scaffold_8493760942254832091e-45
PHIF:NW_003303730.16969836973854132081e-45
PHRA:scaffold_561626071630164192035e-44
PHRA:scaffold_10612940134134831962e-42
PHIF:NW_003303626.12672982675472511962e-42
PHRA:scaffold_7925683260874171871e-39
PHPA:scaffold_226854356858424161854e-39
PHKE:scaffold_622348838213431712e-35
PHPA:scaffold_632430392435014811673e-34
PHKE:scaffold_9857700579712731611e-32
PYAR:scaffold_3459215225484071555e-31
PYAP:scaffold_182155219423971506e-30
PHSO:scaffold_4436500743653603651443e-28
PHKE:scaffold_7613918044261439e-28
PYIR:scaffold_48282265993871413e-27
PHSO:scaffold_6437959383123651391e-26
PHSO:scaffold_121684181688364311286e-24
PHPA:scaffold_661626231628712491171e-20
PHPA:scaffold_46348437322491171e-20
PHSO:scaffold_11202248620228043501092e-18
PHIF:NW_003303697.13587023591564761092e-18
PLHA:NW_020189073.134836350912631082e-18
PHCA:scaffold_6721936021943475901e-13
PYIR:scaffold_5731593716055119792e-10
PHPA:scaffold_20363650364063436782e-10
PHPA:scaffold_3915145715151963768e-10
PYAR:scaffold_5931576515877114743e-09
PYAP:scaffold_2891449814637141729e-09
PHIF:NW_003303747.12704501270456363713e-08
PYIW:scaffold_354214451569128681e-07
PHRA:scaffold_123248182485841674e-07
PHPA:scaffold_16489035489252219664e-07
PHSO:scaffold_81240748124080154635e-06
PHRA:scaffold_33370647370888250635e-06
PYAR:scaffold_67473157457143625e-06
PHSO:scaffold_1652209252213241625e-06
PHCA:scaffold_1164799564804753612e-05
PYUU:scaffold_202882130582133531572e-04
PHRA:scaffold_28921693175967572e-04
PHRA:scaffold_4948329839567572e-04
PHPA:scaffold_76439334397341572e-04
PHRA:scaffold_921813321818048562e-04
PYVX:scaffold_121289382897740557e-04
PYUU:scaffold_202947772447776340557e-04
PYIW:scaffold_19526500653435557e-04
PYIW:scaffold_7121666170035557e-04
PYAP:scaffold_630121971223135557e-04
PHIF:NW_003303752.12065105206513935557e-04
PYIR:scaffold_1555998605457547e-04
PYAR:scaffold_370176831773251530.002
PYAR:scaffold_8854760559530.002
PHPA:scaffold_952414852419348530.002
PHCA:scaffold_5013948613955469530.002
PYVX:scaffold_6392148218336520.002
PYIR:scaffold_814533456331520.002
PYAP:scaffold_123536625369736520.002
PHRA:scaffold_5210257210261241520.002
SAPA:scaffold_1946477246479928510.009
PYVX:scaffold_305155531559543510.009
PYVX:scaffold_7457118715740500.009
PYVX:scaffold_50423504238435500.009
PYUU:scaffold_2027238952392430500.009
PYAP:scaffold_187101931022735500.009
PHRA:scaffold_423993023996435500.009
HYAP:scaffold_4637442747130500.009
HYAP:scaffold_5936512636515530500.009
PYAR:scaffold_681075479542490.030
PHSO:scaffold_22560056256013581490.030
PHCA:scaffold_2417233117235727490.030
PYIW:scaffold_270169451697834480.030
PYIW:scaffold_1821698173134480.030
PYAP:scaffold_21656459229480.030
PYAP:scaffold_7466469229480.030
PHRA:scaffold_2947269247276574480.030
PHPA:scaffold_456883956886224480.030
PYIW:scaffold_36441515158066470.10
PYAR:scaffold_26171150118536470.10
PYAR:scaffold_16137267730236470.10
PYAR:scaffold_480173871742236470.10
PHPA:scaffold_19496134965341470.10
APIN:scaffold_1182319582324046470.10
SADI:scaffold_9115768715771428460.10
PHKE:scaffold_2215273852842107460.10
PYUU:scaffold_203859596559599935450.37
PYIR:scaffold_8712798283235450.37
PLHA:NW_020189861.11846667184674175450.37
PHRA:scaffold_5559786982035450.37
PHKE:scaffold_399309153095440450.37
PHIF:NW_003303743.11519405151945654450.37
PHIF:NW_003303741.11594354159444797450.37
PHIF:NW_003303738.11090009109004335450.37
PYVX:scaffold_19891593162937440.37
PYVX:scaffold_496103451037127440.37
PYVX:scaffold_90540405409253440.37
PYIW:scaffold_700341046657440.37
PYIR:scaffold_167286332866738440.37
PYAR:scaffold_802113217342440.37
SAPA:scaffold_3211675211678029431.3
PYVX:scaffold_251045348634431.3
PYVX:scaffold_10704354437724431.3
PYUU:scaffold_140215957115959929431.3
PYIR:scaffold_17441828186134431.3
PYAP:scaffold_12483235327339431.3
PHSO:scaffold_3175177929431.3
PHSO:scaffold_61470674147069724431.3
PHIF:NW_003304531.143546329431.3
PHIF:NW_003303391.1404954052329431.3
PHCA:scaffold_882015882018629431.3
APIN:scaffold_171223791122381929431.3
PYVX:scaffold_8947597763236421.3
PYVX:scaffold_385258982592326421.3
PYVX:scaffold_74295472957731421.3
PYUU:scaffold_20061006800100682021421.3
PYIR:scaffold_394412121421.3
PYAR:scaffold_9435478236421.3
PYAR:scaffold_662458060526421.3
PYAP:scaffold_122635137626421.3
PYAP:scaffold_9833737377236421.3
PYAP:scaffold_392187141874431421.3
PYAP:scaffold_328273932741826421.3
PYAP:scaffold_234350173505236421.3
PHRA:scaffold_51383603838526421.3
PHCA:scaffold_49249352497541421.3
ALCA:scaffold_13825088253326421.3
SAPA:scaffold_193872993875628414.5
SADI:scaffold_2641711173828414.5
SADI:scaffold_2444004644007328414.5
SADI:scaffold_1876491476494128414.5
PYUU:scaffold_2040350313505323414.5
PYIW:scaffold_13993824386138414.5
PYIW:scaffold_225234672348923414.5
PYIR:scaffold_7184064409633414.5
PYIR:scaffold_462735276228414.5
PYAR:scaffold_13661429146133414.5
PYAP:scaffold_529140731409523414.5
PYAP:scaffold_238993901523414.5
PLHA:NW_020187475.141132741134923414.5
PLHA:NW_020186941.1299242995128414.5
PHRA:scaffold_90431924325365414.5
PHPA:scaffold_81875248756138414.5
APIN:scaffold_25160021603635414.5
SAPA:scaffold_2234447534449925404.5
SAPA:scaffold_1072188572191430404.5
SAPA:scaffold_347598647600520404.5
SADI:scaffold_6618295218300151404.5
SADI:scaffold_1280845680848025404.5
SADI:scaffold_382162782165630404.5
PYVX:scaffold_8812895291925404.5
PYVX:scaffold_698151931522230404.5
PYVX:scaffold_111133331335725404.5
PYUU:scaffold_131412768212772247404.5
PYIW:scaffold_17835478550730404.5
PYIW:scaffold_12793659369034404.5
PYIW:scaffold_737118831192041404.5
PYIW:scaffold_57123231234725404.5
PYIR:scaffold_1205867589630404.5
PYAR:scaffold_191873376230404.5
PYAP:scaffold_6198311836404.5
PYAP:scaffold_63733247336948404.5
PHRA:scaffold_156455558430404.5
PHRA:scaffold_131958039582927404.5
PHRA:scaffold_4216157716160630404.5
PHIF:NW_003303723.11051252105127120404.5
PHIF:NW_003303506.1720477208135404.5
PHCA:scaffold_31014565101458925404.5
APIN:scaffold_72091935209195925404.5
APAS:scaffold_7015381615384732404.5
APAS:scaffold_2234852234856342404.5
ALCA:scaffold_46230412307030404.5
BLASTN 2.12.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= PYIR_26626

Length=636
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

PYIR:scaffold_5024 pir_scaffold_5024 dna:supercontig supercontig:...  1148    0.0   
PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:p...  538     5e-151
PYIR:scaffold_2249 pir_scaffold_2249 dna:supercontig supercontig:...  488     9e-136
PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_sc...  284     2e-74 
PHSO:scaffold_1                                                       281     2e-73 
PHCA:scaffold_7 PHYCAscaffold_7                                       231     4e-58 
PYVX:scaffold_275 pve_scaffold_275 dna:supercontig supercontig:pv...  217     2e-54 
PHSO:scaffold_14                                                      211     3e-52 
PYAP:scaffold_560 pag1_scaffold_560 dna:supercontig supercontig:p...  201     2e-49 
PHRA:scaffold_267                                                     201     2e-49 
PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:pi...  199     6e-49 
PHSO:scaffold_35                                                      194     3e-47 
PHSO:scaffold_5                                                       194     3e-47 
PHCA:scaffold_84 PHYCAscaffold_84                                     189     1e-45 
PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 ge...  188     1e-45 
PHRA:scaffold_56                                                      184     5e-44 
PHRA:scaffold_106                                                     178     2e-42 
PHIF:NW_003303626.1 Phytophthora infestans T30-4 supercont1.133 g...  178     2e-42 
PHRA:scaffold_79                                                      169     1e-39 
PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 ...  168     4e-39 
PHKE:scaffold_622 scf_22126_622.1 dna:supercontig supercontig:Phy...  155     2e-35 
PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 ...  151     3e-34 
PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercon...  146     1e-32 
PYAR:scaffold_3459 par_scaffold_3459 dna:supercontig supercontig:...  141     5e-31 
PYAP:scaffold_182 pag1_scaffold_182 dna:supercontig supercontig:p...  136     6e-30 
PHSO:scaffold_4                                                       131     3e-28 
PHKE:scaffold_761 scf_22126_761.1_contig_1 dna:supercontig superc...  130     9e-28 
PYIR:scaffold_4828 pir_scaffold_4828 dna:supercontig supercontig:...  128     3e-27 
PHSO:scaffold_64                                                      126     1e-26 
PHSO:scaffold_12                                                      116     6e-24 
PHPA:scaffold_66 NW_008649052.1 Phytophthora parasitica INRA-310 ...  106     1e-20 
PHPA:scaffold_46 NW_008649032.1 Phytophthora parasitica INRA-310 ...  106     1e-20 
PHSO:scaffold_11                                                      99.6    2e-18 
PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 ge...  99.6    2e-18 
PLHA:NW_020189073.1 Plasmopara halstedii genome assembly, contig:...  98.7    2e-18 
PHCA:scaffold_67 PHYCAscaffold_67                                     82.4    1e-13 
PYIR:scaffold_573 pir_scaffold_573 dna:supercontig supercontig:pi...  72.5    2e-10 
PHPA:scaffold_20 NW_008649006.1 Phytophthora parasitica INRA-310 ...  71.6    2e-10 
PHPA:scaffold_39 NW_008649025.1 Phytophthora parasitica INRA-310 ...  69.8    8e-10 
PYAR:scaffold_593 par_scaffold_593 dna:supercontig supercontig:pa...  68.0    3e-09 
PYAP:scaffold_289 pag1_scaffold_289 dna:supercontig supercontig:p...  66.2    9e-09 
PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 ge...  65.3    3e-08 
PYIW:scaffold_3542 piw_scaffold_3542 dna:supercontig supercontig:...  62.6    1e-07 
PHRA:scaffold_123                                                     61.7    4e-07 
PHPA:scaffold_16 NW_008649002.1 Phytophthora parasitica INRA-310 ...  60.8    4e-07 
PHSO:scaffold_8                                                       58.1    5e-06 
PHRA:scaffold_33                                                      58.1    5e-06 
PYAR:scaffold_674 par_scaffold_674 dna:supercontig supercontig:pa...  57.2    5e-06 
PHSO:scaffold_16                                                      57.2    5e-06 
PHCA:scaffold_11 PHYCAscaffold_11                                     56.3    2e-05 
PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:p...  52.7    2e-04 
PHRA:scaffold_2892                                                    52.7    2e-04 
PHRA:scaffold_494                                                     52.7    2e-04 
PHPA:scaffold_76 NW_008649062.1 Phytophthora parasitica INRA-310 ...  52.7    2e-04 
PHRA:scaffold_9                                                       51.8    2e-04 
PYVX:scaffold_121 pve_scaffold_121 dna:supercontig supercontig:pv...  50.9    7e-04 
PYUU:scaffold_2029 scf1117875582029 dna:supercontig supercontig:p...  50.9    7e-04 
PYIW:scaffold_1952 piw_scaffold_1952 dna:supercontig supercontig:...  50.9    7e-04 
PYIW:scaffold_712 piw_scaffold_712 dna:supercontig supercontig:pi...  50.9    7e-04 
PYAP:scaffold_630 pag1_scaffold_630 dna:supercontig supercontig:p...  50.9    7e-04 
PHIF:NW_003303752.1 Phytophthora infestans T30-4 supercont1.7 gen...  50.9    7e-04 
PYIR:scaffold_155 pir_scaffold_155 dna:supercontig supercontig:pi...  50.0    7e-04 
PYAR:scaffold_370 par_scaffold_370 dna:supercontig supercontig:pa...  49.1    0.002 
PYAR:scaffold_88 par_scaffold_88 dna:supercontig supercontig:par_...  49.1    0.002 
PHPA:scaffold_9 NW_008648995.1 Phytophthora parasitica INRA-310 u...  49.1    0.002 
PHCA:scaffold_50 PHYCAscaffold_50                                     49.1    0.002 
PYVX:scaffold_639 pve_scaffold_639 dna:supercontig supercontig:pv...  48.2    0.002 
PYIR:scaffold_81 pir_scaffold_81 dna:supercontig supercontig:pir_...  48.2    0.002 
PYAP:scaffold_123 pag1_scaffold_123 dna:supercontig supercontig:p...  48.2    0.002 
PHRA:scaffold_52                                                      48.2    0.002 
SAPA:scaffold_19 supercont2.19 dna:supercontig supercontig:ASM151...  47.3    0.009 
PYVX:scaffold_305 pve_scaffold_305 dna:supercontig supercontig:pv...  47.3    0.009 
PYVX:scaffold_745 pve_scaffold_745 dna:supercontig supercontig:pv...  46.4    0.009 
PYVX:scaffold_50 pve_scaffold_50 dna:supercontig supercontig:pve_...  46.4    0.009 
PYUU:scaffold_2027 scf1117875582027 dna:supercontig supercontig:p...  46.4    0.009 
PYAP:scaffold_187 pag1_scaffold_187 dna:supercontig supercontig:p...  46.4    0.009 
PHRA:scaffold_4                                                       46.4    0.009 
HYAP:scaffold_463 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  46.4    0.009 
HYAP:scaffold_59 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_5...  46.4    0.009 
PYAR:scaffold_6810 par_scaffold_6810 dna:supercontig supercontig:...  45.5    0.030 
PHSO:scaffold_2                                                       45.5    0.030 
PHCA:scaffold_24 PHYCAscaffold_24                                     45.5    0.030 
PYIW:scaffold_270 piw_scaffold_270 dna:supercontig supercontig:pi...  44.6    0.030 
PYIW:scaffold_182 piw_scaffold_182 dna:supercontig supercontig:pi...  44.6    0.030 
PYAP:scaffold_216 pag1_scaffold_216 dna:supercontig supercontig:p...  44.6    0.030 
PYAP:scaffold_74 pag1_scaffold_74 dna:supercontig supercontig:pag...  44.6    0.030 
PHRA:scaffold_29                                                      44.6    0.030 
PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 u...  44.6    0.030 
PYIW:scaffold_3644 piw_scaffold_3644 dna:supercontig supercontig:...  43.7    0.10  
PYAR:scaffold_2617 par_scaffold_2617 dna:supercontig supercontig:...  43.7    0.10  
PYAR:scaffold_1613 par_scaffold_1613 dna:supercontig supercontig:...  43.7    0.10  
PYAR:scaffold_480 par_scaffold_480 dna:supercontig supercontig:pa...  43.7    0.10  
PHPA:scaffold_19 NW_008649005.1 Phytophthora parasitica INRA-310 ...  43.7    0.10  
APIN:scaffold_11 supercont1.11 dna:supercontig supercontig:Apha_i...  43.7    0.10  
SADI:scaffold_91 supercont1.91 dna:supercontig supercontig:Sap_di...  42.8    0.10  
PHKE:scaffold_221 scf_22126_221.1 dna:supercontig supercontig:Phy...  42.8    0.10  
PYUU:scaffold_2038 scf1117875582038 dna:supercontig supercontig:p...  41.9    0.37  
PYIR:scaffold_871 pir_scaffold_871 dna:supercontig supercontig:pi...  41.9    0.37  
PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig:...  41.9    0.37  
PHRA:scaffold_555                                                     41.9    0.37  
PHKE:scaffold_399 scf_22126_399.1 dna:supercontig supercontig:Phy...  41.9    0.37  
PHIF:NW_003303743.1 Phytophthora infestans T30-4 supercont1.16 ge...  41.9    0.37  
PHIF:NW_003303741.1 Phytophthora infestans T30-4 supercont1.18 ge...  41.9    0.37  
PHIF:NW_003303738.1 Phytophthora infestans T30-4 supercont1.21 ge...  41.9    0.37  
PYVX:scaffold_1989 pve_scaffold_1989 dna:supercontig supercontig:...  41.0    0.37  
PYVX:scaffold_496 pve_scaffold_496 dna:supercontig supercontig:pv...  41.0    0.37  
PYVX:scaffold_90 pve_scaffold_90 dna:supercontig supercontig:pve_...  41.0    0.37  
PYIW:scaffold_7003 piw_scaffold_7003 dna:supercontig supercontig:...  41.0    0.37  
PYIR:scaffold_167 pir_scaffold_167 dna:supercontig supercontig:pi...  41.0    0.37  
PYAR:scaffold_8021 par_scaffold_8021 dna:supercontig supercontig:...  41.0    0.37  
SAPA:scaffold_32 supercont2.32 dna:supercontig supercontig:ASM151...  40.1    1.3   
PYVX:scaffold_2510 pve_scaffold_2510 dna:supercontig supercontig:...  40.1    1.3   
PYVX:scaffold_1070 pve_scaffold_1070 dna:supercontig supercontig:...  40.1    1.3   
PYUU:scaffold_1402 scf1117875581402 dna:supercontig supercontig:p...  40.1    1.3   
PYIR:scaffold_1744 pir_scaffold_1744 dna:supercontig supercontig:...  40.1    1.3   
PYAP:scaffold_1248 pag1_scaffold_1248 dna:supercontig supercontig...  40.1    1.3   
PHSO:scaffold_31                                                      40.1    1.3   
PHSO:scaffold_6                                                       40.1    1.3   
PHIF:NW_003304531.1 Phytophthora infestans T30-4 supercont1.4149 ...  40.1    1.3   
PHIF:NW_003303391.1 Phytophthora infestans T30-4 supercont1.368 g...  40.1    1.3   
PHCA:scaffold_8 PHYCAscaffold_8                                       40.1    1.3   
APIN:scaffold_17 supercont1.17 dna:supercontig supercontig:Apha_i...  40.1    1.3   
PYVX:scaffold_894 pve_scaffold_894 dna:supercontig supercontig:pv...  39.2    1.3   
PYVX:scaffold_385 pve_scaffold_385 dna:supercontig supercontig:pv...  39.2    1.3   
PYVX:scaffold_74 pve_scaffold_74 dna:supercontig supercontig:pve_...  39.2    1.3   
PYUU:scaffold_2006 scf1117875582006 dna:supercontig supercontig:p...  39.2    1.3   
PYIR:scaffold_3944 pir_scaffold_3944 dna:supercontig supercontig:...  39.2    1.3   
PYAR:scaffold_9435 par_scaffold_9435 dna:supercontig supercontig:...  39.2    1.3   
PYAR:scaffold_6624 par_scaffold_6624 dna:supercontig supercontig:...  39.2    1.3   
PYAP:scaffold_1226 pag1_scaffold_1226 dna:supercontig supercontig...  39.2    1.3   
PYAP:scaffold_983 pag1_scaffold_983 dna:supercontig supercontig:p...  39.2    1.3   
PYAP:scaffold_392 pag1_scaffold_392 dna:supercontig supercontig:p...  39.2    1.3   
PYAP:scaffold_328 pag1_scaffold_328 dna:supercontig supercontig:p...  39.2    1.3   
PYAP:scaffold_234 pag1_scaffold_234 dna:supercontig supercontig:p...  39.2    1.3   
PHRA:scaffold_51                                                      39.2    1.3   
PHCA:scaffold_49 PHYCAscaffold_49                                     39.2    1.3   
ALCA:scaffold_13 AcNc2_CONTIG_13_length_192192 dna:supercontig su...  39.2    1.3   
SAPA:scaffold_1 supercont2.1 dna:supercontig supercontig:ASM15154...  38.3    4.5   
SADI:scaffold_264 supercont1.264 dna:supercontig supercontig:Sap_...  38.3    4.5   
SADI:scaffold_24 supercont1.24 dna:supercontig supercontig:Sap_di...  38.3    4.5   
SADI:scaffold_18 supercont1.18 dna:supercontig supercontig:Sap_di...  38.3    4.5   
PYUU:scaffold_2040 scf1117875582040 dna:supercontig supercontig:p...  38.3    4.5   
PYIW:scaffold_1399 piw_scaffold_1399 dna:supercontig supercontig:...  38.3    4.5   
PYIW:scaffold_225 piw_scaffold_225 dna:supercontig supercontig:pi...  38.3    4.5   
PYIR:scaffold_718 pir_scaffold_718 dna:supercontig supercontig:pi...  38.3    4.5   
PYIR:scaffold_46 pir_scaffold_46 dna:supercontig supercontig:pir_...  38.3    4.5   
PYAR:scaffold_1366 par_scaffold_1366 dna:supercontig supercontig:...  38.3    4.5   
PYAP:scaffold_529 pag1_scaffold_529 dna:supercontig supercontig:p...  38.3    4.5   
PYAP:scaffold_23 pag1_scaffold_23 dna:supercontig supercontig:pag...  38.3    4.5   
PLHA:NW_020187475.1 Plasmopara halstedii genome assembly, contig:...  38.3    4.5   
PLHA:NW_020186941.1 Plasmopara halstedii genome assembly, contig:...  38.3    4.5   
PHRA:scaffold_90                                                      38.3    4.5   
PHPA:scaffold_81 NW_008649067.1 Phytophthora parasitica INRA-310 ...  38.3    4.5   
APIN:scaffold_25 supercont1.25 dna:supercontig supercontig:Apha_i...  38.3    4.5   
SAPA:scaffold_22 supercont2.22 dna:supercontig supercontig:ASM151...  37.4    4.5   
SAPA:scaffold_10 supercont2.10 dna:supercontig supercontig:ASM151...  37.4    4.5   
SAPA:scaffold_3 supercont2.3 dna:supercontig supercontig:ASM15154...  37.4    4.5   
SADI:scaffold_66 supercont1.66 dna:supercontig supercontig:Sap_di...  37.4    4.5   
SADI:scaffold_12 supercont1.12 dna:supercontig supercontig:Sap_di...  37.4    4.5   
SADI:scaffold_3 supercont1.3 dna:supercontig supercontig:Sap_dicl...  37.4    4.5   
PYVX:scaffold_881 pve_scaffold_881 dna:supercontig supercontig:pv...  37.4    4.5   
PYVX:scaffold_698 pve_scaffold_698 dna:supercontig supercontig:pv...  37.4    4.5   
PYVX:scaffold_111 pve_scaffold_111 dna:supercontig supercontig:pv...  37.4    4.5   
PYUU:scaffold_1314 scf1117875581314 dna:supercontig supercontig:p...  37.4    4.5   
PYIW:scaffold_1783 piw_scaffold_1783 dna:supercontig supercontig:...  37.4    4.5   
PYIW:scaffold_1279 piw_scaffold_1279 dna:supercontig supercontig:...  37.4    4.5   
PYIW:scaffold_737 piw_scaffold_737 dna:supercontig supercontig:pi...  37.4    4.5   
PYIW:scaffold_57 piw_scaffold_57 dna:supercontig supercontig:piw_...  37.4    4.5   
PYIR:scaffold_120 pir_scaffold_120 dna:supercontig supercontig:pi...  37.4    4.5   
PYAR:scaffold_1918 par_scaffold_1918 dna:supercontig supercontig:...  37.4    4.5   
PYAP:scaffold_619 pag1_scaffold_619 dna:supercontig supercontig:p...  37.4    4.5   
PYAP:scaffold_63 pag1_scaffold_63 dna:supercontig supercontig:pag...  37.4    4.5   
PHRA:scaffold_1564                                                    37.4    4.5   
PHRA:scaffold_131                                                     37.4    4.5   
PHRA:scaffold_42                                                      37.4    4.5   
PHIF:NW_003303723.1 Phytophthora infestans T30-4 supercont1.36 ge...  37.4    4.5   
PHIF:NW_003303506.1 Phytophthora infestans T30-4 supercont1.253 g...  37.4    4.5   
PHCA:scaffold_3 PHYCAscaffold_3                                       37.4    4.5   
APIN:scaffold_7 supercont1.7 dna:supercontig supercontig:Apha_inv...  37.4    4.5   
APAS:scaffold_70 supercont1.70 dna:supercontig supercontig:Apha_a...  37.4    4.5   
APAS:scaffold_22 supercont1.22 dna:supercontig supercontig:Apha_a...  37.4    4.5   
ALCA:scaffold_46 AcNc2_CONTIG_46_length_118559 dna:supercontig su...  37.4    4.5   

>PYIR:scaffold_5024 pir_scaffold_5024 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_5024:1:718:1 
REF
Length=718

 Score = 1148 bits (1272),  Expect = 0.0
 Identities = 636/636 (100%), Gaps = 0/636 (0%)
 Strand=Plus/Plus

Query  1    ATGGCCCCTTCCGTCGTCAAGTCCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCGCTC  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  76   ATGGCCCCTTCCGTCGTCAAGTCCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCGCTC  135

Query  61   TGCGACTCGTCGGTTGACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAAC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  136  TGCGACTCGTCGGTTGACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAAC  195

Query  121  CCGGACAAGAACGTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACC  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  196  CCGGACAAGAACGTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACC  255

Query  181  ACCGCAGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATG  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  256  ACCGCAGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATG  315

Query  241  GACGACAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACC  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  316  GACGACAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACC  375

Query  301  AACATCAACGGCAAGCGCCAGCCGATCCCAGCGGGCACAATCCGCTCCACAGGTTACACT  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  376  AACATCAACGGCAAGCGCCAGCCGATCCCAGCGGGCACAATCCGCTCCACAGGTTACACT  435

Query  361  CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  436  CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGC  495

Query  421  AACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGC  480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  496  AACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGC  555

Query  481  ACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTG  540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  556  ACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTG  615

Query  541  TACAAGGAGTGCGTGCCAATTGGCAGCGGTCGCCGCCTCGAGGGAGAGGAAGCCGAAGGT  600
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  616  TACAAGGAGTGCGTGCCAATTGGCAGCGGTCGCCGCCTCGAGGGAGAGGAAGCCGAAGGT  675

Query  601  GACGAAGAGCGTCACCTCGCGATCAGCAACACCACC  636
            ||||||||||||||||||||||||||||||||||||
Sbjct  676  GACGAAGAGCGTCACCTCGCGATCAGCAACACCACC  711

>PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:pug:scf1117875582037:1:1414051:1 
REF
Length=1414051

 Score = 538 bits (596),  Expect = 5e-151
 Identities = 460/564 (82%), Gaps = 8/564 (1%)
 Strand=Plus/Plus

Query  1        ATGGCCCCTTCCGTCGTCAAGTCCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCGCTC  60
                ||||| || || |   |||||||| |||||||||||||||| || ||    || ||||||
Sbjct  1297948  ATGGCGCCATCTGCTATCAAGTCCGTCGCGCTCGCCGCCATTGTATCTGCTGCAGCGCTC  1298007

Query  61       TGCGACTC-GTCGGTTGACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAA  119
                |||||||| ||||   ||||| ||||||   |||||||| ||    ||||| |||||   
Sbjct  1298008  TGCGACTCCGTCGCC-GACGCCCACCAGCTCGTGATCCTGCCCAACCCGACCTTCACCGT  1298066

Query  120      CCCGGACAAGAACGTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGAC  179
                |||   |||| |||     |||   || |||||||| |||||||||||||||||||||||
Sbjct  1298067  CCCCACCAAGGACGAACGATGGTCGCCGCTCGCGTTCCTCGAGAACCAGGGCTACAAGAC  1298126

Query  180      CACCGCAGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCAT  239
                |||||| |||||||||| ||||  ||||||||||||||||||| | || || ||||||||
Sbjct  1298127  CACCGCCGACTTCAACGCCTACTACAAGTCCAAGGGCTACAAGTCGCTGCGCGCGTTCAT  1298186

Query  240      GGACGACAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACAC  299
                ||||||||||||||| ||||||||| || ||     |||| |||| ||||||||||||||
Sbjct  1298187  GGACGACAAGAAGGCGTACAAGGTCAACTCGAA---CGCCGACTTCGAGTGCGGCTACAC  1298243

Query  300      CAACATCAACGGCAAGCGCCAGCCGATCCCAGCGGGCACAATCCGCTCCACAGGTTACAC  359
                |||||  ||||||  |||||| |||||||| ||   ||   ||||| |||| || |||||
Sbjct  1298244  CAACAAGAACGGCGCGCGCCAACCGATCCCGGC---CAACTTCCGCACCACGGGGTACAC  1298300

Query  360      TCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTG  419
                 |||||||||||||||||||| ||||| ||||||||||||||| |||||||  |||||||
Sbjct  1298301  GCACGACGGTCCGTGCGAGGTGTGGCTCGACAACACCAAGGTCTTGTCGGGTTCCAACTG  1298360

Query  420      CAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTG  479
                  ||||||||||||| || ||||||||| | || ||||||||| |||||||||| |||||
Sbjct  1298361  TCACAAGGACTTCCCCGGCAAGACCCACGCCATGAGCTACGCGGCGTGCAAGGGCTCGTG  1298420

Query  480      CACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGT  539
                |||| |||||||||||||||||||| | ||||||||||||  ||||   |||||||| ||
Sbjct  1298421  CACGTTGCGCTGGTACTGGATGGGCATCCGCTTCCTCAAGGGCAAGCACTCGTGGCAAGT  1298480

Query  540      GTACAAGGAGTGCGTGCCAATTGG  563
                ||||||||||||||||||  ||||
Sbjct  1298481  GTACAAGGAGTGCGTGCCGCTTGG  1298504

 Score = 480 bits (532),  Expect = 1e-133
 Identities = 451/573 (79%), Gaps = 21/573 (4%)
 Strand=Plus/Plus

Query  1        ATGGCCCCTTCCGTCGTCA---AGTCCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCG  57
                ||||| |||||| ||||||   |||| |||| ||||||||||   || ||||||||||||
Sbjct  1288553  ATGGCTCCTTCCATCGTCACCAAGTCGCTCGTGCTCGCCGCCGCGGTCTCCAGCGCCGCG  1288612

Query  58       CTCTGCGACTCGTCGGTTGACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACT  117
                |||| ||| ||| | | ||   | ||||||   ||||| || || ||||| |||||||| 
Sbjct  1288613  CTCTTCGAATCGGCCGATG---CGCACCAGTACGTGATGCTCCCGGCGCCAACGTTCAC-  1288668

Query  118      AACCCGGACAAGAAC------GTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGC  171
                     || ||||| |      | | | |  |||||||| ||||| || ||||||||||||
Sbjct  1288669  -----GGTCAAGACCCGCGCCGAGCAGTTCAACCCACTTGCGTTCCTTGAGAACCAGGGC  1288723

Query  172      TACAAGACCACCGCAGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGT  231
                | |||||| ||||| ||||||||||  |||  |||| |||||||||||||| | || |||
Sbjct  1288724  TTCAAGACGACCGCCGACTTCAACGCGTACTACAAGGCCAAGGGCTACAAGTCGCTGCGT  1288783

Query  232      GCGTTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGC  291
                || ||||||||||||||||| ||||||||||| |   | || || ||| | ||  |||| 
Sbjct  1288784  GCCTTCATGGACGACAAGAAAGCATACAAGGTTG---CTGCTGGTGCCGATTTCCAGTGT  1288840

Query  292      GGCTACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCGGGCACAATCCGCTCCACA  351
                || |  || ||  || | || |||||||||||||| ||||| ||||| ||||| || || 
Sbjct  1288841  GGATGGACGAAACTCGATGGAAAGCGCCAGCCGATTCCAGCTGGCACGATCCGTTCGACT  1288900

Query  352      GGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGC  411
                |||||||| ||||||||||| |||||||| ||||| |||||||||   || |||  ||||
Sbjct  1288901  GGTTACACCCACGACGGTCCATGCGAGGTGTGGCTCGACAACACCCTTGTGATGAAGGGC  1288960

Query  412      ACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAG  471
                | ||||||| ||  ||| ||||| || | ||| |||  |||||| ||||| |||||||||
Sbjct  1288961  AACAACTGCCACTCGGAGTTCCCAGGCACGACGCACAAGATCAGTTACGCTTCGTGCAAG  1289020

Query  472      GGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCG  531
                || |||||||||||||||||||||||||||||  ||||||||||||||  |||||  |||
Sbjct  1289021  GGCTCGTGCACGCTGCGCTGGTACTGGATGGGTATTCGCTTCCTCAAGGGCAAGTACTCG  1289080

Query  532      TGGCAGGTGTACAAGGAGTGCGTGCCAATTGGC  564
                ||||||||||||||| | ||||| |||||||||
Sbjct  1289081  TGGCAGGTGTACAAGAACTGCGTCCCAATTGGC  1289113

 Score = 444 bits (492),  Expect = 9e-123
 Identities = 443/573 (77%), Gaps = 21/573 (4%)
 Strand=Plus/Plus

Query  1        ATGGCCCCTTCCGTCGTCA---AGTCCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCG  57
                ||||| |||||| ||||||   |||| |||| ||||||||||   || ||||||||||||
Sbjct  1294277  ATGGCTCCTTCCATCGTCACCAAGTCGCTCGTGCTCGCCGCCGCGGTCTCCAGCGCCGCG  1294336

Query  58       CTCTGCGACTCGTCGGTTGACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACT  117
                |||| ||| ||| | | ||   | ||||||   ||||| || || ||||| |||||||| 
Sbjct  1294337  CTCTTCGAATCGGCCGATG---CGCACCAGTACGTGATGCTCCCGGCGCCAACGTTCAC-  1294392

Query  118      AACCCGGACAAGAAC------GTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGC  171
                     || ||||| |      | | | |  |||||||| ||||| || ||||||||||||
Sbjct  1294393  -----GGTCAAGACCCGCGCCGAGCAGTTCAACCCACTTGCGTTCCTTGAGAACCAGGGC  1294447

Query  172      TACAAGACCACCGCAGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGT  231
                |||||||| || |  ||||||||||  |||  |||| ||||||||||||||||||| |||
Sbjct  1294448  TACAAGACGACGGTCGACTTCAACGCGTACTACAAGGCCAAGGGCTACAAGACCCTGCGT  1294507

Query  232      GCGTTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGC  291
                || |||||||| |||  |||||| |||||||| | ||| |   | ||| | ||  |||| 
Sbjct  1294508  GCCTTCATGGATGACCCGAAGGCGTACAAGGTTGCCGCTG---GTGCCGATTTCCAGTGT  1294564

Query  292      GGCTACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCGGGCACAATCCGCTCCACA  351
                || |  || ||  || | || |||||||||||||| ||||| ||||| ||||| || || 
Sbjct  1294565  GGATGGACGAAACTCGATGGAAAGCGCCAGCCGATTCCAGCTGGCACGATCCGTTCGACT  1294624

Query  352      GGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGC  411
                |||||||| ||||||||||| |||||||| ||||| || | |||    || |||  ||||
Sbjct  1294625  GGTTACACCCACGACGGTCCATGCGAGGTGTGGCTCGATAGCACGCGCGTGATGAAGGGC  1294684

Query  412      ACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAG  471
                | ||||||| ||  ||| ||||| || | ||||  |   |||  |||| |||||||||||
Sbjct  1294685  AACAACTGCCACTCGGAGTTCCCAGGCACGACCTTCAAAATCGACTACTCGTCGTGCAAG  1294744

Query  472      GGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCG  531
                || |||||||||||||||||||||||||||||  ||||||||||||||  |||||  |||
Sbjct  1294745  GGCTCGTGCACGCTGCGCTGGTACTGGATGGGTATTCGCTTCCTCAAGGGCAAGTACTCG  1294804

Query  532      TGGCAGGTGTACAAGGAGTGCGTGCCAATTGGC  564
                ||||||||||||||| | ||||| |||||||||
Sbjct  1294805  TGGCAGGTGTACAAGAACTGCGTCCCAATTGGC  1294837

 Score = 394 bits (436),  Expect = 1e-107
 Identities = 438/584 (75%), Gaps = 18/584 (3%)
 Strand=Plus/Plus

Query  1        ATGGCCCCTTCCGTCGTCAAGTCCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCGCTC  60
                |||||||| ||  ||  |||||| || |   ||| |||  | || ||||||||  | || 
Sbjct  1295817  ATGGCCCCATCGATCACCAAGTCGCTTGTCTTCGGCGCTCTGGTCTCCAGCGCTACTCTG  1295876

Query  61       TGCGACTCGTCGGTTGACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAAC  120
                | | || || | |   |||| ||||||   ||||| || || ||||| ||||||||    
Sbjct  1295877  TACAACACGGCAG---ACGCGCACCAGTACGTGATGCTCCCGGCGCCAACGTTCAC----  1295929

Query  121      CCGGACAAGAAC------GTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTAC  174
                  || ||||| |      | | | |  ||||| |||||||| || |||||||| || | |
Sbjct  1295930  --GGTCAAGACCCGCGCCGAGCAGTTCAACCCGCTCGCGTTCCTTGAGAACCAAGGATTC  1295987

Query  175      AAGACCACCGCAGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCG  234
                 |||| || || ||||||||||  |||  |||| ||||||||||||||||||| ||||| 
Sbjct  1295988  GAGACGACGGCCGACTTCAACGCGTACTACAAGGCCAAGGGCTACAAGACCCTGCGTGCC  1296047

Query  235      TTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGC  294
                |||||||||||||||||||| ||||  |||| | | |   | ||  ||||||| ||||| 
Sbjct  1296048  TTCATGGACGACAAGAAGGCGTACACAGTCGCCTCTG---GAGCTGACTTTGAATGCGGA  1296104

Query  295      TACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCGGGCACAATCCGCTCCACAGGT  354
                |  || ||  || | || | ||| ||  | |||||||| ||||| ||||| || || |||
Sbjct  1296105  TGGACGAAACTCGATGGTACGCGTCAATCCATCCCAGCTGGCACGATCCGTTCGACTGGT  1296164

Query  355      TACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACC  414
                ||||| ||||||||||| |||||||| ||||| |||| |||    || |||  ||||| |
Sbjct  1296165  TACACCCACGACGGTCCATGCGAGGTGTGGCTCGACAGCACGCGCGTGATGAAGGGCAAC  1296224

Query  415      AACTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGG  474
                |||||| |||  || ||| | |||| ||| ||| | |||  |||| ||||||||||||| 
Sbjct  1296225  AACTGCCACACCGAGTTCACTGGAACGACGCACACAATCGACTACTCGTCGTGCAAGGGC  1296284

Query  475      TCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGG  534
                |||||||||||||||||||||||||||||  ||||||||||||||  | |||  ||||||
Sbjct  1296285  TCGTGCACGCTGCGCTGGTACTGGATGGGTATTCGCTTCCTCAAGGGCGAGTACTCGTGG  1296344

Query  535      CAGGTGTACAAGGAGTGCGTGCCAATTGGCAGCGGTCGCCGCCT  578
                |||||||||||  | |||||||| ||||| |||   ||||| ||
Sbjct  1296345  CAGGTGTACAAAAACTGCGTGCCGATTGGTAGCTCGCGCCGTCT  1296388

 Score = 216 bits (239),  Expect = 8e-54
 Identities = 311/433 (72%), Gaps = 8/433 (2%)
 Strand=Plus/Plus

Query  126      CAAGAACGTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGC  185
                |||| |||   | ||||| || ||||| || || ||||||||||||   || || |  ||
Sbjct  1299537  CAAGGACGCACAATGGAAGCCGCTCGCATTCCTTGAGAACCAGGGCGTGAACACGAGTGC  1299596

Query  186      AGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGA  245
                 ||  ||  ||| | ||| |||   ||||| |||  || | | || ||||| ||||||||
Sbjct  1299597  TGATGTCGCCGGGTTCATGAAGCAGAAGGGGTACGCGAACTTGCGCGCGTTGATGGACGA  1299656

Query  246      CAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACAT  305
                  | |||   ||| | ||  || |||  | |||   |||||||||||| |||||  ||  
Sbjct  1299657  TGAAAAGCTCTACGAAGTTAACACGGACG-CGCT--CTTTGAGTGCGGGTACACGGACC-  1299712

Query  306      CAACGG-CAAGCGCCAGCCGATCCCAGCG---GGCACAATCCGCTCCACAGGTTACACTC  361
                |||||  | ||   || ||||||||  ||   || || || ||||| || || ||||| |
Sbjct  1299713  CAACGTACGAGTCGCAACCGATCCCCACGACGGGAACCATTCGCTCGACGGGGTACACCC  1299772

Query  362      ACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCA  421
                |||| || ||||| || || ||||| ||  ||  ||||||||||||||||  ||||||| 
Sbjct  1299773  ACGATGGGCCGTGTGAAGTGTGGCTCGATGACGTCAAGGTCATGTCGGGCGACAACTGCC  1299832

Query  422      ACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCA  481
                || |  | ||||| || ||||||  | || ||  ||||   ||||||||||| || ||||
Sbjct  1299833  ACGACAAGTTCCCAGGCAAGACCTTCCCGCTCGACTACAGCTCGTGCAAGGGTTCATGCA  1299892

Query  482      CGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGT  541
                ||||||| ||||||||| | ||| | |||| ||| |||||    |  ||||||||| | |
Sbjct  1299893  CGCTGCGGTGGTACTGGCTCGGCGTGCGCTACCTGAAGAAGCGATACTCGTGGCAGATTT  1299952

Query  542      ACAAGGAGTGCGT  554
                |||||||||||||
Sbjct  1299953  ACAAGGAGTGCGT  1299965

 Score = 189 bits (209),  Expect = 1e-45
 Identities = 300/425 (71%), Gaps = 14/425 (3%)
 Strand=Plus/Plus

Query  135      GTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAA  194
                |||||||  ||| ||  |||| ||||||||  | ||   |||||| | |||   | ||||
Sbjct  1301051  GTACTGGGCCCCGCTGTCGTTCCTCGAGAAGAACGGTGTCAAGACAAGCGCGAGCGTCAA  1301110

Query  195      CGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGC  254
                 |||| ||| |||   ||||| ||||| || || || |   ||||||||||| |||||  
Sbjct  1301111  TGGCTTCATGAAGGAGAAGGGGTACAACACGCTCCGCGATCTCATGGACGACCAGAAGCT  1301170

Query  255      ATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAAC---ATCAACGG  311
                 ||||||||| || ||   | ||  ||||||   |||||||||||  ||   | ||| ||
Sbjct  1301171  CTACAAGGTCAACTCGAACGCCGATAACTTTCTCTGCGGCTACACGGACCCGACCAAGGG  1301230

Query  312      CAAGCGCCAGCCGATCCC---AGCGGGCACAATCCGCTCCACAGGTTACACTCACGACGG  368
                |  |   |||||||||||   ||   |||| || ||| | || || ||||| ||||  ||
Sbjct  1301231  CTCG---CAGCCGATCCCCAAAGACAGCACCATGCGCACGACCGGATACACCCACGTGGG  1301287

Query  369      TCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGA  428
                 ||||| || |||||| | ||| ||  |||||||||  | |||  ||||||| || |  |
Sbjct  1301288  CCCGTGTGAAGTCTGGATCGACGACGTCAAGGTCATCGCAGGCGACAACTGCCACGAACA  1301347

Query  429      CTTCCCGGGAAAGACCCACTCGATCAGCTAC-GCGTCGTGCAAGGGGTCGTGCACGCTGC  487
                  |   | | || |||  |  | |   |||| ||  | ||||||||   ||||||| |||
Sbjct  1301348  AGT---GAGCAACACCACCAAGGTGGACTACAGCAAC-TGCAAGGGCAAGTGCACGATGC  1301403

Query  488      GCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGG  547
                 |||||||||| | ||  | |||||||||||||| |||||||||||||| ||||||||| 
Sbjct  1301404  ACTGGTACTGGCTCGGATTGCGCTTCCTCAAGAAGAAGTGGTCGTGGCAAGTGTACAAGA  1301463

Query  548      AGTGC  552
                | |||
Sbjct  1301464  ACTGC  1301468

 Score = 158 bits (174),  Expect = 2e-36
 Identities = 284/406 (70%), Gaps = 12/406 (3%)
 Strand=Plus/Minus

Query  156      TCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTACATCAAGTCCAAGGG  215
                ||||||| | ||||||  |||||| | ||| ||| ||   | || ||| |||   |||||
Sbjct  1303020  TCTCGAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGACTTCATGAAGCAGAAGGG  1302961

Query  216      CTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGG  275
                 ||   || |||||| ||| |  |||||||| |||||   ||||| ||  || |||  | 
Sbjct  1302960  GTATGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGATG-  1302902

Query  276      CGC-CAACTTTGAGTGCGGCTACACCAACATCAACGG-CAAGCGCCAGCCGATCCCAGCG  333
                ||| | ||   |||||||| |||||  ||  | |||| | ||   ||||||||||||| |
Sbjct  1302901  CGCTCGAC---GAGTGCGGGTACACGGACC-CGACGGTCGAGTCACAGCCGATCCCAGTG  1302846

Query  334      GGCA---CAATCCGCTCCACAGGTTACACTCACGAC-GGTCCGTGCGAGGTCTGGCTTGA  389
                  ||   |  ||  |||||| || |||  ||  ||  || ||||||||||| ||||| ||
Sbjct  1302845  ACCAACGCCTTCATCTCCACGGGGTACG-TCTTGAATGGACCGTGCGAGGTGTGGCTCGA  1302787

Query  390      CAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTC  449
                | ||  |||||||||||||| ||  |||||| |||   | | ||| || | || |     
Sbjct  1302786  CGACCTCAAGGTCATGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTAT  1302727

Query  450      GATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCG  509
                | ||  ||||   ||||||||||| ||||||| |||||| ||||||||| | ||| | | 
Sbjct  1302726  GCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCA  1302667

Query  510      CTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTG  555
                   | | ||  | | ||  |||||||||||||||||||  ||||||
Sbjct  1302666  GCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTG  1302621

>PYIR:scaffold_2249 pir_scaffold_2249 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_2249:1:3349:1 
REF
Length=3349

 Score = 488 bits (540),  Expect = 9e-136
 Identities = 465/593 (78%), Gaps = 24/593 (4%)
 Strand=Plus/Minus

Query  1     ATGGCCCCTTCCGTCGTCAAGTCCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCGCTC  60
             |||||  |||||||   |||||| |||||||||||||||||||| |||||||||||||||
Sbjct  1994  ATGGCTTCTTCCGTTACCAAGTCGCTCGCGCTCGCCGCCATCGTCTCCAGCGCCGCGCTC  1935

Query  61    TGCGACTCGTCGGTTGACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAAC  120
             | |||| ||||||| ||||| ||||||   |||||||| || ||||||||||||||    
Sbjct  1934  TACGACACGTCGGTCGACGCGCACCAGTACGTGATCCTGCCGGCGCCGACGTTCAC----  1879

Query  121   CCGGACAAGAAC------GTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTAC  174
               || ||||| |      | | | |  ||||| || |||||  | ||||||||||||| |
Sbjct  1878  --GGTCAAGACCCGCGCGGAGCAGTTCAACCCGCTGGCGTTCTTGGAGAACCAGGGCTTC  1821

Query  175   AAGACCACCGCAGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCG  234
             |||||||| || |||||| ||| ||||  |||| ||||||||||||||||||| ||||||
Sbjct  1820  AAGACCACGGCGGACTTCGACGCCTACTACAAGGCCAAGGGCTACAAGACCCTCCGTGCG  1761

Query  235   TTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGC  294
             ||||||||||||||||  || |||||||||| ||  |   ||||  ||||||| ||||||
Sbjct  1760  TTCATGGACGACAAGAGCGCGTACAAGGTCGCCGATG---GCGCGGACTTTGAATGCGGC  1704

Query  295   TACACCAACATCAACGGCAAGCGCCAGCCGATCCC---AGCGGGCACAATCCGCTCCACA  351
             |  |||||  ||  ||||| ||  |||||||||||   |||  ||||  | |||||||||
Sbjct  1703  TGGACCAAGCTCGCCGGCACGCCGCAGCCGATCCCGTCAGCCAGCACGGTGCGCTCCACA  1644

Query  352   GGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGC  411
             || ||||| |||||||||||||||||||||||||| ||||| |||   ||  |   ||||
Sbjct  1643  GGCTACACCCACGACGGTCCGTGCGAGGTCTGGCTCGACAAGACCCGTGTGCTCAAGGGC  1584

Query  412   ACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAG  471
             ||||||||| ||  ||| |||||||| | ||||  |  ||||  |||  |||| ||||||
Sbjct  1583  ACCAACTGCCACTCGGAGTTCCCGGGCACGACCTTCAAGATCGACTATTCGTCTTGCAAG  1524

Query  472   GGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCG  531
             || ||||||  |||||||||||||||||||||| | |||||||| |||  | |||  || 
Sbjct  1523  GGTTCGTGCGTGCTGCGCTGGTACTGGATGGGCATCCGCTTCCTTAAGGGCCAGTACTCA  1464

Query  532   TGGCAGGTGTACAAGGAGTGCGTGCCAATTGGCAGCGGT---CGCCGCCTCGA  581
             ||||||||||||||| | |||||||||   | || ||||   ||| |||||||
Sbjct  1463  TGGCAGGTGTACAAGAACTGCGTGCCA---GTCACCGGTTCGCGCAGCCTCGA  1414

>PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_8:1:111390:1 
REF
Length=111390

 Score = 284 bits (314),  Expect = 2e-74
 Identities = 326/432 (75%), Gaps = 10/432 (2%)
 Strand=Plus/Plus

Query  128     AGAACGTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAG  187
               || || || | ||| | || |||||||| ||||||||||||     ||| || | ||| |
Sbjct  107094  AGGACATGCAGTGGCAGCCGCTCGCGTTCCTCGAGAACCAGAAGATCAACACGAGCGCCG  107153

Query  188     ACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACA  247
               ||||   ||||| | |||||   || || |||   | ||| || ||  | ||||||||| 
Sbjct  107154  ACTTTGCCGGCTTCCTCAAGCAGAAAGGGTACGCAAACCTGCGCGCCATGATGGACGACG  107213

Query  248     AGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCA  307
               |||||   ||| ||||  ||   |  | |||   ||| || |||||||||||  ||  | 
Sbjct  107214  AGAAGCTCTACGAGGTGAACCTCGATG-CGCT--CTTCGACTGCGGCTACACGGACC-CG  107269

Query  308     ACGG-CAAGCGCCAGCCGATCCC----AGCGGGCACAATCCGCTCCACAGGTTACACTCA  362
               |||  | ||   |||||||||||    | ||| || | |||||||||| || || || ||
Sbjct  107270  ACGTACGAGTCGCAGCCGATCCCGACCAACGGCCAGA-TCCGCTCCACGGGCTATACGCA  107328

Query  363     CGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAA  422
               |||||| ||||||||||| ||||| ||| ||  |||||| ||||||||    |||||| |
Sbjct  107329  CGACGGCCCGTGCGAGGTTTGGCTCGACGACGTCAAGGTTATGTCGGGAGAGAACTGCCA  107388

Query  423     CAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCAC  482
                |  || || ||||| |||||   |  ||||  |||| || |||||||||| ||||||||
Sbjct  107389  TACCGAGTTTCCGGGCAAGACGTTCAAGATCGACTACTCGACGTGCAAGGGATCGTGCAC  107448

Query  483     GCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTA  542
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  107449  GCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTA  107508

Query  543     CAAGGAGTGCGT  554
               ||||||||| ||
Sbjct  107509  CAAGGAGTGTGT  107520

 Score = 235 bits (260),  Expect = 9e-60
 Identities = 303/417 (73%), Gaps = 6/417 (1%)
 Strand=Plus/Plus

Query  139     TGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGC  198
               ||||| || ||||| || || ||| ||||| ||| |  ||||||||| ||||||||||  
Sbjct  110522  TGGAATCCGCTCGCATTCCTGGAGGACCAGAGCTTCCCGACCACCGCCGACTTCAACGCG  110581

Query  199     TACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATAC  258
               ||| | |   | ||    |||| | | || |||||||||||| || ||  || |   |||
Sbjct  110582  TACCTGACAGCGAACAAGTACACGTCGCTGCGTGCGTTCATGAACAACTCGACGCTCTAC  110641

Query  259     AAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGC  318
               | |||| |||||    |||| ||||||| ||| ||||  || ||  || ||||| |||| 
Sbjct  110642  ACGGTCAACGCGA---GCGCGAACTTTGGGTGTGGCTTTACGAAGCTCGACGGCGAGCGG  110698

Query  319     CAGCCGATCCCAGCG---GGCACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGC  375
               ||||| |||||  ||   |||   || ||||  || || ||||| |||||||||||||||
Sbjct  110699  CAGCCAATCCCGACGAACGGCCAGATGCGCTTGACCGGGTACACCCACGACGGTCCGTGC  110758

Query  376     GAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCG  435
               |||  |||| |  || | ||||||||  |  | |||   |||||| ||| |||  | || 
Sbjct  110759  GAGACCTGGATGAACGATACCAAGGTGTTTGCCGGCGAGAACTGCCACACGGAGCTGCCC  110818

Query  436     GGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTAC  495
                 ||  | | ||   ||   |||| || |||||||||| |||||||  |||||| |||||
Sbjct  110819  TCAATTAGCTACAGCATGGACTACTCGGCGTGCAAGGGCTCGTGCATACTGCGCCGGTAC  110878

Query  496     TGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGC  552
               ||||||||| | |||| | |||||||| |||  ||||||||||||||||||| ||||
Sbjct  110879  TGGATGGGCATCCGCTACGTCAAGAACGAGTACTCGTGGCAGGTGTACAAGGCGTGC  110935

 Score = 175 bits (193),  Expect = 2e-41
 Identities = 299/426 (70%), Gaps = 16/426 (4%)
 Strand=Plus/Plus

Query  135     GTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAA  194
               |||||||   || ||| |||| ||||||||  | ||   |||||||| |||   | || |
Sbjct  108856  GTACTGGGCGCCGCTCTCGTTCCTCGAGAAGAACGGTGTCAAGACCAGCGCCAGCGTCGA  108915

Query  195     CGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGC  254
                |||| ||| |||   |||||||||   || || || ||  ||||||||||||  |||  
Sbjct  108916  TGGCTTCATGAAGGAGAAGGGCTACTCCACGCTGCGCGCACTCATGGACGACAGCAAGCT  108975

Query  255     ATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACG-GCA  313
                ||||||||| || ||   | || ||||||    ||||| |||||  | |||  ||  ||
Sbjct  108976  CTACAAGGTCAACTCGAACGCCGACAACTTCCTCTGCGGGTACAC--AGATC--CGACCA  109031

Query  314     AGCGC---CAGCCGATCCCAGCGG---GCACAATCCGCTCCACAGGTTACACTCACGACG  367
               || ||   |||   |||||   ||   |||| || ||| | || || ||||| ||||  |
Sbjct  109032  AGGGCTCGCAGGTCATCCCCAAGGACAGCACCATGCGCACGACCGGATACACCCACGTGG  109091

Query  368     GTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGG  427
               ||||||||||||||||| | ||||||  |   |||||  | |||  ||||||| || || 
Sbjct  109092  GTCCGTGCGAGGTCTGGATCGACAACGTCCGCGTCATCGCCGGCGACAACTGCCACGAGC  109151

Query  428     ACTTCCCGGGAAAGACCCACTCGATCAGCTAC-GCGTCGTGCAAGGGGTCGTGCACGCTG  486
               |  || |    | |||| |   | |   |||| ||  | || ||||| ||||||||  ||
Sbjct  109152  AGGTCTCCAACACGACCAA---GGTGGACTACAGCAAC-TGTAAGGGCTCGTGCACCATG  109207

Query  487     CGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAG  546
               |||||||||||| | || || |||| ||| || || ||||||||||||||||||||||||
Sbjct  109208  CGCTGGTACTGGCTCGGACTGCGCTACCTGAAAAAGAAGTGGTCGTGGCAGGTGTACAAG  109267

Query  547     GAGTGC  552
                | |||
Sbjct  109268  AACTGC  109273

>PHSO:scaffold_1
Length=13391543

 Score = 281 bits (311),  Expect = 2e-73
 Identities = 402/561 (72%), Gaps = 14/561 (2%)
 Strand=Plus/Minus

Query  1        ATGGCCCCTTCCGTCGTCAAGTCCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCGCTC  60
                ||||| |||||| || ||  ||| ||| ||   || ||  |  | |||||||||||||| 
Sbjct  2791958  ATGGCTCCTTCCTTCCTCTCGTCGCTCTCGGCTGCTGCTCTACTCTCCAGCGCCGCGCTG  2791899

Query  61       TGCGACTCGTCGGTTGACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAAC  120
                  ||   || ||| |||||| ||||||   ||| | ||||| |||||||| | ||| |  
Sbjct  2791898  CTCGCTCCGACGGCTGACGCGCACCAGGTCGTGCTGCTACCTGCGCCGACCTACACCACG  2791839

Query  121      CCGGACAAG---AACGTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAG  177
                   ||||||   | |  ||||  |   || || || || || ||||||||||||||| ||
Sbjct  2791838  GACGACAAGGCCACCAAGTACGCG---CCGCTGGCCTTCCTGGAGAACCAGGGCTACGAG  2791782

Query  178      ACCACCGCAGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTC  237
                |||  ||  ||||||||||  |    |     |||||||||||||||||| || || |||
Sbjct  2791781  ACCGTCGAGGACTTCAACGCGTGGCGCCGCGACAAGGGCTACAAGACCCTGCGCGCCTTC  2791722

Query  238      ATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTAC  297
                ||||||| |  |    | |||| ||| | ||  | || || | |||   | ||||| | |
Sbjct  2791721  ATGGACGGCGCGT---CCTACACGGTGGCCGACGGGGCCGACTACT---ACTGCGGATTC  2791668

Query  298      ACCAACATCAACGGCAAGCGC-CAGCCGATCCCAGCGGGCACAATCCGCTCCACAGGTTA  356
                ||| ||||||| |||   ||| ||||| || || |  ||||| || |||||||| || ||
Sbjct  2791667  ACCGACATCAAGGGCGT-CGCGCAGCCCATTCCGGACGGCACCATGCGCTCCACGGGCTA  2791609

Query  357      CACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAA  416
                ||| |||||||| ||||||||||||||||| |||| |||    ||  ||  |  |  |||
Sbjct  2791608  CACGCACGACGGCCCGTGCGAGGTCTGGCTGGACACCACGCGCGTGCTGCAGTCCGACAA  2791549

Query  417      CTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTC  476
                |||| || ||  ||||   || |||||  ||    ||  ||||   ||||||||||| ||
Sbjct  2791548  CTGCCACGAGACCTTCAGCGGCAAGACGTACGACCTCGACTACAGCTCGTGCAAGGGCTC  2791489

Query  477      GTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCA  536
                 ||||| ||||||||||||||| ||||| | ||||||||||||||| | |  ||||||||
Sbjct  2791488  CTGCACCCTGCGCTGGTACTGGCTGGGCGTGCGCTTCCTCAAGAACGAATACTCGTGGCA  2791429

Query  537      GGTGTACAAGGAGTGCGTGCC  557
                ||| ||||||| |||||||||
Sbjct  2791428  GGTTTACAAGGCGTGCGTGCC  2791408

 Score = 168 bits (186),  Expect = 1e-39
 Identities = 212/288 (74%), Gaps = 5/288 (2%)
 Strand=Plus/Plus

Query  274      GGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGC-AAGCGCCAGCCGATCCCAGC  332
                |||||| ||||    || |||| |||||||| ||||||  ||| || |||| || || | 
Sbjct  2790535  GGCGCCGACTTCACCTGTGGCTTCACCAACACCAACGGTGAAGTGC-AGCCCATTCCGGA  2790593

Query  333      GGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGA  389
                 | ||   | || ||||||||||| ||||| |||||||| ||||||||||| ||||| ||
Sbjct  2790594  CGACAACGCTATGCGCTCCACAGGCTACACGCACGACGGCCCGTGCGAGGTTTGGCTCGA  2790653

Query  390      CAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTC  449
                | |||||| |||||||  |  |  ||||||| || ||  | ||   || |||  | || |
Sbjct  2790654  CGACACCATGGTCATGCAGTACGACAACTGCCACGAGTCCATCAGCGGCAAGGACTACAC  2790713

Query  450      GATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCG  509
                 |||  ||||   |||||||      ||||||||||   ||||| |||| ||||| | ||
Sbjct  2790714  CATCGACTACAGCTCGTGCACCTCCACGTGCACGCTCTACTGGTTCTGGCTGGGCGTGCG  2790773

Query  510      CTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCC  557
                || |||||||||| |||  ||||||||| | ||||||| |||||| ||
Sbjct  2790774  CTACCTCAAGAACGAGTACTCGTGGCAGATCTACAAGGCGTGCGTACC  2790821

 Score = 85.1 bits (93),  Expect = 3e-14
 Identities = 145/206 (70%), Gaps = 6/206 (3%)
 Strand=Plus/Minus

Query  352      GGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGC  411
                || ||||| |  ||||| || |||||||||||||| ||| ||||||||||     | |||
Sbjct  2793815  GGCTACACGCTGGACGGCCCCTGCGAGGTCTGGCTGGACGACACCAAGGTGGCTGCTGGC  2793756

Query  412      ACCAACTGCAACAAGGACTTCCCGGGAAAGACC--CACTCGATCAGCTAC-GCGTCGTGC  468
                  ||||||| ||| | | |||||  | | | ||  |||  ||||  |||| ||| |||||
Sbjct  2793755  CGCAACTGCCACACGCAGTTCCC--GCACGGCCAGCACGAGATCGACTACAGCG-CGTGC  2793699

Query  469      AAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGG  528
                   |  |||||||||||  | ||||||||| | ||| |    | | || ||  |   |  
Sbjct  2793698  GGAGACTCGTGCACGCTCTGGTGGTACTGGCTCGGCATCAAGTACGTCGAGGGCGCCTAC  2793639

Query  529      TCGTGGCAGGTGTACAAGGAGTGCGT  554
                ||||||||||| |||||| | |||||
Sbjct  2793638  TCGTGGCAGGTCTACAAGAACTGCGT  2793613

 Score = 48.2 bits (52),  Expect = 0.002
 Identities = 35/41 (85%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  361      CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
                ||| |||| ||||||||||||||| | ||| |||||| |||
Sbjct  2592425  CACCACGGCCCGTGCGAGGTCTGGATCGACGACACCATGGT  2592465

 Score = 48.2 bits (52),  Expect = 0.002
 Identities = 35/41 (85%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  361      CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
                ||| |||| ||||||||||||||| | ||| |||||| |||
Sbjct  2595287  CACCACGGCCCGTGCGAGGTCTGGATCGACGACACCATGGT  2595247

>PHCA:scaffold_7 PHYCAscaffold_7
Length=1368812

 Score = 231 bits (255),  Expect = 4e-58
 Identities = 304/415 (73%), Gaps = 15/415 (4%)
 Strand=Plus/Plus

Query  143     ACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCA-GACTTCAACGGCTAC  201
               |||||||||| || ||||||| |||||||| ||||||  | ||| |||||||  | ||  
Sbjct  901490  ACCCACTCGCTTTCCTCGAGAGCCAGGGCTTCAAGACG-CAGCAAGACTTCACTGCCTGG  901548

Query  202     ATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAG--AAGGCATACA  259
                 |||    || ||||||||  |||| ||||  |||||||||  | ||  |||   ||||
Sbjct  901549  CGCAATGAAAACGGCTACAAATCCCTGCGTGACTTCATGGAC--CGAGCCAAG---TACA  901603

Query  260     AGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCC  319
                 |||     |   || ||| ||||  |||||||||| ||| ||  |||||| | ||  |
Sbjct  901604  CAGTCAG---GAACGGAGCCGACTTCAAGTGCGGCTATACCGACCCCAACGGTACGCCGC  901660

Query  320     AGCCGATCCCAGCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCG  376
               |||| || || || ||||   | || |||||||| |||||||| |||||||||||||| |
Sbjct  901661  AGCCCATTCCTGCAGGCAACGCCATGCGCTCCACGGGTTACACGCACGACGGTCCGTGTG  901720

Query  377     AGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGG  436
               | || ||| ||||  |||| | ||| |||   |||   |||||| || || | ||||| |
Sbjct  901721  AAGTGTGGATTGATGACACGATGGTGATGGAAGGCGATAACTGCCACGAGAAGTTCCCTG  901780

Query  437     GAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACT  496
               | |||  | || | |||  |||| || | ||||||||   ||||||||||  ||||||||
Sbjct  901781  GTAAGGGCTACACCATCGACTACTCGCCCTGCAAGGGCAAGTGCACGCTGTACTGGTACT  901840

Query  497     GGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTG  551
               || ||||  |||||||||| || |||  ||  |||||||||||||||||||||||
Sbjct  901841  GGCTGGGTGTTCGCTTCCTGAAAAACTCGTACTCGTGGCAGGTGTACAAGGAGTG  901895

 Score = 196 bits (216),  Expect = 8e-48
 Identities = 292/410 (71%), Gaps = 11/410 (3%)
 Strand=Plus/Minus

Query  142     AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAG-ACTTCAACGGCTA  200
               ||||| ||||| || ||||||||||||||||  |||||  | |||| ||||||  | || 
Sbjct  905884  AACCCGCTCGCTTTCCTCGAGAACCAGGGCTTTAAGACG-CAGCAGGACTTCACTGCCTG  905826

Query  201     CATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAA  260
                  |||    || ||||||||| | || ||||  |||||||||      |||   |||| 
Sbjct  905825  GCGCAACGAAAACGGCTACAAGTCACTGCGTGACTTCATGGACAGAGCTAAG---TACAC  905769

Query  261     GGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCCA  320
                |||    ||   || ||| ||||    || || |  ||| ||   || || | ||  ||
Sbjct  905768  AGTCA---CGAACGGAGCCGACTTCTCTTGTGGGTTTACCGACCCGAAGGGTACGCCGCA  905712

Query  321     GCCGATCCCAGCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGA  377
               ||| || || |||||||   | || |||||||| |||||||| ||||| |||||||| ||
Sbjct  905711  GCCCATTCCGGCGGGCAACGCCATGCGCTCCACGGGTTACACGCACGATGGTCCGTGTGA  905652

Query  378     GGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGG  437
                || ||||||||| |||| | |||  ||   ||   ||||||| || || | || || ||
Sbjct  905651  AGTGTGGCTTGACGACACGATGGTGCTGGATGGTGACAACTGCCACGAGAAATTTCCCGG  905592

Query  438     AAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTG  497
                |||  | || || |   |||| |||| ||||||||  |||||||||| || ||||||||
Sbjct  905591  CAAGGACTACACGGTGGACTACTCGTCTTGCAAGGGCACGTGCACGCTTCGTTGGTACTG  905532

Query  498     GATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGG  547
               | ||||  |||||||| | ||||||  ||  |||||||||||||||||||
Sbjct  905531  GCTGGGTGTTCGCTTCTTGAAGAACGCGTACTCGTGGCAGGTGTACAAGG  905482

 Score = 194 bits (214),  Expect = 3e-47
 Identities = 279/388 (72%), Gaps = 13/388 (3%)
 Strand=Plus/Minus

Query  169     GGCTACAAGACCACCGCAGACTTCAACGGCTA--CATCAAGTCCAAGGGCTACAAGACCC  226
               |||| ||||||    |||||||||| | |||   | | |||   || ||||||||  | |
Sbjct  876615  GGCTTCAAGACGCAGGCAGACTTCA-CTGCTTGGCGT-AAGGAGAACGGCTACAAATCTC  876558

Query  227     TTCGTGCGTTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTG  286
               | ||||  ||||||||  ||   |||   |||   |||    |||  || ||| ||||  
Sbjct  876557  TGCGTGATTTCATGGATAACGCCAAG---TACCCAGTCT---CGGAAGGTGCCGACTTCA  876504

Query  287     AGTGCGGCTACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCGGGCA---CAATCC  343
               |||||||||  ||| ||  |||||| | ||  ||||| || || ||||| |   | || |
Sbjct  876503  AGTGCGGCTTTACCGACCCCAACGGTACGCCGCAGCCCATTCCGGCGGGAAATGCCATGC  876444

Query  344     GCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCA  403
               | ||||| |||||||| |||||||||||||| ||||| ||| ||||  |||| | ||| |
Sbjct  876443  GTTCCACTGGTTACACGCACGACGGTCCGTGTGAGGTGTGGATTGATGACACGATGGTGA  876384

Query  404     TGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGT  463
               ||   ||   ||||||| || || | ||||| || |||  | || | |||  |||| || 
Sbjct  876383  TGGAAGGTGACAACTGCCACGAGAAGTTCCCTGGTAAGGACTACACCATCGACTACTCGC  876324

Query  464     CGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACA  523
               | ||||||||   ||||||||||  |||||||||| ||||  | || |||||||| ||||
Sbjct  876323  CCTGCAAGGGCAAGTGCACGCTGTACTGGTACTGGCTGGGTGTGCGTTTCCTCAAAAACA  876264

Query  524     AGTGGTCGTGGCAGGTGTACAAGGAGTG  551
                 |  |||||||||||||||||||||||
Sbjct  876263  GATACTCGTGGCAGGTGTACAAGGAGTG  876236

 Score = 190 bits (210),  Expect = 3e-46
 Identities = 343/494 (69%), Gaps = 22/494 (4%)
 Strand=Plus/Plus

Query  64      GACTCGTCGGTTGACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAACCCG  123
               |||||  | | ||| ||||||||||  ||| | || || |  ||   ||  || | |   
Sbjct  904304  GACTCTACTGCTGAAGCTCACCAGATCGTGTTGCTGCCGGAACCTCAGTGGACGACCAAT  904363

Query  124     GACAAGAACGTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACC  183
               |||||| ||    | |  |||||||| ||||| ||||||||||||||||  |||||  | 
Sbjct  904364  GACAAGGACACCAAGTACAACCCACTGGCGTTCCTCGAGAACCAGGGCTTTAAGACG-CA  904422

Query  184     GCAG-ACTTCAACGGCTACATCAAGTCC----AAGGGCTACAAGACCCTTCGTGCGTTCA  238
               |||| ||||     ||| | |   || |    ||   ||||||  ||||||| |  ||||
Sbjct  904423  GCAGGACTTT----GCTTCGTGGCGTACGGAAAACAACTACAAATCCCTTCGCGACTTCA  904478

Query  239     TGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACA  298
               ||||| |    ||   |||||  |||    |||  || ||| ||||    ||||| |  |
Sbjct  904479  TGGACAATGCCAA---ATACACAGTCA---CGGACGGAGCCGACTTCTCTTGCGGGTTTA  904532

Query  299     CCAACATCAACGGCAAGCGCCAGCCGATCCCAGCGGGCA---CAATCCGCTCCACAGGTT  355
               || ||   || || | ||  ||||| || || ||||| |   | || || ||||| ||||
Sbjct  904533  CCGACCCGAAGGGTACGCCGCAGCCCATTCCGGCGGGAAATGCCATGCGTTCCACTGGTT  904592

Query  356     ACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCA  415
               |||| |||||||||||||| || || ||||||||| |||| | |||  ||   ||   ||
Sbjct  904593  ACACGCACGACGGTCCGTGTGAAGTGTGGCTTGACGACACGATGGTGCTGGATGGTGACA  904652

Query  416     ACTGCAACAAGGACTT--CCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGG  473
               ||||| || || | ||  ||||| ||||||  || || |   |||| |||| ||||||||
Sbjct  904653  ACTGCCACGAGAAATTTCCCCGGTAAAGACT-ACACGGTGGACTACTCGTCTTGCAAGGG  904711

Query  474     GTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTG  533
                 |||||||||| |||||||||||| ||||| | || ||| | |||||  |||  |||||
Sbjct  904712  CACGTGCACGCTTCGCTGGTACTGGCTGGGCATCCGTTTCTTGAAGAATCAGTACTCGTG  904771

Query  534     GCAGGTGTACAAGG  547
               ||||||||||||||
Sbjct  904772  GCAGGTGTACAAGG  904785

 Score = 174 bits (192),  Expect = 2e-41
 Identities = 208/282 (74%), Gaps = 3/282 (1%)
 Strand=Plus/Plus

Query  274     GGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCG  333
               || ||| ||||  |||||||||  ||| ||  |||||| | ||  ||||| || || |||
Sbjct  908937  GGTGCCGACTTCAAGTGCGGCTTTACCGACCCCAACGGTACGCCGCAGCCCATTCCGGCG  908996

Query  334     GGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGAC  390
               || |   | || || ||||| |||||||| || || |||||||| ||||| |||||||||
Sbjct  908997  GGTAACGCCATGCGTTCCACGGGTTACACGCATGATGGTCCGTGTGAGGTGTGGCTTGAC  909056

Query  391     AACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCG  450
                | || | |||  ||   ||    |||||  || || | ||||| || |||  | || | 
Sbjct  909057  GATACGATGGTGCTGGACGGAGAGAACTGTCACGAGAAGTTCCCTGGTAAGGGCTACACC  909116

Query  451     ATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGC  510
               |||  |||| |||| ||||||||  | |||||||||  ||||| |||| | ||  |||||
Sbjct  909117  ATCGACTACTCGTCTTGCAAGGGCACCTGCACGCTGTACTGGTTCTGGCTTGGTGTTCGC  909176

Query  511     TTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGC  552
               ||||| |||||| | |  ||||||||||||||||||| ||||
Sbjct  909177  TTCCTGAAGAACGACTACTCGTGGCAGGTGTACAAGGCGTGC  909218

>PYVX:scaffold_275 pve_scaffold_275 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_275:1:32274:1 
REF
Length=32274

 Score = 217 bits (240),  Expect = 2e-54
 Identities = 340/484 (70%), Gaps = 7/484 (1%)
 Strand=Plus/Plus

Query  79    GCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAACCCGGACAAGAACGTGTAC  138
             || ||||||   |||||||| || ||||| |||| |||   |  || |||| ||     |
Sbjct  7586  GCGCACCAGCTCGTGATCCTGCCGGCGCCAACGTACACGGTCGAGGGCAAGGACAACCGC  7645

Query  139   TGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGC  198
             ||||| || ||||| || ||||||  ||||  || |  ||||||||  ||||||  ||||
Sbjct  7646  TGGAAGCCGCTCGCCTTCCTCGAGGGCCAGAACTTCTCGACCACCGACGACTTCGTCGGC  7705

Query  199   TACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATAC  258
             ||| |  |  |||| |||| | |  | || || || |||||||||||| |   |   |||
Sbjct  7706  TACTTGGACGCCAACGGCTTCGACTCGCTCCGCGCCTTCATGGACGACGACTCGCTCTAC  7765

Query  259   AAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGC  318
               |||  ||||| |   |||  ||||    ||||||| |||  ||    ||| |  ||  
Sbjct  7766  TCGGTGAACGCGTC---CGCGGACTTCCGATGCGGCTTCACGGACCCGGACGCCGCGCCG  7822

Query  319   CAGCCGATCCCAGCGGGCACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAG  378
             ||||| ||||| |  ||||  || |||||||| || ||||| |||||||| |||||||||
Sbjct  7823  CAGCCCATCCCCGACGGCATTATGCGCTCCACGGGGTACACGCACGACGGCCCGTGCGAG  7882

Query  379   GTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGA  438
             |||||||| ||| ||||    ||  ||  |  |  ||||||| |  ||| | || | || 
Sbjct  7883  GTCTGGCTCGACGACACGCGTGTGCTGCAGCACGACAACTGCCATGAGGTCATCTCCGGC  7942

Query  439   AAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGG  498
             || ||| ||    |   |||| || ||||||| || ||||||||||||  ||||||||||
Sbjct  7943  AAAACCTACGACCTTGACTACTCGGCGTGCAACGGCTCGTGCACGCTGTACTGGTACTGG  8002

Query  499   ATGGGCCTTCGCTTCCTCAAGAACAAG--TGGTCGTGGCAGGTGTACAAGGAGTGCGTGC  556
              | ||| | |||| |||||||  ||||  |  |||||||||||||||||||  |||||||
Sbjct  8003  CTCGGCGTGCGCTACCTCAAG--CAAGTCTACTCGTGGCAGGTGTACAAGGCCTGCGTGC  8060

Query  557   CAAT  560
             | ||
Sbjct  8061  CGAT  8064

 Score = 198 bits (219),  Expect = 2e-48
 Identities = 403/579 (70%), Gaps = 41/579 (7%)
 Strand=Plus/Minus

Query  22     TCCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCGCT-CT-GCGACTCGTCGGTTGACG  79
              || ||||| || ||||||      ||| | |||||||| || || || |||||   ||||
Sbjct  14976  TCGCTCGCCCTTGCCGCC------TCCGGTGCCGCGCTGCTCGCCAC-CGTCGCC-GACG  14925

Query  80     CTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAACCCGGAC---AAGAACGT--  134
              | ||||||  ||||||| | || ||||||||||  |   || |||||   ||| ||||  
Sbjct  14924  CGCACCAGTATGTGATCTTGCCGGCGCCGACGTGGA---ACACGGACGACAAGGACGTCA  14868

Query  135    -GTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCA  193
               ||||  |   ||||| || || || ||| ||||||| | |  |||    |  |||||||
Sbjct  14867  TGTACGCG---CCACTGGCTTTCCTGGAGGACCAGGGGTTCTCGACGCAGGAGGACTTCA  14811

Query  194    ACGGC-TACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAG  252
               |||| |    |  |  ||| |||||| |  | || ||||| |||||||||| |  |  |
Sbjct  14810  -CGGCGTGGCGCTCGGACAACGGCTACGACTCGCTCCGTGCCTTCATGGACGGCGCGTCG  14752

Query  253    GCATACAAGGTCGACGCGGCGGGCGCCAACTTTGA-GTGCGGCTACACCAACATCAACGG  311
                 |||| ||| ||||  |  |||||| | |  || ||||||||  |||||||   ||||
Sbjct  14751  ---TACACGGT-GACG--GACGGCGCCGA-TCAGACGTGCGGCTGGACCAACAAGGACGG  14699

Query  312    CAAGCGCCAGCCGATCCCAGCGGGCACAATCCGCTCCACAGGTTACACTCACGACGGTCC  371
              || |   ||| || | || |  |||   || |||||||| || ||||| |||| ||||||
Sbjct  14698  CACGGCGCAGGCGCTTCCCGACGGCGTCATGCGCTCCACGGGGTACACGCACGTCGGTCC  14639

Query  372    GTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACT-  430
              ||||||||||||||| ||| |||| | |||  ||  |  |  ||||||| ||   |||| 
Sbjct  14638  GTGCGAGGTCTGGCTCGACGACACGATGGTGCTGCAGTACGACAACTGCCAC---GACTC  14582

Query  431    --TCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCG  488
                || | || |||||| ||    ||  |||| |||| |||| |    ||||||||||   
Sbjct  14581  AATCTCTGGCAAGACCTACGACCTCGACTACTCGTCCTGCACGTCCACGTGCACGCTCTA  14522

Query  489    CTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGA  548
              ||||| |||||||||| | |||| |||||| ||| |||  |||||||||||||||||| |
Sbjct  14521  CTGGTTCTGGATGGGCGTCCGCTACCTCAACAACGAGTACTCGTGGCAGGTGTACAAGAA  14462

Query  549    GTGCGTGC--CAATTGGCAGCGG-TCGCCGCCTCGAGGG  584
               ||||| |  |  | |||  ||| |||||| ||||| ||
Sbjct  14461  CTGCGTACCGCTCTCGGCCTCGGCTCGCCGTCTCGAAGG  14423

 Score = 133 bits (147),  Expect = 8e-29
 Identities = 327/492 (66%), Gaps = 24/492 (5%)
 Strand=Plus/Plus

Query  76     GACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAACCCGGACAAGAACGTG  135
              ||||||||||||  ||||||||| || |  |||||||  || | | | |||    |||| 
Sbjct  13551  GACGCTCACCAGTATGTGATCCTTCCCGAACCGACGTGGACGACCACCGACCGAGACGT-  13609

Query  136    TACTGGAAC---CCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTC  192
                |||| ||   || |||||||| || ||  |||||||||   ||||   ||  ||||||
Sbjct  13610  --CTGGTACGCGCCGCTCGCGTTCCTTGAAGACCAGGGCTTTGAGACAGTCGAGGACTTC  13667

Query  193    AACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAG  252
              |||| ||    |   ||||| ||||||||||| || ||||| ||||||   ||| ||  |
Sbjct  13668  AACGCCTGGCGCCGCTCCAACGGCTACAAGACGCTGCGTGCCTTCATG---GACCAGGCG  13724

Query  253    GCATACAAGGTCGACG--CGGCGGGCGCCA-ACTTTGAGTGCGGCTACACCAACATCAAC  309
               | || | ||| ||||  ||||| |  ||| ||     |||||| | |||  | ||| | 
Sbjct  13725  TCCTATACGGT-GACGGACGGCGCGGACCAGAC-----GTGCGGGTTCACTGAGATCGAT  13778

Query  310    GGCAAGCGCCAGCCGATCCCAGCGGGCACAATCCGCTCCACAGGTTACACTCACGACGGT  369
              ||||  |  ||||||||||   ||| ||   |||| ||||| || ||||| ||||| || 
Sbjct  13779  GGCACACCTCAGCCGATCC---CGGCCAACTTCCGATCCACGGGATACACGCACGATGGA  13835

Query  370    CCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGAC  429
              || || ||| ||||||| |||   |||   |||    |   |  ||| ||  || ||| |
Sbjct  13836  CCCTGTGAGATCTGGCTCGACTCGACCCGCGTCTACGCCAACGACAATTGTCACGAGGCC  13895

Query  430    TTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAG---GGGTCGTGCACGCTG  486
               || |||| |||  |    | |||  |||| ||            ||  | ||||| || 
Sbjct  13896  ATCTCGGGCAAGGACACGGCCATCGACTACTCGNNNNNNNNNNGCGGCACATGCACACTC  13955

Query  487    CGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAG  546
                |||||||||||||||  | || | |||||| |||   |  |||||||| |||||||||
Sbjct  13956  TACTGGTACTGGATGGGTGTGCGATACCTCAACAACGCCTACTCGTGGCAAGTGTACAAG  14015

Query  547    GAGTGCGTGCCA  558
               | || ||||||
Sbjct  14016  AACTGTGTGCCA  14027

 Score = 121 bits (133),  Expect = 5e-25
 Identities = 147/198 (74%), Gaps = 2/198 (1%)
 Strand=Plus/Minus

Query  361   CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGC  420
             |||||||||||||||||| ||||||| ||| ||||     || |   ||||  |||||||
Sbjct  9063  CACGACGGTCCGTGCGAGATCTGGCTCGACGACACTCGCATCTTCCAGGGCGACAACTGC  9004

Query  421   AACAAGGACTTC-CCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTG  479
              || ||  | || |||| || ||| |   || ||  |||| |||||||||  || |||||
Sbjct  9003  CACGAGAGCGTCTCCGGCAAGGACACGGCCG-TCGACTACTCGTCGTGCAGCGGCTCGTG  8945

Query  480   CACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGT  539
             |||||||  ||||| |||||||||  | |||| ||| |||     ||  |||||||| ||
Sbjct  8944  CACGCTGTACTGGTTCTGGATGGGTGTGCGCTACCTGAAGGGAGCGTACTCGTGGCAAGT  8885

Query  540   GTACAAGGAGTGCGTGCC  557
             ||||||| | ||||||||
Sbjct  8884  GTACAAGAACTGCGTGCC  8867

 Score = 96.9 bits (106),  Expect = 5e-18
 Identities = 83/103 (81%), Gaps = 0/103 (0%)
 Strand=Plus/Plus

Query  456    CTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCT  515
              |||| ||||||||||||| ||||||||||||  |||||||||||||||  | |||| |||
Sbjct  12720  CTACTCGTCGTGCAAGGGCTCGTGCACGCTGTACTGGTACTGGATGGGTGTGCGCTACCT  12779

Query  516    CAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCCA  558
               |||     ||  |||||||| ||||||||| | || ||||||
Sbjct  12780  GAAGGGAGCGTACTCGTGGCAAGTGTACAAGAACTGTGTGCCA  12822

 Score = 67.1 bits (73),  Expect = 9e-09
 Identities = 74/99 (75%), Gaps = 0/99 (0%)
 Strand=Plus/Plus

Query  145    CCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTACATC  204
              || |||||||| |||||||||||||||| ||||||    |  ||||||| || ||    |
Sbjct  12500  CCGCTCGCGTTCCTCGAGAACCAGGGCTTCAAGACGCAGGAGGACTTCAGCGCCTGGCGC  12559

Query  205    AAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGAC  243
                  |||| ||||||||||| || ||  | |||||||||
Sbjct  12560  CGCGCCAACGGCTACAAGACGCTGCGCTCCTTCATGGAC  12598

>PHSO:scaffold_14
Length=1806347

 Score = 211 bits (233),  Expect = 3e-52
 Identities = 341/481 (71%), Gaps = 21/481 (4%)
 Strand=Plus/Minus

Query  76      GACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAACCCGGACAAG--AACG  133
               |||||||||||||  ||| | ||||| | |||    |  || | |   ||||||  ||| 
Sbjct  819299  GACGCTCACCAGATCGTGCTGCTACCGGAGCCTCAATGGACAACCAATGACAAGGAAACT  819240

Query  134     T-GTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTC  192
                 ||||   ||||| ||||| || || || |||||||| | |||||||   |  ||||||
Sbjct  819239  AAGTAC---AACCCGCTCGCCTTCCTTGAAAACCAGGGTTTCAAGACCCAGGAGGACTTC  819183

Query  193     AACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGAC---GACAAG  249
               | || ||    ||||   || ||||||||| | || ||||  |||||||||   | ||||
Sbjct  819182  ACCGCCTGGCGCAAGGAGAACGGCTACAAGTCGCTGCGTGATTTCATGGACAGGGCCAAG  819123

Query  250     AAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAAC  309
                     ||| | ||| || | |||| |||| ||||    || |||| |||| ||  ||| 
Sbjct  819122  ------TACGACGTC-AC-CAGCGG-CGCCGACTTCTCCTGTGGCTTCACCGACCCCAAG  819072

Query  310     GGCAAGCGCCAGCCGATCCCAGCGGGCA-CAA--TCCGCTCCACAGGTTACACTCACGAC  366
               ||||  |  ||||| || || |  || | |||  | ||||| || || ||||| ||||||
Sbjct  819071  GGCACCCCTCAGCCCATTCCGGAAGGTAACAAGATGCGCTCTACCGGCTACACCCACGAC  819012

Query  367     GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAG  426
               || ||||||||||| ||||| ||| |||| | |||  ||   |||  ||||||| || ||
Sbjct  819011  GGCCCGTGCGAGGTGTGGCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAG  818952

Query  427     GACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTG  486
                | |||||||| |||  | || || |   |||| | |||||||||||  |||||||||| 
Sbjct  818951  AAGTTCCCGGGCAAGGACTACACGGTGGACTACTCATCGTGCAAGGGCACGTGCACGCTT  818892

Query  487     CGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAG  546
               |||||||||||| ||||  | || ||| | |||||  | |  ||||||||||||||||||
Sbjct  818891  CGCTGGTACTGGCTGGGAGTGCGTTTCTTGAAGAATGACTACTCGTGGCAGGTGTACAAG  818832

Query  547     G  547
               |
Sbjct  818831  G  818831

 Score = 162 bits (179),  Expect = 2e-37
 Identities = 284/413 (69%), Gaps = 38/413 (9%)
 Strand=Plus/Minus

Query  142     AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTAC  201
               ||||| ||||| || || || |||||||| | |||||||   |  ||||||   | ||  
Sbjct  815752  AACCCGCTCGCCTTCCTTGAAAACCAGGGTTTCAAGACCCAGGAGGACTTCGCTGCCTGG  815693

Query  202     ATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAG  261
                 ||||   || |||||| |||| || ||||  |||||||||      |||||   ||||
Sbjct  815692  CGCAAGGAGAACGGCTACCAGACGCTGCGTGACTTCATGGAC------AAGGC---CAAG  815642

Query  262     GTCGACG----CGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCG  317
                 |||||    | |||| |||| ||||    ||||||| |||| ||  ||| ||||  | 
Sbjct  815641  TACGACGTCACCAGCGG-CGCCGACTTCTCCTGCGGCTTCACCGACCCCAAGGGCACCCC  815583

Query  318     CCAGCCGATCCCAGCGGGCA-CAA--TCCGCTCCACAGGTTACACTCACGACGGTCCGTG  374
                ||||| || || |  || | |||  | |||||||| || ||||| |||||||||     
Sbjct  815582  TCAGCCCATTCCGGAAGGTAACAAGATGCGCTCCACGGGATACACCCACGACGGTG----  815527

Query  375     CGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCC  434
                      ||||| ||| |||| | |||  ||   |||  ||||||| || || | |||||
Sbjct  815526  -------TGGCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAGAAGTTCCC  815474

Query  435     GGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTA  494
               ||| |||  | || || ||  |||| ||||||| ||||| ||||||||||| ||||||||
Sbjct  815473  GGGCAAGGACTACACGGTCGACTACTCGTCGTGTAAGGGCTCGTGCACGCTTCGCTGGTA  815414

Query  495     CTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGG  547
               |||||||||           | ||||||  ||  |||||| ||||||||||||
Sbjct  815413  CTGGATGGG----------ATGAAGAACTCGTACTCGTGGAAGGTGTACAAGG  815371

 Score = 123 bits (136),  Expect = 4e-26
 Identities = 215/307 (70%), Gaps = 17/307 (6%)
 Strand=Plus/Plus

Query  142     AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAAC----GG  197
               |||||  | || || |||||||||||||||| | ||||    |  ||||||  |    ||
Sbjct  814021  AACCCGTTGGCCTTCCTCGAGAACCAGGGCTTCGAGACGCAGGAGGACTTCGCCTCGTGG  814080

Query  198     CTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATA  257
               |   | ||||   || ||||||||| | || ||||  ||||||||| |    |||   ||
Sbjct  814081  CGTGA-CAAG---AACGGCTACAAGTCGCTGCGTGACTTCATGGACAAGGCTAAG---TA  814133

Query  258     CAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCG  317
               ||  || |||| |   || ||| ||||    ||||||| |||| ||  ||| || |  | 
Sbjct  814134  CACAGT-GACGAGT--GGAGCCGACTTCTCCTGCGGCTTCACCGACCCCAAGGGTACCCC  814190

Query  318     CCAGCCGATCCCAGCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTG  374
                ||||| || || ||||||    | || || || || |||||||| |||||||| |||||
Sbjct  814191  TCAGCCCATTCCGGCGGGCGACGCCATGCGTTCGACGGGTTACACGCACGACGGCCCGTG  814250

Query  375     CGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCC  434
               |||||| ||||| ||| |||| |||||  ||  ||||  ||||||| || || | |||||
Sbjct  814251  CGAGGTGTGGCTCGACGACACGAAGGTGCTGGAGGGCGACAACTGCCACGAGAAGTTCCC  814310

Query  435     GGGAAAG  441
               ||| |||
Sbjct  814311  GGGCAAG  814317

 Score = 44.6 bits (48),  Expect = 0.030
 Identities = 24/24 (100%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  529     TCGTGGCAGGTGTACAAGGAGTGC  552
               ||||||||||||||||||||||||
Sbjct  814331  TCGTGGCAGGTGTACAAGGAGTGC  814354

>PYAP:scaffold_560 pag1_scaffold_560 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_560:1:21458:1 
REF
Length=21458

 Score = 201 bits (222),  Expect = 2e-49
 Identities = 361/519 (70%), Gaps = 34/519 (7%)
 Strand=Plus/Minus

Query  66    CTCGTCGGTTGACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAACCCGGA  125
             ||| || || ||||| |||||| |||||| | | ||||| || || ||||| |||   ||
Sbjct  8578  CTCTTCCGTGGACGCGCACCAGCGTGTGACCATCCCAGCACCAACCTTCACCAACAACGA  8519

Query  126   CAAGAACGTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGC  185
             |   |||||  ||||||||||  | ||||| ||||||||||||||   |||| |   || 
Sbjct  8518  CCGCAACGTCAACTGGAACCCGTTGGCGTTCCTCGAGAACCAGGGTGTCAAGGCTGGCGA  8459

Query  186   AGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGA  245
              ||| |||  |||| | ||     |||||||  |||||| || ||||  | ||||||| |
Sbjct  8458  CGACCTCACGGGCTTCCTCCGTAGCAAGGGCATCAAGACGCTCCGTGACTACATGGACAA  8399

Query  246   CAAGAAGGCA--TACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAAC  303
             ||||  | ||  |||||| |||| |||   || || | ||| ||||| ||||||||||||
Sbjct  8398  CAAG--GCCAACTACAAGATCGAGGCGCGTGGTGCGAGCTTCGAGTGTGGCTACACCAAC  8341

Query  304   ATCAACGGCAAGCGCCAGCCGATCCC--AG-CGGGCACAATCCGCTCCACAGGTTACACT  360
                |||||   ||||||||| || ||  ||   ||||  || || || || || ||||| 
Sbjct  8340  CCAAACGGTGCGCGCCAGCCTATTCCGAAGAACGGCATGATGCGTTCGACCGGCTACACG  8281

Query  361   CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATG-TCGG--GC-AC---  413
             |||||||| || || ||||||||||| ||||||||   |  | || ||||  || ||   
Sbjct  8280  CACGACGGCCCATGTGAGGTCTGGCTCGACAACAC---GCGCGTGCTCGGCAGCTACACT  8224

Query  414   --CAACTGCAACAAGGACTTCCCGGGAAA---------GACCCACTCGATCAGCTACGCG  462
               ||||||| ||| |||  ||   |||||         || | ||  ||||  || | | 
Sbjct  8223  GGCAACTGCCACAGGGATGTC---GGAAACAAGGCTGTGAGCTACAAGATCGACTTCTCC  8167

Query  463   TCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTC---AAG  519
               |||||||||    |||| ||| || ||||||||| | |||   ||| || ||      
Sbjct  8166  AAGTGCAAGGGCAACTGCATGCTCCGTTGGTACTGGCTCGGCAAGCGCCTCATCGGTGGC  8107

Query  520   AACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCCA  558
             || ||||||||||||||| | ||||||| ||| ||||||
Sbjct  8106  AAGAAGTGGTCGTGGCAGATCTACAAGGCGTGTGTGCCA  8068

 Score = 150 bits (166),  Expect = 3e-34
 Identities = 301/440 (68%), Gaps = 31/440 (7%)
 Strand=Plus/Minus

Query  141    GAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTA  200
              |||||| || ||||| || ||||||||||||  |||| |||| |  ||  |||  |||||
Sbjct  11247  GAACCCTCTGGCGTTCCTGGAGAACCAGGGCGTCAAGGCCACTGATGATCTCACGGGCTA  11188

Query  201    CAT---CAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCA--  255
              | |   | ||   ||||||   ||||| || ||||  ||||||||  |||||  | ||  
Sbjct  11187  CCTGCGCCAG---AAGGGCGTGAAGACGCTCCGTGATTTCATGGATAACAAG--GCCAAC  11133

Query  256    TACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAG  315
              || |||||||| || || || ||||  || |||||||| |||||| |    |||||    
Sbjct  11132  TATAAGGTCGAGGCTGCAGGTGCCACGTTCGAGTGCGGTTACACCGATCCAAACGGTGCC  11073

Query  316    CGCCAGCCGATCCCAGCG---GGCACAATCCGCTCCACAGGTTACACTCACGACGGTCCG  372
              || || || || ||| ||   ||||  || ||||| || |||||||| |||||||| |||
Sbjct  11072  CGTCAACCAATTCCATCGAACGGCATGATGCGCTCGACTGGTTACACGCACGACGGCCCG  11013

Query  373    TGCGAGGTCTGGCTTGACAACAC-CAAGGTCATG--------TCGGGCACCAACTGCAAC  423
              || ||||| ||||| || ||||| | ||  | ||        || ||   | ||||| ||
Sbjct  11012  TGTGAGGTTTGGCTCGATAACACGCGAGTGCTTGGATCTACATCCGG---CGACTGCCAC  10956

Query  424    AAGGA---CTTCCCGGGAAAG---ACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCG  477
              |||||   |  || ||| | |   | | ||  ||||   | | |   |||||||||    
Sbjct  10955  AAGGATATCGGCCAGGGCATGATTAGCTACAAGATCGATTTCTCCAAGTGCAAGGGCAAC  10896

Query  478    TGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAG  537
              |||| ||| || ||||||||| |||     |||    |    | ||||||||||||||||
Sbjct  10895  TGCATGCTCCGTTGGTACTGGCTGGCGAAGCGCAAGATTGGCAGCAAGTGGTCGTGGCAG  10836

Query  538    GTGTACAAGGAGTGCGTGCC  557
              ||||||||| |||| |||||
Sbjct  10835  GTGTACAAGCAGTGTGTGCC  10816

 Score = 124 bits (137),  Expect = 4e-26
 Identities = 287/423 (68%), Gaps = 21/423 (5%)
 Strand=Plus/Plus

Query  157    CTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTACATCAAGTCCAAGGGC  216
              |||||||||||||||||||||||||||   ||||||||||  ||| ||  | |||| |||
Sbjct  12656  CTCGAGAACCAGGGCTACAAGACCACCAAGGACTTCAACGCGTACCTCTCGGCCAACGGC  12715

Query  217    TACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGGC  276
              |||||||| || ||||  ||||||||| |       || |||||||   ||  || | ||
Sbjct  12716  TACAAGACGCTCCGTGACTTCATGGACAAGCCTGGTGCCTACAAGGCTAACAAGG-GTGC  12774

Query  277    GCCAACT-TTGAGTGCGGCTACACCAACATCAACG-GCAAGCGCCAGCCGATCCCAGCG-  333
              |   ||| | ||||| || |||||  |    |||| || | || |||||||||||| || 
Sbjct  12775  G---ACTGTCGAGTGTGGTTACACGGATCCGAACGCGCCACCG-CAGCCGATCCCAACGA  12830

Query  334    --GGCACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACA  391
                |||    ||||| |  | || ||||| ||||| || ||||||||| ||||| | ||| 
Sbjct  12831  ACGGCGAGTTCCGCACATCGGGATACACGCACGAAGGCCCGTGCGAGATCTGGATCGACG  12890

Query  392    ACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAG------ACCC  445
              |    | ||||| |   ||||  |||||  || | ||| || |||  |||      ||  
Sbjct  12891  ATGTGATGGTCAAGAGCGGCAAGAACTGTCACTACGACATCTCGGAGAAGGCGTTCACTG  12950

Query  446    ACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCC  505
              ||  |||   ||||    | ||||||||   ||||| |||    ||||||||| | ||| 
Sbjct  12951  ACAAGATTGACTACAGTGCATGCAAGGGCAAGTGCATGCTCAAGTGGTACTGGCTCGGCA  13010

Query  506    TTCGCTTCC--TCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCCAATTGG  563
              | ||  |||  |    || ||||  || |||||| | |||||||  ||| | || | |||
Sbjct  13011  TCCG--TCCAATGGGCAAGAAGTATTCATGGCAGATCTACAAGGCCTGCATACC-ACTGG  13067

Query  564    CAG  566
              |||
Sbjct  13068  CAG  13070

>PHRA:scaffold_267
Length=29552

 Score = 201 bits (222),  Expect = 2e-49
 Identities = 371/536 (69%), Gaps = 15/536 (3%)
 Strand=Plus/Plus

Query  23    CCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCGCT-CTG-CGACTCGTCGGTTGACGC  80
             |||||||  ||||  |  || ||||||||   ||||| ||| || ||  |  |  |||||
Sbjct  9286  CCCTCGCAGTCGCTTCGGTCCTGTCCAGCATGGCGCTGCTGGCGCCTACT--GCCGACGC  9343

Query  81    TCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAACCCGGACAAGAACGTGTACTG  140
             |||||||  |||| | || || |  ||    |  |||| |   |||||| ||    | | 
Sbjct  9344  TCACCAGGTTGTGCTGCTGCCGGAACCCCAATGGACTACCGACGACAAGGACACCAAGTA  9403

Query  141   GAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGC-T  199
              ||||| || || || ||||| ||| | |||| || ||||   |  ||||||  || | |
Sbjct  9404  CAACCCGCTGGCTTTCCTCGAAAACGAAGGCTTCACGACCCAGGAGGACTTCG-CGTCGT  9462

Query  200   ACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACA  259
                 | |    || ||||||||| | || ||||  ||||||||| ||   |||   ||||
Sbjct  9463  GGCGCGACGAAAACGGCTACAAGTCGCTGCGTGACTTCATGGACAACGCCAAG---TACA  9519

Query  260   AGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCC  319
             | || | ||  |   ||||| ||||    |||||||  ||| ||  ||| || |  |  |
Sbjct  9520  ATGTGGCCGACG---GCGCCGACTTCTCTTGCGGCTTTACCGACCCCAAGGGAACCCCGC  9576

Query  320   AGCCGATCCCAGCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCG  376
             |||| || || || || |   | || || ||||| || ||||| ||||||||||||||||
Sbjct  9577  AGCCCATTCCGGCTGGTAACGCGATGCGTTCCACGGGATACACGCACGACGGTCCGTGCG  9636

Query  377   AGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGG  436
             |||| ||||||||| |||| | |||  |    |||  ||||||  || || | ||||| |
Sbjct  9637  AGGTGTGGCTTGACGACACGATGGTGCTCGACGGCGACAACTGTCACGAGAAGTTCCCTG  9696

Query  437   GAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACT  496
             | |||  | || |  ||  |||| |||| ||||||||  |||||||||| || |||||||
Sbjct  9697  GCAAGGACTACACCGTCGACTACTCGTCCTGCAAGGGCACGTGCACGCTTCGTTGGTACT  9756

Query  497   GGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGC  552
             || ||||| | || |||||||||||| | |  |||||||| |||||||||||||||
Sbjct  9757  GGCTGGGCATCCGTTTCCTCAAGAACGACTACTCGTGGCAAGTGTACAAGGAGTGC  9812

>PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_711:1:15030:1 
REF
Length=15030

 Score = 199 bits (220),  Expect = 6e-49
 Identities = 272/382 (71%), Gaps = 31/382 (8%)
 Strand=Plus/Plus

Query  1     ATGGCCCCTTCCGTCGTCAAGTCCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCGCTC  60
             ||||| |||||| |   ||||||||||| |||||| |    ||||||||| || ||||||
Sbjct  3492  ATGGCTCCTTCCATTACCAAGTCCCTCGTGCTCGCGGTTGCCGTGTCCAGTGCTGCGCTC  3551

Query  61    TGCGACTCGTCGGTTGACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACT---  117
                         || ||||| ||||||   |||   || ||||| |||||||  ||    
Sbjct  3552  ------------GTCGACGCGCACCAGTACGTGTCGCTGCCAGCCCCGACGTGGACCGTC  3599

Query  118   --AACCCGGACAAGAACGTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACA  175
               ||| ||  |     || | | |  ||||| || ||||| ||||||  |||||||||||
Sbjct  3600  AAAACGCGCGC-----CGAGCAGTTCAACCCGCTTGCGTTCCTCGAGGGCCAGGGCTACA  3654

Query  176   AGACCACCGCAGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGT  235
             ||  ||| || || |||| ||  |||  |||||| ||||||||||||| ||| || |  |
Sbjct  3655  AGTGCACGGCGGATTTCACCGCGTACTACAAGTCGAAGGGCTACAAGAACCTGCGCGGTT  3714

Query  236   TCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCT  295
             ||||||||||||||||||| ||||||||||||      ||||  || |||||||||||||
Sbjct  3715  TCATGGACGACAAGAAGGCGTACAAGGTCGAC------GGCGGTAATTTTGAGTGCGGCT  3768

Query  296   ACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCGGGC---ACAATCCGCTCCACAG  352
               | |    |||| |||| ||  ||||||||||| ||||||    |  ||||||| || |
Sbjct  3769  GGAGCTCGCTCAAGGGCACGCCGCAGCCGATCCCGGCGGGCGGTGCTCTCCGCTCGACGG  3828

Query  353   GTTACACTCACGACGGTCCGTG  374
             | ||||| |||||||| |||||
Sbjct  3829  GCTACACGCACGACGGCCCGTG  3850

 Score = 166 bits (183),  Expect = 1e-38
 Identities = 297/426 (70%), Gaps = 16/426 (4%)
 Strand=Plus/Plus

Query  135   GTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGA-CTTCA  193
             |||||||   || ||  | || ||||||||  | |||   ||||| | || ||| | || 
Sbjct  5232  GTACTGGGCGCCGCTATCCTTCCTCGAGAAGAACGGCGTGAAGACGAGCG-AGAGCGTCG  5290

Query  194   ACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGG  253
             |||||| ||| |||  |||||||||||  || || || ||| ||||||||||||  ||| 
Sbjct  5291  ACGGCTTCATGAAGGACAAGGGCTACAGCACGCTGCGCGCGCTCATGGACGACAGCAAGC  5350

Query  254   CATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCA  313
               ||||||  | || ||   | || ||||||    |||||||||||  ||   |   |||
Sbjct  5351  TGTACAAGACCAACTCGAACGCCGACAACTTCCTCTGCGGCTACACGGACCCGA---GCA  5407

Query  314   AGCGCCAGCCG---ATCCCAGCGG---GCACAATCCGCTCCACAGGTTACACTCACGACG  367
             || ||  || |   |||||   ||   |||| || ||| | || || ||||| ||||  |
Sbjct  5408  AGGGCTCGCAGGTCATCCCCAAGGACAGCACCATGCGCACGACCGGCTACACGCACGTGG  5467

Query  368   GTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGG  427
             | ||||||||||||||| | ||| ||      |||||  | |||  ||||||  || || 
Sbjct  5468  GCCCGTGCGAGGTCTGGATCGACGACGAGCGTGTCATCGCCGGCGACAACTGTCACGAGC  5527

Query  428   ACTTCCCGGGAAAGACCCACTCGATCAGCTAC-GCGTCGTGCAAGGGGTCGTGCACGCTG  486
             |  || |    | |||| |   | |   |||| ||  | ||||||||   ||||||  ||
Sbjct  5528  AGGTCTCCAACACGACCAA---GGTGGACTACAGCAAC-TGCAAGGGCGAGTGCACCATG  5583

Query  487   CGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAG  546
             |||||||||||| | ||||| |||| ||||||||| ||||||||||||||||||||||||
Sbjct  5584  CGCTGGTACTGGCTCGGCCTGCGCTACCTCAAGAAGAAGTGGTCGTGGCAGGTGTACAAG  5643

Query  547   GAGTGC  552
              | |||
Sbjct  5644  AACTGC  5649

 Score = 146 bits (161),  Expect = 1e-32
 Identities = 146/190 (77%), Gaps = 6/190 (3%)
 Strand=Plus/Plus

Query  142   AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTAC  201
             ||||| |||||||| || ||||||||||||| ||||||||| || || ||| | | ||||
Sbjct  1114  AACCCGCTCGCGTTCCTGGAGAACCAGGGCTTCAAGACCACGGCGGATTTCGAAGCCTAC  1173

Query  202   ATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAG  261
               |     |||||||||||||||||| || |  |||||||||||| |||  || ||||||
Sbjct  1174  TACCGCGACAAGGGCTACAAGACCCTGCGCGACTTCATGGACGACCAGACCGCCTACAAG  1233

Query  262   GTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCCAG  321
             ||||||      ||||   |||||||||||||||  | ||   |||| |||| ||  |||
Sbjct  1234  GTCGAC------GGCGGTGACTTTGAGTGCGGCTGGAGCACGCTCAAGGGCACGCCGCAG  1287

Query  322   CCGATCCCAG  331
             ||||||||||
Sbjct  1288  CCGATCCCAG  1297

 Score = 97.8 bits (107),  Expect = 5e-18
 Identities = 157/222 (71%), Gaps = 13/222 (6%)
 Strand=Plus/Plus

Query  282    CTTTGAGTGCGGCTACACCAACATCAACGG-CAAGCGCCAGCCGATCCCAGCG---GGCA  337
              ||||||||||||||||||  ||  | |||  | ||   ||||| |||||  |    ||||
Sbjct  10981  CTTTGAGTGCGGCTACACGGACC-CGACGTACGAGTCGCAGCCTATCCCGACAAACGGCA  11039

Query  338    CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCA  397
                 | || | |||||| ||||   | ||||| ||||||||| ||||| | ||| ||  ||
Sbjct  11040  AGCTGCGTTTCACAGGCTACATGAAGGACGGGCCGTGCGAGATCTGGATCGACGACCTCA  11099

Query  398    AGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACC----CACTCGATC  453
              || |  | ||  |  | |||||||| |||||||||||||| | || |     ||||||  
Sbjct  11100  AGCTGCTCTCCAGTGCGAACTGCAAGAAGGACTTCCCGGGCACGAGCACAAAACTCGA--  11157

Query  454    AGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTAC  495
                |||| ||   ||||||||   |||||||||||||||||||
Sbjct  11158  --CTACTCGAGCTGCAAGGGCGAGTGCACGCTGCGCTGGTAC  11197

>PHSO:scaffold_35
Length=32414

 Score = 194 bits (214),  Expect = 3e-47
 Identities = 294/412 (71%), Gaps = 15/412 (4%)
 Strand=Plus/Minus

Query  142    AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTAC  201
              ||||| || || || ||||||||  |||| |  | ||||   |  ||||||| || ||  
Sbjct  18549  AACCCGCTGGCTTTCCTCGAGAATGAGGGATTTACGACCCAGGAGGACTTCACCGCCTGG  18490

Query  202    ATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGAC---GACAAGAAGGCATAC  258
                ||||   || ||||||||| | || ||||  |||||||||   | ||||      |||
Sbjct  18489  CGCAAGGAGAACGGCTACAAGTCGCTGCGTGATTTCATGGACAGGGCCAAG------TAC  18436

Query  259    AAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGC  318
               | ||| || | |||| |||| ||||    || |||| |||| ||  ||| ||||  |  
Sbjct  18435  GACGTC-AC-CAGCGG-CGCCGACTTCTCCTGTGGCTTCACCGACCCCAAGGGCACCCCT  18379

Query  319    CAGCCGATCCCAGCGGGCA-CAA--TCCGCTCCACAGGTTACACTCACGACGGTCCGTGC  375
              ||||| || || |  || | |||  | ||||| || || ||||| |||||||| ||||||
Sbjct  18378  CAGCCCATTCCGGAAGGTAACAAGATGCGCTCTACCGGCTACACCCACGACGGCCCGTGC  18319

Query  376    GAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCG  435
              ||||| ||||| ||| |||| | |||  ||   |||  ||||||| || || | ||||||
Sbjct  18318  GAGGTGTGGCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAGAAGTTCCCG  18259

Query  436    GGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTAC  495
              || |||  | || || |   |||| | |||||||||||  |||||||||| |||||||||
Sbjct  18258  GGCAAGGACTACACGGTGGACTACTCATCGTGCAAGGGCACGTGCACGCTTCGCTGGTAC  18199

Query  496    TGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGG  547
              ||| ||||  | || ||| | |||||  | |  |||||||||||||||||||
Sbjct  18198  TGGCTGGGAGTGCGTTTCTTGAAGAATGACTACTCGTGGCAGGTGTACAAGG  18147

>PHSO:scaffold_5
Length=6830280

 Score = 194 bits (214),  Expect = 3e-47
 Identities = 294/412 (71%), Gaps = 15/412 (4%)
 Strand=Plus/Minus

Query  142     AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTAC  201
               ||||| || || || ||||||||  |||| |  | ||||   |  ||||||| || ||  
Sbjct  682402  AACCCGCTGGCTTTCCTCGAGAATGAGGGATTTACGACCCAGGAGGACTTCACCGCCTGG  682343

Query  202     ATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGAC---GACAAGAAGGCATAC  258
                 ||||   || ||||||||| | || ||||  |||||||||   | ||||      |||
Sbjct  682342  CGCAAGGAGAACGGCTACAAGTCGCTGCGTGATTTCATGGACAGGGCCAAG------TAC  682289

Query  259     AAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGC  318
                | ||| || | |||| |||| ||||    || |||| |||| ||  ||| ||||  |  
Sbjct  682288  GACGTC-AC-CAGCGG-CGCCGACTTCTCCTGTGGCTTCACCGACCCCAAGGGCACCCCT  682232

Query  319     CAGCCGATCCCAGCGGGCA-CAA--TCCGCTCCACAGGTTACACTCACGACGGTCCGTGC  375
               ||||| || || |  || | |||  | ||||| || || ||||| |||||||| ||||||
Sbjct  682231  CAGCCCATTCCGGAAGGTAACAAGATGCGCTCTACCGGCTACACCCACGACGGCCCGTGC  682172

Query  376     GAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCG  435
               ||||| ||||| ||| |||| | |||  ||   |||  ||||||| || || | ||||||
Sbjct  682171  GAGGTGTGGCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAGAAGTTCCCG  682112

Query  436     GGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTAC  495
               || |||  | || || |   |||| | |||||||||||  |||||||||| |||||||||
Sbjct  682111  GGCAAGGACTACACGGTGGACTACTCATCGTGCAAGGGCACGTGCACGCTTCGCTGGTAC  682052

Query  496     TGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGG  547
               ||| ||||  | || ||| | |||||  | |  |||||||||||||||||||
Sbjct  682051  TGGCTGGGAGTGCGTTTCTTGAAGAATGACTACTCGTGGCAGGTGTACAAGG  682000

>PHCA:scaffold_84 PHYCAscaffold_84
Length=182275

 Score = 189 bits (209),  Expect = 1e-45
 Identities = 336/483 (70%), Gaps = 28/483 (6%)
 Strand=Plus/Minus

Query  76     GACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCAC------TAACCCGGACAAG  129
              ||||||||||||  |||  | || ||||| ||||| | |||      ||||  |||||  
Sbjct  94225  GACGCTCACCAGGTTGTCCTTCTGCCAGCACCGACCTACACGACGGATAACAAGGACACC  94166

Query  130    AACGTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGAC  189
              ||   ||||  |   || || || || || |||| ||| || | |||||||  ||  |||
Sbjct  94165  AA---GTACGCG---CCTCTTGCTTTCCTGGAGAGCCAAGGGTTCAAGACCGTCGAGGAC  94112

Query  190    TTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAG  249
              ||||| || |    |     ||| ||||||||||| || || || ||||||||||     
Sbjct  94111  TTCAATGGATGGCGCCGTAGCAACGGCTACAAGACTCTGCGCGCCTTCATGGACGGTGCC  94052

Query  250    AAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAAC  309
              |||   ||||  |||    | |  || ||  |||   | ||||||| ||| |||  ||| 
Sbjct  94051  AAG---TACACTGTCA---CAGACGGAGCTGACTACTATTGCGGCTTCACGAACGCCAA-  93999

Query  310    GGCAAGCGCC--AGCCGATCCCAGCGGGCACAATCCGCTCCACAGGTTACACTCACGACG  367
              |||| || ||  |||| || || |  |||||||| || || || || ||||| ||||| |
Sbjct  93998  GGCA-GCTCCGCAGCCCATTCCGGATGGCACAATGCGTTCGACCGGGTACACGCACGATG  93940

Query  368    GTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCAT---GTCGGGCACCAACTGCAACA  424
              ||||||||||||| ||||| |||  |||    ||| |   ||||| ||   ||||| || 
Sbjct  93939  GTCCGTGCGAGGTTTGGCTCGACTCCACGCGCGTCCTCCAGTCGGACA---ACTGCCACG  93883

Query  425    AGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGC  484
              ||   |||||||| |||||  ||    |   ||||   ||||||||||| ||||||| ||
Sbjct  93882  AGACGTTCCCGGGCAAGACGTACAACCTGGACTACAGCTCGTGCAAGGGCTCGTGCATGC  93823

Query  485    TGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACA  544
              |||| ||||||||| ||||    ||||||||||||||| ||   ||||||||||||||||
Sbjct  93822  TGCGTTGGTACTGGTTGGGAACGCGCTTCCTCAAGAACGAGCACTCGTGGCAGGTGTACA  93763

Query  545    AGG  547
              |||
Sbjct  93762  AGG  93760

 Score = 100 bits (110),  Expect = 4e-19
 Identities = 154/220 (70%), Gaps = 0/220 (0%)
 Strand=Plus/Plus

Query  338    CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCA  397
              |||| ||||| || || ||||| ||||||||||||||||| || ||||| ||| | || |
Sbjct  92997  CAATGCGCTCAACCGGGTACACGCACGACGGTCCGTGCGAAGTGTGGCTGGACGATACGA  93056

Query  398    AGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCT  457
               |||||||  |  |  ||||||  || |||   ||   || |||  | || | ||   ||
Sbjct  93057  TGGTCATGCAGTACGACAACTGTCACGAGGCTATCAGCGGCAAGGACTACACCATAGACT  93116

Query  458    ACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCA  517
              ||   || |||| |    | |||||| |   ||||| |||| | ||  | || | |||||
Sbjct  93117  ACAGTTCTTGCACGTCCACCTGCACGTTATACTGGTTCTGGCTCGGTGTCCGGTACCTCA  93176

Query  518    AGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCC  557
              ||||| |||  ||||||||| | |||||||  || |||||
Sbjct  93177  AGAACGAGTACTCGTGGCAGATCTACAAGGCCTGTGTGCC  93216

 Score = 77.9 bits (85),  Expect = 5e-12
 Identities = 232/351 (66%), Gaps = 18/351 (5%)
 Strand=Plus/Minus

Query  214    GGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCG  273
              ||||||| | |  | |||||  |  |||||||  ||  |   ||| |||| ||||  | |
Sbjct  95573  GGCTACACGTCATTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGT-GACG--GAG  95517

Query  274    GGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCG  333
              |  || | |||||||||||||  ||| |    |||   | ||   ||||| |||||  | 
Sbjct  95516  GAAGCTATCTTTGAGTGCGGCCTCACGAGTCCCAAGACCGAGACGCAGCCCATCCCGACC  95457

Query  334    GGCACAATCCGCTCCACA-----GGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTG  388
                 ||||  || |||| |     || ||||| |  ||||| ||||||||||||||||| |
Sbjct  95456  A--ACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGG  95399

Query  389    ACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCC---GGGAAAGACCC  445
              || |||| || ||     |||||  ||||||| |||  || |||||   |||  ||   |
Sbjct  95398  ACGACACTAAAGTGTCTGCGGGCCGCAACTGCCACACCGAATTCCCGCAGGGTCAG---C  95342

Query  446    ACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCC  505
              ||  | ||  ||||   ||||||   | ||| |||||| ||   ||||||||| | ||| 
Sbjct  95341  ACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCA  95282

Query  506    TTCGCTTCCTC-AAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTG  555
              |    | | || ||| | |  |  |||||||| ||||||||| | ||||||
Sbjct  95281  TCAAGTACGTCGAAGGA-ATCTACTCGTGGCAAGTGTACAAGAACTGCGTG  95232

>PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 
genomic scaffold, whole genome shotgun sequence
Length=2113949

 Score = 188 bits (208),  Expect = 1e-45
 Identities = 297/413 (72%), Gaps = 17/413 (4%)
 Strand=Plus/Plus

Query  142     AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAG-ACTTCAACGGCTA  200
               ||||| || || ||  | |||||||||||||  |||||  | |||| | ||||| | || 
Sbjct  696983  AACCCGCTGGCTTTCTTAGAGAACCAGGGCTTTAAGACG-CAGCAGGATTTCAAGGCCTG  697041

Query  201     -CATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCA--TA  257
                | | | |   || ||||||||  | |||||||  |||||||||    ||| | ||  ||
Sbjct  697042  GCGTGATGAA-AACGGCTACAAATCGCTTCGTGACTTCATGGAC----AGA-GCCAAGTA  697095

Query  258     CAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCG  317
               | | || ||| | |||| |||| ||||   |||||| |  ||  ||   || || | || 
Sbjct  697096  CGACGT-GAC-CAGCGG-CGCCGACTTCTCGTGCGGTTTTACGGACCCGAAGGGGACGCC  697152

Query  318     CCAGCCGATCCCAGCGGG---CACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTG  374
                ||||| || || |||||   | | || || || || |||||||| |||||||| |||||
Sbjct  697153  GCAGCCTATTCCGGCGGGTGGCGCCATGCGATCGACTGGTTACACGCACGACGGACCGTG  697212

Query  375     CGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCC  434
               ||| || ||||||||| |||  | |||  ||   |||  ||||||  || || | |||||
Sbjct  697213  CGAAGTGTGGCTTGACGACAAGATGGTGCTGGATGGCGACAACTGTCACGAGAAGTTCCC  697272

Query  435     GGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTA  494
                || |||  | || |  |   |||| |||| ||||||||  |||||||||||||||||||
Sbjct  697273  AGGCAAGGACTACACTGTGGACTACTCGTCATGCAAGGGCACGTGCACGCTGCGCTGGTA  697332

Query  495     CTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGG  547
               |||| ||||| | |||||| | ||||||  ||  |||||||||||||||||||
Sbjct  697333  CTGGCTGGGCGTGCGCTTCTTGAAGAACTCGTACTCGTGGCAGGTGTACAAGG  697385

 Score = 178 bits (196),  Expect = 2e-42
 Identities = 191/251 (76%), Gaps = 4/251 (2%)
 Strand=Plus/Plus

Query  319     CAGCCGATCCCAGCGGG---CACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGC  375
               ||||| || || |||||   | | || || || || |||||||| |||||||| ||||||
Sbjct  673447  CAGCCTATTCCGGCGGGTGACGCCATGCGATCGACTGGTTACACGCACGACGGACCGTGC  673506

Query  376     GAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCG  435
               ||||| ||||| ||| |||  | |||  ||   |||  ||||||  || || | ||||| 
Sbjct  673507  GAGGTGTGGCTCGACGACAAGATGGTGCTGGATGGCGACAACTGTCACGAGAAGTTCCCA  673566

Query  436     GGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTAC  495
               || |||  | || |  |   |||| |||| ||||||||  ||||||||||||||||||||
Sbjct  673567  GGCAAGGACTACACTGTGGACTACTCGTCATGCAAGGGCACGTGCACGCTGCGCTGGTAC  673626

Query  496     TGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTG  555
               ||| ||||| | |||||||| ||||||||||  |||||||||||||| ||||  ||| | 
Sbjct  673627  TGGCTGGGCATCCGCTTCCTGAAGAACAAGTACTCGTGGCAGGTGTATAAGGCCTGCAT-  673685

Query  556     CCAATTGGCAG  566
               ||  |||||||
Sbjct  673686  CCCCTTGGCAG  673696

>PHRA:scaffold_56
Length=334739

 Score = 184 bits (203),  Expect = 5e-44
 Identities = 295/419 (70%), Gaps = 15/419 (4%)
 Strand=Plus/Plus

Query  145     CCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTACATC  204
               || ||||| || || ||||||||||||| | |||||   |  ||||||||||  |    |
Sbjct  162607  CCGCTCGCCTTCCTGGAGAACCAGGGCTTCGAGACCGTGGGGGACTTCAACGCGTGGCGC  162666

Query  205     AAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAGGTC  264
                    ||| || |||||||| || || || ||||||||||     |||   ||||  |||
Sbjct  162667  CGCAGCAACGGGTACAAGACGCTCCGCGCCTTCATGGACGGTGCCAAG---TACACTGTC  162723

Query  265     GACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCCAGCCG  324
               |   |||  || ||| |||   | ||||||| ||| |||  | ||| || ||  ||| | 
Sbjct  162724  G---CGGACGGAGCCGACTACTACTGCGGCTTCACGAACGCCGACGCCACGCCACAGGCC  162780

Query  325     ATCCCAGCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTC  381
               || || |  || |   | || ||||| || || ||||| |||||||| ||||||||||||
Sbjct  162781  ATTCCGGACGGTAACGCTATGCGCTCGACGGGCTACACGCACGACGGCCCGTGCGAGGTC  162840

Query  382     TGGCTTGACAACACCAAGGTCATG-TCGGGCAC--CAACTGCAACAAGGACTTCCCGGGA  438
               ||||| |||| |||   |  | || ||   |||  ||||||| || ||| | ||   || 
Sbjct  162841  TGGCTCGACACCAC---GCGCGTGCTCACCCACGACAACTGCCACGAGGCCATCAGCGGC  162897

Query  439     AAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGG  498
               |||  | || | |||  ||||   ||||||| |||  | ||||| |||| ||||||||||
Sbjct  162898  AAGGACTACACCATCGACTACAGTTCGTGCACGGGTACCTGCACACTGCACTGGTACTGG  162957

Query  499     ATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCC  557
               |||||| | |||| ||||||||||  ||  || ||||||||||||||||  || |||||
Sbjct  162958  ATGGGCGTGCGCTACCTCAAGAACGCGTACTCCTGGCAGGTGTACAAGGCCTGTGTGCC  163016

 Score = 151 bits (167),  Expect = 3e-34
 Identities = 206/287 (72%), Gaps = 3/287 (1%)
 Strand=Plus/Minus

Query  274     GGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCG  333
               |||||| |||||   || || | |||| ||||||||||| |    ||| | || || |  
Sbjct  163892  GGCGCCGACTTTACCTGTGGGTTCACCGACATCAACGGCGACGTGCAGGCCATTCCGGAC  163833

Query  334     GGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGAC  390
               ||||   | || ||||| || || ||||| |||||||||||||||||||||||||| |||
Sbjct  163832  GGCAACGCCATGCGCTCGACGGGCTACACGCACGACGGTCCGTGCGAGGTCTGGCTGGAC  163773

Query  391     AACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCG  450
                |||||| |||||||  |      |||||| || ||| | ||   || |||  | |  | 
Sbjct  163772  GACACCATGGTCATGCAGTATGATAACTGCCACGAGGTCATCAGCGGCAAGGACTATACC  163713

Query  451     ATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGC  510
               |||  ||||   || |||| |    | ||||||||   ||||| |||||||||| | |||
Sbjct  163712  ATCGACTACAGTTCATGCACGTCCACCTGCACGCTTTACTGGTTCTGGATGGGCGTGCGC  163653

Query  511     TTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCC  557
               | |||||| |||   |  || |||||||||||||||| |||||| ||
Sbjct  163652  TACCTCAACAACGCCTACTCCTGGCAGGTGTACAAGGCGTGCGTCCC  163606

 Score = 81.5 bits (89),  Expect = 4e-13
 Identities = 143/204 (70%), Gaps = 6/204 (3%)
 Strand=Plus/Plus

Query  352     GGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGC  411
               || ||||| | |||||| ||||| ||||||||||| ||| |||||||||    | |||||
Sbjct  161225  GGCTACACGCTCGACGGCCCGTGTGAGGTCTGGCTGGACGACACCAAGGCGGCGGCGGGC  161284

Query  412     ACCAACTGCAACAAGGACTTCCCGGGAAAGACC--CACTCGATCAGCTA-CGCGTCGTGC  468
                 ||||||| |||  || |||||  | | | ||  |||  ||||  |||  ||| |||||
Sbjct  161285  CGCAACTGCCACACCGAGTTCCC--GCACGGCCAGCACCAGATCGACTATAGCG-CGTGC  161341

Query  469     AAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGG  528
                  |   |||||| ||| || ||||||||| | ||| |    | | || |   |  ||  
Sbjct  161342  GGAGCCGCGTGCATGCTCCGGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGCGCGTAC  161401

Query  529     TCGTGGCAGGTGTACAAGGAGTGC  552
               ||||||||||| |||||| | |||
Sbjct  161402  TCGTGGCAGGTCTACAAGAACTGC  161425

 Score = 47.3 bits (51),  Expect = 0.009
 Identities = 86/121 (71%), Gaps = 19/121 (16%)
 Strand=Plus/Minus

Query  1       ATGGCCCCTTCCGTCGTCAAGTCCCTCGCGCTC-GCCGCCATCGTG---TCCAGCGCCGC  56
               |||||||||||| ||||    | |||||| ||| || | |||||||   ||||| || ||
Sbjct  164150  ATGGCCCCTTCCTTCGT----TTCCTCGCTCTCGGCTGGCATCGTGCTCTCCAGTGCTGC  164095

Query  57      GCTCTGCGACTCGTCGGTTGACGCTCACCAGAGT-GTGATCCTACCAGCGCCGACGTTCA  115
               |||      |||| |    ||||| ||||| ||| ||| | || || || ||||||| ||
Sbjct  164094  GCT-----TCTCGCC----GACGCCCACCA-AGTCGTGCTGCTGCCTGCCCCGACGTACA  164045

Query  116     C  116
               |
Sbjct  164044  C  164044

>PHRA:scaffold_106
Length=147471

 Score = 178 bits (196),  Expect = 2e-42
 Identities = 333/483 (69%), Gaps = 15/483 (3%)
 Strand=Plus/Minus

Query  76     GACGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAACCCGGACAAGAACGTG  135
              ||||||||||||| |||| | || || |  ||    |  || | |   |||||| ||   
Sbjct  13413  GACGCTCACCAGATTGTGCTGCTGCCGGAACCCCAATGGACGACCGATGACAAGGACACC  13354

Query  136    TACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAAC  195
               | |  ||||| || || || ||||| ||| | |||| |  ||||   |  |||||||  
Sbjct  13353  AAGTACAACCCGCTGGCTTTCCTCGAAAACGAAGGCTTCGCGACCCAGGAGGACTTCACT  13294

Query  196    GGCTAC---ATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAG  252
              | ||     | | ||   || ||||||||| | || ||||  ||||||||| ||   |||
Sbjct  13293  GCCTGGCGTACCGAG---AACGGCTACAAGTCGCTGCGTGACTTCATGGACAACGCCAAG  13237

Query  253    GCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGC  312
                 ||||  || ||| |  ||| |||| ||||    |||||||  ||| ||  ||| || 
Sbjct  13236  ---TACAGTGT-GAC-CAACGG-CGCCGACTTCTCTTGCGGCTTTACCGACCCCAAGGGA  13183

Query  313    AAGCGCCAGCCGATCCCAGCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGT  369
              |  |  ||||| || || || | ||   | || || ||||| || ||||| |||||||||
Sbjct  13182  ACCCCGCAGCCCATTCCGGCCGACAACGCGATGCGTTCCACGGGATACACGCACGACGGT  13123

Query  370    CCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGAC  429
              ||||||||||| ||||| ||| |||| | |||  |    |||   |||||| || || | 
Sbjct  13122  CCGTGCGAGGTGTGGCTCGACGACACGATGGTGCTCGACGGCGAGAACTGCCACGAGAAG  13063

Query  430    TTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGC  489
              ||||| || |||  | || |  ||  |||| |||| ||||||||  |||||||||| || 
Sbjct  13062  TTCCCTGGCAAGGACTACACCGTCGACTACTCGTCCTGCAAGGGCACGTGCACGCTTCGT  13003

Query  490    TGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAG  549
              ||||||||||||||  | || ||||| ||| | |  |  |||||||| ||||||||||||
Sbjct  13002  TGGTACTGGATGGGTGTCCGATTCCTGAAGGAAACCTACTCGTGGCAAGTGTACAAGGAG  12943

Query  550    TGC  552
              |||
Sbjct  12942  TGC  12940

>PHIF:NW_003303626.1 Phytophthora infestans T30-4 supercont1.133 
genomic scaffold, whole genome shotgun sequence
Length=313873

 Score = 178 bits (196),  Expect = 2e-42
 Identities = 191/251 (76%), Gaps = 4/251 (2%)
 Strand=Plus/Plus

Query  319     CAGCCGATCCCAGCGGG---CACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGC  375
               ||||| || || |||||   | | || || || || |||||||| |||||||| ||||||
Sbjct  267298  CAGCCTATTCCGGCGGGTGACGCCATGCGATCGACTGGTTACACGCACGACGGACCGTGC  267357

Query  376     GAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCG  435
               ||||| ||||| ||| |||  | |||  ||   |||  ||||||  || || | ||||| 
Sbjct  267358  GAGGTGTGGCTCGACGACAAGATGGTGCTGGATGGCGACAACTGTCACGAGAAGTTCCCA  267417

Query  436     GGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTAC  495
               || |||  | || |  |   |||| |||| ||||||||  ||||||||||||||||||||
Sbjct  267418  GGCAAGGACTACACTGTGGACTACTCGTCATGCAAGGGCACGTGCACGCTGCGCTGGTAC  267477

Query  496     TGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTG  555
               ||| ||||| | |||||||| ||||||||||  |||||||||||||| ||||  ||| | 
Sbjct  267478  TGGCTGGGCATCCGCTTCCTGAAGAACAAGTACTCGTGGCAGGTGTATAAGGCCTGCAT-  267536

Query  556     CCAATTGGCAG  566
               ||  |||||||
Sbjct  267537  CCCCTTGGCAG  267547

>PHRA:scaffold_79
Length=220511

 Score = 169 bits (187),  Expect = 1e-39
 Identities = 290/417 (70%), Gaps = 18/417 (4%)
 Strand=Plus/Minus

Query  142    AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTAC  201
              ||||| || || || ||||||   || ||||    |||    | |||||||||||    |
Sbjct  26087  AACCCGCTGGCCTTCCTCGAGGGTCAAGGCTTTGCGACTCAAGGAGACTTCAACG----C  26032

Query  202    ATCAAGTC----CAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCA--  255
              ||   |||    ||| |||||||||||||| ||||  |||||||||    ||| | ||  
Sbjct  26031  ATGGCGTCGTGACAACGGCTACAAGACCCTGCGTGACTTCATGGAC----AGA-GCCAAG  25977

Query  256    TACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAG  315
              |||| |||   ||  |  | || | ||||    ||||| |  ||  ||   |||||||  
Sbjct  25976  TACACGGTGACCGAAGGTGCCGACTACTTC---TGCGGGTGGACAGACCCAAACGGCACA  25920

Query  316    CGCCAGCCGATCCCAGCGGGCACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGC  375
              | |||||| || ||||| || |  || || || || || ||||| |||||||| ||||| 
Sbjct  25919  CCCCAGCCTATTCCAGCCGGTAATATGCGTTCAACCGGATACACGCACGACGGGCCGTGT  25860

Query  376    GAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCG  435
              ||||||||||| ||||| |||   ||  |   ||||  ||||||  || || | || || 
Sbjct  25859  GAGGTCTGGCTAGACAATACCCGTGTGCTCCAGGGCGACAACTGTCACGAGCAGTTTCCC  25800

Query  436    GGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTAC  495
              |  |||  | || | ||   |||  |||| ||||| ||  | || ||  ||| |||||||
Sbjct  25799  GACAAGGACTACCCCATTGACTATTCGTCCTGCAAAGGCACCTGTACATTGCACTGGTAC  25740

Query  496    TGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGC  552
              ||||| ||  |||||||||||||||||  ||  ||||||||||||||||||||||||
Sbjct  25739  TGGATCGGAGTTCGCTTCCTCAAGAACTCGTACTCGTGGCAGGTGTACAAGGAGTGC  25683

>PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.22, whole genome shotgun 
sequence
Length=998868

 Score = 168 bits (185),  Expect = 4e-39
 Identities = 294/416 (71%), Gaps = 13/416 (3%)
 Strand=Plus/Plus

Query  142     AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTA-  200
               |||||  | || || || ||||||||||||| ||||||    |  ||||||||   ||  
Sbjct  685435  AACCCGTTGGCATTCCTTGAGAACCAGGGCTTCAAGACGCAGGAGGACTTCAAGTCCTGG  685494

Query  201     CATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAA  260
               | | | |   || ||||||||| | ||||| |  || |||||| | |  || |  ||| |
Sbjct  685495  CGTGACGAG-AACGGCTACAAGTCGCTTCGCGACTTTATGGAC-AGAGCAAAG--TACGA  685550

Query  261     GGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCCA  320
                || ||| | |||| |||  ||||    ||||| |  ||  ||  ||| ||||  |  ||
Sbjct  685551  AGT-GAC-CAGCGG-CGCTGACTTCTCCTGCGGTTTTACGGACCCCAAGGGCACCCCGCA  685607

Query  321     GCCGATCCCAGCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGA  377
               ||| || || |||||||   | || || ||||| || ||||| ||||| || ||||| ||
Sbjct  685608  GCCCATTCCGGCGGGCAACGCCATGCGTTCCACCGGATACACGCACGATGGCCCGTGTGA  685667

Query  378     GGTCTGGCTTGACAACACCAAGGT-CATGTCGGGCACCAACTGCAACAAGGACTTCCCGG  436
                || ||||| ||| | || | ||| | || |||  || |||||  || || | ||||| |
Sbjct  685668  AGTGTGGCTCGACGATACTATGGTGCTTGACGGCGAC-AACTGTCACGAGAAGTTCCCTG  685726

Query  437     GAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACT  496
               | |||  | || |  |   |||| ||||||||||||| ||||| ||||| ||||||||||
Sbjct  685727  GCAAGGACTACACTGTGGACTACTCGTCGTGCAAGGGCTCGTGTACGCTTCGCTGGTACT  685786

Query  497     GGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGC  552
               || ||||  | || ||| | ||||||  ||  ||||||||||||||||||| ||||
Sbjct  685787  GGCTGGGTGTGCGTTTCTTGAAGAACTCGTACTCGTGGCAGGTGTACAAGGCGTGC  685842

 Score = 157 bits (173),  Expect = 7e-36
 Identities = 241/336 (72%), Gaps = 11/336 (3%)
 Strand=Plus/Minus

Query  216     CTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGG  275
               ||||||  | |||||||  ||||||||  ||   |||   ||| | || ||| | |||| 
Sbjct  686981  CTACAAATCTCTTCGTGACTTCATGGATAACGCAAAG---TACGAAGT-GAC-CAGCGGT  686927

Query  276     CGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCGGG  335
                ||| ||||    ||||| |  ||  ||  ||| ||||  |  ||||| || || || ||
Sbjct  686926  -GCCGACTTCTCCTGCGGTTTTACGGACCCCAAGGGCACCCCGCAGCCCATTCCGGCAGG  686868

Query  336     CA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAA  392
                |   | || || ||||| || ||||| |||||||| ||||| || || ||||| ||| |
Sbjct  686867  TAACGCCATGCGTTCCACCGGATACACGCACGACGGCCCGTGTGAAGTGTGGCTCGACGA  686808

Query  393     CACCAAGGT-CATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCGA  451
                || | ||| | ||  ||  |  |||||  || || | ||||| || |||  | || |  
Sbjct  686807  TACTATGGTGCTTGATGGTGAA-AACTGTCACGAGAAGTTCCCTGGCAAGGACTACACTG  686749

Query  452     TCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCT  511
               |   |||| |||||||||||||  |||||||||| || ||||||||| ||||  ||||||
Sbjct  686748  TGGACTACTCGTCGTGCAAGGGCACGTGCACGCTCCGTTGGTACTGGCTGGGTATTCGCT  686689

Query  512     TCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGG  547
               ||||||||||| |||  |||||||||||||||||||
Sbjct  686688  TCCTCAAGAACCAGTACTCGTGGCAGGTGTACAAGG  686653

 Score = 152 bits (168),  Expect = 8e-35
 Identities = 289/421 (69%), Gaps = 11/421 (3%)
 Strand=Plus/Minus

Query  142     AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTAC  201
               ||||| ||||| || ||||| ||| | |||| || ||||   |  ||||| |  | ||  
Sbjct  682816  AACCCGCTCGCTTTCCTCGAAAACGAAGGCTTCACGACCCAGGAGGACTTTACAGCCTGG  682757

Query  202     ATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAG  261
                 |||    || ||||||||| | |||||||  ||| ||||| ||   ||   ||||  |
Sbjct  682756  CGCAAAGAGAATGGCTACAAGTCGCTTCGTGACTTCTTGGACAACGCCAA---ATACCCG  682700

Query  262     GTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCCAG  321
               |||    | |  || ||  ||||  | ||||| |  ||  ||  ||| ||||  |  |||
Sbjct  682699  GTCA---CAGATGGTGCTGACTTCAAATGCGGTTTTACGGACCCCAAGGGCACCCCGCAG  682643

Query  322     CCGATCCCAGCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAG  378
               || || || |||||||   | || || ||||| || ||||| ||||| || ||||| || 
Sbjct  682642  CCCATTCCGGCGGGCAACGCCATGCGTTCCACCGGATACACGCACGATGGCCCGTGTGAA  682583

Query  379     GTCTGGCTTGACAACACCAAGGT-CATGTCGGGCACCAACTGCAACAAGGACTTCCCGGG  437
               || ||||| ||| | || | ||| | || |||  || |||||  || || | ||||| ||
Sbjct  682582  GTGTGGCTCGACGATACTATGGTGCTTGACGGCGAC-AACTGTCACGAGAAGTTCCCTGG  682524

Query  438     AAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTG  497
                |||  | || |  |   |||| |||||||||||||  ||||||||||   |||||||||
Sbjct  682523  CAAGGACTACACTGTGGACTACTCGTCGTGCAAGGGCACGTGCACGCTTTACTGGTACTG  682464

Query  498     GATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCC  557
               | | ||  | || ||||| |||||| | |  |||||||| || |||||||  ||| | ||
Sbjct  682463  GCTAGGTGTGCGTTTCCTGAAGAACGACTACTCGTGGCAAGTATACAAGGCCTGCATTCC  682404

Query  558     A  558
               |
Sbjct  682403  A  682403

 Score = 123 bits (136),  Expect = 4e-26
 Identities = 155/213 (73%), Gaps = 0/213 (0%)
 Strand=Plus/Plus

Query  340     ATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAG  399
               || || ||||| || ||||||||||||||||| ||||| || |  |||||  | |||  |
Sbjct  714439  ATGCGTTCCACCGGGTACACTCACGACGGTCCATGCGAAGTGTACCTTGATGATACCTTG  714498

Query  400     GTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTAC  459
               ||  |    |||  ||| ||| |  || | ||||| || |||  |  | | |||  ||||
Sbjct  714499  GTGCTCCAAGGCGACAATTGCCATGAGAAATTCCCCGGCAAGGACTGCCCCATCGACTAC  714558

Query  460     GCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAG  519
                | |||||||| ||  | ||||| || || ||||||||| ||||| | |||||||| |||
Sbjct  714559  TCATCGTGCAAAGGAACATGCACACTTCGATGGTACTGGTTGGGCATCCGCTTCCTGAAG  714618

Query  520     AACAAGTGGTCGTGGCAGGTGTACAAGGAGTGC  552
               ||   ||  || ||||||||||||||||| |||
Sbjct  714619  AATGCGTACTCATGGCAGGTGTACAAGGAATGC  714651

>PHKE:scaffold_622 scf_22126_622.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_622.1:1:14582:1 
REF
Length=14582

 Score = 155 bits (171),  Expect = 2e-35
 Identities = 243/343 (71%), Gaps = 15/343 (4%)
 Strand=Plus/Minus

Query  211   AAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAGGTCGACGCG  270
             || ||||||||| | || || |  ||||||||| ||   |||   |||  ||| |||  |
Sbjct  3821  AATGGCTACAAGTCGCTGCGCGACTTCATGGACAACGCCAAG---TACTCGGT-GACCAG  3766

Query  271   GCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCCAGCCGATCCCA  330
                || ||  ||| ||  ||||| |  ||| ||  ||| ||||  |  ||||| || || 
Sbjct  3765  T--GGTGCTGACTCTGCTTGCGGTTTTACCGACCCCAATGGCACACCGCAGCCCATTCCG  3708

Query  331   GCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTT  387
             | |||||   | || |||||||| || ||||| |||||||| ||||||||||||||| | 
Sbjct  3707  GAGGGCAACGCCATGCGCTCCACGGGATACACGCACGACGGACCGTGCGAGGTCTGGATC  3648

Query  388   GACAACACCAAGGTCATGTCGGGCAC---CAACTGCAACAAGGACTTCCCGGGAAAGACC  444
             ||| | |||   |  |||   ||||    ||||||| || |||  ||||| || |||  |
Sbjct  3647  GACGATACCCTTGCGATG---GGCAATGACAACTGCCACGAGGCGTTCCCCGGCAAGGAC  3591

Query  445   CACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGC  504
              || | |||  |||| || | ||||||||  ||||||| || || ||||||||| |||||
Sbjct  3590  TACACCATCGACTACTCGGCCTGCAAGGGCACGTGCACACTCCGTTGGTACTGGCTGGGC  3531

Query  505   CTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGG  547
              | || |||||||||||    |  ||||||||||| |||||||
Sbjct  3530  GTGCGTTTCCTCAAGAATTCCTACTCGTGGCAGGTATACAAGG  3488

 Score = 96.9 bits (106),  Expect = 5e-18
 Identities = 92/118 (78%), Gaps = 0/118 (0%)
 Strand=Plus/Plus

Query  430  TTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGC  489
            ||||| || |||  | || | |||  |||| || | ||||||||  ||||||| || |||
Sbjct  4    TTCCCCGGCAAGGACTACACCATCGACTACTCGGCCTGCAAGGGCACGTGCACACTCCGC  63

Query  490  TGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGG  547
            ||||||||| ||||| | || |||||||||||    |  |||||||||||||||||||
Sbjct  64   TGGTACTGGCTGGGCGTGCGTTTCCTCAAGAATGCCTACTCGTGGCAGGTGTACAAGG  121

>PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.63, whole genome shotgun 
sequence
Length=342508

 Score = 151 bits (167),  Expect = 3e-34
 Identities = 326/481 (68%), Gaps = 30/481 (6%)
 Strand=Plus/Minus

Query  79      GCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCAC------TAACCCGGACAAGAAC  132
               || |||||   |||| |||| ||||| ||||| | |||      ||||  |||||  || 
Sbjct  243501  GCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACTGATAACAAGGACACTAA-  243443

Query  133     GTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTC  192
                 ||| || |  ||| | || || || ||||||||||| ||| |||||  ||  || |||
Sbjct  243442  --GTA-TGCA--CCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTC  243388

Query  193     AACGGCT---ACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAG  249
               ||||| |    |  |||   ||| || ||||||||||| ||||  |||||||||  |   
Sbjct  243387  AACGGGTGGCGCCGCAA---CAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCC  243331

Query  250     AAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAAC  309
               |||   ||||    || | | |  || ||  |||   | ||||| | ||| ||| |||||
Sbjct  243330  AAG---TACA---CCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAAC  243277

Query  310     GGCAAGCGCCAGCCGATCCCAGCGGGCACAATCCGCTCCACAGGTTACACTCACGACGGT  369
               | |   |  ||||| || || |  || ||||| |||||||| |||||||| ||||| |||
Sbjct  243276  GCCGCACCTCAGCCCATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGT  243217

Query  370     CCGTGCGAGGTCTGGCTTGACAACA---CCAAGGTCATGTCGGGCACCAACTGCAACAAG  426
               ||||| ||||| ||||| |||| ||    |  | ||  |||||    ||||||| || ||
Sbjct  243216  CCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGG---ACAACTGCCACGAG  243160

Query  427     GACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTG  486
                 | ||   || |||||  ||    |   ||||   |||||||  ||  | ||||| || 
Sbjct  243159  ACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTT  243100

Query  487     CGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAG  546
               || ||||||||| ||||| | |||| |||||||||    |  ||||||||| | ||||||
Sbjct  243099  CGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAG  243040

Query  547     G  547
               |
Sbjct  243039  G  243039

 Score = 106 bits (117),  Expect = 1e-20
 Identities = 181/262 (69%), Gaps = 3/262 (1%)
 Strand=Plus/Plus

Query  289     TGCGGCTACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCGGGCA---CAATCCGC  345
               || |||| |||||||||||| ||  |    ||||| || || |  ||||   | || || 
Sbjct  242194  TGTGGCTTCACCAACATCAATGGAGACGTTCAGCCCATTCCGGATGGCAACGCTATGCGT  242253

Query  346     TCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATG  405
               || || || ||||| |||||||| ||||| ||||| ||||| ||| |||||| |||||||
Sbjct  242254  TCGACTGGGTACACGCACGACGGCCCGTGTGAGGTGTGGCTGGACGACACCATGGTCATG  242313

Query  406     TCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCG  465
                 |  |  ||||||| |  | | | ||   || ||   | || |||||  |||    |||
Sbjct  242314  CAGTACGACAACTGCCATGAAGCCATCAGTGGCAAATACTACACGATCGACTATAGCTCG  242373

Query  466     TGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAG  525
               |||| |    | ||||| ||    |||| |||| ||||  | |||| ||| |||||| | 
Sbjct  242374  TGCACGTCCACCTGCACACTCTATTGGTTCTGGCTGGGTGTCCGCTACCTGAAGAACGAA  242433

Query  526     TGGTCGTGGCAGGTGTACAAGG  547
               |  ||||||||| | |||||||
Sbjct  242434  TACTCGTGGCAGATTTACAAGG  242455

 Score = 61.7 bits (67),  Expect = 4e-07
 Identities = 56/71 (79%), Gaps = 0/71 (0%)
 Strand=Plus/Minus

Query  364     GACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAAC  423
               || || ||||||||||||||||| ||| |||| |||||    ||||||  ||||||| ||
Sbjct  244903  GATGGCCCGTGCGAGGTCTGGCTGGACGACACGAAGGTGTCCTCGGGCCGCAACTGCCAC  244844

Query  424     AAGGACTTCCC  434
               |  || |||||
Sbjct  244843  ACCGAATTCCC  244833

>PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_98.1_contig_1:1:103693:1 
REF
Length=103693

 Score = 146 bits (161),  Expect = 1e-32
 Identities = 198/273 (73%), Gaps = 5/273 (2%)
 Strand=Plus/Plus

Query  289    TGCGGCTACACCAACATCAACGGCA-AGCGCCAGCCGATCCCAGCGGGCA---CAATCCG  344
              ||||||| |||  ||||||| |||  ||| |||||| |||||||  | ||   | || ||
Sbjct  57700  TGCGGCTTCACGGACATCAATGGCGCAGC-CCAGCCCATCCCAGACGACAATGCCATGCG  57758

Query  345    CTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCAT  404
               || || |||||||| || |||||||| |||||||| ||||| ||| | || | ||||||
Sbjct  57759  TTCGACGGGTTACACGCATGACGGTCCCTGCGAGGTGTGGCTGGACGATACGATGGTCAT  57818

Query  405    GTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTC  464
              |  |  || ||| ||| || |   | ||   || |||  | || | ||   ||||   ||
Sbjct  57819  GCAGTACAACAATTGCCACGACTCCATCAGTGGCAAGGACTACACTATTGACTACAGCTC  57878

Query  465    GTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAA  524
              ||| | |    | || |||||   ||||| |||||||||| | ||||  ||||||||| |
Sbjct  57879  GTGTACGTCTACTTGTACGCTCTACTGGTTCTGGATGGGCGTCCGCTATCTCAAGAACGA  57938

Query  525    GTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCC  557
              ||  ||||||||||||||||||| |||||||||
Sbjct  57939  GTACTCGTGGCAGGTGTACAAGGCGTGCGTGCC  57971

 Score = 142 bits (157),  Expect = 1e-31
 Identities = 290/420 (69%), Gaps = 17/420 (4%)
 Strand=Plus/Minus

Query  145    CCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTA-CAT  203
              || || || || || ||||||||||||| | | ||    |  ||||||||||  |  | |
Sbjct  59117  CCTCTAGCCTTCCTGGAGAACCAGGGCTTCGAAACGGTGGATGACTTCAACGCTTGGCGT  59058

Query  204    CA-AGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAGG  262
              |  | |  || |||||||| ||  | ||||| |||||||||| |   |||   ||||  |
Sbjct  59057  CGTAAT--AACGGCTACAAAACTTTGCGTGCCTTCATGGACGGCGCAAAG---TACACCG  59003

Query  263    TCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACG--GCAAGCGCCA  320
              | ||||  |  || ||| ||| | | ||||| | ||||||     |||  ||   | | |
Sbjct  59002  T-GACG--GATGGAGCCGACTATCACTGCGGATTCACCAATGCTGACGCTGCTC-CTCAA  58947

Query  321    GCCGATCCCAGCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGA  377
              ||| || ||| | ||||   | || ||||| || || ||||| ||||| |||||||||||
Sbjct  58946  GCC-ATTCCATCCGGCAACGCCATGCGCTCGACGGGCTACACACACGATGGTCCGTGCGA  58888

Query  378    GGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGG  437
              ||||||||| ||||  ||    ||  |  |   |  ||||||| || | |   ||   ||
Sbjct  58887  GGTCTGGCTGGACACGACGCGCGTACTTACACACGACAACTGCCACGAAGCAATCAGTGG  58828

Query  438    AAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTG  497
               |||  | || | ||   |||    ||||||| |||  | ||||| ||||||||||||||
Sbjct  58827  CAAGGACTACACCATTGACTATAGTTCGTGCACGGGCACATGCACCCTGCGCTGGTACTG  58768

Query  498    GATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCC  557
              | ||||| | || || ||||||||| |||  ||||||||||||||||||| |||||| ||
Sbjct  58767  GTTGGGCGTCCGTTTTCTCAAGAACGAGTACTCGTGGCAGGTGTACAAGGCGTGCGTCCC  58708

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 104/151 (69%), Gaps = 4/151 (3%)
 Strand=Plus/Minus

Query  350    CAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGG  409
              ||||||||||    ||||| ||||| ||||||||||| ||| |||  || ||   | | |
Sbjct  60641  CAGGTTACACAATGGACGGACCGTGTGAGGTCTGGCTAGACGACAAGAAAGTGGCGGCTG  60582

Query  410    GCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTC--GTG  467
              |   ||| ||| ||| ||| |||||      ||  |||||||||  ||||   ||  |||
Sbjct  60581  GACGCAATTGCCACACGGAATTCCCTCATGGGATGCACTCGATCGACTACAGCTCCTGTG  60522

Query  468    CAAGGGGTCGTGCACGCTGCGCTGGTACTGG  498
               ||    ||||||||| || | ||||| |||
Sbjct  60521  GAA--ACTCGTGCACGTTGTGGTGGTATTGG  60493

>PYAR:scaffold_3459 par_scaffold_3459 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_3459:1:3265:1 
REF
Length=3265

 Score = 141 bits (155),  Expect = 5e-31
 Identities = 280/407 (69%), Gaps = 26/407 (6%)
 Strand=Plus/Plus

Query  157   CTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTACATCAAGTCCAAGGGC  216
             |||||||| ||||||||||||||||| || ||||| ||||  ||| | ||| ||||   |
Sbjct  2152  CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  2211

Query  217   TACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGGC  276
             ||||||||||| || | |||||||||| |   |   || ||||||  | |  | || |||
Sbjct  2212  TACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAA--CAGC-GGC  2268

Query  277   GCCAACTTTGAGTGCGGCTACACCAACATCAACG-GCAAGCGCCAGCCGATCCC---AGC  332
             || | ||| || ||||||| |||  ||   || | ||  ||| |||||||| ||    | 
Sbjct  2269  GCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCG-CAGCCGATTCCGAAGGA  2327

Query  333   GGGCACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAA  392
              ||| |  ||||| |  |||| ||||| || || || || |||||| ||||| ||||| |
Sbjct  2328  CGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGA  2387

Query  393   CACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACC-----CAC  447
             |  || ||||| |   |||  ||| ||| ||   ||| |  |||   |||||     |||
Sbjct  2388  CGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGG---AGACCGCGTTCAC  2444

Query  448   T----CGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGG  503
             |     |||   |||| || ||||||||||  |||||| |||    ||||||||| ||||
Sbjct  2445  TGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGG  2504

Query  504   CCTTCGCTTCCTCAAGAACAAG---TGGTCGTGGCAGGTGTACAAGG  547
             | | ||   ||  | |  ||||   |  ||||||||| | |||||||
Sbjct  2505  CATCCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGG  2548

>PYAP:scaffold_182 pag1_scaffold_182 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_182:1:48098:1 
REF
Length=48098

 Score = 136 bits (150),  Expect = 6e-30
 Identities = 273/397 (69%), Gaps = 26/397 (7%)
 Strand=Plus/Plus

Query  184   GCAGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGAC  243
             |||||| |||   ||||| ||||   ||||||   |||||| || ||    |||||||||
Sbjct  1552  GCAGACCTCACTAGCTACTTCAACAGCAAGGGTATCAAGACGCTGCGCCACTTCATGGAC  1611

Query  244   GACAAGAAGGCA--TACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCA  301
             ||||  ||| ||  |||||||| || || || || ||||  |||||||| ||  ||||| 
Sbjct  1612  GACA--AAGCCAACTACAAGGTGGAAGCCGCAGGTGCCACGTTTGAGTGTGGTAACACCG  1669

Query  302   ACATCAACGGCAAGCGCCAGCCGATCCC--AG-CGGGCACAATCCGCTCCACAGGTTACA  358
             ||   ||||||   || ||||| |||||  ||   || |  || || || || || | ||
Sbjct  1670  ACCCGAACGGCCCCCGTCAGCCCATCCCGAAGAATGGTATGATGCGTTCGACGGGCTTCA  1729

Query  359   CTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACAC-------CAAGG--TCATGTCGG  409
             | |||||||| || || ||||||||| | ||||||||       |  ||   || || ||
Sbjct  1730  CGCACGACGG-CCATGTGAGGTCTGGATCGACAACACGCGTGTGCTTGGCTCCAAGTTGG  1788

Query  410   GCACCAACTGCAACAAGGACTTC---CCGGGAAAGACC---CACTCGATCAGCTACGCGT  463
             |   ||||||| |||||  | ||   | ||| | || |    ||  ||||  || | |  
Sbjct  1789  G---CAACTGCCACAAGAGCATCGGGCAGGGCATGATCAGTTACAAGATCGACTTCTCCA  1845

Query  464   CGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACA  523
              ||| |||||    |||| | | |||||||||||| | ||| | ||| | |||   || |
Sbjct  1846  AGTGTAAGGGCGACTGCATGATCCGCTGGTACTGGCTCGGCATGCGCCTACTCGGCAAGA  1905

Query  524   AGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCCAAT  560
             |||||||||||||||||||||||| |||  | |||||
Sbjct  1906  AGTGGTCGTGGCAGGTGTACAAGGCGTGTATCCCAAT  1942

>PHSO:scaffold_4
Length=7609242

 Score = 131 bits (144),  Expect = 3e-28
 Identities = 253/365 (69%), Gaps = 19/365 (5%)
 Strand=Plus/Plus

Query  142      AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCA-GACTTC----AACG  196
                ||||| || || || || |||||||| || | |  |||| | ||| |||||     |  |
Sbjct  4365007  AACCCGCTGGCCTTCCTTGAGAACCAAGGGTTCGCGACC-CAGCAAGACTTTCGGGAGTG  4365065

Query  197      GCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCAT  256
                ||  || ||||   || |||||||||||||| || |  ||||||||| |    |||   |
Sbjct  4365066  GCG-CACCAAG---AACGGCTACAAGACCCTGCGCGACTTCATGGACCATGGCAAG---T  4365118

Query  257      ACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGC  316
                ||| ||| |||   |  |||||| ||||    ||||| |  ||| ||  ||| ||||  |
Sbjct  4365119  ACACGGT-GACCAAG--GGCGCCGACTTCTCTTGCGGTTGGACCGACCCCAAGGGCACCC  4365175

Query  317      GCCAGCCGATCCCAGCGGG---CACAATCCGCTCCACAGGTTACACTCACGACGGTCCGT  373
                  ||||| || || |  ||   | | || |||||||| || ||||| ||||| |||||||
Sbjct  4365176  CGCAGCCCATTCCGGACGGAGACGCCATGCGCTCCACGGGCTACACCCACGATGGTCCGT  4365235

Query  374      GCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCC  433
                ||||||||||| | ||||||||    ||  ||  ||||  ||||||| || || |  || 
Sbjct  4365236  GCGAGGTCTGGATCGACAACACGCGCGTGCTGCAGGGCGACAACTGCCACGAGAAGATCG  4365295

Query  434      CGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGT  493
                | |  |||  | || |||||  |||| || | || |||||  |||||||||| || ||||
Sbjct  4365296  CCGACAAGGGCTACACGATCGACTACTCGGCTTGTAAGGGCACGTGCACGCTCCGTTGGT  4365355

Query  494      ACTGG  498
                |||||
Sbjct  4365356  ACTGG  4365360

 Score = 131 bits (144),  Expect = 3e-28
 Identities = 253/365 (69%), Gaps = 19/365 (5%)
 Strand=Plus/Minus

Query  142      AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCA-GACTTC----AACG  196
                ||||| || || || || |||||||| || | |  |||| | ||| |||||     |  |
Sbjct  4374286  AACCCGCTGGCCTTCCTTGAGAACCAAGGGTTCGCGACC-CAGCAAGACTTTCGGGAGTG  4374228

Query  197      GCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCAT  256
                ||  || ||||   || |||||||||||||| || |  ||||||||| |    |||   |
Sbjct  4374227  GCG-CACCAAG---AACGGCTACAAGACCCTGCGCGACTTCATGGACCATGGCAAG---T  4374175

Query  257      ACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGC  316
                ||| ||| |||   |  |||||| ||||    ||||| |  ||| ||  ||| ||||  |
Sbjct  4374174  ACACGGT-GACCAAG--GGCGCCGACTTCTCTTGCGGTTGGACCGACCCCAAGGGCACCC  4374118

Query  317      GCCAGCCGATCCCAGCGGG---CACAATCCGCTCCACAGGTTACACTCACGACGGTCCGT  373
                  ||||| || || |  ||   | | || |||||||| || ||||| ||||| |||||||
Sbjct  4374117  CGCAGCCCATTCCGGACGGAGACGCCATGCGCTCCACGGGCTACACCCACGATGGTCCGT  4374058

Query  374      GCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCC  433
                ||||||||||| | ||||||||    ||  ||  ||||  ||||||| || || |  || 
Sbjct  4374057  GCGAGGTCTGGATCGACAACACGCGCGTGCTGCAGGGCGACAACTGCCACGAGAAGATCG  4373998

Query  434      CGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGT  493
                | |  |||  | || |||||  |||| || | || |||||  |||||||||| || ||||
Sbjct  4373997  CCGACAAGGGCTACACGATCGACTACTCGGCTTGTAAGGGCACGTGCACGCTCCGTTGGT  4373938

Query  494      ACTGG  498
                |||||
Sbjct  4373937  ACTGG  4373933

>PHKE:scaffold_761 scf_22126_761.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_761.1_contig_1:1:9298:1 
REF
Length=9298

 Score = 130 bits (143),  Expect = 9e-28
 Identities = 290/426 (68%), Gaps = 21/426 (5%)
 Strand=Plus/Minus

Query  142  AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTA-  200
            ||||| || || || || |||||||| |||| |   |||   | |||   ||||| ||  
Sbjct  804  AACCCGCTGGCATTCCTGGAGAACCAAGGCTTCGCAACCCAGGAAGATGCCAACGCCTGG  745

Query  201  CATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGAC---GACAAGAAGGCATA  257
            | ||  |   || || |||||||| || ||||| |||||||||   | ||||      ||
Sbjct  744  CGTCGTGAT-AATGGTTACAAGACGCTCCGTGCCTTCATGGACATGGCCAAG------TA  692

Query  258  CAAGGTCGACGCGGCGG-GC-GCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAG  315
            | |||| ||| ||  || || | | ||||    |||||||  ||| ||  |||||||| |
Sbjct  691  CCAGGT-GAC-CGAAGGTGCTGACTACTTC---TGCGGCTGGACCGACCCCAACGGCACG  637

Query  316  CGCCAGCCGATCCCAGCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCG  372
               || || ||||||| |||     | || ||||||||||| ||||| || || ||||| 
Sbjct  636  GCACAACCAATCCCAGAGGGGGGTGCCATGCGCTCCACAGGCTACACGCATGATGGTCCA  577

Query  373  TGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTC  432
            || ||||||||| | ||||||||    ||  ||    |    || ||| || ||    ||
Sbjct  576  TGTGAGGTCTGGATCGACAACACGCGCGTGCTGGAAAGTGGTAATTGCCACGAGACGATC  517

Query  433  CCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGG  492
             | ||||||  | || | |||  |||  |  | ||  | ||  | |||| ||||||||||
Sbjct  516  ACTGGAAAGGACTACACCATCGACTATTCTGCCTGTCAAGGCACCTGCATGCTGCGCTGG  457

Query  493  TACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGC  552
            |||||| ||||  |||||||||||||||||   |  ||||||||||||||||| |  |||
Sbjct  456  TACTGGTTGGGTGTTCGCTTCCTCAAGAACTCTTACTCGTGGCAGGTGTACAAAGCCTGC  397

Query  553  GTGCCA  558
             | |||
Sbjct  396  ATCCCA  391

>PYIR:scaffold_4828 pir_scaffold_4828 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_4828:1:781:1 
REF
Length=781

 Score = 128 bits (141),  Expect = 3e-27
 Identities = 269/387 (70%), Gaps = 32/387 (8%)
 Strand=Plus/Plus

Query  185  CAGACTTCAACGGCTACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACG  244
            ||||||||||||| ||| |   ||||||||| | ||||||| | || | |||||||||| 
Sbjct  226  CAGACTTCAACGGATACTTGTCGTCCAAGGGATTCAAGACCATGCGCGAGTTCATGGACA  285

Query  245  ACAAGAAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACA  304
            || | |||  ||||   |||   | |   | |||| ||||  ||||||| ||||| ||  
Sbjct  286  ACGACAAGCTATAC--CGTC-CTGTGAGCGACGCCGACTTCAAGTGCGGATACACGAAGC  342

Query  305  TCAACGGCAAGCGCCAGCCGATCCC--AGCGGGCACA-ATCCGCTCCACAGGTTACACTC  361
            || | ||| |||  ||||| || ||  ||   |  || |||||| |||| || ||||| |
Sbjct  343  TCGATGGCGAGCCGCAGCCCATTCCGAAGAACGACCAGATCCGCACCACTGGATACACGC  402

Query  362  ACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCA  421
            |||| || ||||||||| ||||||| ||| ||  ||||||  | |  ||||  |||||| 
Sbjct  403  ACGAAGGGCCGTGCGAGATCTGGCTGGACGACGTCAAGGTGTTCTACGGCAAGAACTGCC  462

Query  422  ACAAGGACTT----CCCGGGA--AAGACCCA----CTCGA--TCAGCT-ACGCGTCGTGC  468
            || | ||| |     |||| |  ||   |||    |||||  |||||| | |||| | ||
Sbjct  463  ACTACGACGTGGCATCCGGCATGAACTTCCAGAAGCTCGACTTCAGCTCATGCGT-GGGC  521

Query  469  AAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGC-TTCCT--CAAGAACAAG  525
            ||      ||||||  ||  |||||||||||||||| | |||  |  |  ||||| |  |
Sbjct  522  AA------GTGCACCATGTACTGGTACTGGATGGGCATCCGCGGTAGTGGCAAGAGC--G  573

Query  526  TGGTCGTGGCAGGTGTACAAGGAGTGC  552
            |  ||||||||  | ||||||||||||
Sbjct  574  T-CTCGTGGCAAATCTACAAGGAGTGC  599

>PHSO:scaffold_64
Length=40116

 Score = 126 bits (139),  Expect = 1e-26
 Identities = 253/365 (69%), Gaps = 19/365 (5%)
 Strand=Plus/Plus

Query  142    AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCA-GACTTCAACGGCTA  200
              ||||| || || || ||||||||||| || | |  |||| | ||| |||||   |||   
Sbjct  37959  AACCCGCTGGCCTTCCTCGAGAACCAAGGATTCGCGACC-CAGCAAGACTTT--CGGG--  38013

Query  201    CATCAAGT-CCAAG---GGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCAT  256
              | |   || |||||   |||||||||||||| || |  ||||||||| |    |||   |
Sbjct  38014  CGTGGCGTACCAAGAACGGCTACAAGACCCTGCGCGACTTCATGGACCATGGCAAG---T  38070

Query  257    ACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGC  316
              ||| ||| |||   |  |||||| ||||    ||||| |  ||| ||  ||| ||||  |
Sbjct  38071  ACACGGT-GACCAAG--GGCGCCGACTTCTCTTGCGGTTGGACCGACCCCAAGGGCACCC  38127

Query  317    GCCAGCCGATCCCAGCGGG---CACAATCCGCTCCACAGGTTACACTCACGACGGTCCGT  373
                ||||| || || |  ||   | | || |||||||| || ||||| ||||| || ||||
Sbjct  38128  CGCAGCCCATTCCGGACGGAGACGCCATGCGCTCCACGGGCTACACCCACGATGGCCCGT  38187

Query  374    GCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCC  433
              ||||||||||| | ||||||||    ||  ||  ||||  ||||||| || || |  || 
Sbjct  38188  GCGAGGTCTGGATCGACAACACGCGCGTGCTGCAGGGCGACAACTGCCACGAGAAGATCG  38247

Query  434    CGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGT  493
              | |  |||  | || |||||  |||| || | || |||||  |||||||||| || ||||
Sbjct  38248  CCGACAAGGGCTACACGATCGACTACTCGGCTTGTAAGGGCACGTGCACGCTCCGTTGGT  38307

Query  494    ACTGG  498
              |||||
Sbjct  38308  ACTGG  38312

>PHSO:scaffold_12
Length=2105860

 Score = 116 bits (128),  Expect = 6e-24
 Identities = 291/431 (68%), Gaps = 21/431 (5%)
 Strand=Plus/Minus

Query  139     TGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGA-CTTCAACGG  197
               ||||||||  | ||||| ||||||||||| || | | ||||  | | ||| ||||| |  
Sbjct  168836  TGGAACCCGTTGGCGTTCCTCGAGAACCAAGGTTTCCAGACG-CAGTAGAACTTCACCCA  168778

Query  198     CTACATCAAGTC--CAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCA  255
                |||  || |||  ||| |||||||||| ||| ||||  ||||||||| ||   |||   
Sbjct  168777  GTAC--CAGGTCGACAACGGCTACAAGAGCCTGCGTGATTTCATGGACAACGCCAAG---  168723

Query  256     TACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAG  315
               |||| ||||    |||  || ||| ||   |  ||||| |  ||| ||  ||| ||||  
Sbjct  168722  TACACGGTCA---CGGAAGGAGCCGACCAGGCCTGCGGATGGACCGACCCCAAGGGCATC  168666

Query  316     CGCCAGCCGATCCCAGCGGGC---ACAATCCGCTCCACAGGTTACACTCACGACGGTCCG  372
                 ||||| ||| ||| ||| |   || || ||  |  | || ||||| |||||||| || 
Sbjct  168665  GCCCAGCAGATTCCATCGGACGGAACCATGCGTACGTCGGGCTACACCCACGACGGCCCC  168606

Query  373     TGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTC  432
               |||||| |||   | | | |||    ||   |||||      |||||| || ||    ||
Sbjct  168605  TGCGAGATCTACATGGGCGACAAGCTGGCGCTGTCGTATCTGAACTGCCACGAGTCGATC  168546

Query  433     CCGGGAAAGACCCACTCGATCAGCTAC-GCGTC-GTGCAAGGGGTCG-TGCACGCTGCGC  489
                |||   ||||   |  | |   |||| |||   |||   | | | | |||||  ||  |
Sbjct  168545  ACGGACCAGACGTTCAAGCTGGACTACAGCGGATGTG---GCGATAGCTGCACCTTGTAC  168489

Query  490     TGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAG  549
               ||||||||| ||||| | ||||||||||| |||||||  |||||||||||||||||||||
Sbjct  168488  TGGTACTGGCTGGGCGTGCGCTTCCTCAACAACAAGTACTCGTGGCAGGTGTACAAGGAG  168429

Query  550     TGCGTGCCAAT  560
               ||| | || ||
Sbjct  168428  TGCATCCCCAT  168418

 Score = 70.7 bits (77),  Expect = 8e-10
 Identities = 279/426 (65%), Gaps = 25/426 (6%)
 Strand=Plus/Minus

Query  138     CTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGA-CTTCAACG  196
               ||||||||| ||  | || ||||||||  |||| | ||||||  | | ||| |||||   
Sbjct  167536  CTGGAACCCGCTGTCTTTCCTCGAGAAGGAGGGATTCAAGACG-CAGGAGAACTTCACGC  167478

Query  197     GCTACATCAAGTC--CAAGGGCTACAAGACCCTTCGTGCGTTCATGGAC---GACAAGAA  251
                 |||  || |||  ||| ||||||||||  || || |  ||||||||    | ||||  
Sbjct  167477  AGTAC--CAGGTCGACAATGGCTACAAGAGTCTCCGCGACTTCATGGAGAGGGCCAAG--  167422

Query  252     GGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGG  311
                   |||||| | ||||  |  || ||| ||   |  ||||| |  ||| ||  ||| ||
Sbjct  167421  ----TACAAGCT-GACG--GATGGAGCCGACCAGGCCTGCGGATGGACCGACCCCAAGGG  167369

Query  312     CAAGCGCCAGCCGATCCCAGCGG---GCACAATCCGCTCCACAGGTTACACTCACGACGG  368
                |  |  || | |||||| | ||   |||| || ||| |  | || ||||| ||||||||
Sbjct  167368  AATCCCGCAACAGATCCCCGAGGACGGCACGATGCGCACGTCGGGCTACACCCACGACGG  167309

Query  369     TCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGA  428
                ||||| ||| |||   | | | |||    || | | |||  |  ||||||| || ||  
Sbjct  167308  ACCGTGTGAGATCTACATGGGCGACAAGCTGGCCCTCTCGTACCTCAACTGCCACGAGTC  167249

Query  429     CTTCCCGGGAAAGACCCACTCGATCAGCTAC-GCGTCGTGCAAGGGGTCG-TGCACGCTG  486
                 || | |   ||||   |  | |   |||| ||| | |||  ||| | | ||||  |||
Sbjct  167248  GATCACTGACCAGACGTTCAAGCTGGACTACAGCGGC-TGCG-GGGATAGCTGCATCCTG  167191

Query  487     CGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAG  546
                 |||||||||| ||||| | ||    || |||  |||||  |||||||| |||||||||
Sbjct  167190  TACTGGTACTGGCTGGGCGTGCGTAAGCTGAAGGGCAAGTTCTCGTGGCAAGTGTACAAG  167131

Query  547     GAGTGC  552
               ||||||
Sbjct  167130  GAGTGC  167125

 Score = 61.7 bits (67),  Expect = 4e-07
 Identities = 57/72 (79%), Gaps = 3/72 (4%)
 Strand=Plus/Minus

Query  489     CTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGA  548
               |||||||||| ||||| | |||||| |||||  ||  |   ||| |||||||||||||||
Sbjct  161993  CTGGTACTGGCTGGGCGTGCGCTTCATCAAGGGCATCT---CGTAGCAGGTGTACAAGGA  161937

Query  549     GTGCGTGCCAAT  560
               |||| | || ||
Sbjct  161936  GTGCATCCCGAT  161925

>PHPA:scaffold_66 NW_008649052.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.66, whole genome shotgun 
sequence
Length=310063

 Score = 106 bits (117),  Expect = 1e-20
 Identities = 174/249 (70%), Gaps = 9/249 (4%)
 Strand=Plus/Minus

Query  319     CAGCCGATCCCAGCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGC  375
               ||||| || ||||||||     | || || || || ||||||||||| ||||| || |||
Sbjct  162871  CAGCCCATTCCAGCGGGTGGTGCCATGCGTTCAACCGGTTACACTCATGACGGACCATGC  162812

Query  376     GAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCG  435
               ||||| ||||| ||  |       ||  ||  |||   ||| ||| || |     |||| 
Sbjct  162811  GAGGTGTGGCTGGATGATGTTCGTGTGTTGGAGGGTGGCAATTGCCACGAATCGATCCCT  162752

Query  436     GGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAG-----GGGTCG-TGCACGCTGCGC  489
               || |||  | || | |||  |||| | |||||| ||     |||| | |||  ||| |||
Sbjct  162751  GGGAAGGACTACACCATCGACTACTCATCGTGCGAGAAGAAGGGTGGCTGCGTGCTACGC  162692

Query  490     TGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAG  549
               ||||||||| ||||  | ||||||||||| |||  ||  ||||||||||||||||| |||
Sbjct  162691  TGGTACTGGTTGGGTGTCCGCTTCCTCAAAAACTCGTACTCGTGGCAGGTGTACAAAGAG  162632

Query  550     TGCGTGCCA  558
               ||| | |||
Sbjct  162631  TGCATTCCA  162623

>PHPA:scaffold_46 NW_008649032.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.46, whole genome shotgun 
sequence
Length=493760

 Score = 106 bits (117),  Expect = 1e-20
 Identities = 174/249 (70%), Gaps = 9/249 (4%)
 Strand=Plus/Minus

Query  319   CAGCCGATCCCAGCGGGCA---CAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGC  375
             ||||| || ||||||||     | || || || || ||||||||||| ||||| || |||
Sbjct  3732  CAGCCCATTCCAGCGGGTGGTGCCATGCGTTCAACCGGTTACACTCATGACGGACCATGC  3673

Query  376   GAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCG  435
             ||||| ||||| ||  |       ||  ||  |||   ||| ||| || |     |||| 
Sbjct  3672  GAGGTGTGGCTGGATGATGTTCGTGTGTTGGAGGGTGGCAATTGCCACGAATCGATCCCT  3613

Query  436   GGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAG-----GGGTCG-TGCACGCTGCGC  489
             || |||  | || | |||  |||| | |||||| ||     |||| | |||  ||| |||
Sbjct  3612  GGGAAGGACTACACCATCGACTACTCATCGTGCGAGAAGAAGGGTGGCTGCGTGCTACGC  3553

Query  490   TGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAG  549
             ||||||||| ||||  | ||||||||||| |||  ||  ||||||||||||||||| |||
Sbjct  3552  TGGTACTGGTTGGGTGTCCGCTTCCTCAAAAACTCGTACTCGTGGCAGGTGTACAAAGAG  3493

Query  550   TGCGTGCCA  558
             ||| | |||
Sbjct  3492  TGCATTCCA  3484

>PHSO:scaffold_11
Length=2192408

 Score = 99.6 bits (109),  Expect = 2e-18
 Identities = 233/350 (67%), Gaps = 39/350 (11%)
 Strand=Plus/Minus

Query  211      AAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCA--TACAAGGTCGACG  268
                || |||||||| || || || |  |||||||||       |||||  |||| ||| ||| 
Sbjct  2022804  AATGGCTACAAAACTCTACGCGACTTCATGGACCG-----AGGCAAGTACACGGT-GACC  2022751

Query  269      CGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCCAGCCGATCC  328
                | |  |||||| |||     |||||||  ||||||  ||| || | ||  ||||| || |
Sbjct  2022750  CAG--GGCGCCGACTACTTCTGCGGCTGGACCAACCCCAAGGGGACGCCGCAGCCCATTC  2022693

Query  329      CAGCGGGCACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTG  388
                |             |||||||| |||||||| || ||||| ||||| ||| | ||||| |
Sbjct  2022692  CG------------CGCTCCACGGGTTACACCCATGACGGCCCGTGTGAGATTTGGCTGG  2022645

Query  389      ACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACT  448
                || ||      ||  ||  |  |  ||||||| || ||    ||||         |||| 
Sbjct  2022644  ACGACGTGCGCGTGCTGGAGTCCGGCAACTGCCACGAGACGATCCC---------CCAC-  2022595

Query  449      CGATCAGCTACGCGTCGTGCAAGG----GGTCG--TGCACGCTGCGCTGGTACTGGATGG  502
                 ||||  |||| |||| ||| ||     || ||  |||||| ||| |||||||||| | |
Sbjct  2022594  -GATCGACTACTCGTCCTGCGAGAAGAAGGGCGGCTGCACGATGCACTGGTACTGGCTCG  2022536

Query  503      GCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGC  552
                |  | |||||||||||||||  ||  ||||||||||| ||||||||||||
Sbjct  2022535  GAGTGCGCTTCCTCAAGAACTCGTACTCGTGGCAGGTCTACAAGGAGTGC  2022486

>PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 
genomic scaffold, whole genome shotgun sequence
Length=695754

 Score = 99.6 bits (109),  Expect = 2e-18
 Identities = 308/476 (65%), Gaps = 27/476 (6%)
 Strand=Plus/Minus

Query  78      CGCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCACTAACCCGGACAAGAACGTGTA  137
               |||||||||   |||  | |||||| | ||||| | ||| | |   || ||| ||  | |
Sbjct  359156  CGCTCACCAAGTTGTCCTGCTACCATCCCCGACCTACACAACCGATGATAAGGACACGAA  359097

Query  138     CTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGG  197
                |     || ||  | ||||| |||  |||||| ||| |||||  ||  ||||| |||||
Sbjct  359096  ATATGCACCTCTGACCTTTCTGGAGGGCCAGGGATACGAGACCGTCGAGGACTTTAACGG  359037

Query  198     CTA-CATC--AAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGC  254
               ||  | ||  ||   ||| || || ||||| || ||||  ||||||||  |||       
Sbjct  359036  CTGGCGTCGCAA---CAACGGGTATAAGACTCTGCGTGACTTCATGGAGTACAC------  358986

Query  255     ATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAA  314
                        || |||||  || ||| ||| | | || |||| ||| ||  | |||| |  
Sbjct  358985  ---------CGTCGCGGATGGAGCCGACTATTACTGTGGCTTCACGAATGTTAACGCCGC  358935

Query  315     GCGCCAGCCGATCCCAGCGGGCACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTG  374
                |  || || |  || |  ||  |||| || ||||| || ||||| ||||| || |||||
Sbjct  358934  TCCGCAACCTAATCCGGACGGAGCAATGCGTTCCACGGGCTACACACACGATGGCCCGTG  358875

Query  375     CGAGGTCTGGCTTGACAACAC---CAAGGTCATGTCGGGCACCAACTGCAACAAGGACTT  431
                ||||| ||||| |||| |||   |  | ||  |||||  |   ||||| || |   | |
Sbjct  358874  TGAGGTTTGGCTCGACAGCACACGCGTGCTCCAGTCGGATA---ACTGCCACGAAACCAT  358818

Query  432     CCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTG  491
                   || |||||| |     |   ||||   |||||||||||  | |||||||| |||||
Sbjct  358817  TATTGGCAAGACCTATAATTTGGACTACAGCTCGTGCAAGGGCACCTGCACGCTACGCTG  358758

Query  492     GTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGG  547
               ||||||| | ||  | || || ||||| |||   |  ||||||||| | |||||||
Sbjct  358757  GTACTGGCTTGGTGTGCGTTTTCTCAAAAACGCCTACTCGTGGCAGATCTACAAGG  358702

>PLHA:NW_020189073.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2165, whole genome shotgun sequence
Length=94632

 Score = 98.7 bits (108),  Expect = 2e-18
 Identities = 184/263 (70%), Gaps = 17/263 (6%)
 Strand=Plus/Plus

Query  306    CAACGGCAAGCGCCAGCCGATCCCAGCGGGCA-CAATCCGC--TCCACAGGTTACACTCA  362
              ||| || | || |||||| || ||||| |||| ||||  ||  | ||| || ||||||||
Sbjct  34836  CAATGGTACGCCCCAGCCCATTCCAGCTGGCAACAATATGCGATTCACTGGATACACTCA  34895

Query  363    CGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAA  422
              ||| || |  || ||| | ||||||||  ||||||| ||  |    ||  |||||||  |
Sbjct  34896  CGATGGCCTCTGTGAGATGTGGCTTGATGACACCAAAGTGCTCAGCGGATCCAACTGTCA  34955

Query  423    CAAGGAC-TTCCCGGGAAAGA---CCCACTCGATCAGCTACGCGTCGTGCAAGG--GGTC  476
              ||| ||| |||| || |||||   |||  |||||    ||| ||||||||||||    | 
Sbjct  34956  CAACGACTTTCCTGGAAAAGACTGCCCTGTCGAT----TACTCGTCGTGCAAGGACAATT  35011

Query  477    GTG-CACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGC  535
              ||| ||   ||  |||||||||| ||| | ||||  | || || ||  |||  |||||||
Sbjct  35012  GTGTCA---TGTACTGGTACTGGCTGGCCGTTCGTCTTCTGAAAAATGAGTATTCGTGGC  35068

Query  536    AGGTGTACAAGGAGTGCGTGCCA  558
              | || || ||||  ||| | |||
Sbjct  35069  AAGTCTATAAGGCCTGCATTCCA  35091

>PHCA:scaffold_67 PHYCAscaffold_67
Length=292061

 Score = 82.4 bits (90),  Expect = 1e-13
 Identities = 63/75 (84%), Gaps = 0/75 (0%)
 Strand=Plus/Minus

Query  478     TGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAG  537
               ||||  |||  |||||||||| ||||  |||||| ||||||||| ||||  |||||||| 
Sbjct  219434  TGCATTCTGTACTGGTACTGGCTGGGAGTTCGCTACCTCAAGAAGAAGTACTCGTGGCAA  219375

Query  538     GTGTACAAGGAGTGC  552
               |||||||||||||||
Sbjct  219374  GTGTACAAGGAGTGC  219360

 Score = 68.9 bits (75),  Expect = 3e-09
 Identities = 280/428 (65%), Gaps = 29/428 (7%)
 Strand=Plus/Minus

Query  138     CTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGA-CTTCAACG  196
               |||||||||  |  |||| ||||||||  |||| | ||||||  | | ||| |||||   
Sbjct  220779  CTGGAACCCCTTGTCGTTCCTCGAGAAGGAGGGATTCAAGACG-CAGGAGAACTTCACGC  220721

Query  197     GCTACATCAAGTC--CAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGC  254
                 |||  |||||   ||| ||||||||||  || ||||  ||||||||      ||||||
Sbjct  220720  AGTAC--CAAGTGGACAATGGCTACAAGAGTCTGCGTGACTTCATGGA------GAAGGC  220669

Query  255     A---TACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGG  311
                   ||||||||     |||  || ||  |    |  ||||| |  | | ||   || ||
Sbjct  220668  CAAGTACAAGGTTT---CGGACGGAGCTGATCAGGCTTGCGGGTGGAGCGACCCGAAGGG  220612

Query  312     CAAGCGCCAGCCGATCCCAGCGG---GCACAATCCGCTCCACAGGTTACACTCACGACGG  368
               ||  |  |||| ||||||  |||   |||| || ||| |  | || ||||| ||||| ||
Sbjct  220611  CATCCCGCAGCAGATCCCGTCGGACGGCACCATGCGCACGTCGGGATACACGCACGATGG  220552

Query  369     TCCGTGCGAGGTCTGGCTTGACAACAC-CAAGGTCATGTCGGGCACCAACTGCAACAAGG  427
                ||||||||| ||||| | |   |||  |  | || |||||  |  ||||||| || |  
Sbjct  220551  CCCGTGCGAGATCTGGATGGGGGACAAGCTCGCTC-TGTCGTACCTCAACTGCCACGAAT  220493

Query  428     ACTTCCCGGGAAAGACCCACTCGATCAGCTAC-GCGTC-GTGCAAGGGGTCG-TGCACGC  484
                  |||| |   ||||   |  | ||  |||| | | | |||   | | | | ||||   
Sbjct  220492  CGATCCCCGAGCAGACGTTCAAGCTCGACTACAGTGGCTGTG---GTGATAGCTGCATTT  220436

Query  485     TGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACA  544
               ||  |||||||||| ||||  | ||    ||||||  |||||  ||||||||||||||||
Sbjct  220435  TGTACTGGTACTGGCTGGGAGTGCGTAAACTCAAGGGCAAGTACTCGTGGCAGGTGTACA  220376

Query  545     AGGAGTGC  552
               ||||||||
Sbjct  220375  AGGAGTGC  220368

>PYIR:scaffold_573 pir_scaffold_573 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_573:1:20947:1 
REF
Length=20947

 Score = 72.5 bits (79),  Expect = 2e-10
 Identities = 87/119 (73%), Gaps = 6/119 (5%)
 Strand=Plus/Plus

Query  361    CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGC  420
              ||| |||| |||||||||| |||| | ||||||||||||||| |      |  | |||||
Sbjct  15937  CACCACGGCCCGTGCGAGGGCTGGATCGACAACACCAAGGTCTTCCACTACGACGACTGC  15996

Query  421    AACAAGGACTTCCCGGG------AAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGG  473
                ||||  |||||||||      |  ||||  | |||| |||| |||||||||||||||
Sbjct  15997  GTCAAGAGCTTCCCGGGCTACCCAGCGACCATCCCGATGAGCTTCGCGTCGTGCAAGGG  16055

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 39/45 (87%), Gaps = 0/45 (0%)
 Strand=Plus/Plus

Query  361   CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATG  405
             ||| |||| |||||||| |||||| | |||||||||||| |||||
Sbjct  5569  CACCACGGCCCGTGCGAAGTCTGGATCGACAACACCAAGATCATG  5613

 Score = 42.8 bits (46),  Expect = 0.10
 Identities = 37/45 (82%), Gaps = 1/45 (2%)
 Strand=Plus/Plus

Query  361   CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATG  405
             ||| |||| || |||||| ||||| | | ||||||||||| ||||
Sbjct  7361  CACCACGGCCCCTGCGAGCTCTGGGTCGGCAACACCAAGG-CATG  7404

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  532   TGGCAGGTGTACAAGGAGTGCGTGCCAAT  560
             |||||| | |||||| |||||||||||||
Sbjct  5734  TGGCAGATTTACAAGCAGTGCGTGCCAAT  5762

>PHPA:scaffold_20 NW_008649006.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.20, whole genome shotgun 
sequence
Length=1049362

 Score = 71.6 bits (78),  Expect = 2e-10
 Identities = 283/436 (65%), Gaps = 41/436 (9%)
 Strand=Plus/Plus

Query  142     AACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAA--CG-GC  198
               ||||| || ||||| || || | |||||| | ||||||    | |||||| ||  || | 
Sbjct  363650  AACCCTCTTGCGTTCCTTGAAAGCCAGGGATTCAAGACGCAAGAAGACTTTAAGTCGTGG  363709

Query  199     TACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAG--AAGGCAT  256
                 |||| ||   || |||||||| || || ||||  || |||||  ||| |  |||   |
Sbjct  363710  CGCATCCAG---AACGGCTACAAAACACTCCGTGACTTTATGGA--ACATGCCAAG---T  363761

Query  257     ACAAGGT---CGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCA  313
               |||  ||   ||| |  ||||      ||||   ||| || |  ||||||  ||| || |
Sbjct  363762  ACACTGTTACCGAAGGAGCGG------ACTTCTCGTGTGGTTGGACCAACCCCAAAGGTA  363815

Query  314     AGCGCCAGCCGATCCCAGCGGG---CACAATCCGCTCCACAGGTTACACTCACGACGGTC  370
                ||  ||||| || || || ||   ||  || ||||| || || || || || || || |
Sbjct  363816  CGCCACAGCCAATTCCGGCTGGAGGCATCATGCGCTCTACCGGATATACCCATGAGGGGC  363875

Query  371     CGTGCGAGGTCTGGCTTGACAACACCAAGGT----CATGTCGGGCACCAACTGCAACA-A  425
               | |||||  | ||| | |   | ||  ||||    || | ||     ||||||| ||  |
Sbjct  363876  CATGCGAAATGTGGGTCGCTGATACGCAGGTGTACCAAGCCGA----CAACTGCCACGTA  363931

Query  426     GGACTTCCCGGGAAAGAC---CCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCAC  482
                 ||| || || |||||    ||| ||||    |||  || ||||||||||    ||   
Sbjct  363932  TCACTGCCAGGCAAAGAATATCCAATCGA----CTATTCGCCGTGCAAGGGAAACTGTGT  363987

Query  483     GCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTA  542
                ||   |||||||||| | ||  | ||||||||||||||   ||  ||||||||||||||
Sbjct  363988  TCTCTACTGGTACTGGCTCGGTGTGCGCTTCCTCAAGAATTCGTATTCGTGGCAGGTGTA  364047

Query  543     CAAGGAGTGCGTGCCA  558
               ||| || ||| | |||
Sbjct  364048  CAAAGAATGCATCCCA  364063

>PHPA:scaffold_39 NW_008649025.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.39, whole genome shotgun 
sequence
Length=634653

 Score = 69.8 bits (76),  Expect = 8e-10
 Identities = 53/63 (84%), Gaps = 0/63 (0%)
 Strand=Plus/Plus

Query  489     CTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGA  548
               |||||||||| ||||  |||| | ||| || || ||||  ||||||||||||||||||||
Sbjct  151457  CTGGTACTGGTTGGGTGTTCGTTACCTAAAAAAGAAGTACTCGTGGCAGGTGTACAAGGA  151516

Query  549     GTG  551
               |||
Sbjct  151517  GTG  151519

 Score = 65.3 bits (71),  Expect = 3e-08
 Identities = 58/73 (79%), Gaps = 0/73 (0%)
 Strand=Plus/Plus

Query  489     CTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGA  548
               |||||||||| ||||| | |||   || |||  |||||  ||||||||||||||||||||
Sbjct  150275  CTGGTACTGGCTGGGCGTGCGCAAGCTGAAGGGCAAGTACTCGTGGCAGGTGTACAAGGA  150334

Query  549     GTGCGTGCCAATT  561
                ||| | || |||
Sbjct  150335  ATGCATCCCGATT  150347

>PYAR:scaffold_593 par_scaffold_593 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_593:1:15936:1 
REF
Length=15936

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 84/114 (74%), Gaps = 1/114 (1%)
 Strand=Plus/Minus

Query  460    GCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAG  519
              ||||| ||||||||    |||||| | | |||||||||| | | |   ||  || |    
Sbjct  15877  GCGTC-TGCAAGGGTGACTGCACGATCCACTGGTACTGGCTCGCCAAGCGTCTCATTGGC  15819

Query  520    AACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCCAATTGGCAGCGGTCGC  573
              || |||||||||||||||| ||||||||||||| | || ||  || ||||| ||
Sbjct  15818  AAGAAGTGGTCGTGGCAGGCGTACAAGGAGTGCATTCCGATCAGCGGCGGTGGC  15765

>PYAP:scaffold_289 pag1_scaffold_289 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_289:1:35482:1 
REF
Length=35482

 Score = 66.2 bits (72),  Expect = 9e-09
 Identities = 101/141 (72%), Gaps = 5/141 (4%)
 Strand=Plus/Plus

Query  366    CGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAA  425
              ||| ||||||||||||||||| || ||||||||||||  ||||| ||   | |||   ||
Sbjct  14498  CGGGCCGTGCGAGGTCTGGCTGGATAACACCAAGGTCGCGTCGGCCAAGGAATGCTGGAA  14557

Query  426    GGACTTCCCGGGAAAGACCCACTCGA-TCAGCTACGCGTCGTGCAAG---GGGTCGTGCA  481
              ||| |||||    ||| | || |  | ||  ||  ||   ||| |||   || |||||| 
Sbjct  14558  GGAGTTCCCAAACAAG-CGCATTAAAGTCGACTTTGCCAAGTGTAAGAGCGGCTCGTGCC  14616

Query  482    CGCTGCGCTGGTACTGGATGG  502
               ||||||||||  ||||||||
Sbjct  14617  AGCTGCGCTGGGTCTGGATGG  14637

>PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 
genomic scaffold, whole genome shotgun sequence
Length=3552875

 Score = 65.3 bits (71),  Expect = 3e-08
 Identities = 52/63 (83%), Gaps = 0/63 (0%)
 Strand=Plus/Minus

Query  489      CTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGA  548
                |||||| ||| ||||| |||| |  || ||||| ||||  |||||||| |||||||||||
Sbjct  2704563  CTGGTATTGGTTGGGCGTTCGTTATCTTAAGAAGAAGTACTCGTGGCAAGTGTACAAGGA  2704504

Query  549      GTG  551
                |||
Sbjct  2704503  GTG  2704501

 Score = 60.8 bits (66),  Expect = 4e-07
 Identities = 51/63 (81%), Gaps = 0/63 (0%)
 Strand=Plus/Minus

Query  490      TGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAG  549
                ||||||||| ||||  | |||   ||||||  |||||  || ||||||||||||||||||
Sbjct  2743247  TGGTACTGGCTGGGTGTGCGCAAGCTCAAGGGCAAGTACTCCTGGCAGGTGTACAAGGAG  2743188

Query  550      TGC  552
                |||
Sbjct  2743187  TGC  2743185

>PYIW:scaffold_3542 piw_scaffold_3542 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_3542:1:2951:1 
REF
Length=2951

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 91/128 (71%), Gaps = 12/128 (9%)
 Strand=Plus/Minus

Query  361   CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCAT---GTCGGGCACCAAC  417
             ||| |||| |||||||||| |||| | ||||||||||||||| |    ||||    | ||
Sbjct  1569  CACCACGGCCCGTGCGAGGGCTGGATCGACAACACCAAGGTCTTCCACTCGG---ACGAC  1513

Query  418   TGCAACAAGGACTTCCCGGGAAA------GACCCACTCGATCAGCTACGCGTCGTGCAAG  471
             |||  ||||  || ||||||  |      || |  | | || ||||||||| ||||||||
Sbjct  1512  TGCGTCAAGAGCTACCCGGGCTACCCGGCGAACATCCCCATGAGCTACGCGGCGTGCAAG  1453

Query  472   GGGTCGTG  479
             ||  ||||
Sbjct  1452  GGCACGTG  1445

>PHRA:scaffold_123
Length=117378

 Score = 61.7 bits (67),  Expect = 4e-07
 Identities = 38/41 (93%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  361    CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
              ||| |||||||||||||||||||| ||||| ||||||||||
Sbjct  24818  CACCACGGTCCGTGCGAGGTCTGGATTGACGACACCAAGGT  24858

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 57/80 (71%), Gaps = 12/80 (15%)
 Strand=Plus/Plus

Query  478    TGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAG  537
              |||||||||||||  |||||| |||     ||| | | | ||  |||       ||||||
Sbjct  24944  TGCACGCTGCGCTTCTACTGGCTGG-----CGC-TGCACGAGCCCAA------CTGGCAG  24991

Query  538    GTGTACAAGGAGTGCGTGCC  557
              || |||||| ||||||||||
Sbjct  24992  GTCTACAAGCAGTGCGTGCC  25011

>PHPA:scaffold_16 NW_008649002.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.16, whole genome shotgun 
sequence
Length=1156373

 Score = 60.8 bits (66),  Expect = 4e-07
 Identities = 148/219 (68%), Gaps = 8/219 (4%)
 Strand=Plus/Plus

Query  346     TCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAAC-ACCAAGGTCAT  404
               || || || ||||| || |||||||||||||  || |  || ||  || | | || || |
Sbjct  489035  TCAACGGGCTACACGCATGACGGTCCGTGCGCTGTTTACCTCGATGACGAGCTAGTTC-T  489093

Query  405     GTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTC  464
               |  |  |  ||||||  || || |  |||| || ||| |  ||  |||   |||| ||||
Sbjct  489094  GGAGTACGACAACTGTCACGAGAAGCTCCCTGGCAAGTCATACAAGATTGACTACTCGTC  489153

Query  465     GTGC---AAGG--GGTCG-TGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAA  518
                |||   |||   ||| | || |||||    |||| |||| ||||  | |||||  | ||
Sbjct  489154  CTGCGAAAAGAAAGGTGGCTGTACGCTTTATTGGTTCTGGTTGGGAATCCGCTTTGTAAA  489213

Query  519     GAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCC  557
               || |   ||||| ||||| || |||||||||||||| ||
Sbjct  489214  GAGCCGCTGGTCCTGGCAAGTTTACAAGGAGTGCGTCCC  489252

>PHSO:scaffold_8
Length=3549547

 Score = 58.1 bits (63),  Expect = 5e-06
 Identities = 45/54 (83%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  348      CACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
                ||| || | ||| |||  |||||||||||||||||||  |||| ||||||||||
Sbjct  1240748  CACGGGCTTCACGCACCCCGGTCCGTGCGAGGTCTGGTGTGACGACACCAAGGT  1240801

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 44/54 (81%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  348      CACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
                |||||| | ||| |||   ||||||||||||||||||   ||| ||||||||||
Sbjct  1238257  CACAGGCTTCACGCACACTGGTCCGTGCGAGGTCTGGTGCGACGACACCAAGGT  1238310

 Score = 45.5 bits (49),  Expect = 0.030
 Identities = 81/118 (69%), Gaps = 3/118 (3%)
 Strand=Plus/Plus

Query  287      AGTGCGGCTACACC---AACATCAACGGCAAGCGCCAGCCGATCCCAGCGGGCACAATCC  343
                ||||||||||||||    ||  |  | ||  ||||||| |||| ||  ||  ||   || 
Sbjct  1236334  AGTGCGGCTACACCGTGTACGACGCCAGCGCGCGCCAGACGATGCCCTCGACCAACCTCA  1236393

Query  344      GCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
                  | |||||| | ||| |||   || || |||||| |||||   ||| ||||||||||
Sbjct  1236394  CGTACACAGGCTTCACCCACCCGGGCCCCTGCGAGATCTGGTGCGACGACACCAAGGT  1236451

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  530      CGTGGCAGGTGTACAAGGAGTGCGTG  555
                ||||||||||||||| ||| ||||||
Sbjct  1236563  CGTGGCAGGTGTACACGGACTGCGTG  1236588

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  530      CGTGGCAGGTGTACAAGGAGTGCGTG  555
                ||||||||||||||| ||| ||||||
Sbjct  1238433  CGTGGCAGGTGTACACGGACTGCGTG  1238458

>PHRA:scaffold_33
Length=496317

 Score = 58.1 bits (63),  Expect = 5e-06
 Identities = 165/250 (66%), Gaps = 13/250 (5%)
 Strand=Plus/Plus

Query  138     CTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGG  197
               ||||||||| ||  |||| ||||| ||  |||| | | |||||   | | ||||||    
Sbjct  370647  CTGGAACCCGCTGTCGTTCCTCGAAAAGGAGGGGTTCGAGACCCAAGAAAACTTCACGCA  370706

Query  198     CTACATCAAGTC--CAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCA  255
                | |  || |||  ||| ||||||| ||  || || |  ||| ||||| |    |||   
Sbjct  370707  GTTC--CAGGTCGACAACGGCTACACGAGTCTGCGAGACTTCCTGGACAAGGCCAAG---  370761

Query  256     TACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAG  315
               |||||||||    |||  || ||  ||   |  ||||| |   |  ||  ||| || |  
Sbjct  370762  TACAAGGTCT---CGGACGGAGCTGACCAAGCTTGCGGGTGGTCGGACCCCAAGGGAATC  370818

Query  316     CGCCAGCCGATCCCAGCGG---GCACAATCCGCTCCACAGGTTACACTCACGACGGTCCG  372
               |  |||| |||||||| ||   |||| || ||| |  | || ||||| ||||||||||||
Sbjct  370819  CCGCAGCAGATCCCAGAGGACGGCACCATGCGCACGTCGGGATACACGCACGACGGTCCG  370878

Query  373     TGCGAGGTCT  382
               |||||| |||
Sbjct  370879  TGCGAGATCT  370888

 Score = 57.2 bits (62),  Expect = 5e-06
 Identities = 37/41 (90%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  361     CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
               |||| ||||||||||||| ||||||| ||| ||||||||||
Sbjct  430679  CACGTCGGTCCGTGCGAGATCTGGCTCGACGACACCAAGGT  430639

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 57/75 (76%), Gaps = 0/75 (0%)
 Strand=Plus/Plus

Query  478     TGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAG  537
               ||||  |||  |||||||||| ||||  | || | ||| |||  ||  |  |||||||||
Sbjct  370984  TGCATCCTGTACTGGTACTGGCTGGGTGTGCGATACCTGAAGGGCAGCTACTCGTGGCAG  371043

Query  538     GTGTACAAGGAGTGC  552
               ||||||||||| |||
Sbjct  371044  GTGTACAAGGAATGC  371058

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 60/80 (75%), Gaps = 3/80 (4%)
 Strand=Plus/Minus

Query  306     CAACGGCAAGCGCCAGCCGATCCCAGCGG---GCACAATCCGCTCCACAGGTTACACTCA  362
               |||||| |  |  |||| |||||||| ||   |||| ||  || |  | || ||||| ||
Sbjct  171314  CAACGGAATCCCGCAGCAGATCCCAGAGGACGGCACCATGAGCCCGTCGGGATACACGCA  171255

Query  363     CGACGGTCCGTGCGAGGTCT  382
               |||||||||||||||| |||
Sbjct  171254  CGACGGTCCGTGCGAGATCT  171235

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 60/80 (75%), Gaps = 3/80 (4%)
 Strand=Plus/Minus

Query  306     CAACGGCAAGCGCCAGCCGATCCCAGCGG---GCACAATCCGCTCCACAGGTTACACTCA  362
               |||||| |  |  |||| |||||||| ||   |||| ||  || |  | || ||||| ||
Sbjct  175673  CAACGGAATCCCGCAGCAGATCCCAGAGGACGGCACCATGAGCCCGTCGGGATACACGCA  175614

Query  363     CGACGGTCCGTGCGAGGTCT  382
               |||||||||||||||| |||
Sbjct  175613  CGACGGTCCGTGCGAGATCT  175594

 Score = 50.9 bits (55),  Expect = 7e-04
 Identities = 56/75 (75%), Gaps = 0/75 (0%)
 Strand=Plus/Minus

Query  478     TGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAG  537
               ||||  |||  |||||||||| ||||    || | ||| |||  ||  |  |||||||||
Sbjct  171140  TGCATCCTGTACTGGTACTGGCTGGGTGCGCGATACCTGAAGGGCAGCTACTCGTGGCAG  171081

Query  538     GTGTACAAGGAGTGC  552
               ||||||||||| |||
Sbjct  171080  GTGTACAAGGAATGC  171066

 Score = 50.9 bits (55),  Expect = 7e-04
 Identities = 56/75 (75%), Gaps = 0/75 (0%)
 Strand=Plus/Minus

Query  478     TGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAG  537
               ||||  |||  |||||||||| ||||    || | ||| |||  ||  |  |||||||||
Sbjct  175499  TGCATCCTGTACTGGTACTGGCTGGGTGCGCGATACCTGAAGGGCAGCTACTCGTGGCAG  175440

Query  538     GTGTACAAGGAGTGC  552
               ||||||||||| |||
Sbjct  175439  GTGTACAAGGAATGC  175425

>PYAR:scaffold_674 par_scaffold_674 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_674:1:14611:1 
REF
Length=14611

 Score = 57.2 bits (62),  Expect = 5e-06
 Identities = 100/143 (70%), Gaps = 6/143 (4%)
 Strand=Plus/Minus

Query  366   CGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAA  425
             ||| ||||| ||| ||||||| ||| ||||||||||| | || | |||| |||||   ||
Sbjct  7457  CGGGCCGTGTGAGATCTGGCTCGACGACACCAAGGTCGTCTCAGCCACCGACTGCTGGAA  7398

Query  426   GGACTTCCCGGGAAAG----ACCCACTCGA-TCAGCTACGCGT-CGTGCAAGGGGTCGTG  479
             | | || || |  |||     |||  |||| |   | | | || ||  |||||  |||||
Sbjct  7397  GCAGTTTCCTGACAAGCGCATCCCCGTCGACTTTTCCAAGTGTGCGAACAAGGCCTCGTG  7338

Query  480   CACGCTGCGCTGGTACTGGATGG  502
             |  | ||||||||  ||||||||
Sbjct  7337  CGAGTTGCGCTGGATCTGGATGG  7315

>PHSO:scaffold_16
Length=803425

 Score = 57.2 bits (62),  Expect = 5e-06
 Identities = 37/41 (90%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  361     CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
               ||||  |||||||||||| ||||||| ||||||||||||||
Sbjct  522092  CACGTGGGTCCGTGCGAGATCTGGCTCGACAACACCAAGGT  522132

 Score = 57.2 bits (62),  Expect = 5e-06
 Identities = 87/123 (71%), Gaps = 6/123 (5%)
 Strand=Plus/Minus

Query  289     TGCGGCTACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCG---GGCA---CAATC  342
               || ||||||||||||   ||||||| ||   |||| |||||  |    ||||   | |||
Sbjct  542939  TGTGGCTACACCAACCCGAACGGCACGCCGTAGCCCATCCCGACCAATGGCAAGGCCATC  542880

Query  343     CGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
                 |||    |||  ||  |||  ||||||||||||| ||||||| |||||||  ||||| 
Sbjct  542879  TTCTCTCGTGGTCTCATCCACACCGGTCCGTGCGAGATCTGGCTCGACAACAAGAAGGTT  542820

Query  403     ATG  405
               |||
Sbjct  542819  ATG  542817

 Score = 57.2 bits (62),  Expect = 5e-06
 Identities = 87/123 (71%), Gaps = 6/123 (5%)
 Strand=Plus/Minus

Query  289     TGCGGCTACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCG---GGCA---CAATC  342
               || ||||||||||||   ||||||| ||  ||||| |||||  |    ||||   | |||
Sbjct  551426  TGTGGCTACACCAACCCGAACGGCACGCCGCAGCCCATCCCGACCAATGGCAAGGCCATC  551367

Query  343     CGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
                 |||    |||  ||  |||   |||||||||||| ||||||| ||| |||  ||||||
Sbjct  551366  TTCTCTCGTGGTCTCATCCACACTGGTCCGTGCGAGATCTGGCTCGACGACAAGAAGGTC  551307

Query  403     ATG  405
               |||
Sbjct  551306  ATG  551304

 Score = 50.0 bits (54),  Expect = 7e-04
 Identities = 39/47 (83%), Gaps = 0/47 (0%)
 Strand=Plus/Minus

Query  361     CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTC  407
               ||||  |||||||||||| ||||||| ||| ||| ||||||  ||||
Sbjct  524347  CACGTGGGTCCGTGCGAGATCTGGCTCGACGACAACAAGGTGCTGTC  524301

>PHCA:scaffold_11 PHYCAscaffold_11
Length=1076090

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 44/53 (83%), Gaps = 0/53 (0%)
 Strand=Plus/Plus

Query  349     ACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
               || |||| |||||||  |||||||||||| ||||||   ||| ||||||||||
Sbjct  647995  ACCGGTTTCACTCACCCCGGTCCGTGCGAAGTCTGGTGCGACGACACCAAGGT  648047

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 44/53 (83%), Gaps = 0/53 (0%)
 Strand=Plus/Minus

Query  349     ACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
               || |||| |||||||  |||||||||||| ||||||   ||| ||||||||||
Sbjct  684910  ACCGGTTTCACTCACCCCGGTCCGTGCGAAGTCTGGTGCGACGACACCAAGGT  684858

>PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:pug:scf1117875582028:1:960197:1 
REF
Length=960197

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 30/31 (97%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  530     CGTGGCAGGTGTACAAGGAGTGCGTGCCAAT  560
               ||||||||||||||||| |||||||||||||
Sbjct  821335  CGTGGCAGGTGTACAAGCAGTGCGTGCCAAT  821305

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 34/39 (87%), Gaps = 0/39 (0%)
 Strand=Plus/Minus

Query  356     ACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACA  394
               || ||||| |||| ||||||||||||||| | |||||||
Sbjct  821503  ACTCTCACCACGGCCCGTGCGAGGTCTGGATCGACAACA  821465

>PHRA:scaffold_2892
Length=2014

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 52/67 (78%), Gaps = 3/67 (4%)
 Strand=Plus/Minus

Query  319   CAGCCGATCCCAGCGG---GCACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGC  375
             |||| |||||||| ||   |||| ||  || |  | || ||||| |||||||||||||||
Sbjct  1759  CAGCAGATCCCAGAGGACGGCACCATGAGCCCGTCGGGATACACGCACGACGGTCCGTGC  1700

Query  376   GAGGTCT  382
             ||| |||
Sbjct  1699  GAGATCT  1693

 Score = 50.9 bits (55),  Expect = 7e-04
 Identities = 56/75 (75%), Gaps = 0/75 (0%)
 Strand=Plus/Minus

Query  478   TGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAG  537
             ||||  |||  |||||||||| ||||    || | ||| |||  ||  |  |||||||||
Sbjct  1598  TGCATCCTGTACTGGTACTGGCTGGGTGCGCGATACCTGAAGGGCAGCTACTCGTGGCAG  1539

Query  538   GTGTACAAGGAGTGC  552
             ||||||||||| |||
Sbjct  1538  GTGTACAAGGAATGC  1524

>PHRA:scaffold_494
Length=11395

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 52/67 (78%), Gaps = 3/67 (4%)
 Strand=Plus/Minus

Query  319   CAGCCGATCCCAGCGG---GCACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGC  375
             |||| |||||||| ||   |||| ||  || |  | || ||||| |||||||||||||||
Sbjct  8395  CAGCAGATCCCAGAGGACGGCACCATGAGCCCGTCGGGATACACGCACGACGGTCCGTGC  8336

Query  376   GAGGTCT  382
             ||| |||
Sbjct  8335  GAGATCT  8329

 Score = 50.9 bits (55),  Expect = 7e-04
 Identities = 56/75 (75%), Gaps = 0/75 (0%)
 Strand=Plus/Minus

Query  478   TGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAG  537
             ||||  |||  |||||||||| ||||    || | ||| |||  ||  |  |||||||||
Sbjct  8234  TGCATCCTGTACTGGTACTGGCTGGGTGCGCGATACCTGAAGGGCAGCTACTCGTGGCAG  8175

Query  538   GTGTACAAGGAGTGC  552
             ||||||||||| |||
Sbjct  8174  GTGTACAAGGAATGC  8160

>PHPA:scaffold_76 NW_008649062.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.76, whole genome shotgun 
sequence
Length=282732

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 36/41 (88%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  361    CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
              ||||  |||||||| ||| ||||||||||| ||||||||||
Sbjct  43933  CACGTTGGTCCGTGTGAGATCTGGCTTGACGACACCAAGGT  43973

>PHRA:scaffold_9
Length=727265

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 40/48 (83%), Gaps = 0/48 (0%)
 Strand=Plus/Plus

Query  360     TCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTC  407
               ||||| ||||||||||||  ||||||| ||| |||| |||||  ||||
Sbjct  218133  TCACGCCGGTCCGTGCGAAATCTGGCTGGACGACACGAAGGTTCTGTC  218180

>PYVX:scaffold_121 pve_scaffold_121 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_121:1:49194:1 
REF
Length=49194

 Score = 50.9 bits (55),  Expect = 7e-04
 Identities = 35/40 (88%), Gaps = 0/40 (0%)
 Strand=Plus/Minus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGT  406
              |||||||||||| | ||||| ||| |||||| ||||||||
Sbjct  28977  GGTCCGTGCGAGATTTGGCTCGACGACACCATGGTCATGT  28938

 Score = 48.2 bits (52),  Expect = 0.002
 Identities = 35/41 (85%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTC  407
              |||||||||||| ||||||| ||| |||| | |||| ||||
Sbjct  19752  GGTCCGTGCGAGATCTGGCTCGACGACACTATGGTCCTGTC  19712

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 31/35 (89%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
              |||||||||||| ||||||| ||| |||||| |||
Sbjct  17635  GGTCCGTGCGAGATCTGGCTCGACGACACCATGGT  17601

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 31/35 (89%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
              |||||||||||| ||||||| ||| |||||| |||
Sbjct  27207  GGTCCGTGCGAGATCTGGCTCGACGACACCATGGT  27173

>PYUU:scaffold_2029 scf1117875582029 dna:supercontig supercontig:pug:scf1117875582029:1:1550222:1 
REF
Length=1550222

 Score = 50.9 bits (55),  Expect = 7e-04
 Identities = 35/40 (88%), Gaps = 0/40 (0%)
 Strand=Plus/Minus

Query  361     CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGG  400
               ||||| ||||||||||| ||||||  ||||||||||| ||
Sbjct  477763  CACGAAGGTCCGTGCGAAGTCTGGTGTGACAACACCATGG  477724

>PYIW:scaffold_1952 piw_scaffold_1952 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1952:1:6546:1 
REF
Length=6546

 Score = 50.9 bits (55),  Expect = 7e-04
 Identities = 32/35 (91%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  367   GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
             || ||||||||| ||||||| ||||||||||||||
Sbjct  6500  GGCCCGTGCGAGATCTGGCTCGACAACACCAAGGT  6534

>PYIW:scaffold_712 piw_scaffold_712 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_712:1:15016:1 
REF
Length=15016

 Score = 50.9 bits (55),  Expect = 7e-04
 Identities = 32/35 (91%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  367   GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
             || ||||||||| ||||||| ||||||||||||||
Sbjct  1700  GGCCCGTGCGAGATCTGGCTCGACAACACCAAGGT  1666

>PYAP:scaffold_630 pag1_scaffold_630 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_630:1:18565:1 
REF
Length=18565

 Score = 50.9 bits (55),  Expect = 7e-04
 Identities = 32/35 (91%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
              || |||||||||||||||  |||||||||||||||
Sbjct  12231  GGCCCGTGCGAGGTCTGGTGTGACAACACCAAGGT  12197

>PHIF:NW_003303752.1 Phytophthora infestans T30-4 supercont1.7 
genomic scaffold, whole genome shotgun sequence
Length=4595942

 Score = 50.9 bits (55),  Expect = 7e-04
 Identities = 32/35 (91%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  367      GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
                |||||||| ||| ||||||||||| ||||||||||
Sbjct  2065139  GGTCCGTGTGAGATCTGGCTTGACGACACCAAGGT  2065105

>PYIR:scaffold_155 pir_scaffold_155 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_155:1:48358:1 
REF
Length=48358

 Score = 50.0 bits (54),  Expect = 7e-04
 Identities = 45/57 (79%), Gaps = 0/57 (0%)
 Strand=Plus/Plus

Query  450   GATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCT  506
             ||||  || | | || |||||||| || |||| ||||||||||| |||| | |||||
Sbjct  5998  GATCGACTTCTCATCCTGCAAGGGCTCATGCATGCTGCGCTGGTTCTGGCTCGGCCT  6054

 Score = 44.6 bits (48),  Expect = 0.030
 Identities = 36/44 (82%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  463   TCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCT  506
             || || ||||| ||||||| ||||||||||| |||| | || ||
Sbjct  2586  TCCTGTAAGGGCTCGTGCATGCTGCGCTGGTTCTGGCTCGGTCT  2543

 Score = 42.8 bits (46),  Expect = 0.10
 Identities = 26/28 (93%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  367  GGTCCGTGCGAGGTCTGGCTTGACAACA  394
            |||||||||||| ||||||| |||||||
Sbjct  535  GGTCCGTGCGAGCTCTGGCTCGACAACA  508

>PYAR:scaffold_370 par_scaffold_370 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_370:1:20005:1 
REF
Length=20005

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 42/51 (82%), Gaps = 1/51 (2%)
 Strand=Plus/Plus

Query  352    GGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
              |||| ||| |||| ||| |||||||||||||||   ||||| |||||| ||
Sbjct  17683  GGTT-CACGCACGCCGGGCCGTGCGAGGTCTGGTGCGACAATACCAAGCTC  17732

>PYAR:scaffold_88 par_scaffold_88 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_88:1:34485:1 
REF
Length=34485

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 46/59 (78%), Gaps = 0/59 (0%)
 Strand=Plus/Plus

Query  450  GATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTC  508
            ||||| || | || |||||||||||   |||| ||||||||  |||||| | || ||||
Sbjct  547  GATCAACTTCTCGGCGTGCAAGGGGAGCTGCATGCTGCGCTTCTACTGGCTCGGGCTTC  605

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 98/145 (68%), Gaps = 3/145 (2%)
 Strand=Plus/Plus

Query  367   GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAG  426
             |||||||||||| ||||||||||  | |||| ||   |     ||  | ||||| | |||
Sbjct  2582  GGTCCGTGCGAGATCTGGCTTGATGAAACCATGGCGTTCCACAGCGACGACTGCGAGAAG  2641

Query  427   GACTTCC---CGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACG  483
              | |||    ||   | | ||  |  | ||| || | || |||||||||||   |||| |
Sbjct  2642  CAGTTCGGCTCGTCCACGTCCGTCAAGGTCAACTTCTCGGCGTGCAAGGGGAGCTGCATG  2701

Query  484   CTGCGCTGGTACTGGATGGGCCTTC  508
             |||||||  |||||| | || ||||
Sbjct  2702  CTGCGCTTCTACTGGCTCGGGCTTC  2726

>PHPA:scaffold_9 NW_008648995.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.9, whole genome shotgun 
sequence
Length=1651025

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 40/48 (83%), Gaps = 2/48 (4%)
 Strand=Plus/Plus

Query  354     TTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
               |||| | ||||  ||||||||||||||||||   ||| ||||||||||
Sbjct  524148  TTACCCACACG--GGTCCGTGCGAGGTCTGGTGCGACGACACCAAGGT  524193

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 64/90 (71%), Gaps = 0/90 (0%)
 Strand=Plus/Plus

Query  348     CACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTC  407
               ||| || | ||| |||   ||||||||||||||||||   ||| |||| |||||  ||| 
Sbjct  538470  CACGGGCTTCACGCACCCAGGTCCGTGCGAGGTCTGGTGCGACGACACTAAGGTGCTGTT  538529

Query  408     GGGCACCAACTGCAACAAGGACTTCCCGGG  437
                | |  | ||||| | |   | ||||||||
Sbjct  538530  CGACTACGACTGCCAGACCAAATTCCCGGG  538559

>PHCA:scaffold_50 PHYCAscaffold_50
Length=475612

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 52/69 (75%), Gaps = 0/69 (0%)
 Strand=Plus/Plus

Query  352     GGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGC  411
               |||||| ||||| | || || ||||||||||||   ||| |||    || | | |||| |
Sbjct  139486  GGTTACTCTCACCAGGGGCCTTGCGAGGTCTGGTGCGACGACAAGTTGGCCTTCTCGGAC  139545

Query  412     ACCAACTGC  420
               |||||||||
Sbjct  139546  ACCAACTGC  139554

 Score = 44.6 bits (48),  Expect = 0.030
 Identities = 54/74 (73%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  361     CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGC  420
               ||||| |||||||||||||| |||   ||  |||||   ||| |   || |  |||||||
Sbjct  151167  CACGAAGGTCCGTGCGAGGTTTGGTGCGATGACACCCGCGTCTTCCAGGACGACAACTGC  151226

Query  421     AACAAGGACTTCCC  434
                 |||| |||||||
Sbjct  151227  CCCAAGAACTTCCC  151240

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  361     CACGACGGTCCGTGCGAGGTCTGGCTTGACAACAC  395
               ||||| || |||||||||||||||   ||| ||||
Sbjct  136277  CACGAAGGCCCGTGCGAGGTCTGGTGCGACGACAC  136311

>PYVX:scaffold_639 pve_scaffold_639 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_639:1:17349:1 
REF
Length=17349

 Score = 48.2 bits (52),  Expect = 0.002
 Identities = 32/36 (89%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  366   CGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
             ||| ||||||||||| ||||| ||| ||||||||||
Sbjct  2183  CGGGCCGTGCGAGGTGTGGCTCGACGACACCAAGGT  2148

>PYIR:scaffold_81 pir_scaffold_81 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_81:1:58218:1 
REF
Length=58218

 Score = 48.2 bits (52),  Expect = 0.002
 Identities = 29/31 (94%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  530   CGTGGCAGGTGTACAAGGAGTGCGTGCCAAT  560
             ||||||||||||||||| |||||||||| ||
Sbjct  4563  CGTGGCAGGTGTACAAGCAGTGCGTGCCGAT  4533

>PYAP:scaffold_123 pag1_scaffold_123 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_123:1:61624:1 
REF
Length=61624

 Score = 48.2 bits (52),  Expect = 0.002
 Identities = 32/36 (89%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
              ||||||||||||||||||  |||||| |||||| ||
Sbjct  53697  GGTCCGTGCGAGGTCTGGTGTGACAAGACCAAGCTC  53662

>PHRA:scaffold_52
Length=349176

 Score = 48.2 bits (52),  Expect = 0.002
 Identities = 35/41 (85%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  361     CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
               |||| ||| ||||||||| ||||||||||| |||  |||||
Sbjct  102612  CACGTCGGCCCGTGCGAGATCTGGCTTGACGACAAGAAGGT  102572

>SAPA:scaffold_19 supercont2.19 dna:supercontig supercontig:ASM15154v2:supercont2.19:1:569072:1 
REF
Length=569072

 Score = 47.3 bits (51),  Expect = 0.009
 Identities = 27/28 (96%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  367     GGTCCGTGCGAGGTCTGGCTTGACAACA  394
               |||||||||||||||||||| |||||||
Sbjct  464772  GGTCCGTGCGAGGTCTGGCTCGACAACA  464799

 Score = 42.8 bits (46),  Expect = 0.10
 Identities = 26/28 (93%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  367     GGTCCGTGCGAGGTCTGGCTTGACAACA  394
               |||||||||||||||||| | |||||||
Sbjct  459465  GGTCCGTGCGAGGTCTGGATCGACAACA  459492

>PYVX:scaffold_305 pve_scaffold_305 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_305:1:30708:1 
REF
Length=30708

 Score = 47.3 bits (51),  Expect = 0.009
 Identities = 36/43 (84%), Gaps = 0/43 (0%)
 Strand=Plus/Minus

Query  357    CACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAG  399
              ||| |||  |||||||||||||||||||   ||| ||||||||
Sbjct  15595  CACGCACCCCGGTCCGTGCGAGGTCTGGTGCGACGACACCAAG  15553

>PYVX:scaffold_745 pve_scaffold_745 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_745:1:14285:1 
REF
Length=14285

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 34/40 (85%), Gaps = 0/40 (0%)
 Strand=Plus/Minus

Query  21    GTCCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCGCTC  60
             |||| | |||||||||||||||  | ||||| ||||||||
Sbjct  7157  GTCCTTGGCGCTCGCCGCCATCTCGCCCAGCTCCGCGCTC  7118

>PYVX:scaffold_50 pve_scaffold_50 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_50:1:72629:1 
REF
Length=72629

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 31/35 (89%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
              |||||||||||| ||||||| ||| |||||| |||
Sbjct  42350  GGTCCGTGCGAGATCTGGCTGGACGACACCATGGT  42384

>PYUU:scaffold_2027 scf1117875582027 dna:supercontig supercontig:pug:scf1117875582027:1:666937:1 
REF
Length=666937

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 28/30 (93%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  28     GCGCTCGCCGCCATCGTGTCCAGCGCCGCG  57
              ||||||||||||||||||| ||||| ||||
Sbjct  23924  GCGCTCGCCGCCATCGTGTACAGCGGCGCG  23895

>PYAP:scaffold_187 pag1_scaffold_187 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_187:1:47143:1 
REF
Length=47143

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 31/35 (89%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  361    CACGACGGTCCGTGCGAGGTCTGGCTTGACAACAC  395
              ||| |||| ||||||||||||||| | ||||||||
Sbjct  10193  CACCACGGCCCGTGCGAGGTCTGGATCGACAACAC  10227

>PHRA:scaffold_4
Length=963095

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 31/35 (89%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  361     CACGACGGTCCGTGCGAGGTCTGGCTTGACAACAC  395
               |||| ||||||||||||| ||||||| ||| ||||
Sbjct  239930  CACGCCGGTCCGTGCGAGATCTGGCTGGACGACAC  239964

 Score = 45.5 bits (49),  Expect = 0.030
 Identities = 35/42 (83%), Gaps = 0/42 (0%)
 Strand=Plus/Plus

Query  361     CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
               |||| ||| ||||||||| ||||||||||| |||  | ||||
Sbjct  235299  CACGCCGGCCCGTGCGAGATCTGGCTTGACGACAAGATGGTC  235340

 Score = 45.5 bits (49),  Expect = 0.030
 Identities = 26/27 (96%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  531     GTGGCAGGTGTACAAGGAGTGCGTGCC  557
               |||||||||||||||||| ||||||||
Sbjct  240124  GTGGCAGGTGTACAAGGACTGCGTGCC  240150

 Score = 45.5 bits (49),  Expect = 0.030
 Identities = 26/27 (96%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  531     GTGGCAGGTGTACAAGGAGTGCGTGCC  557
               |||||||||||||||||| ||||||||
Sbjct  331718  GTGGCAGGTGTACAAGGACTGCGTGCC  331744

 Score = 42.8 bits (46),  Expect = 0.10
 Identities = 62/84 (74%), Gaps = 8/84 (10%)
 Strand=Plus/Plus

Query  478     TGCACGCTGCGCTGGTACTGGATGGGCCTTC----GCTTCCTCAAGAACAAGTGGTCGTG  533
               |||| |||||| |  |||||| ||| |||||    || ||  ||    ||  |||| |||
Sbjct  333420  TGCATGCTGCGGTTCTACTGGCTGG-CCTTCCAGGGCGTCGACAGCTCCA--TGGT-GTG  333475

Query  534     GCAGGTGTACAAGGAGTGCGTGCC  557
               ||||||||||||| | ||||||||
Sbjct  333476  GCAGGTGTACAAGAACTGCGTGCC  333499

 Score = 41.9 bits (45),  Expect = 0.37
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  367     GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
               |||||||||||| ||||||| ||  |||||| |||
Sbjct  228487  GGTCCGTGCGAGATCTGGCTGGATGACACCATGGT  228453

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  366     CGGTCCGTGCGAGGTCTGGCTTGACAAC  393
               ||| ||||||||||||||||| ||| ||
Sbjct  238390  CGGCCCGTGCGAGGTCTGGCTGGACGAC  238417

>HYAP:scaffold_463 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_463:1:12715:1 
REF
Length=12715

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 28/30 (93%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  532   TGGCAGGTGTACAAGGAGTGCGTGCCAATT  561
             |||||||| |||||| ||||||||||||||
Sbjct  7471  TGGCAGGTCTACAAGCAGTGCGTGCCAATT  7442

>HYAP:scaffold_59 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_59:1:376122:1 
REF
Length=376122

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 28/30 (93%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  532     TGGCAGGTGTACAAGGAGTGCGTGCCAATT  561
               |||||||| |||||| ||||||||||||||
Sbjct  365155  TGGCAGGTCTACAAGCAGTGCGTGCCAATT  365126

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 128/198 (65%), Gaps = 6/198 (3%)
 Strand=Plus/Plus

Query  352     GGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGC  411
               || ||||| |  ||||| || || ||||||||| | ||  ||||  | || |  || || 
Sbjct  161507  GGCTACACGCTGGACGGCCCCTGTGAGGTCTGGTTCGATGACACGCAAGTGACATCAGGG  161566

Query  412     ACCAACTGCAACAAGGACTTCCCG---GGAAAGACCCACTCGATCAGCTACGCGTCGTGC  468
                 ||| ||   || ||| ||||||   ||| ||   ||   | |   ||||   ||||||
Sbjct  161567  CGCAATTGTCGCACGGAATTCCCGCACGGACAGCATCA---GGTGGACTACAGCTCGTGC  161623

Query  469     AAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGG  528
                  |  |||||||| || || ||||||||| | ||| |||  | | |  |    |  |  
Sbjct  161624  GGAGACTCGTGCACCCTCCGGTGGTACTGGCTCGGCATTCAGTACATGGATGGTATCTAC  161683

Query  529     TCGTGGCAGGTGTACAAG  546
               |||||||||||||| |||
Sbjct  161684  TCGTGGCAGGTGTATAAG  161701

>PYAR:scaffold_6810 par_scaffold_6810 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_6810:1:1098:1 
REF
Length=1098

 Score = 45.5 bits (49),  Expect = 0.030
 Identities = 35/42 (83%), Gaps = 0/42 (0%)
 Strand=Plus/Plus

Query  361  CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
            ||||  || ||||||||| |||||   |||||||||||||||
Sbjct  754  CACGCTGGCCCGTGCGAGATCTGGTGCGACAACACCAAGGTC  795

>PHSO:scaffold_2
Length=11587142

 Score = 45.5 bits (49),  Expect = 0.030
 Identities = 60/81 (74%), Gaps = 2/81 (2%)
 Strand=Plus/Plus

Query  478      TGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAG-TGGTCGTGGCA  536
                |||| ||||||||  |||||| |||   | |    | |  | | |||| |||| ||||||
Sbjct  2560056  TGCATGCTGCGCTTCTACTGGTTGGCGTTCCAGGGCGTTGATAGCAAGATGGT-GTGGCA  2560114

Query  537      GGTGTACAAGGAGTGCGTGCC  557
                |||||||||||| ||||| ||
Sbjct  2560115  GGTGTACAAGGACTGCGTACC  2560135

 Score = 45.5 bits (49),  Expect = 0.030
 Identities = 26/27 (96%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  531      GTGGCAGGTGTACAAGGAGTGCGTGCC  557
                |||||||||||||||||| ||||||||
Sbjct  2679871  GTGGCAGGTGTACAAGGACTGCGTGCC  2679845

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  159      CGAGAACCAGGGCTACAAGACCACC  183
                |||||||||||||| ||||| ||||
Sbjct  6971891  CGAGAACCAGGGCTGCAAGATCACC  6971867

>PHCA:scaffold_24 PHYCAscaffold_24
Length=787421

 Score = 45.5 bits (49),  Expect = 0.030
 Identities = 26/27 (96%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  531     GTGGCAGGTGTACAAGGAGTGCGTGCC  557
               |||||||||||||||||| ||||||||
Sbjct  172331  GTGGCAGGTGTACAAGGACTGCGTGCC  172357

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  361     CACGACGGTCCGTGCGAGGTCTGGCTTGACAACA  394
               |||| ||||||||||||| ||||| | ||| |||
Sbjct  167800  CACGCCGGTCCGTGCGAGATCTGGTTGGACGACA  167833

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  361     CACGACGGTCCGTGCGAGGTCTGGCTTGA  389
               |||| ||||||||||||| ||||||| ||
Sbjct  170737  CACGCCGGTCCGTGCGAGATCTGGCTGGA  170765

>PYIW:scaffold_270 piw_scaffold_270 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_270:1:22416:1 
REF
Length=22416

 Score = 44.6 bits (48),  Expect = 0.030
 Identities = 30/34 (88%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  361    CACGACGGTCCGTGCGAGGTCTGGCTTGACAACA  394
              ||| |||| ||||||||||||||| | |||||||
Sbjct  16945  CACCACGGCCCGTGCGAGGTCTGGATCGACAACA  16978

>PYIW:scaffold_182 piw_scaffold_182 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_182:1:25962:1 
REF
Length=25962

 Score = 44.6 bits (48),  Expect = 0.030
 Identities = 30/34 (88%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  366   CGGTCCGTGCGAGGTCTGGCTTGACAACACCAAG  399
             ||| |||||||||| |||| | ||||||||||||
Sbjct  1698  CGGCCCGTGCGAGGCCTGGATCGACAACACCAAG  1731

>PYAP:scaffold_216 pag1_scaffold_216 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_216:1:44217:1 
REF
Length=44217

 Score = 44.6 bits (48),  Expect = 0.030
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  367  GGTCCGTGCGAGGTCTGGCTTGACAACAC  395
            |||||||||||| ||||||| ||||||||
Sbjct  592  GGTCCGTGCGAGATCTGGCTCGACAACAC  564

 Score = 44.6 bits (48),  Expect = 0.030
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  367   GGTCCGTGCGAGGTCTGGCTTGACAACAC  395
             |||||||||||| ||||||| ||||||||
Sbjct  3522  GGTCCGTGCGAGATCTGGCTCGACAACAC  3494

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  361   CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACC  396
             |||| ||| || || ||| ||||| |||||||||||
Sbjct  1936  CACGCCGGCCCATGTGAGTTCTGGGTTGACAACACC  1901

>PYAP:scaffold_74 pag1_scaffold_74 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_74:1:72664:1 
REF
Length=72664

 Score = 44.6 bits (48),  Expect = 0.030
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  532  TGGCAGGTGTACAAGGAGTGCGTGCCAAT  560
            ||||||||||||||| |||||| ||||||
Sbjct  692  TGGCAGGTGTACAAGCAGTGCGCGCCAAT  664

 Score = 44.6 bits (48),  Expect = 0.030
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  532   TGGCAGGTGTACAAGGAGTGCGTGCCAAT  560
             ||||||||||||||| |||||| ||||||
Sbjct  3570  TGGCAGGTGTACAAGCAGTGCGCGCCAAT  3542

>PHRA:scaffold_29
Length=529199

 Score = 44.6 bits (48),  Expect = 0.030
 Identities = 54/74 (73%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  361     CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGC  420
               ||||| || ||||||||||| |||  |||| |||||   ||  |   || |  |||||||
Sbjct  472692  CACGAGGGCCCGTGCGAGGTGTGGTGTGACGACACCCGTGTGTTCCAGGACGACAACTGC  472751

Query  421     AACAAGGACTTCCC  434
                 |||| |||||||
Sbjct  472752  CCCAAGAACTTCCC  472765

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  359     CTCACGACGGTCCGTGCGAGGTCTGG  384
               ||||||| ||||| ||||||||||||
Sbjct  455350  CTCACGAAGGTCCATGCGAGGTCTGG  455375

>PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.4, whole genome shotgun 
sequence
Length=2787191

 Score = 44.6 bits (48),  Expect = 0.030
 Identities = 24/24 (100%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  361     CACGACGGTCCGTGCGAGGTCTGG  384
               ||||||||||||||||||||||||
Sbjct  568839  CACGACGGTCCGTGCGAGGTCTGG  568862

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  361     CACGACGGTCCGTGCGAGGTCTGG  384
               ||||| ||||||||||||||||||
Sbjct  493506  CACGAGGGTCCGTGCGAGGTCTGG  493483

>PYIW:scaffold_3644 piw_scaffold_3644 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_3644:1:2839:1 
REF
Length=2839

 Score = 43.7 bits (47),  Expect = 0.10
 Identities = 49/66 (74%), Gaps = 0/66 (0%)
 Strand=Plus/Minus

Query  361   CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGGGCACCAACTGC  420
             ||||| || |||||||||||||||   |||||||| | || | |    |||  |||||||
Sbjct  1580  CACGAGGGCCCGTGCGAGGTCTGGTGCGACAACACGATGGCCTTCCATGGCGACAACTGC  1521

Query  421   AACAAG  426
               ||||
Sbjct  1520  GCCAAG  1515

>PYAR:scaffold_2617 par_scaffold_2617 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_2617:1:4678:1 
REF
Length=4678

 Score = 43.7 bits (47),  Expect = 0.10
 Identities = 31/36 (86%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  367   GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
             || ||||||||||| |||   |||||||||||||||
Sbjct  1185  GGCCCGTGCGAGGTTTGGTGCGACAACACCAAGGTC  1150

>PYAR:scaffold_1613 par_scaffold_1613 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1613:1:7643:1 
REF
Length=7643

 Score = 43.7 bits (47),  Expect = 0.10
 Identities = 31/36 (86%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  367   GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
             || |||||||||||||||   |||||||||||| ||
Sbjct  7302  GGACCGTGCGAGGTCTGGTGCGACAACACCAAGCTC  7267

>PYAR:scaffold_480 par_scaffold_480 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_480:1:17633:1 
REF
Length=17633

 Score = 43.7 bits (47),  Expect = 0.10
 Identities = 31/36 (86%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
              || ||||||||||||||| | | |||||||| ||||
Sbjct  17422  GGGCCGTGCGAGGTCTGGATCGGCAACACCATGGTC  17387

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  531  GTGGCAGGTGTACAAGGAGTGCG  553
            |||||||||||||||| ||||||
Sbjct  291  GTGGCAGGTGTACAAGCAGTGCG  313

>PHPA:scaffold_19 NW_008649005.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.19, whole genome shotgun 
sequence
Length=1020763

 Score = 43.7 bits (47),  Expect = 0.10
 Identities = 34/41 (83%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  361    CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
              ||| |||||||||||||||| ||| | ||| |||| | |||
Sbjct  49613  CACCACGGTCCGTGCGAGGTTTGGATCGACGACACTATGGT  49653

>APIN:scaffold_11 supercont1.11 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.11:1:1510989:1 
REF
Length=1510989

 Score = 43.7 bits (47),  Expect = 0.10
 Identities = 37/46 (80%), Gaps = 0/46 (0%)
 Strand=Plus/Plus

Query  461     CGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCT  506
               |||||||||  |||||||||||| | ||||  |||||| | | |||
Sbjct  823195  CGTCGTGCATCGGGTCGTGCACGATTCGCTTCTACTGGCTCGCCCT  823240

>SADI:scaffold_91 supercont1.91 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.91:1:209005:1 
REF
Length=209005

 Score = 42.8 bits (46),  Expect = 0.10
 Identities = 26/28 (93%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  367     GGTCCGTGCGAGGTCTGGCTTGACAACA  394
               |||||||||||| ||||||| |||||||
Sbjct  157714  GGTCCGTGCGAGATCTGGCTCGACAACA  157687

>PHKE:scaffold_221 scf_22126_221.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_221.1:1:58736:1 
REF
Length=58736

 Score = 42.8 bits (46),  Expect = 0.10
 Identities = 76/107 (71%), Gaps = 7/107 (7%)
 Strand=Plus/Minus

Query  456    CTACGCGTCGTG--CAAGGGGTCG-TGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTT  512
              |||| |||||||  |   |||| | |||| | | ||||  ||||||||||  ||  ||  
Sbjct  52842  CTACTCGTCGTGTGCTGCGGGTGGGTGCATGTTCCGCTTCTACTGGATGGCGCT--GCAG  52785

Query  513    CCTCAAGAA--CAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCC  557
              | || |||   ||||  ||  ||||||||||||||| | || |||||
Sbjct  52784  CGTCTAGATGGCAAGACGTACTGGCAGGTGTACAAGAATTGTGTGCC  52738

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 29/33 (88%), Gaps = 1/33 (3%)
 Strand=Plus/Minus

Query  525    GTGGTCGTGGCAGGTGTACAAGGAGTGCGTGCC  557
              ||||| |||||||||||| ||||| || |||||
Sbjct  51108  GTGGT-GTGGCAGGTGTATAAGGACTGTGTGCC  51077

>PYUU:scaffold_2038 scf1117875582038 dna:supercontig supercontig:pug:scf1117875582038:1:913258:1 
REF
Length=913258

 Score = 41.9 bits (45),  Expect = 0.37
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  214     GGCTACAAGACCCTTCGTGCGTTCATGGACGACAA  248
               |||||||||||||| ||| ||||| | ||| ||||
Sbjct  595999  GGCTACAAGACCCTGCGTTCGTTCCTCGACAACAA  595965

 Score = 41.9 bits (45),  Expect = 0.37
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  214     GGCTACAAGACCCTTCGTGCGTTCATGGACGACAA  248
               |||||||||||||| ||| ||||| | ||| ||||
Sbjct  598032  GGCTACAAGACCCTGCGTTCGTTCCTCGACAACAA  598066

 Score = 41.9 bits (45),  Expect = 0.37
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  214     GGCTACAAGACCCTTCGTGCGTTCATGGACGACAA  248
               |||||||||||||| ||| ||||| | ||| ||||
Sbjct  598355  GGCTACAAGACCCTGCGTTCGTTCCTCGACAACAA  598321

 Score = 41.9 bits (45),  Expect = 0.37
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  214     GGCTACAAGACCCTTCGTGCGTTCATGGACGACAA  248
               |||||||||||||| ||| ||||| | ||| ||||
Sbjct  601381  GGCTACAAGACCCTGCGTTCGTTCCTCGACAACAA  601415

>PYIR:scaffold_871 pir_scaffold_871 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_871:1:14137:1 
REF
Length=14137

 Score = 41.9 bits (45),  Expect = 0.37
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  359   CTCACGACGGTCCGTGCGAGGTCTGGCTTGACAAC  393
             ||||||| ||||| ||||||||||||   ||||||
Sbjct  2798  CTCACGAGGGTCCTTGCGAGGTCTGGTGCGACAAC  2832

>PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2956, whole genome shotgun sequence
Length=1921269

 Score = 41.9 bits (45),  Expect = 0.37
 Identities = 54/75 (72%), Gaps = 0/75 (0%)
 Strand=Plus/Minus

Query  350      CAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTCGG  409
                |||| || || |  || ||||| |||||||||||| |  |||| || | ||| ||  |||
Sbjct  1846741  CAGGCTATACGCTGGATGGTCCTTGCGAGGTCTGGTTGAACAATACGATGGTTATCACGG  1846682

Query  410      GCACCAACTGCAACA  424
                |   ||| ||| |||
Sbjct  1846681  GTCGCAATTGCTACA  1846667

>PHRA:scaffold_555
Length=10086

 Score = 41.9 bits (45),  Expect = 0.37
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  367   GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
             |||||||||||| ||||||| ||  |||||| |||
Sbjct  9786  GGTCCGTGCGAGATCTGGCTGGATGACACCATGGT  9820

>PHKE:scaffold_399 scf_22126_399.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_399.1:1:32365:1 
REF
Length=32365

 Score = 41.9 bits (45),  Expect = 0.37
 Identities = 33/40 (83%), Gaps = 0/40 (0%)
 Strand=Plus/Plus

Query  361    CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGG  400
              ||||  |||||||| ||  |||||||||||| ||| ||||
Sbjct  30915  CACGTTGGTCCGTGTGAAATCTGGCTTGACAGCACTAAGG  30954

>PHIF:NW_003303743.1 Phytophthora infestans T30-4 supercont1.16 
genomic scaffold, whole genome shotgun sequence
Length=3114892

 Score = 41.9 bits (45),  Expect = 0.37
 Identities = 42/54 (78%), Gaps = 2/54 (4%)
 Strand=Plus/Minus

Query  354      TTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTCATGTC  407
                |||| | ||||  ||||||||||| ||||||   ||| ||||||| ||  ||||
Sbjct  1519456  TTACCCACACG--GGTCCGTGCGAAGTCTGGTGCGACGACACCAAAGTGTTGTC  1519405

>PHIF:NW_003303741.1 Phytophthora infestans T30-4 supercont1.18 
genomic scaffold, whole genome shotgun sequence
Length=2518706

 Score = 41.9 bits (45),  Expect = 0.37
 Identities = 69/97 (71%), Gaps = 6/97 (6%)
 Strand=Plus/Minus

Query  139      TGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGC  198
                |||||||| ||||| || |||||   |||||||| |  |  |   | |||||||||||| 
Sbjct  1594447  TGGAACCCTCTCGCATTCCTCGAATCCCAGGGCTTCCCGTGCCAGGAAGACTTCAACGGT  1594388

Query  199      T-ACAT--CAAGTCCAAGGGCTACAAGACCCTTCGTG  232
                |  | |  ||||   || |||||||||  ||| ||||
Sbjct  1594387  TGGCGTGCCAAG---AACGGCTACAAGGACCTGCGTG  1594354

>PHIF:NW_003303738.1 Phytophthora infestans T30-4 supercont1.21 
genomic scaffold, whole genome shotgun sequence
Length=2319577

 Score = 41.9 bits (45),  Expect = 0.37
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  361      CACGACGGTCCGTGCGAGGTCTGGCTTGACAACAC  395
                |||||||||||||||||| |||||  |||  ||||
Sbjct  1090009  CACGACGGTCCGTGCGAGATCTGGTGTGATGACAC  1090043

>PYVX:scaffold_1989 pve_scaffold_1989 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1989:1:1804:1 
REF
Length=1804

 Score = 41.0 bits (44),  Expect = 0.37
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  359   CTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACAC  395
             ||||| | ||||||||||||||||||   ||| ||||
Sbjct  1629  CTCACCAGGGTCCGTGCGAGGTCTGGTGCGACGACAC  1593

>PYVX:scaffold_496 pve_scaffold_496 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_496:1:22231:1 
REF
Length=22231

 Score = 41.0 bits (44),  Expect = 0.37
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAAC  393
              |||||||||||||||||||| ||| ||
Sbjct  10371  GGTCCGTGCGAGGTCTGGCTCGACGAC  10345

>PYVX:scaffold_90 pve_scaffold_90 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_90:1:56889:1 
REF
Length=56889

 Score = 41.0 bits (44),  Expect = 0.37
 Identities = 41/53 (77%), Gaps = 3/53 (6%)
 Strand=Plus/Minus

Query  24     CCTCGCGCTCGCCGCCATCGTG---TCCAGCGCCGCGCTCTGCGACTCGTCGG  73
              |||||||||||||| |||||||   ||| |||||| |  || | |||  ||||
Sbjct  54092  CCTCGCGCTCGCCGGCATCGTGGGCTCCGGCGCCGTGTACTACTACTACTCGG  54040

>PYIW:scaffold_7003 piw_scaffold_7003 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_7003:1:774:1 
REF
Length=774

 Score = 41.0 bits (44),  Expect = 0.37
 Identities = 43/57 (75%), Gaps = 0/57 (0%)
 Strand=Plus/Plus

Query  450  GATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCT  506
            ||||  || | || | ||||||||   ||||| ||||||||||| |||| | || ||
Sbjct  410  GATCGACTTCTCGGCCTGCAAGGGCAAGTGCATGCTGCGCTGGTTCTGGCTCGGGCT  466

>PYIR:scaffold_167 pir_scaffold_167 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_167:1:46471:1 
REF
Length=46471

 Score = 41.0 bits (44),  Expect = 0.37
 Identities = 32/38 (84%), Gaps = 3/38 (8%)
 Strand=Plus/Plus

Query  417    CTGCAACAAGGACTTCCCGGGAAAGACCCACTCGATCA  454
              ||| |||||||||||||||   || ||| |||||||||
Sbjct  28633  CTGGAACAAGGACTTCCCG---AACACCGACTCGATCA  28667

>PYAR:scaffold_8021 par_scaffold_8021 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_8021:1:822:1 
REF
Length=822

 Score = 41.0 bits (44),  Expect = 0.37
 Identities = 34/42 (81%), Gaps = 0/42 (0%)
 Strand=Plus/Minus

Query  361  CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
            ||||  || ||||||||| |||||   ||||||||||| |||
Sbjct  173  CACGCTGGCCCGTGCGAGATCTGGTGCGACAACACCAAAGTC  132

>SAPA:scaffold_32 supercont2.32 dna:supercontig supercontig:ASM15154v2:supercont2.32:1:360474:1 
REF
Length=360474

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  367     GGTCCGTGCGAGGTCTGGCTTGACAACAC  395
               |||||||||||| ||||||| |||| |||
Sbjct  116780  GGTCCGTGCGAGATCTGGCTCGACAGCAC  116752

>PYVX:scaffold_2510 pve_scaffold_2510 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_2510:1:1138:1 
REF
Length=1138

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  465  GTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGG  498
            ||||  |||||||||||||||||| |  ||||||
Sbjct  486  GTGCTCGGGGTCGTGCACGCTGCGATTCTACTGG  453

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  361  CACGACGGTCCGTGCGAGGTCTGGCTTGACAAC  393
            ||| ||||||| |||||||||||| | ||| ||
Sbjct  596  CACCACGGTCCATGCGAGGTCTGGATCGACGAC  564

>PYVX:scaffold_1070 pve_scaffold_1070 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1070:1:7524:1 
REF
Length=7524

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  361   CACGACGGTCCGTGCGAGGTCTGG  384
             ||||| ||||||||||||||||||
Sbjct  4377  CACGAAGGTCCGTGCGAGGTCTGG  4354

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  361   CACGACGGTCCGTGCGAGGTCTGG  384
             |||||||||||||||||| |||||
Sbjct  6223  CACGACGGTCCGTGCGAGATCTGG  6200

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  361  CACGACGGTCCGTGCGAGGTCTGGCTTGACAACAC  395
            ||| |||| |||||||||||||||   ||| ||||
Sbjct  40   CACCACGGCCCGTGCGAGGTCTGGTGCGACGACAC  6

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  361   CACGACGGTCCGTGCGAGGTCTGGCTTGACAACAC  395
             || ||||||||||| |||||||||   ||| ||||
Sbjct  1558  CATGACGGTCCGTGTGAGGTCTGGTGCGACGACAC  1524

>PYUU:scaffold_1402 scf1117875581402 dna:supercontig supercontig:pug:scf1117875581402:1:979788:1 
REF
Length=979788

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  532     TGGCAGGTGTACAAGGAGTGCGTGCCAAT  560
               |||||| | |||||| |||||||||||||
Sbjct  159599  TGGCAGATCTACAAGCAGTGCGTGCCAAT  159571

>PYIR:scaffold_1744 pir_scaffold_1744 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_1744:1:5237:1 
REF
Length=5237

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  361   CACGACGGTCCGTGCGAGGTCTGGCTTGACAACA  394
             ||||| || |||||||||||||||   |||||||
Sbjct  1828  CACGAAGGGCCGTGCGAGGTCTGGTGCGACAACA  1861

>PYAP:scaffold_1248 pag1_scaffold_1248 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_1248:1:5139:1 
REF
Length=5139

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 32/39 (82%), Gaps = 0/39 (0%)
 Strand=Plus/Minus

Query  204   CAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGA  242
             |||| ||||||||||| ||||| | |||  |||||| ||
Sbjct  3273  CAAGGCCAAGGGCTACCAGACCGTGCGTCAGTTCATCGA  3235

>PHSO:scaffold_31
Length=53937

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  580  GAGGGAGAGGAAGCCGAAGGTGACGAAGA  608
            ||||||||||||| ||||| |||||| ||
Sbjct  751  GAGGGAGAGGAAGACGAAGATGACGATGA  779

>PHSO:scaffold_6
Length=4785000

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  585      AGAGGAAGCCGAAGGTGACGAAGA  608
                |||||||||||| |||||||||||
Sbjct  1470674  AGAGGAAGCCGACGGTGACGAAGA  1470697

>PHIF:NW_003304531.1 Phytophthora infestans T30-4 supercont1.4149 
genomic scaffold, whole genome shotgun sequence
Length=1472

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  354  TTACACTCACGACGGTCCGTGCGAGGTCT  382
            |||||| ||||||||||| |||||| |||
Sbjct  463  TTACACACACGACGGTCCCTGCGAGATCT  435

>PHIF:NW_003303391.1 Phytophthora infestans T30-4 supercont1.368 
genomic scaffold, whole genome shotgun sequence
Length=80461

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  354    TTACACTCACGACGGTCCGTGCGAGGTCT  382
              |||||| ||||||||||| |||||| |||
Sbjct  40523  TTACACACACGACGGTCCCTGCGAGATCT  40495

>PHCA:scaffold_8 PHYCAscaffold_8
Length=1194346

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  532     TGGCAGGTGTACAAGGAGTGCGTGCCAAT  560
               |||||| | |||||| |||||||||||||
Sbjct  820186  TGGCAGATCTACAAGCAGTGCGTGCCAAT  820158

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  367     GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
               ||||||||||| |  ||| |||| |||||||| ||
Sbjct  850338  GGTCCGTGCGAAGCTTGGATTGATAACACCAAAGT  850372

>APIN:scaffold_17 supercont1.17 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.17:1:1477854:1 
REF
Length=1477854

 Score = 40.1 bits (43),  Expect = 1.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  22       TCCCTCGCGCTCGCCGCCATCGTGTCCAG  50
                |||||||||||  |||||||||| |||||
Sbjct  1223819  TCCCTCGCGCTACCCGCCATCGTTTCCAG  1223791

>PYVX:scaffold_894 pve_scaffold_894 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_894:1:10447:1 
REF
Length=10447

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  361   CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACC  396
             ||||| |||||||||||| |||||   ||| |||||
Sbjct  7597  CACGAGGGTCCGTGCGAGATCTGGTGCGACGACACC  7632

>PYVX:scaffold_385 pve_scaffold_385 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_385:1:26997:1 
REF
Length=26997

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  359    CTCACGACGGTCCGTGCGAGGTCTGG  384
              ||||||| || |||||||||||||||
Sbjct  25923  CTCACGAAGGCCCGTGCGAGGTCTGG  25898

>PYVX:scaffold_74 pve_scaffold_74 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_74:1:63186:1 
REF
Length=63186

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  448    TCGATCAGCTACGCGTCGTGCAAGGGGTCGT  478
              |||||||||   ||||||| |||||||||||
Sbjct  29547  TCGATCAGCATGGCGTCGTCCAAGGGGTCGT  29577

>PYUU:scaffold_2006 scf1117875582006 dna:supercontig supercontig:pug:scf1117875582006:1:1270039:1 
REF
Length=1270039

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  23       CCCTCGCGCTCGCCGCCATCG  43
                |||||||||||||||||||||
Sbjct  1006800  CCCTCGCGCTCGCCGCCATCG  1006820

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  23       CCCTCGCGCTCGCCGCCATCG  43
                |||||||||||||||||||||
Sbjct  1007663  CCCTCGCGCTCGCCGCCATCG  1007683

>PYIR:scaffold_3944 pir_scaffold_3944 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_3944:1:1197:1 
REF
Length=1197

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  616  CTCGCGATCAGCAACACCACC  636
            |||||||||||||||||||||
Sbjct  1    CTCGCGATCAGCAACACCACC  21

>PYAR:scaffold_9435 par_scaffold_9435 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_9435:1:628:1 
REF
Length=628

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  367  GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
            || || |||||||| |||  ||| ||||||||||||
Sbjct  82   GGCCCTTGCGAGGTGTGGTGTGATAACACCAAGGTC  47

>PYAR:scaffold_6624 par_scaffold_6624 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_6624:1:1152:1 
REF
Length=1152

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  367  GGTCCGTGCGAGGTCTGGCTTGACAA  392
            ||||||||||||||||||  ||||||
Sbjct  605  GGTCCGTGCGAGGTCTGGTGTGACAA  580

>PYAP:scaffold_1226 pag1_scaffold_1226 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_1226:1:5389:1 
REF
Length=5389

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  377  AGGTCTGGCTTGACAACACCAAGGTC  402
            |||||||||||||| ||| |||||||
Sbjct  351  AGGTCTGGCTTGACCACATCAAGGTC  376

>PYAP:scaffold_983 pag1_scaffold_983 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_983:1:9183:1 
REF
Length=9183

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  367   GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
             ||||| |||||||| |||   |||||||||||| ||
Sbjct  3772  GGTCCATGCGAGGTATGGTGCGACAACACCAAGCTC  3737

>PYAP:scaffold_392 pag1_scaffold_392 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_392:1:29069:1 
REF
Length=29069

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  241    GACGACAAGAAGGCATACAAGGTCGACGCGG  271
              ||||| |||| | |||||||||||||| |||
Sbjct  18744  GACGAGAAGATGTCATACAAGGTCGACTCGG  18714

>PYAP:scaffold_328 pag1_scaffold_328 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_328:1:32485:1 
REF
Length=32485

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  530    CGTGGCAGGTGTACAAGGAGTGCGTG  555
              |||||||||||||||| || ||||||
Sbjct  27418  CGTGGCAGGTGTACAATGACTGCGTG  27393

>PYAP:scaffold_234 pag1_scaffold_234 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_234:1:42208:1 
REF
Length=42208

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGTC  402
              ||||| || |||| ||||  ||||||||||||| ||
Sbjct  35017  GGTCCATGTGAGGCCTGGTGTGACAACACCAAGATC  35052

>PHRA:scaffold_51
Length=360848

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  530    CGTGGCAGGTGTACAAGGAGTGCGTG  555
              ||||||||||||||| ||| ||||||
Sbjct  38385  CGTGGCAGGTGTACACGGACTGCGTG  38360

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
              || |||||||||||||||   ||  ||||||||||
Sbjct  38542  GGACCGTGCGAGGTCTGGTGCGATGACACCAAGGT  38508

>PHCA:scaffold_49 PHYCAscaffold_49
Length=508508

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 33/41 (80%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  361    CACGACGGTCCGTGCGAGGTCTGGCTTGACAACACCAAGGT  401
              ||| |||| ||||||||||||||| | ||| | || | |||
Sbjct  24935  CACCACGGCCCGTGCGAGGTCTGGATCGACGATACGATGGT  24975

>ALCA:scaffold_13 AcNc2_CONTIG_13_length_192192 dna:supercontig 
supercontig:ASM107853v1:AcNc2_CONTIG_13_length_192192:1:192192:1 
REF
Length=192192

 Score = 39.2 bits (42),  Expect = 1.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  198    CTACATCAAGTCCAAGGGCTACAAGA  223
              |||||||||||||| | |||||||||
Sbjct  82533  CTACATCAAGTCCAGGAGCTACAAGA  82508

>SAPA:scaffold_1 supercont2.1 dna:supercontig supercontig:ASM15154v2:supercont2.1:1:1615555:1 
REF
Length=1615555

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  29      CGCTCGCCGCCATCGTGTCCAGCGCCGC  56
               ||||| ||||||||||||| |||| |||
Sbjct  938756  CGCTCACCGCCATCGTGTCGAGCGTCGC  938729

>SADI:scaffold_264 supercont1.264 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.264:1:6072:1 
REF
Length=6072

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  367   GGTCCGTGCGAGGTCTGGCTTGACAACA  394
             ||||||||||| |||||||| || ||||
Sbjct  1711  GGTCCGTGCGAAGTCTGGCTCGATAACA  1738

>SADI:scaffold_24 supercont1.24 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.24:1:724546:1 
REF
Length=724546

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  367     GGTCCGTGCGAGGTCTGGCTTGACAACA  394
               |||||||||||||| ||||| ||| |||
Sbjct  440046  GGTCCGTGCGAGGTATGGCTGGACGACA  440073

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  367     GGTCCGTGCGAGGTCTGGCTTGACAACA  394
               |||||||||||||| ||||| ||| |||
Sbjct  452981  GGTCCGTGCGAGGTATGGCTGGACGACA  452954

>SADI:scaffold_18 supercont1.18 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.18:1:789572:1 
REF
Length=789572

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  14      TCGTCAAGTCCCTCGCGCTCGCCGCCAT  41
               ||||||  | ||||||||||||||||||
Sbjct  764914  TCGTCATCTTCCTCGCGCTCGCCGCCAT  764941

>PYUU:scaffold_2040 scf1117875582040 dna:supercontig supercontig:pug:scf1117875582040:1:493084:1 
REF
Length=493084

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  588    GGAAGCCGAAGGTGACGAAGAGC  610
              |||||||||||||||||| ||||
Sbjct  35031  GGAAGCCGAAGGTGACGACGAGC  35053

>PYIW:scaffold_1399 piw_scaffold_1399 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1399:1:9130:1 
REF
Length=9130

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  26    TCGCGCTCGCCGCCATCGTGTCCAGCGCCGCGCTCTGC  63
             |||| |||| | |||||||  |||  ||||||||||||
Sbjct  3824  TCGCTCTCGTCCCCATCGTAGCCAATGCCGCGCTCTGC  3861

>PYIW:scaffold_225 piw_scaffold_225 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_225:1:24037:1 
REF
Length=24037

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  194    ACGGCTACATCAAGTCCAAGGGC  216
              |||||||| ||||||||||||||
Sbjct  23489  ACGGCTACGTCAAGTCCAAGGGC  23467

>PYIR:scaffold_718 pir_scaffold_718 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_718:1:17234:1 
REF
Length=17234

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  25    CTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCG  57
             |||||||||||||| ||||||  ||  ||||||
Sbjct  4096  CTCGCGCTCGCCGCGATCGTGGGCACGGCCGCG  4064

>PYIR:scaffold_46 pir_scaffold_46 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_46:1:69731:1 
REF
Length=69731

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  367   GGTCCGTGCGAGGTCTGGCTTGACAACA  394
             ||||| |||||||||||||| ||| |||
Sbjct  2735  GGTCCCTGCGAGGTCTGGCTGGACGACA  2762

>PYAR:scaffold_1366 par_scaffold_1366 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1366:1:8801:1 
REF
Length=8801

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  361   CACGACGGTCCGTGCGAGGTCTGGCTTGACAAC  393
             |||| |||||||||||| |||||| | ||| ||
Sbjct  1461  CACGCCGGTCCGTGCGAAGTCTGGTTCGACGAC  1429

>PYAP:scaffold_529 pag1_scaffold_529 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_529:1:22835:1 
REF
Length=22835

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  197    GCTACATCAAGTCCAAGGGCTAC  219
              ||||||||||||||||| |||||
Sbjct  14095  GCTACATCAAGTCCAAGAGCTAC  14073

>PYAP:scaffold_23 pag1_scaffold_23 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_23:1:110862:1 
REF
Length=110862

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  361   CACGACGGTCCGTGCGAGGTCTG  383
             |||||||||||||||||||| ||
Sbjct  9015  CACGACGGTCCGTGCGAGGTGTG  8993

>PLHA:NW_020187475.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_555, whole genome shotgun sequence
Length=2240492

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  244     GACAAGAAGGCATACAAGGTCGA  266
               |||||||| ||||||||||||||
Sbjct  411349  GACAAGAAAGCATACAAGGTCGA  411327

>PLHA:NW_020186941.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_20, whole genome shotgun sequence
Length=72972

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAACA  394
              ||||| || ||| |||||||||||||||
Sbjct  29951  GGTCCATGTGAGATCTGGCTTGACAACA  29924

>PHRA:scaffold_90
Length=192427

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 48/65 (74%), Gaps = 6/65 (9%)
 Strand=Plus/Plus

Query  3      GGCCCCTTCCGTCGTCAAGTCCCTCGCGCTCGCCGCCATCGTGTCC---AGCGCCGCGCT  59
              |||||| |||| ||||  | | |||||   |||||||  || | ||   |||||||||||
Sbjct  43192  GGCCCCCTCCGCCGTCTCGGCTCTCGC---CGCCGCCTCCGAGACCCTCAGCGCCGCGCT  43248

Query  60     CTGCG  64
              | |||
Sbjct  43249  CAGCG  43253

>PHPA:scaffold_81 NW_008649067.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.81, whole genome shotgun 
sequence
Length=244838

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  357    CACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAACA  394
              ||||||||  |||||||||||  |||  |||||| |||
Sbjct  87524  CACTCACGTTGGTCCGTGCGAAATCTACCTTGACGACA  87561

>APIN:scaffold_25 supercont1.25 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.25:1:1058404:1 
REF
Length=1058404

 Score = 38.3 bits (41),  Expect = 4.5
 Identities = 30/35 (86%), Gaps = 1/35 (3%)
 Strand=Plus/Minus

Query  485    TGCGCTGGTACTGGATGG-GCCTTCGCTTCCTCAA  518
              |||||||||||| ||||| ||| ||||| || |||
Sbjct  16036  TGCGCTGGTACTCGATGGTGCCGTCGCTGCCACAA  16002

>SAPA:scaffold_22 supercont2.22 dna:supercontig supercontig:ASM15154v2:supercont2.22:1:463319:1 
REF
Length=463319

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  471     GGGGTCGTGCACGCTGCGCTGGTAC  495
               |||| ||||||||||||||| ||||
Sbjct  344475  GGGGGCGTGCACGCTGCGCTTGTAC  344499

>SAPA:scaffold_10 supercont2.10 dna:supercontig supercontig:ASM15154v2:supercont2.10:1:790954:1 
REF
Length=790954

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  459     CGCGTCGTGCAAGGGGTCGTGCACGCTGCG  488
               ||||||||||| ||||| |||| || ||||
Sbjct  721914  CGCGTCGTGCACGGGGTTGTGCGCGATGCG  721885

>SAPA:scaffold_3 supercont2.3 dna:supercontig supercontig:ASM15154v2:supercont2.3:1:1275006:1 
REF
Length=1275006

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  38      CCATCGTGTCCAGCGCCGCG  57
               ||||||||||||||||||||
Sbjct  476005  CCATCGTGTCCAGCGCCGCG  475986

>SADI:scaffold_66 supercont1.66 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.66:1:301975:1 
REF
Length=301975

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 40/51 (78%), Gaps = 3/51 (6%)
 Strand=Plus/Plus

Query  24      CCTCGCGCTCGCCG--CCATCGTGTCCAGCGCCGCGCTCTGCGACTCGTCG  72
               |||| |||| ||||  ||  | |||||||||||||| ||||||   |||||
Sbjct  182952  CCTCCCGCT-GCCGATCCCGCTTGTCCAGCGCCGCGATCTGCGCTACGTCG  183001

>SADI:scaffold_12 supercont1.12 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.12:1:915569:1 
REF
Length=915569

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  41      TCGTGTCCAGCGCCGCGCTCTGCGA  65
               ||||||||||||||| |||||| ||
Sbjct  808480  TCGTGTCCAGCGCCGAGCTCTGGGA  808456

>SADI:scaffold_3 supercont1.3 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.3:1:1523884:1 
REF
Length=1523884

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  258     CAAGGTCGACGCGGCGGGCGCCAACTTTGA  287
               ||||||  || |||||| ||||||||||||
Sbjct  821656  CAAGGTGCACACGGCGGCCGCCAACTTTGA  821627

>PYVX:scaffold_881 pve_scaffold_881 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_881:1:10757:1 
REF
Length=10757

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  288   GTGCGGCTACACCAACATCAACGGC  312
             |||||||| | ||||||||||||||
Sbjct  2919  GTGCGGCTTCTCCAACATCAACGGC  2895

>PYVX:scaffold_698 pve_scaffold_698 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_698:1:15486:1 
REF
Length=15486

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  367    GGTCCGTGCGAGGTCTGGCTTGACAACACC  396
              |||||||||||| ||||| | ||| |||||
Sbjct  15193  GGTCCGTGCGAGCTCTGGATCGACGACACC  15222

>PYVX:scaffold_111 pve_scaffold_111 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_111:1:51838:1 
REF
Length=51838

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  514    CTCAAGAACAAGTGGTCGTGGCAGG  538
              |||||||||||||  ||||||||||
Sbjct  13333  CTCAAGAACAAGTTCTCGTGGCAGG  13357

>PYUU:scaffold_1314 scf1117875581314 dna:supercontig supercontig:pug:scf1117875581314:1:162732:1 
REF
Length=162732

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 37/47 (79%), Gaps = 6/47 (13%)
 Strand=Plus/Plus

Query  14      TCGTCAAGTCCCTCGCGCTCGCCGCCATCGTGTCCAGCGCCGCGCTC  60
               |||||||||||| ||||||   || ||| ||   |||||||| ||||
Sbjct  127682  TCGTCAAGTCCCGCGCGCT---CGACATTGT---CAGCGCCGTGCTC  127722

>PYIW:scaffold_1783 piw_scaffold_1783 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1783:1:7131:1 
REF
Length=7131

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  27    CGCGCTCGCCGCCATCGTGTCCAGCGCCGC  56
             ||||||||| |  ||||||||||||| |||
Sbjct  5507  CGCGCTCGCGGGGATCGTGTCCAGCGTCGC  5478

>PYIW:scaffold_1279 piw_scaffold_1279 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1279:1:9892:1 
REF
Length=9892

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 29/34 (85%), Gaps = 2/34 (6%)
 Strand=Plus/Plus

Query  242   ACGACAAGAAGGCATACAAGGTCGACGCGGCGGG  275
             ||||||  |||||| |||  ||||||||||||||
Sbjct  3659  ACGACAGCAAGGCAAACA--GTCGACGCGGCGGG  3690

>PYIW:scaffold_737 piw_scaffold_737 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_737:1:14703:1 
REF
Length=14703

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 35/41 (85%), Gaps = 3/41 (7%)
 Strand=Plus/Minus

Query  30     GCTCGCCGCCATCGTGTCCAGCGCCGCGCTCTGCGACTCGT  70
              ||||| || ||| | ||| || |||||||||||||||||||
Sbjct  11920  GCTCGGCGACAT-GCGTC-AG-GCCGCGCTCTGCGACTCGT  11883

>PYIW:scaffold_57 piw_scaffold_57 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_57:1:35091:1 
REF
Length=35091

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  40     ATCGTGTCCAGCGCCGCGCTCTGCG  64
              ||||| | |||||||||||||||||
Sbjct  12323  ATCGTCTGCAGCGCCGCGCTCTGCG  12347

>PYIR:scaffold_120 pir_scaffold_120 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_120:1:52041:1 
REF
Length=52041

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  24    CCTCGCGCTCGCCGCCATCGTGTCCAGCGC  53
             ||| ||||||||||||  |||||||| |||
Sbjct  5867  CCTGGCGCTCGCCGCCTCCGTGTCCAACGC  5896

>PYAR:scaffold_1918 par_scaffold_1918 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1918:1:6575:1 
REF
Length=6575

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  361  CACGACGGTCCGTGCGAGGTCTGGCTTGAC  390
            ||| |||| || |||||||||||| |||||
Sbjct  733  CACCACGGGCCCTGCGAGGTCTGGATTGAC  762

>PYAP:scaffold_619 pag1_scaffold_619 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_619:1:19241:1 
REF
Length=19241

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 30/36 (83%), Gaps = 3/36 (8%)
 Strand=Plus/Minus

Query  295  TACACCAACATCAACGGCAAGCGCCAG---CCGATC  327
            ||| |||||  ||||||||||||||||   ||||||
Sbjct  118  TACCCCAACTGCAACGGCAAGCGCCAGTCACCGATC  83

>PYAP:scaffold_63 pag1_scaffold_63 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_63:1:76388:1 
REF
Length=76388

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 38/48 (79%), Gaps = 4/48 (8%)
 Strand=Plus/Minus

Query  389    ACAACACCAAGGTCATGTCGGGCACCAAC--TGCAACAAGGACTTCCC  434
              |||||||||||||||| |||   | ||||  |||  | ||||||||||
Sbjct  73369  ACAACACCAAGGTCATCTCGACGATCAACATTGC--CCAGGACTTCCC  73324

>PHRA:scaffold_1564
Length=4246

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  44   TGTCCAGCGCCGCGCTCTGCGACTCGTCGG  73
            ||||||||||| ||  ||||| ||||||||
Sbjct  584  TGTCCAGCGCCACGGCCTGCGCCTCGTCGG  555

>PHRA:scaffold_131
Length=101106

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Plus

Query  25     CTCGCGCTCGCCGCCATCGTG-TCCAG  50
              ||||| ||||||||||||||| |||||
Sbjct  95803  CTCGCTCTCGCCGCCATCGTGTTCCAG  95829

>PHRA:scaffold_42
Length=420019

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  44      TGTCCAGCGCCGCGCTCTGCGACTCGTCGG  73
               ||||||||||| ||  ||||| ||||||||
Sbjct  161606  TGTCCAGCGCCACGGCCTGCGCCTCGTCGG  161577

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  44      TGTCCAGCGCCGCGCTCTGCGACTCGTCGG  73
               ||||||||||| ||  ||||| ||||||||
Sbjct  165297  TGTCCAGCGCCACGGCCTGCGCCTCGTCGG  165326

>PHIF:NW_003303723.1 Phytophthora infestans T30-4 supercont1.36 
genomic scaffold, whole genome shotgun sequence
Length=1665391

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  543      CAAGGAGTGCGTGCCAATTG  562
                ||||||||||||||||||||
Sbjct  1051252  CAAGGAGTGCGTGCCAATTG  1051271

>PHIF:NW_003303506.1 Phytophthora infestans T30-4 supercont1.253 
genomic scaffold, whole genome shotgun sequence
Length=123523

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  358    ACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAA  392
              || ||||| ||||||||||| ||||||   |||||
Sbjct  72047  ACGCACGAAGGTCCGTGCGAAGTCTGGTGCGACAA  72081

>PHCA:scaffold_3 PHYCAscaffold_3
Length=1611504

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  588      GGAAGCCGAAGGTGACGAAGAGCGT  612
                ||||| |||||||||||||| ||||
Sbjct  1014589  GGAAGTCGAAGGTGACGAAGCGCGT  1014565

>APIN:scaffold_7 supercont1.7 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.7:1:2130599:1 
REF
Length=2130599

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  249      GAAGGCATACAAGGTCGACGCGGCG  273
                |||||||||||||| ||||||| ||
Sbjct  2091935  GAAGGCATACAAGGACGACGCGCCG  2091959

>APAS:scaffold_70 supercont1.70 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.70:1:329858:1 
REF
Length=329858

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 28/32 (88%), Gaps = 1/32 (3%)
 Strand=Plus/Minus

Query  32      TCGCCGCCATCGTGT-CCAGCGCCGCGCTCTG  62
               ||||||||  || || ||||||||||||||||
Sbjct  153847  TCGCCGCCTACGAGTTCCAGCGCCGCGCTCTG  153816

>APAS:scaffold_22 supercont1.22 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.22:1:940546:1 
REF
Length=940546

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 34/42 (81%), Gaps = 1/42 (2%)
 Strand=Plus/Minus

Query  273     GGGCGCCAACTTTGAGTG-CGGCTACACCAACATCAACGGCA  313
               ||||| ||| | |||| | |||| ||||  ||||||||||||
Sbjct  348563  GGGCGTCAATTCTGAGCGGCGGCGACACGGACATCAACGGCA  348522

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 34/42 (81%), Gaps = 1/42 (2%)
 Strand=Plus/Minus

Query  273     GGGCGCCAACTTTGAGTG-CGGCTACACCAACATCAACGGCA  313
               ||||| ||| | |||| | |||| ||||  ||||||||||||
Sbjct  361054  GGGCGTCAATTCTGAGCGGCGGCGACACGGACATCAACGGCA  361013

>ALCA:scaffold_46 AcNc2_CONTIG_46_length_118559 dna:supercontig 
supercontig:ASM107853v1:AcNc2_CONTIG_46_length_118559:1:118559:1 
REF
Length=118559

 Score = 37.4 bits (40),  Expect = 4.5
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  579    CGAGGGAGAGGAAGCCGAAGGTGACGAAGA  608
              ||||| ||| ||| ||||||||||||| ||
Sbjct  23070  CGAGGAAGAAGAATCCGAAGGTGACGATGA  23041

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 783818490565

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2