Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
PHCA:scaffold_9397473398953148129620.0
PHSO:scaffold_252402675241753148722400.0
PHRA:scaffold_63168618338148322380.0
PHRA:scaffold_131326254111148722350.0
PHPA:scaffold_2160690162176148721850.0
PHIF:NW_003303740.120636942065167148321380.0
PYVX:scaffold_953808839567149020700.0
HYAP:scaffold_7733985735409142820040.0
PYIW:scaffold_3691840419881149017560.0
SAPA:scaffold_13651030652504148717120.0
SADI:scaffold_45217968219442148717070.0
PHRA:scaffold_35159024160215119717010.0
PYAP:scaffold_1393753539000148216810.0
PYUU:scaffold_1478102581104043148116500.0
APAS:scaffold_1039160492988138515740.0
SADI:scaffold_429205393406136215440.0
SAPA:scaffold_1201967203328136815170.0
PYIR:scaffold_1203746438774132415000.0
APIN:scaffold_4355098356493139914860.0
PYVX:scaffold_103613512621127314550.0
PHKE:scaffold_11762217307986313510.0
PYAR:scaffold_109373738730135813160.0
APAS:scaffold_44234648236007136512800.0
PHPA:scaffold_1494068741936125012650.0
APIN:scaffold_2111640301165384135912610.0
PYAP:scaffold_2523209033437135011840.0
PHKE:scaffold_1029304594401136011140.0
PLHA:NW_020189499.121676221762686510250.0
PYAR:scaffold_11126628275018868950.0
ALCA:scaffold_7476534907614278900.0
ALLA:FR824064129101433514288850.0
PLHA:NW_020188283.183215917608600.0
PHIF:NW_003303721.18922788930427658150.0
PHIF:NW_003303736.1149570214964687678060.0
PHIF:NW_003303722.11675161682847727970.0
PHIF:NW_003303667.13263013270667677970.0
PHKE:scaffold_53517087087910.0
PHIF:NW_003303750.11612351619997657750.0
ALCA:scaffold_45881038953014347600.0
PLHA:NW_020187350.11100161110152113617520.0
ALLA:FR82405216254816374611997180.0
PHSO:scaffold_54460457446166412267058e-180
PHPA:scaffold_381479451486958057048e-180
PYVX:scaffold_160252622659713537023e-179
PHCA:scaffold_6511670711802113336799e-173
PHRA:scaffold_176935877067213346632e-168
PHPA:scaffold_1589310289441613316261e-158
PHRA:scaffold_1454229428745816176e-156
PHIF:NW_003303758.12770672277198613346089e-154
SADI:scaffold_883098183215011836051e-152
PHCA:scaffold_5017941918054311435946e-150
PLHA:NW_020188106.115265265879e-148
PYIW:scaffold_14691600291413365814e-146
PHSO:scaffold_1042393242509711865791e-145
PYAR:scaffold_7172028334913415774e-145
PLHA:NW_020187567.17085857093387545764e-145
PYIW:scaffold_4899557170611585725e-144
PHKE:scaffold_1835061623911955725e-144
PHIF:NW_003303738.193451093567511895662e-142
PYIR:scaffold_176428514416513415611e-140
PYVX:scaffold_271159831714811855601e-140
PHRA:scaffold_2952262952379411865492e-137
PHIF:NW_003303690.13059723065045335413e-135
PYAR:scaffold_112989951016011905351e-133
PHKE:scaffold_155742877541111335341e-133
PHPA:scaffold_229052159058536435311e-132
PHPA:scaffold_4198636119870657285295e-132
APAS:scaffold_913007333014567715262e-131
PHPA:scaffold_2111073117006425232e-130
APAS:scaffold_108578885922313525232e-130
HYAP:scaffold_527448727580813395143e-128
PYAP:scaffold_4954719684513965114e-127
PYIW:scaffold_1597775194612035104e-127
APAS:scaffold_2538872999311425081e-126
SAPA:scaffold_62109151209112125052e-125
PHPA:scaffold_187768017774006364987e-124
APAS:scaffold_1151271624811484972e-123
PHPA:scaffold_7541297418756384958e-123
SADI:scaffold_1562567362685012084933e-122
PHPA:scaffold_11138638413869836364933e-122
PHPA:scaffold_7154599415465936364933e-122
PHPA:scaffold_286114896120886374821e-119
PYIR:scaffold_17262523370012084782e-118
PYUU:scaffold_135467425867557913434601e-113
PYVX:scaffold_67518625299511714342e-106
PHPA:scaffold_603016883020673814248e-104
APIN:scaffold_8512326712437811364092e-99
PHSO:scaffold_47303110730413410554066e-99
PYUU:scaffold_202941959342071711503973e-96
PYAP:scaffold_5552867399111533941e-95
PHIF:NW_003303754.1314363231439923613924e-95
PHIF:NW_003303744.1202616620265323673895e-94
HYAP:scaffold_212420124317711813895e-94
PHRA:scaffold_446299946401610463597e-86
PHPA:scaffold_82601856120210433523e-84
PYAR:scaffold_20461472255411173352e-79
PHCA:scaffold_644490544592210453352e-79
PLHA:NW_020188126.179359079466810983043e-71
PYIW:scaffold_41454511536352964e-69
PHIF:NW_003303719.11337466133848310452858e-66
PHKE:scaffold_179429454396210442811e-64
PYIR:scaffold_46521669222776352666e-61
PHRA:scaffold_1141099781106466752432e-54
APAS:scaffold_21140860114199311722382e-53
PYUU:scaffold_20414089574093974482321e-51
SAPA:scaffold_5107681210772644602264e-50
SADI:scaffold_385249305253824602264e-50
PHIF:NW_003303682.15376725378471762071e-44
PYAP:scaffold_291519557525811976e-42
PHRA:scaffold_1584233726033041903e-40
PHPA:scaffold_6109783710981132871824e-38
PHPA:scaffold_63861588912871722e-35
HYAP:scaffold_553437193440443261679e-34
PLHA:NW_020188562.1111440611148204201653e-33
SADI:scaffold_19922693231594681581e-31
PHRA:scaffold_941788681683001542e-30
SAPA:scaffold_631814491819144671512e-29
APAS:scaffold_13559341597514201487e-29
PHRA:scaffold_201300671303493001448e-28
APIN:scaffold_123275393278543171411e-26
PHCA:scaffold_3795423956432301401e-26
SAPA:scaffold_761219551223794251354e-25
PHSO:scaffold_1627252562731796691331e-24
PHSO:scaffold_7265490226552433481321e-24
PHIF:NW_003303343.180694809943041292e-23
ALLA:FR82414958466591186661238e-22
ALCA:scaffold_425850890245231203e-21
ALCA:scaffold_11640420408344171189e-21
PHRA:scaffold_21413024321311134e-19
PHRA:scaffold_18658429721311134e-19
PHRA:scaffold_11817919211311134e-19
PHRA:scaffold_2989982101121311134e-19
PHRA:scaffold_15231193313231311134e-19
PHRA:scaffold_781743391744691311134e-19
PYVX:scaffold_1829130914181101101e-18
APIN:scaffold_245232795236874121101e-18
PHRA:scaffold_30647368724071072e-17
PHSO:scaffold_212429852431021181062e-17
PHSO:scaffold_172019722020891181062e-17
ALLA:FR82431027358278935441062e-17
PYUU:scaffold_12426686246690904751056e-17
PYAP:scaffold_30714740149291931046e-17
PHCA:scaffold_4153863615389252981022e-16
PYVX:scaffold_234595760641081017e-16
SAPA:scaffold_1991682617779978992e-15
APIN:scaffold_37387819388013196992e-15
PYIR:scaffold_15738871327448943e-14
PYIW:scaffold_44025352746215931e-13
PHPA:scaffold_20800522801106597921e-13
PHRA:scaffold_227718521961110914e-13
PHRA:scaffold_995776885110914e-13
PYAR:scaffold_427713191468150904e-13
PYVX:scaffold_133831838512198891e-12
PYIR:scaffold_156280663017219891e-12
PLHA:NW_020190023.1295201295420223891e-12
PHPA:scaffold_2943618343625977891e-12
APAS:scaffold_716072201607384166891e-12
HYAP:scaffold_10371549371652104881e-12
SADI:scaffold_1358953089695166874e-12
SADI:scaffold_33263799264720952864e-12
SAPA:scaffold_23379375379539165852e-11
PYUU:scaffold_2031508288508499215835e-11
PYIW:scaffold_78686629112455825e-11
PYAP:scaffold_89133681346295758e-09
PHPA:scaffold_574762547769153748e-09
PHIF:NW_003303755.122029722203075104733e-08
PHSO:scaffold_34930944493100966723e-08
PHRA:scaffold_79296922978696701e-07
PHKE:scaffold_2265150151706209701e-07
PHPA:scaffold_114691846924562693e-07
PHKE:scaffold_4541340013503104683e-07
PYAR:scaffold_11953675566204661e-06
PYIW:scaffold_5026697677478615e-05
PHIF:NW_003303705.1230828230931104582e-04
PHCA:scaffold_2012284412291573582e-04
SAPA:scaffold_3841098419791566e-04
PYVX:scaffold_56004608683566e-04
PYIW:scaffold_95963056408104530.008
PHRA:scaffold_5916236616243572530.008
SAPA:scaffold_279457949741520.008
APAS:scaffold_16553270553895635520.008
APAS:scaffold_327101327104836520.008
ALLA:FR824170231292317951520.008
ALCA:scaffold_113310663112156520.008
SADI:scaffold_139701237021191510.026
APIN:scaffold_2685825785831055510.026
PHPA:scaffold_45848734997129500.026
PHCA:scaffold_1656239156244050500.026
PHRA:scaffold_7319306319313472490.092
PHIF:NW_003303725.195146895150942490.092
PYAR:scaffold_15488944892229480.092
APAS:scaffold_87863238638159480.092
PYAP:scaffold_4754067409226470.32
PYAP:scaffold_41830858311733460.32
PHRA:scaffold_5164762478928460.32
PHRA:scaffold_1914621514624228460.32
PHPA:scaffold_3067290667294338460.32
PHIF:NW_003303757.152379352382533460.32
APAS:scaffold_2140653140657446460.32
SADI:scaffold_4827994627997530451.1
SADI:scaffold_25937349376835451.1
PYVX:scaffold_64169771700630451.1
PYUU:scaffold_1239443274437650451.1
PYIW:scaffold_8953270335891451.1
PYIR:scaffold_66102701029930451.1
PYAR:scaffold_24182827285832451.1
PYAR:scaffold_12202732031546451.1
PYAP:scaffold_6383703373230451.1
PHRA:scaffold_818488318494666451.1
PYVX:scaffold_24236402367943441.1
PYIW:scaffold_808133781340427441.1
PYIW:scaffold_254203082033427441.1
PYIR:scaffold_77547134829117441.1
PYAR:scaffold_9202331235727441.1
PHRA:scaffold_137849588499136441.1
PHRA:scaffold_2731092531096339441.1
PHRA:scaffold_1037627137630232441.1
PHPA:scaffold_4834705334709039441.1
SAPA:scaffold_1768649867729433.9
SAPA:scaffold_3130987230989524433.9
SADI:scaffold_4030509830512629433.9
SADI:scaffold_1829606429609229433.9
SADI:scaffold_16246372466833433.9
PYVX:scaffold_11903151318434433.9
PYVX:scaffold_9289512953524433.9
PYUU:scaffold_198719638419641229433.9
PYIW:scaffold_402118161183924433.9
PYAR:scaffold_6482595264754433.9
PYAR:scaffold_406145191454830433.9
PHSO:scaffold_811532211535840433.9
PHSO:scaffold_669917869920629433.9
PHRA:scaffold_4223878723885469433.9
PHRA:scaffold_3217940517942824433.9
PHRA:scaffold_2236894436897431433.9
HYAP:scaffold_8428182728187044433.9
APIN:scaffold_48396043962724433.9
APIN:scaffold_1188103288106029433.9
APAS:scaffold_1194721394723624433.9
SAPA:scaffold_635992103241423.9
SAPA:scaffold_157359063594641423.9
SAPA:scaffold_30551545517421423.9
PYVX:scaffold_498156801570021423.9
PYVX:scaffold_3549351940152423.9
PYVX:scaffold_53143771442653423.9
PYIW:scaffold_231161131613826423.9
PYIW:scaffold_2141671170636423.9
PYIR:scaffold_391272572727721423.9
PYIR:scaffold_3264877491236423.9
PYIR:scaffold_283198381985821423.9
PYAR:scaffold_23019012031423.9
BLASTN 2.12.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= PHYCA_532912

Length=1881
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

PHCA:scaffold_9 PHYCAscaffold_9                                       2672    0.0   
PHSO:scaffold_2                                                       2021    0.0   
PHRA:scaffold_631                                                     2019    0.0   
PHRA:scaffold_1313                                                    2016    0.0   
PHPA:scaffold_2 NW_008648988.1 Phytophthora parasitica INRA-310 u...  1971    0.0   
PHIF:NW_003303740.1 Phytophthora infestans T30-4 supercont1.19 ge...  1929    0.0   
PYVX:scaffold_95 pve_scaffold_95 dna:supercontig supercontig:pve_...  1867    0.0   
HYAP:scaffold_7 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_7:...  1808    0.0   
PYIW:scaffold_369 piw_scaffold_369 dna:supercontig supercontig:pi...  1584    0.0   
SAPA:scaffold_13 supercont2.13 dna:supercontig supercontig:ASM151...  1544    0.0   
SADI:scaffold_45 supercont1.45 dna:supercontig supercontig:Sap_di...  1540    0.0   
PHRA:scaffold_35                                                      1535    0.0   
PYAP:scaffold_139 pag1_scaffold_139 dna:supercontig supercontig:p...  1517    0.0   
PYUU:scaffold_1478 scf1117875581478 dna:supercontig supercontig:p...  1489    0.0   
APAS:scaffold_103 supercont1.103 dna:supercontig supercontig:Apha...  1420    0.0   
SADI:scaffold_42 supercont1.42 dna:supercontig supercontig:Sap_di...  1393    0.0   
SAPA:scaffold_1 supercont2.1 dna:supercontig supercontig:ASM15154...  1369    0.0   
PYIR:scaffold_120 pir_scaffold_120 dna:supercontig supercontig:pi...  1353    0.0   
APIN:scaffold_4 supercont1.4 dna:supercontig supercontig:Apha_inv...  1341    0.0   
PYVX:scaffold_1036 pve_scaffold_1036 dna:supercontig supercontig:...  1313    0.0   
PHKE:scaffold_1176 scf_22126_1176.1_contig_1 dna:supercontig supe...  1219    0.0   
PYAR:scaffold_1093 par_scaffold_1093 dna:supercontig supercontig:...  1187    0.0   
APAS:scaffold_44 supercont1.44 dna:supercontig supercontig:Apha_a...  1155    0.0   
PHPA:scaffold_149 NW_008649135.1 Phytophthora parasitica INRA-310...  1141    0.0   
APIN:scaffold_21 supercont1.21 dna:supercontig supercontig:Apha_i...  1138    0.0   
PYAP:scaffold_252 pag1_scaffold_252 dna:supercontig supercontig:p...  1068    0.0   
PHKE:scaffold_102 scf_22126_102.1 dna:supercontig supercontig:Phy...  1005    0.0   
PLHA:NW_020189499.1 Plasmopara halstedii genome assembly, contig:...  925     0.0   
PYAR:scaffold_111 par_scaffold_111 dna:supercontig supercontig:pa...  808     0.0   
ALCA:scaffold_7 AcNc2_CONTIG_7_length_223839 dna:supercontig supe...  803     0.0   
ALLA:FR824064 dna:supercontig supercontig:ENA1:FR824064:1:197315:...  799     0.0   
PLHA:NW_020188283.1 Plasmopara halstedii genome assembly, contig:...  776     0.0   
PHIF:NW_003303721.1 Phytophthora infestans T30-4 supercont1.38 ge...  736     0.0   
PHIF:NW_003303736.1 Phytophthora infestans T30-4 supercont1.23 ge...  728     0.0   
PHIF:NW_003303722.1 Phytophthora infestans T30-4 supercont1.37 ge...  719     0.0   
PHIF:NW_003303667.1 Phytophthora infestans T30-4 supercont1.92 ge...  719     0.0   
PHKE:scaffold_535 scf_22126_535.1 dna:supercontig supercontig:Phy...  714     0.0   
PHIF:NW_003303750.1 Phytophthora infestans T30-4 supercont1.9 gen...  700     0.0   
ALCA:scaffold_45 AcNc2_CONTIG_45_length_119008 dna:supercontig su...  686     0.0   
PLHA:NW_020187350.1 Plasmopara halstedii genome assembly, contig:...  679     0.0   
ALLA:FR824052 dna:supercontig supercontig:ENA1:FR824052:1:241751:...  648     0.0   
PHSO:scaffold_5                                                       636     8e-180
PHPA:scaffold_38 NW_008649024.1 Phytophthora parasitica INRA-310 ...  636     8e-180
PYVX:scaffold_160 pve_scaffold_160 dna:supercontig supercontig:pv...  634     3e-179
PHCA:scaffold_65 PHYCAscaffold_65                                     613     9e-173
PHRA:scaffold_1                                                       599     2e-168
PHPA:scaffold_15 NW_008649001.1 Phytophthora parasitica INRA-310 ...  565     1e-158
PHRA:scaffold_1454                                                    557     6e-156
PHIF:NW_003303758.1 Phytophthora infestans T30-4 supercont1.1 gen...  549     9e-154
SADI:scaffold_8 supercont1.8 dna:supercontig supercontig:Sap_dicl...  546     1e-152
PHCA:scaffold_50 PHYCAscaffold_50                                     536     6e-150
PLHA:NW_020188106.1 Plasmopara halstedii genome assembly, contig:...  530     9e-148
PYIW:scaffold_1469 piw_scaffold_1469 dna:supercontig supercontig:...  525     4e-146
PHSO:scaffold_10                                                      523     1e-145
PYAR:scaffold_717 par_scaffold_717 dna:supercontig supercontig:pa...  521     4e-145
PLHA:NW_020187567.1 Plasmopara halstedii genome assembly, contig:...  520     4e-145
PYIW:scaffold_4899 piw_scaffold_4899 dna:supercontig supercontig:...  517     5e-144
PHKE:scaffold_183 scf_22126_183.1_contig_1 dna:supercontig superc...  517     5e-144
PHIF:NW_003303738.1 Phytophthora infestans T30-4 supercont1.21 ge...  511     2e-142
PYIR:scaffold_176 pir_scaffold_176 dna:supercontig supercontig:pi...  507     1e-140
PYVX:scaffold_271 pve_scaffold_271 dna:supercontig supercontig:pv...  506     1e-140
PHRA:scaffold_29                                                      496     2e-137
PHIF:NW_003303690.1 Phytophthora infestans T30-4 supercont1.69 ge...  489     3e-135
PYAR:scaffold_1129 par_scaffold_1129 dna:supercontig supercontig:...  483     1e-133
PHKE:scaffold_155 scf_22126_155.1 dna:supercontig supercontig:Phy...  482     1e-133
PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 ...  480     1e-132
PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 u...  478     5e-132
APAS:scaffold_91 supercont1.91 dna:supercontig supercontig:Apha_a...  475     2e-131
PHPA:scaffold_21 NW_008649007.1 Phytophthora parasitica INRA-310 ...  472     2e-130
APAS:scaffold_108 supercont1.108 dna:supercontig supercontig:Apha...  472     2e-130
HYAP:scaffold_5 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_5:...  464     3e-128
PYAP:scaffold_4 pag1_scaffold_4 dna:supercontig supercontig:pag1_...  462     4e-127
PYIW:scaffold_1597 piw_scaffold_1597 dna:supercontig supercontig:...  461     4e-127
APAS:scaffold_253 supercont1.253 dna:supercontig supercontig:Apha...  459     1e-126
SAPA:scaffold_62 supercont2.62 dna:supercontig supercontig:ASM151...  456     2e-125
PHPA:scaffold_18 NW_008649004.1 Phytophthora parasitica INRA-310 ...  450     7e-124
APAS:scaffold_1 supercont1.1 dna:supercontig supercontig:Apha_ast...  449     2e-123
PHPA:scaffold_75 NW_008649061.1 Phytophthora parasitica INRA-310 ...  447     8e-123
SADI:scaffold_15 supercont1.15 dna:supercontig supercontig:Sap_di...  445     3e-122
PHPA:scaffold_11 NW_008648997.1 Phytophthora parasitica INRA-310 ...  445     3e-122
PHPA:scaffold_7 NW_008648993.1 Phytophthora parasitica INRA-310 u...  445     3e-122
PHPA:scaffold_28 NW_008649014.1 Phytophthora parasitica INRA-310 ...  435     1e-119
PYIR:scaffold_1726 pir_scaffold_1726 dna:supercontig supercontig:...  432     2e-118
PYUU:scaffold_1354 scf1117875581354 dna:supercontig supercontig:p...  416     1e-113
PYVX:scaffold_67 pve_scaffold_67 dna:supercontig supercontig:pve_...  392     2e-106
PHPA:scaffold_60 NW_008649046.1 Phytophthora parasitica INRA-310 ...  383     8e-104
APIN:scaffold_85 supercont1.85 dna:supercontig supercontig:Apha_i...  370     2e-99 
PHSO:scaffold_4                                                       367     6e-99 
PYUU:scaffold_2029 scf1117875582029 dna:supercontig supercontig:p...  359     3e-96 
PYAP:scaffold_555 pag1_scaffold_555 dna:supercontig supercontig:p...  356     1e-95 
PHIF:NW_003303754.1 Phytophthora infestans T30-4 supercont1.5 gen...  354     4e-95 
PHIF:NW_003303744.1 Phytophthora infestans T30-4 supercont1.15 ge...  352     5e-94 
HYAP:scaffold_212 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  352     5e-94 
PHRA:scaffold_4                                                       324     7e-86 
PHPA:scaffold_82 NW_008649068.1 Phytophthora parasitica INRA-310 ...  318     3e-84 
PYAR:scaffold_2046 par_scaffold_2046 dna:supercontig supercontig:...  303     2e-79 
PHCA:scaffold_6 PHYCAscaffold_6                                       303     2e-79 
PLHA:NW_020188126.1 Plasmopara halstedii genome assembly, contig:...  275     3e-71 
PYIW:scaffold_414 piw_scaffold_414 dna:supercontig supercontig:pi...  268     4e-69 
PHIF:NW_003303719.1 Phytophthora infestans T30-4 supercont1.40 ge...  258     8e-66 
PHKE:scaffold_179 scf_22126_179.1 dna:supercontig supercontig:Phy...  254     1e-64 
PYIR:scaffold_465 pir_scaffold_465 dna:supercontig supercontig:pi...  241     6e-61 
PHRA:scaffold_114                                                     220     2e-54 
APAS:scaffold_2 supercont1.2 dna:supercontig supercontig:Apha_ast...  215     2e-53 
PYUU:scaffold_2041 scf1117875582041 dna:supercontig supercontig:p...  210     1e-51 
SAPA:scaffold_5 supercont2.5 dna:supercontig supercontig:ASM15154...  205     4e-50 
SADI:scaffold_38 supercont1.38 dna:supercontig supercontig:Sap_di...  205     4e-50 
PHIF:NW_003303682.1 Phytophthora infestans T30-4 supercont1.77 ge...  187     1e-44 
PYAP:scaffold_291 pag1_scaffold_291 dna:supercontig supercontig:p...  178     6e-42 
PHRA:scaffold_1584                                                    172     3e-40 
PHPA:scaffold_6 NW_008648992.1 Phytophthora parasitica INRA-310 u...  165     4e-38 
PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 ...  156     2e-35 
HYAP:scaffold_55 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_5...  151     9e-34 
PLHA:NW_020188562.1 Plasmopara halstedii genome assembly, contig:...  150     3e-33 
SADI:scaffold_199 supercont1.199 dna:supercontig supercontig:Sap_...  143     1e-31 
PHRA:scaffold_941                                                     140     2e-30 
SAPA:scaffold_63 supercont2.63 dna:supercontig supercontig:ASM151...  137     2e-29 
APAS:scaffold_135 supercont1.135 dna:supercontig supercontig:Apha...  134     7e-29 
PHRA:scaffold_20                                                      131     8e-28 
APIN:scaffold_12 supercont1.12 dna:supercontig supercontig:Apha_i...  128     1e-26 
PHCA:scaffold_37 PHYCAscaffold_37                                     127     1e-26 
SAPA:scaffold_76 supercont2.76 dna:supercontig supercontig:ASM151...  123     4e-25 
PHSO:scaffold_1                                                       121     1e-24 
PHSO:scaffold_7                                                       120     1e-24 
PHIF:NW_003303343.1 Phytophthora infestans T30-4 supercont1.417 g...  117     2e-23 
ALLA:FR824149 dna:supercontig supercontig:ENA1:FR824149:1:77927:1...  112     8e-22 
ALCA:scaffold_425 AcNc2_CONTIG_425_length_20423 dna:supercontig s...  109     3e-21 
ALCA:scaffold_116 AcNc2_CONTIG_116_length_69695 dna:supercontig s...  107     9e-21 
PHRA:scaffold_2141                                                    103     4e-19 
PHRA:scaffold_1865                                                    103     4e-19 
PHRA:scaffold_1181                                                    103     4e-19 
PHRA:scaffold_298                                                     103     4e-19 
PHRA:scaffold_152                                                     103     4e-19 
PHRA:scaffold_78                                                      103     4e-19 
PYVX:scaffold_1829 pve_scaffold_1829 dna:supercontig supercontig:...  100     1e-18 
APIN:scaffold_24 supercont1.24 dna:supercontig supercontig:Apha_i...  100     1e-18 
PHRA:scaffold_30                                                      97.8    2e-17 
PHSO:scaffold_21                                                      96.9    2e-17 
PHSO:scaffold_17                                                      96.9    2e-17 
ALLA:FR824310 dna:supercontig supercontig:ENA1:FR824310:1:35902:1...  96.9    2e-17 
PYUU:scaffold_1242 scf1117875581242 dna:supercontig supercontig:p...  96.0    6e-17 
PYAP:scaffold_307 pag1_scaffold_307 dna:supercontig supercontig:p...  95.1    6e-17 
PHCA:scaffold_4 PHYCAscaffold_4                                       93.3    2e-16 
PYVX:scaffold_234 pve_scaffold_234 dna:supercontig supercontig:pv...  92.4    7e-16 
SAPA:scaffold_199 supercont2.199 dna:supercontig supercontig:ASM1...  90.6    2e-15 
APIN:scaffold_37 supercont1.37 dna:supercontig supercontig:Apha_i...  90.6    2e-15 
PYIR:scaffold_1573 pir_scaffold_1573 dna:supercontig supercontig:...  86.0    3e-14 
PYIW:scaffold_440 piw_scaffold_440 dna:supercontig supercontig:pi...  85.1    1e-13 
PHPA:scaffold_20 NW_008649006.1 Phytophthora parasitica INRA-310 ...  84.2    1e-13 
PHRA:scaffold_2277                                                    83.3    4e-13 
PHRA:scaffold_995                                                     83.3    4e-13 
PYAR:scaffold_4277 par_scaffold_4277 dna:supercontig supercontig:...  82.4    4e-13 
PYVX:scaffold_13 pve_scaffold_13 dna:supercontig supercontig:pve_...  81.5    1e-12 
PYIR:scaffold_15 pir_scaffold_15 dna:supercontig supercontig:pir_...  81.5    1e-12 
PLHA:NW_020190023.1 Plasmopara halstedii genome assembly, contig:...  81.5    1e-12 
PHPA:scaffold_29 NW_008649015.1 Phytophthora parasitica INRA-310 ...  81.5    1e-12 
APAS:scaffold_7 supercont1.7 dna:supercontig supercontig:Apha_ast...  81.5    1e-12 
HYAP:scaffold_10 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_1...  80.6    1e-12 
SADI:scaffold_135 supercont1.135 dna:supercontig supercontig:Sap_...  79.7    4e-12 
SADI:scaffold_33 supercont1.33 dna:supercontig supercontig:Sap_di...  78.8    4e-12 
SAPA:scaffold_23 supercont2.23 dna:supercontig supercontig:ASM151...  77.9    2e-11 
PYUU:scaffold_2031 scf1117875582031 dna:supercontig supercontig:p...  76.1    5e-11 
PYIW:scaffold_786 piw_scaffold_786 dna:supercontig supercontig:pi...  75.2    5e-11 
PYAP:scaffold_89 pag1_scaffold_89 dna:supercontig supercontig:pag...  68.9    8e-09 
PHPA:scaffold_57 NW_008649043.1 Phytophthora parasitica INRA-310 ...  68.0    8e-09 
PHIF:NW_003303755.1 Phytophthora infestans T30-4 supercont1.4 gen...  67.1    3e-08 
PHSO:scaffold_3                                                       66.2    3e-08 
PHRA:scaffold_79                                                      64.4    1e-07 
PHKE:scaffold_226 scf_22126_226.1 dna:supercontig supercontig:Phy...  64.4    1e-07 
PHPA:scaffold_114 NW_008649100.1 Phytophthora parasitica INRA-310...  63.5    3e-07 
PHKE:scaffold_454 scf_22126_454.1_contig_1 dna:supercontig superc...  62.6    3e-07 
PYAR:scaffold_119 par_scaffold_119 dna:supercontig supercontig:pa...  60.8    1e-06 
PYIW:scaffold_502 piw_scaffold_502 dna:supercontig supercontig:pi...  56.3    5e-05 
PHIF:NW_003303705.1 Phytophthora infestans T30-4 supercont1.54 ge...  53.6    2e-04 
PHCA:scaffold_20 PHYCAscaffold_20                                     53.6    2e-04 
SAPA:scaffold_3 supercont2.3 dna:supercontig supercontig:ASM15154...  51.8    6e-04 
PYVX:scaffold_5 pve_scaffold_5 dna:supercontig supercontig:pve_sc...  51.8    6e-04 
PYIW:scaffold_959 piw_scaffold_959 dna:supercontig supercontig:pi...  49.1    0.008 
PHRA:scaffold_59                                                      49.1    0.008 
SAPA:scaffold_27 supercont2.27 dna:supercontig supercontig:ASM151...  48.2    0.008 
APAS:scaffold_16 supercont1.16 dna:supercontig supercontig:Apha_a...  48.2    0.008 
APAS:scaffold_3 supercont1.3 dna:supercontig supercontig:Apha_ast...  48.2    0.008 
ALLA:FR824170 dna:supercontig supercontig:ENA1:FR824170:1:70474:1...  48.2    0.008 
ALCA:scaffold_113 AcNc2_CONTIG_113_length_71740 dna:supercontig s...  48.2    0.008 
SADI:scaffold_139 supercont1.139 dna:supercontig supercontig:Sap_...  47.3    0.026 
APIN:scaffold_26 supercont1.26 dna:supercontig supercontig:Apha_i...  47.3    0.026 
PHPA:scaffold_458 NW_008649444.1 Phytophthora parasitica INRA-310...  46.4    0.026 
PHCA:scaffold_16 PHYCAscaffold_16                                     46.4    0.026 
PHRA:scaffold_73                                                      45.5    0.092 
PHIF:NW_003303725.1 Phytophthora infestans T30-4 supercont1.34 ge...  45.5    0.092 
PYAR:scaffold_15 par_scaffold_15 dna:supercontig supercontig:par_...  44.6    0.092 
APAS:scaffold_87 supercont1.87 dna:supercontig supercontig:Apha_a...  44.6    0.092 
PYAP:scaffold_475 pag1_scaffold_475 dna:supercontig supercontig:p...  43.7    0.32  
PYAP:scaffold_41 pag1_scaffold_41 dna:supercontig supercontig:pag...  42.8    0.32  
PHRA:scaffold_516                                                     42.8    0.32  
PHRA:scaffold_19                                                      42.8    0.32  
PHPA:scaffold_30 NW_008649016.1 Phytophthora parasitica INRA-310 ...  42.8    0.32  
PHIF:NW_003303757.1 Phytophthora infestans T30-4 supercont1.2 gen...  42.8    0.32  
APAS:scaffold_21 supercont1.21 dna:supercontig supercontig:Apha_a...  42.8    0.32  
SADI:scaffold_48 supercont1.48 dna:supercontig supercontig:Sap_di...  41.9    1.1   
SADI:scaffold_25 supercont1.25 dna:supercontig supercontig:Sap_di...  41.9    1.1   
PYVX:scaffold_64 pve_scaffold_64 dna:supercontig supercontig:pve_...  41.9    1.1   
PYUU:scaffold_1239 scf1117875581239 dna:supercontig supercontig:p...  41.9    1.1   
PYIW:scaffold_895 piw_scaffold_895 dna:supercontig supercontig:pi...  41.9    1.1   
PYIR:scaffold_66 pir_scaffold_66 dna:supercontig supercontig:pir_...  41.9    1.1   
PYAR:scaffold_2418 par_scaffold_2418 dna:supercontig supercontig:...  41.9    1.1   
PYAR:scaffold_12 par_scaffold_12 dna:supercontig supercontig:par_...  41.9    1.1   
PYAP:scaffold_638 pag1_scaffold_638 dna:supercontig supercontig:p...  41.9    1.1   
PHRA:scaffold_8                                                       41.9    1.1   
PYVX:scaffold_24 pve_scaffold_24 dna:supercontig supercontig:pve_...  41.0    1.1   
PYIW:scaffold_808 piw_scaffold_808 dna:supercontig supercontig:pi...  41.0    1.1   
PYIW:scaffold_254 piw_scaffold_254 dna:supercontig supercontig:pi...  41.0    1.1   
PYIR:scaffold_775 pir_scaffold_775 dna:supercontig supercontig:pi...  41.0    1.1   
PYAR:scaffold_920 par_scaffold_920 dna:supercontig supercontig:pa...  41.0    1.1   
PHRA:scaffold_137                                                     41.0    1.1   
PHRA:scaffold_27                                                      41.0    1.1   
PHRA:scaffold_10                                                      41.0    1.1   
PHPA:scaffold_48 NW_008649034.1 Phytophthora parasitica INRA-310 ...  41.0    1.1   
SAPA:scaffold_176 supercont2.176 dna:supercontig supercontig:ASM1...  40.1    3.9   
SAPA:scaffold_31 supercont2.31 dna:supercontig supercontig:ASM151...  40.1    3.9   
SADI:scaffold_40 supercont1.40 dna:supercontig supercontig:Sap_di...  40.1    3.9   
SADI:scaffold_18 supercont1.18 dna:supercontig supercontig:Sap_di...  40.1    3.9   
SADI:scaffold_16 supercont1.16 dna:supercontig supercontig:Sap_di...  40.1    3.9   
PYVX:scaffold_1190 pve_scaffold_1190 dna:supercontig supercontig:...  40.1    3.9   
PYVX:scaffold_928 pve_scaffold_928 dna:supercontig supercontig:pv...  40.1    3.9   
PYUU:scaffold_1987 scf1117875581987 dna:supercontig supercontig:p...  40.1    3.9   
PYIW:scaffold_402 piw_scaffold_402 dna:supercontig supercontig:pi...  40.1    3.9   
PYAR:scaffold_648 par_scaffold_648 dna:supercontig supercontig:pa...  40.1    3.9   
PYAR:scaffold_406 par_scaffold_406 dna:supercontig supercontig:pa...  40.1    3.9   
PHSO:scaffold_8                                                       40.1    3.9   
PHSO:scaffold_6                                                       40.1    3.9   
PHRA:scaffold_42                                                      40.1    3.9   
PHRA:scaffold_32                                                      40.1    3.9   
PHRA:scaffold_22                                                      40.1    3.9   
HYAP:scaffold_84 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_8...  40.1    3.9   
APIN:scaffold_48 supercont1.48 dna:supercontig supercontig:Apha_i...  40.1    3.9   
APIN:scaffold_11 supercont1.11 dna:supercontig supercontig:Apha_i...  40.1    3.9   
APAS:scaffold_11 supercont1.11 dna:supercontig supercontig:Apha_a...  40.1    3.9   
SAPA:scaffold_635 supercont2.635 dna:supercontig supercontig:ASM1...  39.2    3.9   
SAPA:scaffold_157 supercont2.157 dna:supercontig supercontig:ASM1...  39.2    3.9   
SAPA:scaffold_30 supercont2.30 dna:supercontig supercontig:ASM151...  39.2    3.9   
PYVX:scaffold_498 pve_scaffold_498 dna:supercontig supercontig:pv...  39.2    3.9   
PYVX:scaffold_354 pve_scaffold_354 dna:supercontig supercontig:pv...  39.2    3.9   
PYVX:scaffold_53 pve_scaffold_53 dna:supercontig supercontig:pve_...  39.2    3.9   
PYIW:scaffold_231 piw_scaffold_231 dna:supercontig supercontig:pi...  39.2    3.9   
PYIW:scaffold_214 piw_scaffold_214 dna:supercontig supercontig:pi...  39.2    3.9   
PYIR:scaffold_391 pir_scaffold_391 dna:supercontig supercontig:pi...  39.2    3.9   
PYIR:scaffold_326 pir_scaffold_326 dna:supercontig supercontig:pi...  39.2    3.9   
PYIR:scaffold_283 pir_scaffold_283 dna:supercontig supercontig:pi...  39.2    3.9   
PYAR:scaffold_2301 par_scaffold_2301 dna:supercontig supercontig:...  39.2    3.9   
PYAR:scaffold_437 par_scaffold_437 dna:supercontig supercontig:pa...  39.2    3.9   
PYAR:scaffold_375 par_scaffold_375 dna:supercontig supercontig:pa...  39.2    3.9   
PHRA:scaffold_47                                                      39.2    3.9   
PHRA:scaffold_36                                                      39.2    3.9   
PHRA:scaffold_21                                                      39.2    3.9   
PHRA:scaffold_2                                                       39.2    3.9   
PHPA:scaffold_25 NW_008649011.1 Phytophthora parasitica INRA-310 ...  39.2    3.9   
PHPA:scaffold_14 NW_008649000.1 Phytophthora parasitica INRA-310 ...  39.2    3.9   
PHIF:NW_003303743.1 Phytophthora infestans T30-4 supercont1.16 ge...  39.2    3.9   
PHIF:NW_003303715.1 Phytophthora infestans T30-4 supercont1.44 ge...  39.2    3.9   
HYAP:scaffold_22 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_2...  39.2    3.9   
HYAP:scaffold_19 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_1...  39.2    3.9   

>PHCA:scaffold_9 PHYCAscaffold_9
Length=1114135

 Score = 2672 bits (2962),  Expect = 0.0
 Identities = 1481/1481 (100%), Gaps = 0/1481 (0%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398953  AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  398894

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398893  CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  398834

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398833  TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  398774

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398773  AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  398714

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398713  ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  398654

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398653  TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  398594

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398593  CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  398534

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398533  CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  398474

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398473  TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  398414

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398413  CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  398354

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398353  ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  398294

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398293  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  398234

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398233  TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  398174

Query  1181    CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398173  CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  398114

Query  1241    TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398113  TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  398054

Query  1301    TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  398053  TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  397994

Query  1361    ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  397993  ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  397934

Query  1421    ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  397933  ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  397874

Query  1481    TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  397873  TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  397814

Query  1541    AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  397813  AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  397754

Query  1601    AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  397753  AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  397694

Query  1661    AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  397693  AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  397634

Query  1721    TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  397633  TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  397574

Query  1781    GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCTCCCCCTGCTG  1840
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  397573  GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCTCCCCCTGCTG  397514

Query  1841    GTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
               |||||||||||||||||||||||||||||||||||||||||
Sbjct  397513  GTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  397473

 Score = 2645 bits (2932),  Expect = 0.0
 Identities = 1475/1481 (99%), Gaps = 0/1481 (0%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  401714  AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  401773

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  401774  CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  401833

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  401834  TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  401893

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  401894  AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  401953

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  401954  ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  402013

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402014  TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  402073

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402074  CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  402133

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402134  CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  402193

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402194  TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  402253

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402254  CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  402313

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402314  ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  402373

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402374  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  402433

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402434  TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  402493

Query  1181    CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402494  CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  402553

Query  1241    TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402554  TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  402613

Query  1301    TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402614  TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  402673

Query  1361    ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402674  ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  402733

Query  1421    ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402734  ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  402793

Query  1481    TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
               ||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct  402794  TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCCAACAAGCAGCGTATCGAGGCCA  402853

Query  1541    AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402854  AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  402913

Query  1601    AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  402914  AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  402973

Query  1661    AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
               |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
Sbjct  402974  AGTGGCTGGACGCAAACCAGTCTTTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAGT  403033

Query  1721    TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  403034  TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  403093

Query  1781    GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCTCCCCCTGCTG  1840
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  403094  GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCTCCCCCTGCTG  403153

Query  1841    GTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
               |||||||||| ||||||||||||||||||||||||||||||
Sbjct  403154  GTGCTGCGGAACAGGGCCCGAAGATCGAGGAGGTCGACTAA  403194

 Score = 2461 bits (2729),  Expect = 0.0
 Identities = 1440/1493 (96%), Gaps = 33/1493 (2%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395861  AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  395802

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395801  CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  395742

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395741  TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  395682

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395681  AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  395622

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395621  ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  395562

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395561  TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  395502

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395501  CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  395442

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395441  CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  395382

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395381  TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  395322

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395321  CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  395262

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395261  ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  395202

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct  395201  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTAACGCCGC  395142

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
               ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395141  TGTCTCTAGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  395082

Query  1181    CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
               ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct  395081  CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAACCTGGGGTGC  395022

Query  1241    TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  395021  TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  394962

Query  1301    TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  394961  TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  394902

Query  1361    ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  394901  ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  394842

Query  1421    ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  394841  ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  394782

Query  1481    TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
               |||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||
Sbjct  394781  TATCGGAGGCTGAGAAGTACAAGTCGGAGGACGAGGCCAACAAGCAACGTATCGAGGCCA  394722

Query  1541    AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct  394721  AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGCAACAGTCTGAATGACGAGAAGATGA  394662

Query  1601    AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  394661  AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  394602

Query  1661    AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
               ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||
Sbjct  394601  AGTGGCTGGACGCGAACCAGTCTTTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  394542

Query  1721    TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
               ||||||||||||||||||||||||||||||||||||||||           ||    |||
Sbjct  394541  TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGC-----------GT----CTG  394497

Query  1781    GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGC---TCCCCCTG  1837
               |||      |||||||| | ||||||||||||||||| |||||||||||   | || || 
Sbjct  394496  GTG------GTGGTATGGCTGGTGGTGTGCCGGGCGGAATGCCTGGTGCAGATGCCGCTC  394443

Query  1838    CTGGTGCTGCG---------GACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
               ||  | |  ||         |||||||||||||||||||||||||||||||||
Sbjct  394442  CTACTTCATCGAGTGGCACCGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  394390

 Score = 1338 bits (1483),  Expect = 0.0
 Identities = 843/911 (93%), Gaps = 6/911 (1%)
 Strand=Plus/Minus

Query  977     ACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACG  1036
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314510  ACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACG  314451

Query  1037    GTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACC  1096
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314450  GTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACC  314391

Query  1097    TGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGA  1156
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314390  TGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGA  314331

Query  1157    CGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGT  1216
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314330  CGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGT  314271

Query  1217    ACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGC  1276
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314270  ACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGC  314211

Query  1277    GCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTG  1336
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314210  GCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTG  314151

Query  1337    TGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTG  1396
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314150  TGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTG  314091

Query  1397    TGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCT  1456
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314090  TGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCT  314031

Query  1457    CGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGG  1516
               ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct  314030  CGCAGGCTGACATTGACCGCATGGTTTCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGG  313971

Query  1517    CTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGA  1576
               | ||||||   ||||| ||||| |||||||| || ||||||||||| ||||  ||||| |
Sbjct  313970  CCAACAAGGTCCGCATTGAGGCGAAGAACGCTCTTGAGAACTACGCTTACAACCTGCGTA  313911

Query  1577    ACAGTCTGAATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGG  1636
               |||  || || ||||||||  | |||||  ||||| |||| | ||||||||||||  | |
Sbjct  313910  ACACGCTCAACGACGAGAAACTCAAGGACCAGATCTCGGAGGATGACAAGAAGGCTATTG  313851

Query  1637    ACGACAAGGTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATG  1696
               | ||||||||||| ||    ||| | |||||||| || ||||||||    |||||||| |
Sbjct  313850  AGGACAAGGTGACCGAGACTATCAACTGGCTGGATGCTAACCAGTCCGCCGAGAAGGAGG  313791

Query  1697    CGTACGAGTCGAAGCAGAAGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGT  1756
                |||||||   |||||||||||  |||||||||| ||||||||  |  ||||||||||||
Sbjct  313790  AGTACGAGGGCAAGCAGAAGGAGCTGGAGGGCGTTGCCAACCCGATCCTGCAGAAGATGT  313731

Query  1757    ACGCTGCTGCTGGCGGTTCCCCTGGTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCG  1816
               |||| |||||||||||| |||||||||| ||||||||||||||||||||  |||||||||
Sbjct  313730  ACGCAGCTGCTGGCGGTGCCCCTGGTGCCGAGGGTGGTATGCCCGGTGGCATGCCGGGCG  313671

Query  1817    GCATGCCTGG------TGCTCCCCCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGG  1870
               ||||||||||      |||||| ||||| |||||| ||||||||||||||||||||||||
Sbjct  313670  GCATGCCTGGTGCTGGTGCTCCTCCTGCCGGTGCTCCGGACCAGGGCCCGAAGATCGAGG  313611

Query  1871    AGGTCGACTAA  1881
               |||||||||||
Sbjct  313610  AGGTCGACTAA  313600

 Score = 1069 bits (1185),  Expect = 0.0
 Identities = 1057/1366 (77%), Gaps = 3/1366 (0%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||||||||| | ||| |||||  | ||||||||||||||||||||||| |||||||| |
Sbjct  415839  AGGACGCCGGAGTCATCGCCGGTTTGAACGTGCTGCGTATCATCAACGAACCGACGGCTG  415780

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               | || ||||| || ||||| |||||||| || ||||||| ||| ||| ||||||| || |
Sbjct  415779  CTGCTATCGCCTATGGCCTTGACAAGAAAGGGGGCGAGCACAATGTGTTGATCTTTGATC  415720

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               | ||||| || || || || || || || ||  ||||||| || || ||||||||||| |
Sbjct  415719  TTGGCGGTGGAACGTTTGACGTCTCGCTACTCACCATTGAAGACGGGATCTTCGAGGTGA  415660

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               | ||||| || || |||||||| ||||| ||||||||||| ||||||||||| || ||  
Sbjct  415659  AAGCCACGGCGGGCGACACGCATCTGGGCGGTGAGGACTTTGACAACCGCCTTGTCGAGT  415600

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
                ||||     |||||| ||||||||  | ||||||||||| || | |||||| || ||||
Sbjct  415599  TCTTCGTCTTGGAGTTTAAGCGCAAATATCGCAAGGACATGACTGGGAACCAACGCGCTC  415540

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               | ||||| || |||||||| ||||| || ||||| || ||| ||||  |||| |||||||
Sbjct  415539  TCCGTCGACTCCGGACGGCGTGCGAACGAGCCAAACGCACGTTGTCCACGTCCGCTCAGG  415480

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | ||||| ||||| || ||| | || ||||| ||||| ||||| |||||||| || || |
Sbjct  415479  CGTACATTGAGATCGATTCTTTATTTGACGGTATCGATTTCAATTCGACCATTACCCGCG  415420

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               | ||||| || ||  ||||| |||| |||||||||||||||||||  || || |   | |
Sbjct  415419  CGCGTTTTGAAGATCTGTGCAGCGAATACTTCCGCAAGACGATGGGTCCTGTTGCCCAAG  415360

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               | || |  ||| | |||||||| |||| ||| ||| ||||||| || |||||||| || |
Sbjct  415359  TTCTACAGGACTCGAAGCTGTCCAAGAACCACGTGAACGAGGTCGTTCTGGTGGGTGGGT  415300

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               ||||||| ||||| ||||| ||||||||  ||  ||| || ||||||||||| || |   
Sbjct  415299  CGACGCGAATCCCCAAGGTTCAGCAGCTCTTGATGGAGTTTTTCAACGGCAAAGAACTGT  415240

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                |||||||||||||||||| || || |||||||||||||| ||||| ||||| || ||||
Sbjct  415239  TCAAGTCCATCAACCCGGATGAAGCCGTGGCGTACGGTGCTACCGTCCAGGCTGCGATCC  415180

Query  1061    TGAGCGGCAACG---ACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGC  1117
               | || ||||  |   ||  ||||   ||||| ||||||||||| |||||||||||  |||
Sbjct  415179  TCAGTGGCAGTGGGAACATGTCGTCCAAGCTCCAGGACCTGCTACTGCTGGACGTTGCGC  415120

Query  1118    CGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACA  1177
               || ||||||||||||| |||||||| || || |||||||| |  || ||  | || ||||
Sbjct  415119  CGTTGTCTCTGGGTCTGGAGACGGCTGGAGGAGTCATGACCAAACTCATTCCACGCAACA  415060

Query  1178    CGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGG  1237
               | ||||| ||  |||||||| ||||| |||||||||||||  |||| |||||| | || |
Sbjct  415059  CCACGGTTCCAGCCAAGAAGACGCAGTCGTTCTCGACGTATTCCGATAACCAGTCCGGTG  415000

Query  1238    TGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCA  1297
               || | ||||| |||||||| |||||||| ||| ||||||  |||||| |||| |||||||
Sbjct  414999  TGTTGATCCAAGTGTTCGAAGGCGAGCGATCCTTGACGCAGGACAACCACCTACTGGGCA  414940

Query  1298    AGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGT  1357
               |||| || |||||||| ||||| || ||||  || || ||||| ||||| ||||||||||
Sbjct  414939  AGTTTAATCTGGACGGTATCCCGCCGATGCAGCGTGGCGTGCCTCAGATTGACGTGACGT  414880

Query  1358    TCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGG  1417
               ||||| | ||||  || || ||  |||||||||| || |||||||| || ||||| || |
Sbjct  414879  TCGACGTTGACGTCAATGGGATTTTGAACGTGTCAGCGGTGGAGAAATCGACGGGGAAAG  414820

Query  1418    AGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCA  1477
               ||||||| ||||||||||| |||||||| || || ||||| |||   || || ||||| |
Sbjct  414819  AGAACAAAATCACGATCACCAACGACAAAGGACGTCTCTCTCAGAGCGAGATCGACCGGA  414760

Query  1478    TGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGG  1537
               ||||  | || |||||||||||||||    | |||||    ||||| |  ||||||||| 
Sbjct  414759  TGGTTGCCGATGCCGAGAAGTACAAGGACCAAGACGAACGCAACAAACTGCGCATCGAGT  414700

Query  1538    CCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGA  1597
               | ||||||||||||||||||||||| |    |||||| |      |||| || || ||| 
Sbjct  414699  CGAAGAACGCGCTGGAGAACTACGCGTTTTCTCTGCGTAGTTCCATGAAGGAGGACAAGT  414640

Query  1598    TGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGA  1657
               ||  |  |||  ||   | ||| ||||||||| || | || ||||| ||  ||||   | 
Sbjct  414639  TGGCGACGAAACTCAGCGCAGCGGACAAGAAGACGATTGAGGACAAAGTAGCGGAGACGC  414580

Query  1658    TCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGG  1717
               | |||||||||||||| |||||| |   ||| ||||| | || |||    || ||  | |
Sbjct  414579  TGCAGTGGCTGGACGCCAACCAGGCGGCGGAAAAGGAAGAGTTCGACAGCAAACAACAAG  414520

Query  1718    AATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGC  1763
               || | ||||| |||||||||||  |  |||||||  ||||||| ||
Sbjct  414519  AACTTGAGGGTGTGGCCAACCCCATTATGCAGAAAGTGTACGCAGC  414474

 Score = 1032 bits (1144),  Expect = 0.0
 Identities = 572/572 (100%), Gaps = 0/572 (0%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  315182  AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  315123

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  315122  CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  315063

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  315062  TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  315003

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  315002  AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  314943

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314942  ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  314883

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314882  TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  314823

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314822  CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  314763

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314762  CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  314703

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  314702  TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  314643

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTG  972
               ||||||||||||||||||||||||||||||||
Sbjct  314642  CGACGCGTATCCCGAAGGTGCAGCAGCTGCTG  314611

 Score = 729 bits (808),  Expect = 0.0
 Identities = 407/409 (99%), Gaps = 0/409 (0%)
 Strand=Plus/Minus

Query  1       ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  396351  ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  396292

Query  61      TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  396291  TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  396232

Query  121     ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  396231  ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  396172

Query  181     AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  396171  AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  396112

Query  241     AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  396111  AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  396052

Query  301     GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  396051  GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  395992

Query  361     CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
               |||||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct  395991  CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGTGGCCG  395943

 Score = 729 bits (808),  Expect = 0.0
 Identities = 407/409 (99%), Gaps = 0/409 (0%)
 Strand=Plus/Minus

Query  1       ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  399476  ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  399417

Query  61      TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  399416  TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  399357

Query  121     ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  399356  ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  399297

Query  181     AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  399296  AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  399237

Query  241     AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  399236  AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  399177

Query  301     GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  399176  GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  399117

Query  361     CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
               |||||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct  399116  CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGTGGCCG  399068

 Score = 720 bits (798),  Expect = 0.0
 Identities = 405/409 (99%), Gaps = 0/409 (0%)
 Strand=Plus/Plus

Query  1       ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  401224  ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  401283

Query  61      TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  120
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct  401284  TGCGTGGGCGTGTGGCAGAACGACCGCGTGGAAATCATCGCCAACGACCAGGGCAACCGC  401343

Query  121     ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  401344  ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  401403

Query  181     AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  401404  AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  401463

Query  241     AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  401464  AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  401523

Query  301     GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct  401524  GGCGCCGGTGACAAGCCACAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  401583

Query  361     CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
               |||||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct  401584  CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGTGGCCG  401632

 Score = 572 bits (634),  Expect = 8e-161
 Identities = 362/392 (92%), Gaps = 0/392 (0%)
 Strand=Plus/Minus

Query  18      GTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCA  77
               |||||||||||| |||||||| ||||| ||||| || |||||||||||||||||||||||
Sbjct  315655  GTCTGGATACTCGGTCGGCATTGACCTTGGCACGACGTACTCGTGCGTGGGCGTGTGGCA  315596

Query  78      GAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGT  137
               ||||||||||||||| |||||||| ||||||||||| ||||| || ||||| || |||||
Sbjct  315595  GAACGACCGTGTGGAGATCATCGCTAACGACCAGGGTAACCGTACTACCCCTTCGTACGT  315536

Query  138     CGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAA  197
               ||||||||| ||| | || || || |||||||| ||||| ||||| ||||||||||||||
Sbjct  315535  CGCCTTCACGGACACCGAGCGTCTGATCGGTGATGCCGCTAAGAACCAGGTGGCCATGAA  315476

Query  198     CGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGT  257
               ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
Sbjct  315475  CGCGCACAACACGGTGTTCGACGCCAAGCGTCTGATCGGCCGCAAGTTCTCGGACCCCAT  315416

Query  258     CGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCC  317
               ||||||||| ||||||||||||||||||||| |  ||||||||||||| |||||||||||
Sbjct  315415  CGTCCAGGCTGACATCAAGCACTGGCCGTTCAAGCTGACGTCGGGCGCTGGTGACAAGCC  315356

Query  318     GCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTC  377
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  315355  GCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTC  315296

Query  378     CATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
               ||||||||||||||||||||||||||  ||||
Sbjct  315295  CATGGTGCTGATCAAGATGCGCGAGGTGGCCG  315264

 Score = 295 bits (326),  Expect = 3e-77
 Identities = 290/372 (78%), Gaps = 2/372 (1%)
 Strand=Plus/Minus

Query  31      GTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTG  90
               || ||||| || || ||||| ||||| ||||| || |||||||||||||| ||||| |||
Sbjct  416299  GTTGGCATTGATCTGGGCACGACCTATTCGTGTGTTGGCGTGTGGCAGAATGACCGAGTG  416240

Query  91      GAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGAC  150
               || ||||| ||||||||||||||||| |||||||| ||||| || || |||||||| || 
Sbjct  416239  GAGATCATTGCCAACGACCAGGGCAATCGCACCACGCCGTCGTATGTGGCCTTCACCGAT  416180

Query  151     TCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACG  210
                |||| ||||| |||||||| ||||| ||||| || |||||||||||||| |||||||| 
Sbjct  416179  ACGGAGCGCCTTATCGGTGATGCCGCTAAGAACCAAGTGGCCATGAACGCACACAACACA  416120

Query  211     GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
               ||||| || | ||| ||  |||||||  | |||||| | ||||| |  || ||| | |||
Sbjct  416119  GTGTTTGATGTCAAGCGATTGATCGGGAGGAAGTTCACCGACCCGGAAGTGCAGTCGGAC  416060

Query  271     ATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGA-CAAGCCGCAGATCACGGT  329
               || |||||||||||||| ||| | |   || |  || | || ||| || |   |   |||
Sbjct  416059  ATTAAGCACTGGCCGTT-CAAATTAGTCCGTGGTCCAGAGAGCAAACCACTAGTGGAGGT  416001

Query  330     GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGAT  389
               |||||| || || |||   |  |||||||| || || |||||||||||||||||| |  |
Sbjct  416000  GCAGTTTAAAGGGGAGAAGAGAACGTTCCAGCCGGAAGAGATCTCGTCCATGGTGTTAGT  415941

Query  390     CAAGATGCGCGA  401
                |||||||| ||
Sbjct  415940  TAAGATGCGAGA  415929

 Score = 47.3 bits (51),  Expect = 0.026
 Identities = 30/33 (91%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  1849    GACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
               ||| | ||||||||||||||||| |||||||||
Sbjct  414424  GACAACGGCCCGAAGATCGAGGAAGTCGACTAA  414392

 Score = 45.5 bits (49),  Expect = 0.092
 Identities = 26/27 (96%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  1855    GGCCCGAAGATCGAGGAGGTCGACTAA  1881
               ||||||||||||||||| |||||||||
Sbjct  406090  GGCCCGAAGATCGAGGAAGTCGACTAA  406064

>PHSO:scaffold_2
Length=11587142

 Score = 2021 bits (2240),  Expect = 0.0
 Identities = 1340/1487 (90%), Gaps = 6/1487 (0%)
 Strand=Plus/Minus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||||||||| |||||||| ||||| ||||| || |||||||| ||||||||||||||||
Sbjct  5241753  AGGACGCCGGTGCCATTGCTGGCCTGAACGTCCTCCGTATCATTAACGAGCCGACGGCCG  5241694

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                | ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5241693  CGGCCATTGCCTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  5241634

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                |||| |||||||||||||| ||||| || |||  ||| |||||||||||||||||||| |
Sbjct  5241633  TGGGTGGCGGCACCTTCGACGTGTCCCTACTGAGCATCGAGGAGGGCATCTTCGAGGTGA  5241574

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                |||| ||||||||||| ||||||||||| || ||||||||||||||||| || |||||||
Sbjct  5241573  AGGCTACTGCTGGTGATACGCACCTGGGCGGCGAGGACTTCGACAACCGTCTCGTGGACC  5241514

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
                ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
Sbjct  5241513  ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACTGAGAACCAGCGTGCCC  5241454

Query  701      TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
                |||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||
Sbjct  5241453  TTCGTCGTCTGCGGACTGCCTGCGAGCGTGCTAAGCGTACGCTGTCGTCGTCGGCCCAGG  5241394

Query  761      CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
                | ||||| |||||||||||||||||||| ||||| |||||||||||||||||||| ||||
Sbjct  5241393  CGTACATTGAGATTGACTCTCTGTTCGATGGCATTGACTTCAACTCGACCATCACCCGTG  5241334

Query  821      CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
                |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct  5241333  CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACCATGGAGCCCGTGGAGAAGG  5241274

Query  881      TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                |||| || ||||||||||| || |||||||||||||||||||| || || || |||||||
Sbjct  5241273  TGCTCCGTGACGCCAAGCTCTCCAAGAGCCAGGTGCACGAGGTCGTCCTCGTCGGCGGCT  5241214

Query  941      CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
                | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5241213  CTACGCGTATCCCCAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  5241154

Query  1001     ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                ||||||| ||||||||||||||||| || |||||||| || || ||||||||||||||||
Sbjct  5241153  ACAAGTCGATCAACCCGGACGAGGCCGTCGCGTACGGCGCCACGGTGCAGGCGGCCATCC  5241094

Query  1061     TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
                |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
Sbjct  5241093  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTGCTGCTGGATGTGACGCCTC  5241034

Query  1121     TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
                ||||||||||||| ||||||||||| ||||||||||||||||||||||| || |||||||
Sbjct  5241033  TGTCTCTGGGTCTGGAGACGGCCGGCGGTGTCATGACGACGCTGATCGCCCGTAACACGA  5240974

Query  1181     CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
                ||||||| |||||||||||||||||||||||||||||||| ||||||||||| || ||||
Sbjct  5240973  CGGTGCCCACCAAGAAGTCGCAGACGTTCTCGACGTACGCGGACAACCAGCCCGGTGTGC  5240914

Query  1241     TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
                | |||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||
Sbjct  5240913  TGATCCAGGTCTTCGAGGGCGAGCGCTCGATGACCCGCGACAACAACCTGCTGGGCAAGT  5240854

Query  1301     TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
                ||||||||||||||||||| |||||||| || |||||||||||||| |||||||| ||||
Sbjct  5240853  TCAACCTGGACGGCATCCCGCCCATGCCCCGTGGTGTGCCGCAGATTGACGTGACCTTCG  5240794

Query  1361     ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
                |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct  5240793  ACATCGACGCGAACGGCATCCTGAACGTGTCGGCCGTGGAGAAGTCGACGGGCAAGGAGA  5240734

Query  1421     ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
                ||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||
Sbjct  5240733  ACAAGATCACGATCACGAACGACAAGGGCCGTCTGTCCCAGGCTGACATTGACCGCATGG  5240674

Query  1481     TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
                |  |||||||||||||||||||||||||||||||||| ||||||   |||||||||||||
Sbjct  5240673  TGGCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCCAACAAGGTGCGCATCGAGGCCA  5240614

Query  1541     AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
                |||||||||| ||||||||||| ||||  ||||| ||||  || || ||||||||| | |
Sbjct  5240613  AGAACGCGCTCGAGAACTACGCGTACAACCTGCGTAACACGCTCAACGACGAGAAGCTCA  5240554

Query  1601     AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
                ||||  ||||| |||| | ||||||||||||  | |||||||||||||||||    ||| 
Sbjct  5240553  AGGACCAGATCTCGGAGGATGACAAGAAGGCCATCGACGACAAGGTGACGGAGACCATCA  5240494

Query  1661     AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
                | ||||| ||||| ||||||||    |||||||| | |||||||   |||||||||||  
Sbjct  5240493  ACTGGCTCGACGCCAACCAGTCGGCCGAGAAGGAGGAGTACGAGGGCAAGCAGAAGGAGC  5240434

Query  1721     TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
                | |||||||||||||||||  |  ||||||||||||||||||||||||||||| | || |
Sbjct  5240433  TCGAGGGCGTGGCCAACCCCATCCTGCAGAAGATGTACGCTGCTGCTGGCGGTGCTCCCG  5240374

Query  1781     GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCT------CCCC  1834
                | || |||||||| ||||| || ||  |||||||||||||||| ||||||      || |
Sbjct  5240373  GCGCCGAGGGTGGCATGCCGGGCGGCATGCCGGGCGGCATGCCCGGTGCTGGCGCCCCAC  5240314

Query  1835     CTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
                | ||||| ||  ||||||||||||| |||||||||||||||||||||
Sbjct  5240313  CCGCTGGCGCCCCGGACCAGGGCCCCAAGATCGAGGAGGTCGACTAA  5240267

 Score = 2012 bits (2230),  Expect = 0.0
 Identities = 1342/1489 (90%), Gaps = 22/1489 (1%)
 Strand=Plus/Plus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||||||||| |||||||| ||||| ||||| || |||||||| ||||||||||||||||
Sbjct  5264057  AGGACGCCGGTGCCATTGCTGGCCTGAACGTCCTCCGTATCATTAACGAGCCGACGGCCG  5264116

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                | ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5264117  CGGCCATTGCCTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  5264176

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                |||| |||||||||||||| ||||| || |||  ||| |||||||||||||||||||| |
Sbjct  5264177  TGGGTGGCGGCACCTTCGACGTGTCCCTACTGAGCATCGAGGAGGGCATCTTCGAGGTGA  5264236

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                |||| ||||||||||| ||||||||||| || ||||||||||||||||| || |||||||
Sbjct  5264237  AGGCTACTGCTGGTGATACGCACCTGGGCGGCGAGGACTTCGACAACCGTCTCGTGGACC  5264296

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
                ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
Sbjct  5264297  ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACTGAGAACCAGCGTGCCC  5264356

Query  701      TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
                |||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||
Sbjct  5264357  TTCGTCGTCTGCGGACTGCCTGCGAGCGTGCTAAGCGTACGCTGTCGTCGTCGGCCCAGG  5264416

Query  761      CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
                | ||||| |||||||||||||||||||| ||||| |||||||||||||||||||| ||||
Sbjct  5264417  CGTACATTGAGATTGACTCTCTGTTCGATGGCATTGACTTCAACTCGACCATCACCCGTG  5264476

Query  821      CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
                |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct  5264477  CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACCATGGAGCCCGTGGAGAAGG  5264536

Query  881      TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                |||| || ||||||||||| || |||||||||||||||||||| || || || |||||||
Sbjct  5264537  TGCTCCGTGACGCCAAGCTCTCCAAGAGCCAGGTGCACGAGGTCGTCCTCGTCGGCGGCT  5264596

Query  941      CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
                | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5264597  CTACGCGTATCCCCAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  5264656

Query  1001     ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                ||||||| ||||||||||||||||| || |||||||| || || ||||||||||||||||
Sbjct  5264657  ACAAGTCGATCAACCCGGACGAGGCCGTCGCGTACGGCGCCACGGTGCAGGCGGCCATCC  5264716

Query  1061     TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
                |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
Sbjct  5264717  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTGCTGCTGGATGTGACGCCTC  5264776

Query  1121     TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
                ||||||||||||| ||||||||||| ||||||||||||||||||||||| || |||||||
Sbjct  5264777  TGTCTCTGGGTCTGGAGACGGCCGGCGGTGTCATGACGACGCTGATCGCCCGTAACACGA  5264836

Query  1181     CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
                ||||||| |||||||||||||||||||||||||||||||| ||||||||||| || ||||
Sbjct  5264837  CGGTGCCCACCAAGAAGTCGCAGACGTTCTCGACGTACGCGGACAACCAGCCCGGTGTGC  5264896

Query  1241     TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
                | |||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||
Sbjct  5264897  TGATCCAGGTCTTCGAGGGCGAGCGCTCGATGACCCGCGACAACAACCTGCTGGGCAAGT  5264956

Query  1301     TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
                |||||||||||||||||||||||||||| || ||||||||||||||||||||||| ||||
Sbjct  5264957  TCAACCTGGACGGCATCCCTCCCATGCCCCGTGGTGTGCCGCAGATCGACGTGACCTTCG  5265016

Query  1361     ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
                |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct  5265017  ACATCGACGCGAACGGCATCCTGAACGTGTCGGCCGTGGAGAAGTCGACGGGCAAGGAGA  5265076

Query  1421     ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
                ||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct  5265077  ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCCGAGATCGACCGCATGG  5265136

Query  1481     TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
                |  |||||||||||||||||||||||||||||||||| ||||||   |||||||||||||
Sbjct  5265137  TGGCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCCAACAAGGTGCGCATCGAGGCCA  5265196

Query  1541     AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
                |||||||||| ||||||||||| ||||| ||||| ||||||||||| ||||||||| | |
Sbjct  5265197  AGAACGCGCTCGAGAACTACGCGTACAGCCTGCGCAACAGTCTGAACGACGAGAAGCTCA  5265256

Query  1601     AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
                ||||||||||||| || || |||||||||| |||||||||||||||||||||   ||| |
Sbjct  5265257  AGGAGAAGATCCCCGAGGCCGACAAGAAGGTGGTGGACGACAAGGTGACGGAGACGATTC  5265316

Query  1661     AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
                |||||||||||||  ||||||||| ||||||||| | ||||||| | |||||||||||  
Sbjct  5265317  AGTGGCTGGACGCGCACCAGTCATCGGAGAAGGAGGAGTACGAGGCCAAGCAGAAGGAGC  5265376

Query  1721     TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
                | ||||||||||||||||| ||| |||||||| ||||||| || || || ||    | | 
Sbjct  5265377  TCGAGGGCGTGGCCAACCCCGTGCTGCAGAAGGTGTACGCCGCCGCCGGTGG----CAT-  5265431

Query  1781     GTGCTGAGGGTGGTATGCCCGGTGG--TG--TGCCG--GGCGGCATGCCT--GGTGCTCC  1832
                       |||||| ||||| || ||  ||  |||||  | ||||  ||||  | ||||||
Sbjct  5265432  -------GGGTGGCATGCCGGGCGGAATGCCTGCCGGTGCCGGC--GCCTCGGCTGCTCC  5265482

Query  1833     CCCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
                  | || || |  |||||||||||||| |||||||||||||||||||||
Sbjct  5265483  ATCGGCGGGCGGCGCGGACCAGGGCCCCAAGATCGAGGAGGTCGACTAA  5265531

 Score = 2007 bits (2225),  Expect = 0.0
 Identities = 1341/1489 (90%), Gaps = 22/1489 (1%)
 Strand=Plus/Minus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||||||||| |||||||| ||||| ||||| || |||||||| ||||||||||||||||
Sbjct  5250135  AGGACGCCGGTGCCATTGCTGGCCTGAACGTCCTCCGTATCATTAACGAGCCGACGGCCG  5250076

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                | ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5250075  CGGCCATTGCCTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  5250016

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                |||| |||||||||||||| ||||| || |||  ||| |||||||||||||||||||| |
Sbjct  5250015  TGGGTGGCGGCACCTTCGACGTGTCCCTACTGAGCATCGAGGAGGGCATCTTCGAGGTGA  5249956

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                |||| ||||||||||| ||||||||||| || ||||||||||||||||| || |||||||
Sbjct  5249955  AGGCTACTGCTGGTGATACGCACCTGGGCGGCGAGGACTTCGACAACCGTCTCGTGGACC  5249896

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
                ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
Sbjct  5249895  ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACTGAGAACCAGCGTGCCC  5249836

Query  701      TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
                |||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||
Sbjct  5249835  TTCGTCGTCTGCGGACTGCCTGCGAGCGTGCTAAGCGTACGCTGTCGTCGTCGGCCCAGG  5249776

Query  761      CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
                | ||||| |||||||||||||||||||| ||||| |||||||||||||||||||| ||||
Sbjct  5249775  CGTACATTGAGATTGACTCTCTGTTCGATGGCATTGACTTCAACTCGACCATCACCCGTG  5249716

Query  821      CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
                |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct  5249715  CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACCATGGAGCCCGTGGAGAAGG  5249656

Query  881      TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                |||| || ||||||||||| || |||||||||||||||||||| || || || |||||||
Sbjct  5249655  TGCTCCGTGACGCCAAGCTCTCCAAGAGCCAGGTGCACGAGGTCGTCCTCGTCGGCGGCT  5249596

Query  941      CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
                | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5249595  CTACGCGTATCCCCAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  5249536

Query  1001     ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                ||||||| ||||||||||||||||| || |||||||| || || ||||||||||||||||
Sbjct  5249535  ACAAGTCGATCAACCCGGACGAGGCCGTCGCGTACGGCGCCACGGTGCAGGCGGCCATCC  5249476

Query  1061     TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
                |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
Sbjct  5249475  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTGCTGCTGGATGTGACGCCTC  5249416

Query  1121     TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
                ||||||||||||| ||||||||||| ||||||||||||||||||||||| || |||||||
Sbjct  5249415  TGTCTCTGGGTCTGGAGACGGCCGGCGGTGTCATGACGACGCTGATCGCCCGTAACACGA  5249356

Query  1181     CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
                ||||||| |||||||||||||||||||||||||||||||| ||||||||||| || ||||
Sbjct  5249355  CGGTGCCCACCAAGAAGTCGCAGACGTTCTCGACGTACGCGGACAACCAGCCCGGTGTGC  5249296

Query  1241     TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
                | |||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||
Sbjct  5249295  TGATCCAGGTCTTCGAGGGCGAGCGCTCGATGACCCGCGACAACAACCTGCTGGGCAAGT  5249236

Query  1301     TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
                ||||||||||||||||||| |||||||| || ||||||||||||||||||||||| ||||
Sbjct  5249235  TCAACCTGGACGGCATCCCGCCCATGCCCCGTGGTGTGCCGCAGATCGACGTGACCTTCG  5249176

Query  1361     ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
                |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct  5249175  ACATCGACGCGAACGGCATCCTGAACGTGTCGGCCGTGGAGAAGTCGACGGGCAAGGAGA  5249116

Query  1421     ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
                ||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct  5249115  ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCCGAGATCGACCGCATGG  5249056

Query  1481     TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
                |  |||||||||||||||||||||||||||||||||| ||||||   |||||||||||||
Sbjct  5249055  TGGCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCCAACAAGGTGCGCATCGAGGCCA  5248996

Query  1541     AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
                |||||||||| ||||||||||| ||||| ||||| ||||||||||| ||||||||| | |
Sbjct  5248995  AGAACGCGCTCGAGAACTACGCGTACAGCCTGCGCAACAGTCTGAACGACGAGAAGCTCA  5248936

Query  1601     AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
                ||||||||||||| || || |||||||||| |||||||||||||||||||||   ||| |
Sbjct  5248935  AGGAGAAGATCCCCGAGGCCGACAAGAAGGTGGTGGACGACAAGGTGACGGAGACGATTC  5248876

Query  1661     AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
                |||||||||||||  ||||||||| ||||||||| | ||||||| | |||||||||||  
Sbjct  5248875  AGTGGCTGGACGCGCACCAGTCATCGGAGAAGGAGGAGTACGAGGCCAAGCAGAAGGAGC  5248816

Query  1721     TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
                | ||||||||||||||||| ||| |||||||| ||||||| || || || ||    | | 
Sbjct  5248815  TCGAGGGCGTGGCCAACCCCGTGCTGCAGAAGGTGTACGCCGCCGCCGGTGG----CAT-  5248761

Query  1781     GTGCTGAGGGTGGTATGCCCGGTGG--TG--TGCCG--GGCGGCATGCCT--GGTGCTCC  1832
                       |||||| ||||| || ||  ||  |||||  | ||||  ||||  | ||||||
Sbjct  5248760  -------GGGTGGCATGCCGGGCGGAATGCCTGCCGGTGCCGGC--GCCTCGGCTGCTCC  5248710

Query  1833     CCCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
                  | || || |  |||||||||||||| |||||||||||||||||||||
Sbjct  5248709  ATCGGCGGGCGGCGCGGACCAGGGCCCCAAGATCGAGGAGGTCGACTAA  5248661

 Score = 1962 bits (2175),  Expect = 0.0
 Identities = 1331/1489 (89%), Gaps = 22/1489 (1%)
 Strand=Plus/Plus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||||||||| |||||||| ||||| ||||| || |||||||| ||||||||||||||||
Sbjct  5252709  AGGACGCCGGTGCCATTGCTGGCCTGAACGTCCTCCGTATCATTAACGAGCCGACGGCCG  5252768

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                | ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5252769  CGGCCATTGCCTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  5252828

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                |||| |||||||||||||| ||||| || |||  ||| |||||||||||||||||||| |
Sbjct  5252829  TGGGTGGCGGCACCTTCGACGTGTCCCTACTGAGCATCGAGGAGGGCATCTTCGAGGTGA  5252888

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                |||| || |||||||| ||||||||||| || ||||||||||||||||||||||| ||  
Sbjct  5252889  AGGCTACCGCTGGTGATACGCACCTGGGCGGCGAGGACTTCGACAACCGCCTGGTCGAGT  5252948

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
                |||||  |||||||||||||||||||||||||||||||||||| |||||||||||||| |
Sbjct  5252949  ACTTCGTGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACTGAGAACCAGCGTGCCC  5253008

Query  701      TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
                |||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||
Sbjct  5253009  TTCGTCGTCTGCGGACTGCCTGCGAGCGTGCTAAGCGTACGCTGTCGTCGTCGGCCCAGG  5253068

Query  761      CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
                | ||||| ||||| |||||||||||||| ||||| |||||||||||||||||||| ||||
Sbjct  5253069  CGTACATTGAGATCGACTCTCTGTTCGATGGCATTGACTTCAACTCGACCATCACCCGTG  5253128

Query  821      CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
                |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct  5253129  CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACCATGGAGCCCGTGGAGAAGG  5253188

Query  881      TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                |||| || ||||||||||| || |||||||||||||||||||| || || || |||||||
Sbjct  5253189  TGCTCCGTGACGCCAAGCTCTCCAAGAGCCAGGTGCACGAGGTCGTCCTCGTCGGCGGCT  5253248

Query  941      CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
                | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5253249  CTACGCGTATCCCCAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  5253308

Query  1001     ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                ||||||| ||||||||||||||||| || |||||||| || || ||||||||||||||||
Sbjct  5253309  ACAAGTCGATCAACCCGGACGAGGCCGTCGCGTACGGCGCCACGGTGCAGGCGGCCATCC  5253368

Query  1061     TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
                |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
Sbjct  5253369  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTGCTGCTGGATGTGACGCCTC  5253428

Query  1121     TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
                ||||||||||||| ||||||||||| ||||||||||||||||||||||| || |||||||
Sbjct  5253429  TGTCTCTGGGTCTGGAGACGGCCGGCGGTGTCATGACGACGCTGATCGCCCGTAACACGA  5253488

Query  1181     CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
                ||||||| |||||||||||||||||||||||||||||||| ||||||||||| || ||||
Sbjct  5253489  CGGTGCCCACCAAGAAGTCGCAGACGTTCTCGACGTACGCGGACAACCAGCCCGGTGTGC  5253548

Query  1241     TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
                | |||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||
Sbjct  5253549  TGATCCAGGTCTTCGAGGGCGAGCGCTCGATGACCCGCGACAACAACCTGCTGGGCAAGT  5253608

Query  1301     TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
                ||||||||||||||||||| |||||||| || ||||||||||||||||||||||| ||||
Sbjct  5253609  TCAACCTGGACGGCATCCCGCCCATGCCCCGTGGTGTGCCGCAGATCGACGTGACCTTCG  5253668

Query  1361     ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
                |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct  5253669  ACATCGACGCGAACGGCATCCTGAACGTGTCGGCCGTGGAGAAGTCGACGGGCAAGGAGA  5253728

Query  1421     ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
                ||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||
Sbjct  5253729  ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCCGAGATCGACCGCATGG  5253788

Query  1481     TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
                |  |||||||||||||||||||||||||||||||||| ||||||   |||||||||||||
Sbjct  5253789  TGGCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCCAACAAGGTGCGCATCGAGGCCA  5253848

Query  1541     AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
                |||||||||| ||||||||||| ||||| ||||| ||||||||||| ||||||||| | |
Sbjct  5253849  AGAACGCGCTCGAGAACTACGCGTACAGCCTGCGCAACAGTCTGAACGACGAGAAGCTCA  5253908

Query  1601     AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
                ||||||||||||| || || |||||||||| |||||||||||||||||||||   ||| |
Sbjct  5253909  AGGAGAAGATCCCCGAGGCCGACAAGAAGGTGGTGGACGACAAGGTGACGGAGACGATTC  5253968

Query  1661     AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
                |||||||||||||  ||||||||| ||||||||| | ||||||| | |||||||||||  
Sbjct  5253969  AGTGGCTGGACGCGCACCAGTCATCGGAGAAGGAGGAGTACGAGGCCAAGCAGAAGGAGC  5254028

Query  1721     TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
                | ||||||||||||||||| ||| |||||||| ||||||| || || || ||    | | 
Sbjct  5254029  TCGAGGGCGTGGCCAACCCCGTGCTGCAGAAGGTGTACGCCGCCGCCGGTGG----CAT-  5254083

Query  1781     GTGCTGAGGGTGGTATGCCCGGTGG--TG--TGCCG--GGCGGCATGCCT--GGTGCTCC  1832
                       |||||| ||||| || ||  ||  |||||  | ||||  ||||  |  |||||
Sbjct  5254084  -------GGGTGGCATGCCGGGCGGAATGCCTGCCGGTGCCGGC--GCCTCGGCCGCTCC  5254134

Query  1833     CCCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
                  | || || |  |||| | ||||||| |||||||| |||||||| |||
Sbjct  5254135  ATCGGCGGGCGGCGCGGGCGAGGGCCCCAAGATCGATGAGGTCGATTAA  5254183

 Score = 1364 bits (1512),  Expect = 0.0
 Identities = 1208/1502 (80%), Gaps = 33/1502 (2%)
 Strand=Plus/Minus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||||||||| || || || || || ||||| |||||||||||||| || || |||||||
Sbjct  5273094  AGGACGCCGGTGCGATCGCTGGGCTGAACGTCCTGCGTATCATCAATGAACCCACGGCCG  5273035

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                | ||||| || ||||||||||||||||||||||| || | ||||||||||||||||||||
Sbjct  5273034  CGGCCATTGCCTACGGCCTGGACAAGAAGGGCGGGGAACACAACGTGCTGATCTTCGACC  5272975

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                |||| ||||| || || |||||||| |||||  | || || || |||||||| ||||| |
Sbjct  5272974  TGGGTGGCGGGACGTTTGATGTGTCGCTCCTAACGATCGAAGAAGGCATCTTTGAGGTGA  5272915

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                ||||||| || || |||||||||||||| || ||||||||||||||||| ||||| ||  
Sbjct  5272914  AGGCCACGGCCGGAGACACGCACCTGGGCGGCGAGGACTTCGACAACCGTCTGGTCGAGT  5272855

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
                |||||  ||| |||||||||||||| || ||||  ||  |||  | ||||   |||||  
Sbjct  5272854  ACTTCGTGCAAGAGTTCAAGCGCAAACATCGCAGAGATCTCAGTGTGAACTCTCGTGCGA  5272795

Query  701      TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
                | ||||| || || || ||||||||||| || ||||||||||||||  ||||||| || |
Sbjct  5272794  TGCGTCGCCTTCGTACAGCCTGCGAGCGCGCGAAGCGTACGCTGTCCACGTCGGCGCAAG  5272735

Query  761      CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
                | ||||| ||||| || ||  |||| ||||||| ||||||||||||||||||||| || |
Sbjct  5272734  CGTACATTGAGATCGATTCGTTGTTGGACGGCACCGACTTCAACTCGACCATCACGCGCG  5272675

Query  821      CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
                | || ||||||||| |||||  ||| | |||||||||||||||||| || |||| | |||
Sbjct  5272674  CGCGGTTCGAGGACCTGTGCAACGAATTCTTCCGCAAGACGATGGATCCGGTGGCGCAGG  5272615

Query  881      TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                | ||||||||| ||||||||||||||| ||||||| |||||||||| ||||| || ||||
Sbjct  5272614  TCCTGCGCGACTCCAAGCTGTCGAAGAACCAGGTGAACGAGGTGGTTCTGGTTGGAGGCT  5272555

Query  941      CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
                ||||||||||||| |||||||||||| || ||  |||||||||||||||||||||||   
Sbjct  5272554  CGACGCGTATCCCCAAGGTGCAGCAGTTGTTGGTGGACTTCTTCAACGGCAAGGAGCTGT  5272495

Query  1001     ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                 |||||| ||||||||||||||||| || |||||||| || || |||||||| || ||||
Sbjct  5272494  TCAAGTCGATCAACCCGGACGAGGCCGTCGCGTACGGCGCCACGGTGCAGGCTGCTATCC  5272435

Query  1061     TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
                |||| ||||| |||||||||   ||||| |||||| ||||  ||||||||||| | ||||
Sbjct  5272434  TGAGTGGCAATGACTCGTCGTCCAAGCTTCAGGACTTGCTGTTGCTGGACGTGGCTCCGC  5272375

Query  1121     TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
                |||| || || || |||||||||||||| |||||||||| ||| ||  |||| |||||||
Sbjct  5272374  TGTCGCTTGGCCTGGAGACGGCCGGTGGAGTCATGACGAAGCTCATTCCGCGTAACACGA  5272315

Query  1181     CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
                || | ||| |||||||| ||||| |||||||||||||||| |||||||||||||| ||||
Sbjct  5272314  CGATCCCGTCCAAGAAGACGCAGTCGTTCTCGACGTACGCGGACAACCAGCCTGGTGTGC  5272255

Query  1241     TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
                | ||||| |||||||||||||||||| ||||||| ||||||||  | || ||||||||||
Sbjct  5272254  TGATCCAAGTGTTCGAGGGCGAGCGCACCATGACCCGCGACAATCATCTACTGGGCAAGT  5272195

Query  1301     TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
                |||| |||||||||||||| ||||||||||||||||| ||||||||||| || |||||||
Sbjct  5272194  TCAATCTGGACGGCATCCCGCCCATGCCTCGCGGTGTCCCGCAGATCGATGTTACGTTCG  5272135

Query  1361     ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
                |  | || | |||||| ||  | ||||||||||| ||||||||||| |||||||||||||
Sbjct  5272134  ATGTTGATGTGAACGGTATTTTAAACGTGTCGGCCGTGGAGAAGTCGACGGGCAAGGAGA  5272075

Query  1421     ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
                ||||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||
Sbjct  5272074  ACAAGATCACGATCACGAACGACAAGGGCCGACTGTCGCAGGCCGACATTGACCGCATGG  5272015

Query  1481     TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
                |  | || || ||||||||||||    | ||||||   |||||||  ||||||||| |||
Sbjct  5272014  TCGCCGACGCGGAGAAGTACAAGGACCAAGACGAGCGCAACAAGCTGCGCATCGAGTCCA  5271955

Query  1541     AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGA---ATGACGAGAAGA  1597
                |||||||||||||||||||||||| |    ||||   ||||  ||     || |||||| 
Sbjct  5271954  AGAACGCGCTGGAGAACTACGCCTTCTCGTTGCG---CAGTTCGACGCGCGAGGAGAAGT  5271898

Query  1598     TGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGA  1657
                ||  ||  ||| ||   || |  ||||||||| || | ||  |||||||  ||||   | 
Sbjct  5271897  TGGCGGCCAAGCTCAGTGAGGACGACAAGAAGACGATCGAATACAAGGTCGCGGATACGT  5271838

Query  1658     TCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGG  1717
                | || ||||||||||| |||||| |   ||||||||| | || |||  |||||||  |||
Sbjct  5271837  TGCACTGGCTGGACGCTAACCAGGCGGCGGAGAAGGAGGAGTTCGACGCGAAGCAACAGG  5271778

Query  1718     AATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCC  1777
                |  ||||| |  ||||||||||  | ||||||||| | ||||| || |   ||||   | 
Sbjct  5271777  AGCTGGAGAGTATGGCCAACCCGATTTTGCAGAAGGTTTACGCGGC-GGAAGCGG--GCG  5271721

Query  1778     CTGGTGCTG---AGGGTGGTATGCCCGGTGGT-GTGC--CGGGCGGCATGCCTGGTGCT-  1830
                |||||||||    |||||| |||  ||||| |  |||  | ||||      |||||||| 
Sbjct  5271720  CTGGTGCTGGAATGGGTGGCATGGGCGGTGCTACTGCTGCTGGCG------CTGGTGCTG  5271667

Query  1831     --CCCCCTG---CTGGTGCTGCG------GACCAGGGCCCGAAGATCGAGGAGGTCGACT  1879
                  |||| ||   |||| | ||||      ||  | || |||||||| |||||||| ||||
Sbjct  5271666  GACCCCATGGCCCTGGAGGTGCGGATGGTGATGAAGGTCCGAAGATTGAGGAGGTGGACT  5271607

Query  1880     AA  1881
                ||
Sbjct  5271606  AA  5271605

 Score = 577 bits (639),  Expect = 7e-162
 Identities = 363/392 (93%), Gaps = 0/392 (0%)
 Strand=Plus/Minus

Query  18       GTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCA  77
                |||||||||||| |||||||| ||||||||||| |||||||||||||| |||||||||||
Sbjct  5242226  GTCTGGATACTCGGTCGGCATTGACCTCGGCACGACCTACTCGTGCGTCGGCGTGTGGCA  5242167

Query  78       GAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGT  137
                ||||||||| ||||| |||||||||||||||||||| ||||||||||||||||| |||||
Sbjct  5242166  GAACGACCGCGTGGAGATCATCGCCAACGACCAGGGTAACCGCACCACCCCGTCGTACGT  5242107

Query  138      CGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAA  197
                 |||||||| ||| | || ||||| ||||| || ||||||||||| ||||||||||||||
Sbjct  5242106  GGCCTTCACGGACACCGAGCGCCTGATCGGCGATGCCGCCAAGAACCAGGTGGCCATGAA  5242047

Query  198      CGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGT  257
                ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||  |
Sbjct  5242046  CGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCCGACCCGAT  5241987

Query  258      CGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCC  317
                ||||||||||||||||||||||||||||||| |  |  ||||||||||||| ||||||||
Sbjct  5241986  CGTCCAGGCCGACATCAAGCACTGGCCGTTCAAGATCTCGTCGGGCGCCGGCGACAAGCC  5241927

Query  318      GCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTC  377
                |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct  5241926  GCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAGCCCGAGGAGATCTCGTC  5241867

Query  378      CATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
                ||||||||||||||||||||||||||  ||||
Sbjct  5241866  CATGGTGCTGATCAAGATGCGCGAGGTGGCCG  5241835

 Score = 568 bits (629),  Expect = 3e-159
 Identities = 364/397 (92%), Gaps = 0/397 (0%)
 Strand=Plus/Minus

Query  13       ACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTG  72
                || || || |||||||| ||||| || ||||||||||| |||||||||||||| ||||||
Sbjct  5250613  ACAACTTCGGGATACTCTGTCGGTATTGACCTCGGCACGACCTACTCGTGCGTCGGCGTG  5250554

Query  73       TGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCA  132
                |||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||| 
Sbjct  5250553  TGGCAGAACGACCGCGTGGAGATCATCGCCAACGACCAGGGTAACCGCACCACCCCGTCG  5250494

Query  133      TACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCC  192
                ||||| |||||||| ||| | || ||||| ||||| || ||||||||||| |||||||||
Sbjct  5250493  TACGTGGCCTTCACGGACACCGAGCGCCTGATCGGCGATGCCGCCAAGAACCAGGTGGCC  5250434

Query  193      ATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGAC  252
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct  5250433  ATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCCGAC  5250374

Query  253      CCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGAC  312
                ||  |||||||||||||||||||||||||||||||| |  |  ||||||||||||| |||
Sbjct  5250373  CCGATCGTCCAGGCCGACATCAAGCACTGGCCGTTCAAGATCTCGTCGGGCGCCGGCGAC  5250314

Query  313      AAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATC  372
                ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct  5250313  AAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAGCCCGAGGAGATC  5250254

Query  373      TCGTCCATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
                |||||||||||||||||||||||||||||||  ||||
Sbjct  5250253  TCGTCCATGGTGCTGATCAAGATGCGCGAGGTGGCCG  5250217

 Score = 541 bits (599),  Expect = 5e-151
 Identities = 358/397 (90%), Gaps = 0/397 (0%)
 Strand=Plus/Plus

Query  13       ACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTG  72
                || || || |||||||| ||||| || ||||||||||| |||||||||||||| ||||||
Sbjct  5263579  ACAACTTCGGGATACTCTGTCGGTATTGACCTCGGCACGACCTACTCGTGCGTCGGCGTG  5263638

Query  73       TGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCA  132
                |||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||| 
Sbjct  5263639  TGGCAGAACGACCGCGTGGAGATCATCGCCAACGACCAGGGTAACCGCACCACCCCGTCG  5263698

Query  133      TACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCC  192
                ||||| |||||||| ||| | || ||||| ||||| || ||||||||||| |||||||||
Sbjct  5263699  TACGTGGCCTTCACGGACACCGAGCGCCTGATCGGCGATGCCGCCAAGAACCAGGTGGCC  5263758

Query  193      ATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGAC  252
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct  5263759  ATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCCGAC  5263818

Query  253      CCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGAC  312
                || || || || || ||||||||||||||||||||| |  |  |||| ||  |||| |||
Sbjct  5263819  CCGGTGGTGCAAGCAGACATCAAGCACTGGCCGTTCAAGATCTCGTCCGGTCCCGGCGAC  5263878

Query  313      AAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATC  372
                ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct  5263879  AAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAGCCCGAGGAGATC  5263938

Query  373      TCGTCCATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
                |||||||||||||||||||||||||||||||  ||||
Sbjct  5263939  TCGTCCATGGTGCTGATCAAGATGCGCGAGGTGGCCG  5263975

 Score = 532 bits (589),  Expect = 2e-148
 Identities = 356/397 (90%), Gaps = 0/397 (0%)
 Strand=Plus/Plus

Query  13       ACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTG  72
                || || || |||||||| ||||| || ||||||||||| |||||||||||||| ||||||
Sbjct  5252231  ACAACTTCGGGATACTCTGTCGGTATTGACCTCGGCACGACCTACTCGTGCGTCGGCGTG  5252290

Query  73       TGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCA  132
                |||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||| 
Sbjct  5252291  TGGCAGAACGACCGCGTGGAGATCATCGCCAACGACCAGGGTAACCGCACCACCCCGTCG  5252350

Query  133      TACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCC  192
                ||||| |||||||| ||| | || ||||| ||||| || ||||||||||| |||||||||
Sbjct  5252351  TACGTGGCCTTCACGGACACCGAGCGCCTGATCGGCGATGCCGCCAAGAACCAGGTGGCC  5252410

Query  193      ATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGAC  252
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct  5252411  ATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCCGAC  5252470

Query  253      CCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGAC  312
                || || || || || |||||| |||||||||||||| |  |  |||| ||  |||| |||
Sbjct  5252471  CCGGTGGTGCAAGCAGACATCCAGCACTGGCCGTTCAAGATCTCGTCCGGTCCCGGCGAC  5252530

Query  313      AAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATC  372
                ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||
Sbjct  5252531  AAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAGCCCGAGGAAATC  5252590

Query  373      TCGTCCATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
                |||||||||||||||||||||||||||||||  ||||
Sbjct  5252591  TCGTCCATGGTGCTGATCAAGATGCGCGAGGTGGCCG  5252627

 Score = 444 bits (492),  Expect = 3e-122
 Identities = 328/380 (86%), Gaps = 2/380 (1%)
 Strand=Plus/Minus

Query  31       GTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTG  90
                || || || || || ||||| |||||||||||||| |||||||||||||||||||| |||
Sbjct  5273554  GTTGGTATTGATCTGGGCACGACCTACTCGTGCGTCGGCGTGTGGCAGAACGACCGCGTG  5273495

Query  91       GAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGAC  150
                || |||||||||||||||||||| ||||||||||||||||| ||||| |||||||| || 
Sbjct  5273494  GAGATCATCGCCAACGACCAGGGTAACCGCACCACCCCGTCGTACGTGGCCTTCACGGAT  5273435

Query  151      TCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACG  210
                 | || || || ||||| || ||||||||||| |||||||||||||||||||||||||||
Sbjct  5273434  ACCGAGCGTCTGATCGGCGATGCCGCCAAGAACCAGGTGGCCATGAACGCGCACAACACG  5273375

Query  211      GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
                |||||||||| ||| ||  ||||||||||||||||| | ||||| |  || ||| | |||
Sbjct  5273374  GTGTTCGACGTCAAGCGCTTGATCGGCCGCAAGTTCACCGACCCGGAGGTGCAGTCGGAC  5273315

Query  271      ATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGA-CAAGCCGCAGATCACGGT  329
                |||||||||||||||||  ||||  | ||| |  |||| || |||||||||  |   |||
Sbjct  5273314  ATCAAGCACTGGCCGTTTAAAGTTGC-TCGAGGCCCGGAGAACAAGCCGCAACTGGTGGT  5273256

Query  330      GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGAT  389
                |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct  5273255  GCAGTTCAAGGGCGAGTCCAAGACGTTCCAGCCCGAGGAGATCTCGTCCATGGTGCTGAT  5273196

Query  390      CAAGATGCGCGAGGACGCCG  409
                |||||||||||||  |||||
Sbjct  5273195  CAAGATGCGCGAGATCGCCG  5273176

 Score = 60.8 bits (66),  Expect = 1e-06
 Identities = 54/68 (79%), Gaps = 0/68 (0%)
 Strand=Plus/Minus

Query  712      CGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCTTACATCGAG  771
                || || ||||||||||| || ||||||||||||||  ||||||| || ||   ||| |||
Sbjct  5270537  CGTACCGCCTGCGAGCGCGCGAAGCGTACGCTGTCCACGTCGGCGCAAGCGCCCATTGAG  5270478

Query  772      ATTGACTC  779
                || || ||
Sbjct  5270477  ATCGATTC  5270470

 Score = 41.9 bits (45),  Expect = 1.1
 Identities = 39/50 (78%), Gaps = 0/50 (0%)
 Strand=Plus/Minus

Query  1588     GACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGA  1637
                |||||||||| |||||||||||    |||||  || ||||| | || |||
Sbjct  3281406  GACGAGAAGAAGAAGGAGAAGAAAAAGGAAGAGGAGAAGAAAGAGGAGGA  3281357

 Score = 41.0 bits (44),  Expect = 1.1
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  954      GAAGGTGCAGCAGCTGCTGTCGGACTTCTTCA  985
                ||||||||||  |||||||||||||  |||||
Sbjct  4034428  GAAGGTGCAGATGCTGCTGTCGGACCGCTTCA  4034397

 Score = 39.2 bits (42),  Expect = 3.9
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  512      TCTTCGACCTGGGCGGCGGCACCTTCGATGT  542
                ||||||  ||||||||||||| |||||| ||
Sbjct  7654629  TCTTCGCTCTGGGCGGCGGCAACTTCGACGT  7654599

>PHRA:scaffold_631
Length=9359

 Score = 2019 bits (2238),  Expect = 0.0
 Identities = 1338/1483 (90%), Gaps = 7/1483 (0%)
 Strand=Plus/Plus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             |||||||||| ||||| ||||| || |||||||||||||||||||||||||| |||||||
Sbjct  6861  AGGACGCCGGTGCCATCGCCGGGCTGAACGTGCTGCGTATCATCAACGAGCCCACGGCCG  6920

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
             |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  6921  CCGCTATTGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  6980

Query  521   TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
             ||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
Sbjct  6981  TGGGCGGCGGCACCTTCGATGTGTCGCTGCTGTCCATTGAGGAGGGCATCTTCGAGGTGA  7040

Query  581   AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
             ||||||| ||||| |||||||||||||| |||||||||||||||||||| ||||||||||
Sbjct  7041  AGGCCACCGCTGGCGACACGCACCTGGGCGGTGAGGACTTCGACAACCGTCTGGTGGACC  7100

Query  641   ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
             ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
Sbjct  7101  ACTTCACTCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGACAACCAGCGTGCCC  7160

Query  701   TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
             | ||||||||||| ||||| ||||||||||| ||||||||||| || |||||||||||||
Sbjct  7161  TCCGTCGTCTGCGTACGGCGTGCGAGCGTGCTAAGCGTACGCTTTCATCGTCGGCTCAGG  7220

Query  761   CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
             | ||||| |||||||||||||||||||| ||||| ||||| |||||||||||||| ||||
Sbjct  7221  CCTACATTGAGATTGACTCTCTGTTCGATGGCATTGACTTTAACTCGACCATCACGCGTG  7280

Query  821   CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
             |||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||
Sbjct  7281  CTCGTTTCGAGGACATGTGCGGTGACTACTTCCGTAAGACCATGGAGCCCGTGGAGAAGG  7340

Query  881   TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
             || ||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||
Sbjct  7341  TGTTGCGCGACGCCAAGCTGTCCAAGAGCCAGGTGCACGAGGTTGTGCTAGTGGGCGGCT  7400

Query  941   CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
             ||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||
Sbjct  7401  CGACGCGTATCCCGAAGGTGCAGCAACTGCTGTCTGAGTTCTTCAACGGCAAGGAGCCCA  7460

Query  1001  ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
             ||||||||||||||||||||||||| || |||||||| || || ||||||||||||||||
Sbjct  7461  ACAAGTCCATCAACCCGGACGAGGCCGTAGCGTACGGCGCAACGGTGCAGGCGGCCATCC  7520

Query  1061  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
             || ||||||||||||||||||| ||||||||||||||| | ||| |||||||||||||||
Sbjct  7521  TGGGCGGCAACGACTCGTCGGACAAGCTGCAGGACCTGTTGCTGTTGGACGTGACGCCGC  7580

Query  1121  TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
             |||||||||| || |||||||| || |||||||||||||||||||||||||| |||||||
Sbjct  7581  TGTCTCTGGGCCTGGAGACGGCAGGCGGTGTCATGACGACGCTGATCGCGCGTAACACGA  7640

Query  1181  CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
             ||||||| ||||||||| |||||||||||||||||||||| |||||||||||||| ||||
Sbjct  7641  CGGTGCCTACCAAGAAGGCGCAGACGTTCTCGACGTACGCGGACAACCAGCCTGGTGTGC  7700

Query  1241  TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
             |||||||||||||||||||||||||||| ||||| || |||||  | || ||||||||||
Sbjct  7701  TCATCCAGGTGTTCGAGGGCGAGCGCTCGATGACCCGTGACAATCATCTTCTGGGCAAGT  7760

Query  1301  TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
             |||||||||||| |||||| ||||||||||| ||||| || ||||| || ||||||||||
Sbjct  7761  TCAACCTGGACGCCATCCCGCCCATGCCTCGTGGTGTTCCCCAGATTGATGTGACGTTCG  7820

Query  1361  ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
             |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||
Sbjct  7821  ACATCGACGCGAACGGGATCCTGAACGTGTCGGCCGTGGAGAAGTCGACGGGCAAGGAGA  7880

Query  1421  ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
             |||||||||| |||||||||||||||||||| || |||||| | || || ||||||||||
Sbjct  7881  ACAAGATCACTATCACGAACGACAAGGGCCGACTGTCGCAGTCCGATATCGACCGCATGG  7940

Query  1481  TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
             |  |||||||||||||||||||||||||||||||||| ||||||   |||||||||||||
Sbjct  7941  TGGCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCCAACAAGGTGCGCATCGAGGCCA  8000

Query  1541  AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
             |||||||||| ||||||||||| |||||| |||| ||||| ||||| ||||||||| |||
Sbjct  8001  AGAACGCGCTCGAGAACTACGCGTACAGTTTGCGCAACAGCCTGAACGACGAGAAGCTGA  8060

Query  1601  AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
             ||||| |||||||||| || |||||||||| ||||||||||||||||||||||  |||||
Sbjct  8061  AGGAGCAGATCCCGGAGGCCGACAAGAAGGTGGTGGACGACAAGGTGACGGAAACGATCC  8120

Query  1661  AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
             | ||||| |||||| |||||||   ||||| ||| | |||||||||||||||||||||  
Sbjct  8121  AATGGCTCGACGCACACCAGTCTGCGGAGACGGAGGAGTACGAGTCGAAGCAGAAGGAGC  8180

Query  1721  TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
             ||||||||||||| || ||  |  ||||||||||||||||||||||||||||  | ||||
Sbjct  8181  TGGAGGGCGTGGCGAATCCGATCCTGCAGAAGATGTACGCTGCTGCTGGCGGCGCTCCTG  8240

Query  1781  GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGG--TGCTCCCCCTGC  1838
             |||| ||||||||  ||||||| ||  |||| ||     |||  ||   |||||  |  |
Sbjct  8241  GTGCCGAGGGTGGCGTGCCCGGCGGCATGCCTGG-----TGCTGGGGCCGCTCCTTCGTC  8295

Query  1839  TGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
             ||| | |||||||||||||||||||||||| ||||||||||||
Sbjct  8296  TGGCGGTGCGGACCAGGGCCCGAAGATCGAAGAGGTCGACTAA  8338

 Score = 599 bits (663),  Expect = 2e-168
 Identities = 378/409 (92%), Gaps = 0/409 (0%)
 Strand=Plus/Plus

Query  1     ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  60
             ||| ||||||| |  |||||||||||||| |||||||||||||||||||| |||||||||
Sbjct  6371  ATGGCTCAAGCGAAGACGTCTGGATACTCGGTCGGCATCGACCTCGGCACGACCTACTCG  6430

Query  61    TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  120
             |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||
Sbjct  6431  TGCGTGGGCGTGTGGCAGAACGACCGCGTGGAGATCATCGCCAACGACCAGGGCAACCGC  6490

Query  121   ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  180
             ||||| ||||| ||||| |||||||| ||| |||| ||||| |||||||| |||||||||
Sbjct  6491  ACCACGCCGTCCTACGTGGCCTTCACGGACACGGAGCGCCTGATCGGTGATGCCGCCAAG  6550

Query  181   AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
             || ||||||||||||||||||||||||||||||||||||||||| || || |||||||||
Sbjct  6551  AACCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAGCGCCTTATCGGCCGC  6610

Query  241   AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  300
             ||||||||||||||  |||| ||||||||||||||||||||||||||| |  ||||||||
Sbjct  6611  AAGTTCTCGGACCCGATCGTGCAGGCCGACATCAAGCACTGGCCGTTCAAGCTGACGTCG  6670

Query  301   GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct  6671  GGCGCCGGCGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAG  6730

Query  361   CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
             |||||||||||||||||||||||||| ||||||||||||||||  ||||
Sbjct  6731  CCCGAGGAGATCTCGTCCATGGTGCTTATCAAGATGCGCGAGGTGGCCG  6779

 Score = 596 bits (660),  Expect = 7e-168
 Identities = 372/400 (93%), Gaps = 0/400 (0%)
 Strand=Plus/Minus

Query  1     ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  60
             ||| ||||||| |  |||||||||||||| |||||||||||||||||||| |||||||||
Sbjct  4980  ATGGCTCAAGCGAAGACGTCTGGATACTCGGTCGGCATCGACCTCGGCACGACCTACTCG  4921

Query  61    TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  120
             |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||
Sbjct  4920  TGCGTGGGCGTGTGGCAGAACGACCGCGTGGAGATCATCGCCAACGACCAGGGCAACCGC  4861

Query  121   ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  180
             ||||| ||||| ||||| |||||||| ||| |||| ||||| |||||||| |||||||||
Sbjct  4860  ACCACGCCGTCCTACGTGGCCTTCACGGACACGGAGCGCCTGATCGGTGATGCCGCCAAG  4801

Query  181   AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
             || ||||||||||||||||||||||||||||||||||||||||| || || |||||||||
Sbjct  4800  AACCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAGCGCCTTATCGGCCGC  4741

Query  241   AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  300
             ||||||||||||||  |||| ||||||||||||||||||||||||||| |  ||||||||
Sbjct  4740  AAGTTCTCGGACCCGATCGTGCAGGCCGACATCAAGCACTGGCCGTTCAAGCTGACGTCG  4681

Query  301   GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4680  GGCGCCGGCGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  4621

Query  361   CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCG  400
             |||||||||||||||||||||||||| |||||||||||||
Sbjct  4620  CCCGAGGAGATCTCGTCCATGGTGCTTATCAAGATGCGCG  4581

>PHRA:scaffold_1313
Length=6057

 Score = 2016 bits (2235),  Expect = 0.0
 Identities = 1339/1487 (90%), Gaps = 6/1487 (0%)
 Strand=Plus/Minus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             |||||||||| ||||| ||||| || |||||||||||||||||||||||||| |||||||
Sbjct  4111  AGGACGCCGGTGCCATCGCCGGGCTGAACGTGCTGCGTATCATCAACGAGCCCACGGCCG  4052

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
             |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4051  CCGCTATTGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  3992

Query  521   TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
             ||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
Sbjct  3991  TGGGCGGCGGCACCTTCGATGTGTCGCTGCTGTCCATTGAGGAGGGCATCTTCGAGGTGA  3932

Query  581   AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
             ||||||| ||||| |||||||||||||| || ||||||||||||||||| ||||||||||
Sbjct  3931  AGGCCACCGCTGGCGACACGCACCTGGGCGGCGAGGACTTCGACAACCGTCTGGTGGACC  3872

Query  641   ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
             ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
Sbjct  3871  ACTTCACTCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGACAACCAGCGTGCCC  3812

Query  701   TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
             | ||||||||||| ||||| |||||||| |||||||||||||| || |||||||||||||
Sbjct  3811  TCCGTCGTCTGCGTACGGCGTGCGAGCGCGCCAAGCGTACGCTTTCATCGTCGGCTCAGG  3752

Query  761   CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
             | ||||| |||||||||||||||||||| ||||| ||||| |||||||||||||| ||||
Sbjct  3751  CCTACATTGAGATTGACTCTCTGTTCGATGGCATTGACTTTAACTCGACCATCACGCGTG  3692

Query  821   CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
             |||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||
Sbjct  3691  CTCGTTTCGAGGACATGTGCGGTGACTACTTCCGTAAGACCATGGAGCCCGTGGAGAAGG  3632

Query  881   TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
             || ||||||||||||||||||| |||||||||||||||||||| || || || || ||||
Sbjct  3631  TGTTGCGCGACGCCAAGCTGTCCAAGAGCCAGGTGCACGAGGTTGTCCTTGTCGGTGGCT  3572

Query  941   CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
             |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||
Sbjct  3571  CGACGCGTATCCCGAAGGTGCAGCAGCTTCTGTCCGACTTCTTCAACGGCAAGGAGCCCA  3512

Query  1001  ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
             ||||||||||||||||||||||||||||||| |||||||| ||||| ||||| |||||||
Sbjct  3511  ACAAGTCCATCAACCCGGACGAGGCTGTGGCCTACGGTGCCACCGTCCAGGCTGCCATCC  3452

Query  1061  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
             |||| ||||||||||| ||||||||||||||||||||| | ||||| || ||||| || |
Sbjct  3451  TGAGTGGCAACGACTCTTCGGAGAAGCTGCAGGACCTGTTGCTGCTCGATGTGACTCCTC  3392

Query  1121  TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
             ||||||||||| | |||||||||||||| ||||||||||||||||||||||| |||||||
Sbjct  3391  TGTCTCTGGGTTTGGAGACGGCCGGTGGCGTCATGACGACGCTGATCGCGCGTAACACGA  3332

Query  1181  CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
             ||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct  3331  CGGTGCCCACCAAGAAGTCGCAGACGTTCTCGACGTACGCGGACAACCAGCCTGGTGTGC  3272

Query  1241  TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
             |||| ||||||||||||||||||||||| ||||| || ||||||||||||||||||||||
Sbjct  3271  TCATTCAGGTGTTCGAGGGCGAGCGCTCGATGACCCGTGACAACAACCTGCTGGGCAAGT  3212

Query  1301  TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
             ||||||||||||||||||| ||||||||||| ||||| || ||||| || ||||||||||
Sbjct  3211  TCAACCTGGACGGCATCCCGCCCATGCCTCGTGGTGTTCCCCAGATTGATGTGACGTTCG  3152

Query  1361  ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
             |||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||
Sbjct  3151  ACATCGACGCGAACGGAATCCTGAACGTGTCGGCTGTTGAGAAGTCGACGGGCAAGGAGA  3092

Query  1421  ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
             |||||||||| ||||||||||||||||| || || || ||||| ||||||||||||||||
Sbjct  3091  ACAAGATCACTATCACGAACGACAAGGGTCGTCTGTCCCAGGCCGACATTGACCGCATGG  3032

Query  1481  TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
             | || |||||||||||||||||||||||||||||||| ||||||   |||||||||||||
Sbjct  3031  TTTCCGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCCAACAAGGTGCGCATCGAGGCCA  2972

Query  1541  AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
             |||||||||| ||||||||||| ||||  ||||| ||||  || || ||||||||| |||
Sbjct  2971  AGAACGCGCTCGAGAACTACGCGTACAACCTGCGTAACACGCTCAACGACGAGAAGCTGA  2912

Query  1601  AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
             ||||  ||||| |||| | ||||||||||||  | || ||||||||||| ||    ||| 
Sbjct  2911  AGGACCAGATCTCGGAGGATGACAAGAAGGCCATCGAAGACAAGGTGACCGAGACCATCA  2852

Query  1661  AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
             | ||||| ||||| ||||||||    |||||||| | |||||||   |||||||||||  
Sbjct  2851  ACTGGCTCGACGCCAACCAGTCCGCTGAGAAGGAGGAGTACGAGGGCAAGCAGAAGGAGC  2792

Query  1721  TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
             |||||||||| ||||||||  |  ||||||||||||||||||||||||||||  ||||||
Sbjct  2791  TGGAGGGCGTTGCCAACCCGATCCTGCAGAAGATGTACGCTGCTGCTGGCGGCGCCCCTG  2732

Query  1781  GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCT------CCCC  1834
             |||| |||||||| |||||||||||| |||| ||||||||||||||||||      || |
Sbjct  2731  GTGCCGAGGGTGGCATGCCCGGTGGTATGCCCGGCGGCATGCCTGGTGCTGGCGCCCCGC  2672

Query  1835  CTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
             |||| || ||  ||||||||||||| |||||||||||||||||||||
Sbjct  2671  CTGCCGGCGCCCCGGACCAGGGCCCCAAGATCGAGGAGGTCGACTAA  2625

 Score = 603 bits (668),  Expect = 5e-170
 Identities = 379/409 (93%), Gaps = 0/409 (0%)
 Strand=Plus/Minus

Query  1     ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  60
             ||| ||||||| |  |||||||||||||| |||||||||||||||||||| |||||||||
Sbjct  4601  ATGGCTCAAGCGAAGACGTCTGGATACTCGGTCGGCATCGACCTCGGCACGACCTACTCG  4542

Query  61    TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  120
             |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||
Sbjct  4541  TGCGTGGGCGTGTGGCAGAACGACCGCGTGGAGATCATCGCCAACGACCAGGGCAACCGC  4482

Query  121   ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  180
             ||||| ||||| ||||| |||||||| ||| |||| ||||| |||||||| |||||||||
Sbjct  4481  ACCACGCCGTCCTACGTGGCCTTCACGGACACGGAGCGCCTGATCGGTGATGCCGCCAAG  4422

Query  181   AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
             || ||||||||||||||||||||||||||||||||||||||||| || || |||||||||
Sbjct  4421  AACCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAGCGCCTTATCGGCCGC  4362

Query  241   AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  300
             ||||||||||||||  |||| ||||||||||||||||||||||||||| |  ||||||||
Sbjct  4361  AAGTTCTCGGACCCGATCGTGCAGGCCGACATCAAGCACTGGCCGTTCAAGCTGACGTCG  4302

Query  301   GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  4301  GGCGCCGGCGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  4242

Query  361   CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
             |||||||||||||||||||||||||| ||||||||||||||||  ||||
Sbjct  4241  CCCGAGGAGATCTCGTCCATGGTGCTTATCAAGATGCGCGAGGTGGCCG  4193

>PHPA:scaffold_2 NW_008648988.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.2, whole genome shotgun 
sequence
Length=2916180

 Score = 1971 bits (2185),  Expect = 0.0
 Identities = 1329/1487 (89%), Gaps = 6/1487 (0%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||||||||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||
Sbjct  160690  AGGACGCCGGTGCCATCGCCGGTCTCAACGTGCTGCGTATTATTAACGAGCCGACGGCCG  160749

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               |||||||||||||||| |||||||||||||| ||||||||||||||| ||||||||||||
Sbjct  160750  CCGCCATCGCGTACGGTCTGGACAAGAAGGGTGGCGAGCGCAACGTGTTGATCTTCGACC  160809

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               ||||||||||||||||||| |||||  | |||  ||||||||| |||||||||||||| |
Sbjct  160810  TGGGCGGCGGCACCTTCGACGTGTCGTTGCTGAGCATTGAGGAAGGCATCTTCGAGGTGA  160869

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               | ||||| || ||||||||||||||||||||||||||||||||||||||||| || ||||
Sbjct  160870  AAGCCACAGCGGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTCGTCGACC  160929

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct  160930  ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACTGAGAACCAGCGTGCTC  160989

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               | ||||||||| | |||||||||||||| || |||||||||||||| |||||||||||||
Sbjct  160990  TGCGTCGTCTGAGAACGGCCTGCGAGCGCGCTAAGCGTACGCTGTCTTCGTCGGCTCAGG  161049

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               |||| || ||||||||||| |||||||| || || |||||||||||||||||||| ||||
Sbjct  161050  CTTATATTGAGATTGACTCGCTGTTCGATGGTATTGACTTCAACTCGACCATCACGCGTG  161109

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               |||||||||| ||||||||||| ||||||||||||||||| |||||||| || |||||||
Sbjct  161110  CTCGTTTCGAAGACATGTGCGGTGACTACTTCCGCAAGACCATGGAGCCTGTCGAGAAGG  161169

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               | ||||| ||||||||||||||||||||||||||||||||||| |||||||| || ||||
Sbjct  161170  TTCTGCGTGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTTGTGCTGGTTGGTGGCT  161229

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               | || |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct  161230  CTACCCGTATCCCCAAGGTTCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  161289

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
               |||||||||||||||| || |||||||| || |||||||| ||||| ||||| ||||| |
Sbjct  161290  ACAAGTCCATCAACCCTGATGAGGCTGTTGCCTACGGTGCCACCGTCCAGGCTGCCATTC  161349

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               ||||||| |||||||||||||||||||||||||||||||| || ||||| ||||||||||
Sbjct  161350  TGAGCGGTAACGACTCGTCGGAGAAGCTGCAGGACCTGCTGCTTCTGGATGTGACGCCGC  161409

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
               ||||||||||||| ||||| ||||||||||||||||| || ||||| ||||| |||||||
Sbjct  161410  TGTCTCTGGGTCTGGAGACTGCCGGTGGTGTCATGACCACTCTGATTGCGCGTAACACGA  161469

Query  1181    CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
               ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct  161470  CGGTGCCGACCAAGAAGTCGCAGACTTTCTCGACGTACGCCGACAACCAGCCTGGTGTGC  161529

Query  1241    TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
               |||| |||||||||||||| ||||| || |||||||||||||||||||||||||||||||
Sbjct  161530  TCATTCAGGTGTTCGAGGGTGAGCGTTCGATGACGCGCGACAACAACCTGCTGGGCAAGT  161589

Query  1301    TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
               |||||||||||||||| || |||||||| || ||||| || |||||||| ||||||||||
Sbjct  161590  TCAACCTGGACGGCATTCCGCCCATGCCCCGTGGTGTTCCCCAGATCGATGTGACGTTCG  161649

Query  1361    ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
               |||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct  161650  ACATCGACGCTAACGGCATCCTGAACGTGTCGGCCGTGGAGAAGTCGACGGGCAAGGAGA  161709

Query  1421    ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
               |||||||||||||||||||||||||||| || || || ||||||||||||||||| ||||
Sbjct  161710  ACAAGATCACGATCACGAACGACAAGGGTCGTCTGTCCCAGGCTGACATTGACCGTATGG  161769

Query  1481    TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
               |  | |||||||||||||||||||||||||| ||||| ||||||   ||||||||||| |
Sbjct  161770  TTGCTGAGGCCGAGAAGTACAAGTCGGAGGATGAGGCCAACAAGGTCCGCATCGAGGCGA  161829

Query  1541    AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
               |||||||||||||||||||||| ||||  ||||| |||| |||||| ||||||||  | |
Sbjct  161830  AGAACGCGCTGGAGAACTACGCTTACAACCTGCGTAACACTCTGAACGACGAGAAACTCA  161889

Query  1601    AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
               ||||  ||||| |||| | ||||||||||||  | || ||||||||||| ||    ||| 
Sbjct  161890  AGGACCAGATCTCGGAGGATGACAAGAAGGCCATCGATGACAAGGTGACCGAGACCATCA  161949

Query  1661    AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
               | ||||| ||||| ||||||||    |||||||| | |||||||   |||||||||||  
Sbjct  161950  ACTGGCTCGACGCCAACCAGTCGGCTGAGAAGGAGGAGTACGAGGGCAAGCAGAAGGAGC  162009

Query  1721    TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
               | |||||||| ||||||||  |  ||||||||||||||||||||||||||||| ||||||
Sbjct  162010  TTGAGGGCGTTGCCAACCCGATCCTGCAGAAGATGTACGCTGCTGCTGGCGGTGCCCCTG  162069

Query  1781    GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCT------CCCC  1834
               | ||||||||||| |||||||||||| |||| ||||||||||||||||||      || |
Sbjct  162070  GCGCTGAGGGTGGCATGCCCGGTGGTATGCCCGGCGGCATGCCTGGTGCTGGCGCCCCGC  162129

Query  1835    CTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
               ||||||| ||| | ||||||||||| ||||| |||||||||||||||
Sbjct  162130  CTGCTGGCGCTCCCGACCAGGGCCCCAAGATTGAGGAGGTCGACTAA  162176

 Score = 1874 bits (2078),  Expect = 0.0
 Identities = 1287/1457 (88%), Gaps = 24/1457 (2%)
 Strand=Plus/Plus

Query  437     GTATCATCAACGAGCCGACGGCCGCCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCG  496
               |||| || |||||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct  151279  GTATTATTAACGAGCCGACGGCCGCCGCCATCGCGTACGGTCTGGACAAGAAGGGTGGCG  151338

Query  497     AGCGCAACGTGCTGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCA  556
               ||||||||||| ||||||||||||||||||||||||||||||| |||||  | |||  ||
Sbjct  151339  AGCGCAACGTGTTGATCTTCGACCTGGGCGGCGGCACCTTCGACGTGTCGTTGCTGAGCA  151398

Query  557     TTGAGGAGGGCATCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGG  616
               ||||||| |||||||||||||| || ||||| || |||||||||||||||||||||||||
Sbjct  151399  TTGAGGAAGGCATCTTCGAGGTGAAAGCCACAGCGGGTGACACGCACCTGGGTGGTGAGG  151458

Query  617     ACTTCGACAACCGCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGG  676
               |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||
Sbjct  151459  ACTTCGACAACCGCCTCGTCGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGG  151518

Query  677     ACATCACGGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGC  736
               |  | ||| | |||||||| || || ||||||||||| ||||| || |||||||||||||
Sbjct  151519  ATCTGACGCACAACCAGCGCGCACTACGTCGTCTGCGTACGGCGTGTGAGCGTGCCAAGC  151578

Query  737     GTACGCTGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCG  796
               ||||| |||||||||||||||| || ||||||||||| ||||| ||||  |||||| | |
Sbjct  151579  GTACGTTGTCGTCGTCGGCTCAAGCCTACATCGAGATCGACTCGCTGTATGACGGCGTGG  151638

Query  797     ACTTCAACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCA  856
               ||||||||||||||||||| || || |||||||||||| |||||| ||||||||||||||
Sbjct  151639  ACTTCAACTCGACCATCACGCGCGCACGTTTCGAGGACCTGTGCGCCGACTACTTCCGCA  151698

Query  857     AGACGATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGC  916
               |||||||||||||||||||||||||||| ||||| ||||||||||| ||| | |||||||
Sbjct  151699  AGACGATGGAGCCCGTGGAGAAGGTGCTACGCGATGCCAAGCTGTCCAAGGGTCAGGTGC  151758

Query  917     ACGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGG  976
               | || |||||||| |||||||| ||||| |||||||| |||||||||||||| |||||||
Sbjct  151759  ATGAAGTGGTGCTCGTGGGCGGATCGACCCGTATCCCCAAGGTGCAGCAGCTTCTGTCGG  151818

Query  977     ACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACG  1036
               |||||||||||||||||||||||||||||||||||||||||||||| || || |||||||
Sbjct  151819  ACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAAGCCGTCGCGTACG  151878

Query  1037    GTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACC  1096
               | || || |||||||| || ||||||||||||||||||||||||||||||||||||||||
Sbjct  151879  GCGCCACGGTGCAGGCAGCTATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACC  151938

Query  1097    TGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGA  1156
               |||| ||||| |||||||||||||||||  ||||||| |||||||| |||||||||||||
Sbjct  151939  TGCTACTGCTAGACGTGACGCCGCTGTCGTTGGGTCTGGAGACGGCGGGTGGTGTCATGA  151998

Query  1157    CGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGT  1216
               |||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||
Sbjct  151999  CGACGCTGATTGCGCGTAACACGACAGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGT  152058

Query  1217    ACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGC  1276
               |||| ||||||||||| || ||||| || ||||| ||||| ||||| ||| |||||||||
Sbjct  152059  ACGCGGACAACCAGCCGGGCGTGCTGATTCAGGTATTCGAAGGCGAACGCACCATGACGC  152118

Query  1277    GCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTG  1336
               |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||
Sbjct  152119  GCGACAACAACCTGCTGGGCAAATTCAACCTGGACGGCATCCCGCCCATGCCTCGCGGTG  152178

Query  1337    TGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTG  1396
               |||| ||||||||||||||||||||||||||||| || ||||| |||||||||||||| |
Sbjct  152179  TGCCACAGATCGACGTGACGTTCGACATCGACGCCAATGGCATTCTGAACGTGTCGGCCG  152238

Query  1397    TGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCT  1456
               |||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct  152239  TGGAGAAGTCGACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAAGGTCGCCTCT  152298

Query  1457    CGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGG  1516
               ||||||| || || |||||||||||  | || ||||||||||||||||||||||||||||
Sbjct  152299  CGCAGGCCGAGATCGACCGCATGGTGGCCGAAGCCGAGAAGTACAAGTCGGAGGACGAGG  152358

Query  1517    CTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGA  1576
               | ||||||   ||||||||||| ||||||||||||||||||||||| ||||||||||| |
Sbjct  152359  CCAACAAGGTGCGCATCGAGGCGAAGAACGCGCTGGAGAACTACGCGTACAGTCTGCGCA  152418

Query  1577    ACAGTCTGAATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGG  1636
               |||||||||| |||||||||||||||||||||||||| ||||| || ||||||| |||||
Sbjct  152419  ACAGTCTGAACGACGAGAAGATGAAGGAGAAGATCCCAGAAGCCGATAAGAAGGTGGTGG  152478

Query  1637    ACGACAAGGTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATG  1696
               |||||||||||||||| |||||||| ||||||||||| ||||||||    |||||||| |
Sbjct  152479  ACGACAAGGTGACGGAGGTGATCCAATGGCTGGACGCCAACCAGTCGGCCGAGAAGGAAG  152538

Query  1697    CGTACGAGTCGAAGCAGAAGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGT  1756
                |||||||||||||||||||||  |||||   || |||||||| ||| |||||||| |||
Sbjct  152539  AGTACGAGTCGAAGCAGAAGGAGCTGGAGTCTGTTGCCAACCCGGTGCTGCAGAAGGTGT  152598

Query  1757    ACGCTGCTGCTGGCGGTTCCCCTGGTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCG  1816
               ||||  |||| |||||| |            || ||||||| |||||||  || ||||||
Sbjct  152599  ACGCATCTGCGGGCGGTGC------------GGATGGTATGGCCGGTGGAATGGCGGGCG  152646

Query  1817    GCATGCCTGGTGCTCCCCCTGCTGGTGC------------TGCGGACCAGGGCCCGAAGA  1864
               ||||||||||||||    |||||  | |            | ||||||||||||||||||
Sbjct  152647  GCATGCCTGGTGCTGGAGCTGCTCCTTCCTCGTCGAGTAGTACGGACCAGGGCCCGAAGA  152706

Query  1865    TCGAGGAGGTCGACTAA  1881
               |||||||||| ||||||
Sbjct  152707  TCGAGGAGGTTGACTAA  152723

 Score = 543 bits (601),  Expect = 1e-151
 Identities = 366/409 (89%), Gaps = 3/409 (1%)
 Strand=Plus/Plus

Query  1       ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  60
               ||||||||||||||   |||||||||||| || ||||| || |||||||| |||||||||
Sbjct  154475  ATGACTCAAGCTAC---GTCTGGATACTCGGTGGGCATTGATCTCGGCACGACCTACTCG  154531

Query  61      TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  120
               ||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||||
Sbjct  154532  TGCGTCGGCGTGTGGCAGAACGACCGCGTGGAGATCATCGCCAACGACCAGGGCAACCGC  154591

Query  121     ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  180
               || |||||||| ||||| || |||||||||||||| ||||||||||||||||| || |||
Sbjct  154592  ACGACCCCGTCGTACGTGGCGTTCACAGACTCGGAGCGCCTCATCGGTGACGCTGCTAAG  154651

Query  181     AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
               || ||||| |||||||||||   |||||||||||| |||||||| |||||||||||||||
Sbjct  154652  AACCAGGTTGCCATGAACGCAGCCAACACGGTGTTTGACGCCAAGCGTCTGATCGGCCGC  154711

Query  241     AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  300
               ||||||||||||||  |||| ||||||||||||||||||||||||||| |  | ||||| 
Sbjct  154712  AAGTTCTCGGACCCAATCGTGCAGGCCGACATCAAGCACTGGCCGTTCAAGATCACGTCC  154771

Query  301     GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
               ||  ||||||||||||||||||||||||||||||||||||| |||  |||||||||||| 
Sbjct  154772  GGTCCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGTGAGAGCAAGACGTTCCAG  154831

Query  361     CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
               ||||| ||||||||||| |||||||||||||||||||||||||  ||||
Sbjct  154832  CCCGAAGAGATCTCGTCTATGGTGCTGATCAAGATGCGCGAGGTGGCCG  154880

 Score = 536 bits (594),  Expect = 6e-150
 Identities = 354/392 (90%), Gaps = 0/392 (0%)
 Strand=Plus/Plus

Query  18      GTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCA  77
               |||||||||||| |||||||| ||||| ||||| |||||||||||||| |||||||||||
Sbjct  160217  GTCTGGATACTCGGTCGGCATTGACCTTGGCACGACCTACTCGTGCGTCGGCGTGTGGCA  160276

Query  78      GAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGT  137
               ||||||||| ||||| |||||||||||||||||||| ||||| ||||||||||| |||||
Sbjct  160277  GAACGACCGCGTGGAGATCATCGCCAACGACCAGGGTAACCGTACCACCCCGTCGTACGT  160336

Query  138     CGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAA  197
               ||||||||| ||| | || || || |||||||| ||||||||||| ||||| ||||||||
Sbjct  160337  CGCCTTCACGGACACCGAGCGTCTGATCGGTGATGCCGCCAAGAACCAGGTCGCCATGAA  160396

Query  198     CGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGT  257
               ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||  |
Sbjct  160397  CGCGCACAACACGGTGTTCGACGCCAAGCGTCTGATCGGCCGCAAGTTCTCGGACCCGAT  160456

Query  258     CGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCC  317
               ||| ||||||||||||||||||||||||||| |  | ||||| ||| |||| ||||||||
Sbjct  160457  CGTGCAGGCCGACATCAAGCACTGGCCGTTCAAGATCACGTCCGGCCCCGGCGACAAGCC  160516

Query  318     GCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTC  377
               |||||||||||||||||||||||| |||  |||||||||||| ||||| |||||||||||
Sbjct  160517  GCAGATCACGGTGCAGTTCAAGGGTGAGAGCAAGACGTTCCAGCCCGAAGAGATCTCGTC  160576

Query  378     CATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
                |||||||||||||||||||||||||  ||||
Sbjct  160577  TATGGTGCTGATCAAGATGCGCGAGGTGGCCG  160608

 Score = 247 bits (273),  Expect = 1e-62
 Identities = 159/174 (91%), Gaps = 0/174 (0%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||||||||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||
Sbjct  154962  AGGACGCCGGTGCCATCGCCGGTCTCAACGTGCTGCGTATTATTAACGAGCCGACGGCCG  155021

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               |||||||||||||||| |||||||||||||| ||||||||||||||| ||||||||||||
Sbjct  155022  CCGCCATCGCGTACGGTCTGGACAAGAAGGGTGGCGAGCGCAACGTGTTGATCTTCGACC  155081

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCG  574
               ||||||||||||||||||| |||||  | |||  ||||||||| ||||||||||
Sbjct  155082  TGGGCGGCGGCACCTTCGACGTGTCGTTGCTGAGCATTGAGGAAGGCATCTTCG  155135

 Score = 59.9 bits (65),  Expect = 4e-06
 Identities = 34/35 (97%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  1847    CGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
               |||||||||||||||||||||||||||| ||||||
Sbjct  156478  CGGACCAGGGCCCGAAGATCGAGGAGGTTGACTAA  156512

>PHIF:NW_003303740.1 Phytophthora infestans T30-4 supercont1.19 
genomic scaffold, whole genome shotgun sequence
Length=2398068

 Score = 1929 bits (2138),  Expect = 0.0
 Identities = 1318/1483 (89%), Gaps = 12/1483 (1%)
 Strand=Plus/Minus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||| ||||| || || || || |||||||||||||||||||||||||||||||| ||||
Sbjct  2065167  AGGATGCCGGTGCTATCGCTGGGCTCAACGTGCTGCGTATCATCAACGAGCCGACCGCCG  2065108

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                | || ||||||||||||||||||||||| || ||||||||||||||||| |||||||| |
Sbjct  2065107  CTGCGATCGCGTACGGCCTGGACAAGAAAGGTGGCGAGCGCAACGTGCTTATCTTCGATC  2065048

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                ||||||||||||| || || |||||| | |||   ||||||||||||||||||||||| |
Sbjct  2065047  TGGGCGGCGGCACGTTTGACGTGTCTTTGCTGAGTATTGAGGAGGGCATCTTCGAGGTGA  2064988

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                | ||||| || ||||||||||||||||| ||||||||||||||||||||||| || || |
Sbjct  2064987  AAGCCACAGCGGGTGACACGCACCTGGGCGGTGAGGACTTCGACAACCGCCTCGTCGAGC  2064928

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
                | |||  ||||||||||||||||||||||||||||||| | ||| |||||||||| ||  
Sbjct  2064927  ATTTCGTGCAGGAGTTCAAGCGCAAGCACCGCAAGGACCTGACGCAGAACCAGCGCGCGT  2064868

Query  701      TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
                | ||||||||||| ||||| || |||||||||||||||||||||||||||||| | || |
Sbjct  2064867  TGCGTCGTCTGCGTACGGCGTGTGAGCGTGCCAAGCGTACGCTGTCGTCGTCGTCACAAG  2064808

Query  761      CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
                | ||||||||||| ||||||||||| |||||| | |||||||||||||||||||| || |
Sbjct  2064807  CCTACATCGAGATCGACTCTCTGTTTGACGGCGTGGACTTCAACTCGACCATCACGCGCG  2064748

Query  821      CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
                | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2064747  CGCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  2064688

Query  881      TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                | || ||||| ||||||||||| ||| |||||||||| ||||||||||| |||||||| |
Sbjct  2064687  TTCTACGCGATGCCAAGCTGTCCAAGGGCCAGGTGCATGAGGTGGTGCTCGTGGGCGGAT  2064628

Query  941      CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
                | ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct  2064627  CCACGCGTATCCCCAAGGTGCAGCAGCTGCTGTCCGACTTCTTCAACGGCAAGGAGCCCA  2064568

Query  1001     ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                |||||||||||||||| || ||||||||||| |||||||| ||||| ||||| ||||| |
Sbjct  2064567  ACAAGTCCATCAACCCAGATGAGGCTGTGGCCTACGGTGCTACCGTCCAGGCTGCCATTC  2064508

Query  1061     TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
                ||||||||||||||||||| ||||||||||||||| |||| || ||||| ||||||||| 
Sbjct  2064507  TGAGCGGCAACGACTCGTCCGAGAAGCTGCAGGACTTGCTGCTTCTGGATGTGACGCCGT  2064448

Query  1121     TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
                ||||||| ||||| |||||||| || |||||||||||||||||||| || || |||||||
Sbjct  2064447  TGTCTCTAGGTCTGGAGACGGCGGGCGGTGTCATGACGACGCTGATTGCTCGTAACACGA  2064388

Query  1181     CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
                | |||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||
Sbjct  2064387  CAGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCGGACAACCAGCCGGGCGTGC  2064328

Query  1241     TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
                |||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct  2064327  TCATTCAGGTGTTCGAGGGCGAGCGCACCATGACACGCGACAACAACCTGCTGGGCAAGT  2064268

Query  1301     TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
                ||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||
Sbjct  2064267  TCAACCTGGACGGCATCCCGCCCATGCCTCGTGGGGTGCCGCAGATCGACGTGACGTTCG  2064208

Query  1361     ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
                |||||||||| ||||||||||||||||||||||| ||||||||||| || ||||||||||
Sbjct  2064207  ACATCGACGCCAACGGCATCCTGAACGTGTCGGCCGTGGAGAAGTCGACCGGCAAGGAGA  2064148

Query  1421     ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
                ||||||||||||||||||||||||||||||||||||||||||| || || || |||||||
Sbjct  2064147  ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCCGAGATCGAACGCATGG  2064088

Query  1481     TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
                |  |||||||||||||||||||||||| ||||||||| ||||||   ||||||||||| |
Sbjct  2064087  TGGCGGAGGCCGAGAAGTACAAGTCGGCGGACGAGGCCAACAAGGCGCGCATCGAGGCGA  2064028

Query  1541     AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
                |||||||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||
Sbjct  2064027  AGAACGCGCTGGAGAACTACGCGTACAGTCTGCGTAACAGTCTGAACGACGAGAAGATGA  2063968

Query  1601     AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
                ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||
Sbjct  2063967  AGGAGAAGATCCCGGAAGCCGACAAGAAGGTGGTGGACGACAAGGTGACGGAAGTGATCC  2063908

Query  1661     AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
                |||||||||| ||  ||||||| | ||||||||| | |||||||||||||||||||||  
Sbjct  2063907  AGTGGCTGGATGCGCACCAGTCGTCGGAGAAGGAGGAGTACGAGTCGAAGCAGAAGGAGC  2063848

Query  1721     TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
                ||||| ||||||| ||||| ||  |||||||| |||||||  |||| |||         |
Sbjct  2063847  TGGAGAGCGTGGCTAACCCGGTACTGCAGAAGGTGTACGCATCTGCAGGC---------G  2063797

Query  1781     GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCTCCCCCT-GCT  1839
                ||||||  | |||||||||||||||  ||||||| |  ||||||||| ||    || |||
Sbjct  2063796  GTGCTGGTGATGGTATGCCCGGTGGCATGCCGGGTGATATGCCTGGTACTGATTCTCGCT  2063737

Query  1840     GGT--GCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTA  1880
                 ||  | ||| || ||||| |||||||| |||||||| |||||
Sbjct  2063736  CGTCGGGTGCTGAGCAGGGTCCGAAGATTGAGGAGGTGGACTA  2063694

 Score = 1917 bits (2125),  Expect = 0.0
 Identities = 1316/1484 (89%), Gaps = 12/1484 (1%)
 Strand=Plus/Plus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||| ||||| || || || || |||||||||||||||||||||||||||||||| ||||
Sbjct  2068065  AGGATGCCGGTGCTATCGCTGGGCTCAACGTGCTGCGTATCATCAACGAGCCGACCGCCG  2068124

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                | || ||||||||||||||||||||||| || |||||||||||||||||||||||||| |
Sbjct  2068125  CTGCGATCGCGTACGGCCTGGACAAGAAAGGTGGCGAGCGCAACGTGCTGATCTTCGATC  2068184

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                ||||||||||||| || || |||||| | |||   ||||||||||||||||||||||| |
Sbjct  2068185  TGGGCGGCGGCACGTTTGACGTGTCTTTGCTGAGTATTGAGGAGGGCATCTTCGAGGTGA  2068244

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                | ||||| || ||||||||||||||||| ||||||||||||||||||||||| || || |
Sbjct  2068245  AAGCCACAGCGGGTGACACGCACCTGGGCGGTGAGGACTTCGACAACCGCCTCGTCGAGC  2068304

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
                | |||  ||||||||||||||||||||||||||||||| | ||| |||||||||| ||  
Sbjct  2068305  ATTTCGTGCAGGAGTTCAAGCGCAAGCACCGCAAGGACCTGACGCAGAACCAGCGCGCGT  2068364

Query  701      TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
                | ||||||||||| ||||| || |||||||||||||||||||||||||||||||| || |
Sbjct  2068365  TGCGTCGTCTGCGTACGGCGTGTGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCACAAG  2068424

Query  761      CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
                | ||||||||||| ||||||||||| |||||| | |||||||||||||||||||| || |
Sbjct  2068425  CCTACATCGAGATCGACTCTCTGTTTGACGGCGTGGACTTCAACTCGACCATCACGCGCG  2068484

Query  821      CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
                | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2068485  CGCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  2068544

Query  881      TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                | || ||||| ||||||||||| ||| |||||||||| ||||||||||| |||||||| |
Sbjct  2068545  TTCTACGCGATGCCAAGCTGTCCAAGGGCCAGGTGCATGAGGTGGTGCTCGTGGGCGGAT  2068604

Query  941      CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
                | ||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||
Sbjct  2068605  CCACGCGTATCCCCAAGGTGCAGCAGCTGCTGTCCGACTTCTTTAACGGCAAGGAGCCCA  2068664

Query  1001     ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                |||||||||||||||| || ||||| || |||||||| || || |||||||| ||||| |
Sbjct  2068665  ACAAGTCCATCAACCCAGATGAGGCCGTCGCGTACGGCGCCACGGTGCAGGCTGCCATTC  2068724

Query  1061     TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
                ||||||||||||||||||| |||||||||||||||||||| || ||||| ||||||||| 
Sbjct  2068725  TGAGCGGCAACGACTCGTCCGAGAAGCTGCAGGACCTGCTGCTTCTGGATGTGACGCCGT  2068784

Query  1121     TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
                ||||||| ||||| |||||||| || |||||||||||||||||||| || || |||||||
Sbjct  2068785  TGTCTCTAGGTCTGGAGACGGCGGGCGGTGTCATGACGACGCTGATTGCTCGTAACACGA  2068844

Query  1181     CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
                |||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||
Sbjct  2068845  CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCGGACAACCAGCCGGGCGTGC  2068904

Query  1241     TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
                |||| ||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||
Sbjct  2068905  TCATTCAGGTGTTCGAGGGCGAGCGCACCATGACACGCGACAACAACCTGCTCGGCAAGT  2068964

Query  1301     TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
                ||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||
Sbjct  2068965  TCAACCTGGACGGCATCCCGCCCATGCCTCGTGGGGTGCCGCAGATCGACGTGACGTTCG  2069024

Query  1361     ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
                |||||||||| ||||||||||||||||||||||| ||||||||||| || ||||||||||
Sbjct  2069025  ACATCGACGCCAACGGCATCCTGAACGTGTCGGCCGTGGAGAAGTCGACCGGCAAGGAGA  2069084

Query  1421     ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
                ||||||||||||||||||||||||||||||||||||||||||| || || || |||||||
Sbjct  2069085  ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCCGAGATCGAACGCATGG  2069144

Query  1481     TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
                |  |||||||||||||||||||||||||||||||||| ||||||   || |||||||| |
Sbjct  2069145  TGGCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCCAACAAGGTGCGTATCGAGGCGA  2069204

Query  1541     AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
                |||||||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||
Sbjct  2069205  AGAACGCGCTGGAGAACTACGCGTACAGTCTGCGAAACAGTCTGAACGACGAGAAGATGA  2069264

Query  1601     AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
                ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||
Sbjct  2069265  AGGAGAAGATCCCGGAAGCCGACAAGAAGGTGGTGGACGACAAGGTGACGGAAGTGATCC  2069324

Query  1661     AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
                ||||| |||| ||  |||| || | ||||||||| | |||||||||||||||||||||  
Sbjct  2069325  AGTGGATGGATGCGCACCAATCGTCGGAGAAGGAGGAGTACGAGTCGAAGCAGAAGGAGC  2069384

Query  1721     TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
                ||||| ||||||| ||||| ||| |||||||| |||| ||  |||| |||         |
Sbjct  2069385  TGGAGAGCGTGGCTAACCCGGTGCTGCAGAAGGTGTATGCATCTGCAGGC---------G  2069435

Query  1781     GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCTCCCCCT-GCT  1839
                ||||||  | ||||||||||||| |  |||||   |  ||||||||| ||  | || |||
Sbjct  2069436  GTGCTGGTGATGGTATGCCCGGTAGCATGCCGAATGATATGCCTGGTACTGACTCTCGCT  2069495

Query  1840     GGT--GCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
                 ||  | ||| || ||||| ||||||||||||||||| ||||||
Sbjct  2069496  CGTCGGGTGCCGAGCAGGGTCCGAAGATCGAGGAGGTGGACTAA  2069539

 Score = 1898 bits (2104),  Expect = 0.0
 Identities = 1321/1505 (88%), Gaps = 24/1505 (2%)
 Strand=Plus/Minus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||| ||||| |||||||| || |||||||||||||||||||| ||||||||||| ||||
Sbjct  2000659  AGGATGCCGGTGCCATTGCTGGGCTCAACGTGCTGCGTATCATTAACGAGCCGACTGCCG  2000600

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                | || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||
Sbjct  2000599  CTGCTATCGCTTACGGCCTTGACAAGAAGGGCGGCGAGCGCAACGTGCTCATCTTCGACC  2000540

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                | || ||||| |||||||||||||| || |||  ||| || ||||||||||||||||| |
Sbjct  2000539  TTGGTGGCGGTACCTTCGATGTGTCGCTGCTGAGCATCGAAGAGGGCATCTTCGAGGTGA  2000480

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                |||| ||||| |||||||| ||| |||||||||||||||| |||||||| ||||||||||
Sbjct  2000479  AGGCTACTGCCGGTGACACTCACTTGGGTGGTGAGGACTTTGACAACCGTCTGGTGGACC  2000420

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct  2000419  ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCCC  2000360

Query  701      TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
                | |||||||| || || || ||||||||||| ||||||||||| |||||||| |||||||
Sbjct  2000359  TGCGTCGTCTACGAACTGCTTGCGAGCGTGCTAAGCGTACGCTTTCGTCGTCTGCTCAGG  2000300

Query  761      CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
                ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct  2000299  CTTACATTGAGATTGACTCTCTGTTCGACGGTATCGACTTCAACTCGACCATCACGCGTG  2000240

Query  821      CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
                | |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct  2000239  CCCGTTTCGAGGACATGTGCGGTGACTACTTCCGCAAGACGATGGAGCCTGTGGAGAAGG  2000180

Query  881      TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                ||||||| ||||| |||||||| ||||||||||||||||| ||||||||||| || || |
Sbjct  2000179  TGCTGCGTGACGCTAAGCTGTCCAAGAGCCAGGTGCACGAAGTGGTGCTGGTCGGTGGTT  2000120

Query  941      CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
                | ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct  2000119  CCACGCGTATCCCTAAGGTGCAGCAGCTGCTGTCCGACTTCTTCAACGGCAAGGAGCCCA  2000060

Query  1001     ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                |||||||||||||||| || ||||||||||| |||||||| ||||| ||||| ||||| |
Sbjct  2000059  ACAAGTCCATCAACCCCGATGAGGCTGTGGCCTACGGTGCTACCGTCCAGGCTGCCATTC  2000000

Query  1061     TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
                ||||||| ||||| ||||| ||||||||||||||  |||| ||  |||| |||||||| |
Sbjct  1999999  TGAGCGGTAACGATTCGTCTGAGAAGCTGCAGGATTTGCTGCTTTTGGATGTGACGCCTC  1999940

Query  1121     TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
                ||||||||||||| |||||||| |||||||||||||| || ||||| || || |||||||
Sbjct  1999939  TGTCTCTGGGTCTGGAGACGGCTGGTGGTGTCATGACCACCCTGATTGCTCGTAACACGA  1999880

Query  1181     CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
                ||||||||||||||||||| ||||||||||||||||||||||| |||||||| || ||||
Sbjct  1999879  CGGTGCCGACCAAGAAGTCACAGACGTTCTCGACGTACGCCGATAACCAGCCGGGTGTGC  1999820

Query  1241     TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
                ||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct  1999819  TCATCCAGGTGTTTGAGGGTGAGCGTTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1999760

Query  1301     TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
                ||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||
Sbjct  1999759  TCAACCTGGACGGCATCCCGCCCATGCCTCGTGGGGTGCCGCAGATCGACGTGACGTTCG  1999700

Query  1361     ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
                |||||||||| |||||||||||||||||||||||||| |||||||| ||||| |||||||
Sbjct  1999699  ACATCGACGCTAACGGCATCCTGAACGTGTCGGCTGTTGAGAAGTCGACGGGTAAGGAGA  1999640

Query  1421     ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
                |||||||||| || || ||||||||||| || || || ||||||||||||||||||||||
Sbjct  1999639  ACAAGATCACCATTACCAACGACAAGGGTCGTCTGTCTCAGGCTGACATTGACCGCATGG  1999580

Query  1481     TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
                | ||||| || |||||||||||||||||||||||||| ||||||   ||||| |||||||
Sbjct  1999579  TCTCGGAAGCTGAGAAGTACAAGTCGGAGGACGAGGCCAACAAGGTCCGCATTGAGGCCA  1999520

Query  1541     AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
                ||||||| |||||||||||||| ||||  ||||| |||| |||||| ||||||||| | |
Sbjct  1999519  AGAACGCTCTGGAGAACTACGCGTACAACCTGCGCAACACTCTGAACGACGAGAAGCTCA  1999460

Query  1601     AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
                ||||  ||||| |||| | |||||||||||   | |||||||||||||| ||    ||| 
Sbjct  1999459  AGGACCAGATCTCGGAGGATGACAAGAAGGTAATCGACGACAAGGTGACCGAGACCATCA  1999400

Query  1661     AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
                | ||||| ||||| ||||||||    |||||||| | |||||||   |||||||||||  
Sbjct  1999399  ACTGGCTCGACGCGAACCAGTCGGCTGAGAAGGAGGAGTACGAGGGCAAGCAGAAGGAGC  1999340

Query  1721     TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
                | ||||| || ||||||||  |  ||||||||||||||||||||||||||||| ||||||
Sbjct  1999339  TCGAGGGTGTTGCCAACCCGATCCTGCAGAAGATGTACGCTGCTGCTGGCGGTGCCCCTG  1999280

Query  1781     GTGCTGAGGGTGGTATGCCCGGTGG------------TGTGCCGGGCGGCATGCCTGGTG  1828
                | ||||||||||| |||||||||||            | |||| ||||||||||| ||||
Sbjct  1999279  GCGCTGAGGGTGGCATGCCCGGTGGCATGCCCGGTGGTATGCCCGGCGGCATGCCGGGTG  1999220

Query  1829     CT------------CCCCCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCG  1876
                ||            ||||||||||| ||| | ||||||||||| ||||||||||||||||
Sbjct  1999219  CTGCTGGAGGTGCCCCCCCTGCTGGCGCTCCCGACCAGGGCCCCAAGATCGAGGAGGTCG  1999160

Query  1877     ACTAA  1881
                |||||
Sbjct  1999159  ACTAA  1999155

 Score = 1156 bits (1281),  Expect = 0.0
 Identities = 1071/1358 (79%), Gaps = 0/1358 (0%)
 Strand=Plus/Minus

Query  403      GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
                || || || || ||||| || || ||||||||||||||||| || ||||||||||| || 
Sbjct  2075327  GATGCTGGGGCTATTGCTGGTCTGAACGTGCTGCGTATCATTAATGAGCCGACGGCTGCT  2075268

Query  463      GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
                || ||||| || || || |||||||| || ||||||| |||||||||||||||||| || 
Sbjct  2075267  GCGATCGCCTATGGGCTCGACAAGAAAGGAGGCGAGCACAACGTGCTGATCTTCGATCTC  2075208

Query  523      GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
                || ||||| || ||||| || || || ||  | ||||| || || |||||||||||||||
Sbjct  2075207  GGAGGCGGTACGTTCGACGTCTCACTGCTAACTATTGAAGACGGGATCTTCGAGGTCAAG  2075148

Query  583      GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
                || || || |||||||| ||| |||| |||||||||||||||||||| ||||| ||   |
Sbjct  2075147  GCGACGGCGGGTGACACCCACTTGGGCGGTGAGGACTTCGACAACCGTCTGGTCGAGTTC  2075088

Query  643      TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
                |||  |   ||||||||||| |||||||||||||| || |||  ||||||||| ||||| 
Sbjct  2075087  TTCGTGACCGAGTTCAAGCGTAAGCACCGCAAGGATATGACGTCGAACCAGCGAGCTCTG  2075028

Query  703      CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
                |||||||| || ||||| ||||| || |||||||| ||| ||||  | ||||| ||||| 
Sbjct  2075027  CGTCGTCTTCGTACGGCGTGCGAACGCGCCAAGCGGACGTTGTCCACTTCGGCGCAGGCG  2074968

Query  763      TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
                ||||||||||| ||||| ||||| |||||| | |||||||||||||||||||| || || 
Sbjct  2074967  TACATCGAGATCGACTCGCTGTTTGACGGCGTGGACTTCAACTCGACCATCACGCGCGCG  2074908

Query  823      CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
                || || || ||| ||||| |||| || ||||||||||| ||||| || || | | |||| 
Sbjct  2074907  CGGTTTGAAGACTTGTGCAGCGAATATTTCCGCAAGACCATGGATCCTGTTGCGCAGGTT  2074848

Query  883      CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
                ||||| ||  ||||| |||| |||| ||||||  ||||| | ||  |||| || ||||||
Sbjct  2074847  CTGCGGGATTCCAAGTTGTCCAAGAACCAGGTAAACGAGATCGTATTGGTCGGAGGCTCG  2074788

Query  943      ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
                ||||| |||||||||||||||||| |||||  ||| |||||||| ||||||||||    |
Sbjct  2074787  ACGCGCATCCCGAAGGTGCAGCAGTTGCTGAAGGATTTCTTCAATGGCAAGGAGCTGTTC  2074728

Query  1003     AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
                |||||||||||||||||||| || || |||||||| || |||||||| || || || |||
Sbjct  2074727  AAGTCCATCAACCCGGACGAAGCCGTCGCGTACGGCGCCACCGTGCAAGCTGCGATTCTG  2074668

Query  1063     AGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTG  1122
                || |||||||| |||||    ||||||||||||||| | || ||||||||  ||||| ||
Sbjct  2074667  AGTGGCAACGAGTCGTCTTCTAAGCTGCAGGACCTGTTGCTACTGGACGTCGCGCCGTTG  2074608

Query  1123     TCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACG  1182
                || ||||| || ||||| |||||||| |||||||| | ||| ||  | || ||||| |||
Sbjct  2074607  TCGCTGGGCCTGGAGACAGCCGGTGGCGTCATGACTAAGCTCATTCCACGCAACACAACG  2074548

Query  1183     GTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTC  1242
                |||||| | |||||| ||||| |||||||||||||||||||||||||| | || ||| | 
Sbjct  2074547  GTGCCGTCGAAGAAGACGCAGTCGTTCTCGACGTACGCCGACAACCAGTCCGGCGTGTTG  2074488

Query  1243     ATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTC  1302
                || ||||||||||||||||||||  | |||||||| |||||| | |  ||||||||||||
Sbjct  2074487  ATTCAGGTGTTCGAGGGCGAGCGGACTATGACGCGTGACAACCATCATCTGGGCAAGTTC  2074428

Query  1303     AACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGAC  1362
                ||||||||||||||||| |||||||| || || || ||||| || || || |||||||||
Sbjct  2074427  AACCTGGACGGCATCCCGCCCATGCCGCGTGGCGTTCCGCAAATTGATGTCACGTTCGAC  2074368

Query  1363     ATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAAC  1422
                 | || |  ||||| ||  ||||||| ||||| ||||||||||| || || |||||||||
Sbjct  2074367  GTTGATGTTAACGGTATTTTGAACGTCTCGGCCGTGGAGAAGTCCACCGGTAAGGAGAAC  2074308

Query  1423     AAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTA  1482
                |||||||||||||||||||| || || || || |||||  | ||||| ||||||||||| 
Sbjct  2074307  AAGATCACGATCACGAACGATAAAGGTCGACTGTCGCAATCCGACATCGACCGCATGGTC  2074248

Query  1483     TCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAAG  1542
                 | || || ||||| ||||||    | || ||    ||||| |  ||  ||||| | |||
Sbjct  2074247  GCCGACGCTGAGAAATACAAGGATCAAGATGAACGCAACAAACTGCGTGTCGAGTCGAAG  2074188

Query  1543     AACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGAAG  1602
                |||||| ||||||||||||| |     || || |||     |   || ||||||||   |
Sbjct  2074187  AACGCGTTGGAGAACTACGCGTTTTCGCTTCGAAACTCGACGCGCGAGGAGAAGATAGCG  2074128

Query  1603     GAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCCAG  1662
                | |||  |    ||||  |||||||||    | || ||||| ||  |||||  | | || 
Sbjct  2074127  GCGAAACTGAGTGAAGAAGACAAGAAGAGTATCGAGGACAAAGTTGCGGAAACGCTGCAT  2074068

Query  1663     TGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAATTG  1722
                |||||||| || |||||| ||  ||||||||| | ||  ||  | |||||| ||||  ||
Sbjct  2074067  TGGCTGGATGCCAACCAGGCAGCGGAGAAGGAGGAGTTTGACGCCAAGCAGCAGGAGCTG  2074008

Query  1723     GAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGC  1760
                |||||||||||||| ||  |  |||||||||| || ||
Sbjct  2074007  GAGGGCGTGGCCAATCCTATTCTGCAGAAGATCTATGC  2073970

 Score = 532 bits (589),  Expect = 2e-148
 Identities = 353/392 (90%), Gaps = 0/392 (0%)
 Strand=Plus/Minus

Query  18       GTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCA  77
                |||||||||||| |||||||||||||||||||| ||||||||||| || |||||||||||
Sbjct  2001132  GTCTGGATACTCGGTCGGCATCGACCTCGGCACGACCTACTCGTGTGTCGGCGTGTGGCA  2001073

Query  78       GAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGT  137
                |||||||||||| || |||||||| ||||||||||| ||||| || ||||| || |||||
Sbjct  2001072  GAACGACCGTGTCGAGATCATCGCTAACGACCAGGGTAACCGTACGACCCCTTCGTACGT  2001013

Query  138      CGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAA  197
                 |||||||| ||| | || || || |||||||| ||||| ||||| ||||||||||||||
Sbjct  2001012  TGCCTTCACGGACACCGAGCGTCTGATCGGTGATGCCGCTAAGAACCAGGTGGCCATGAA  2000953

Query  198      CGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGT  257
                ||| |||||||| |||||||||||||| |||||||||||||| ||||||||||||||  |
Sbjct  2000952  CGCCCACAACACCGTGTTCGACGCCAAGCGTCTGATCGGCCGTAAGTTCTCGGACCCGAT  2000893

Query  258      CGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCC  317
                ||||||||||||||||||||||||||||||| |  | ||| |||||||||| ||||||||
Sbjct  2000892  CGTCCAGGCCGACATCAAGCACTGGCCGTTCAAGATCACGGCGGGCGCCGGCGACAAGCC  2000833

Query  318      GCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTC  377
                 ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct  2000832  CCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAGCCGGAGGAGATCTCGTC  2000773

Query  378      CATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
                ||||||||||||||||||||||||||  ||||
Sbjct  2000772  CATGGTGCTGATCAAGATGCGCGAGGTGGCCG  2000741

 Score = 516 bits (571),  Expect = 2e-143
 Identities = 360/409 (88%), Gaps = 3/409 (1%)
 Strand=Plus/Plus

Query  1        ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  60
                ||||||||||||||   |||||||||||| || ||||| || || ||||| |||||||||
Sbjct  2067578  ATGACTCAAGCTAC---GTCTGGATACTCGGTGGGCATTGATCTGGGCACGACCTACTCG  2067634

Query  61       TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  120
                || ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||
Sbjct  2067635  TGTGTGGGCGTGTGGCAGAACGACCGCGTGGAGATCATCGCCAACGACCAGGGCAACCGC  2067694

Query  121      ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  180
                || |||||||| || || || || || ||||||||||| || ||||||||||| ||||||
Sbjct  2067695  ACGACCCCGTCGTATGTGGCGTTTACGGACTCGGAACGTCTGATCGGTGACGCTGCCAAG  2067754

Query  181      AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
                || ||||| || |||||||||  |||||||||||| |||||||| || || ||||| |||
Sbjct  2067755  AACCAGGTCGCTATGAACGCGGCCAACACGGTGTTTGACGCCAAGCGCCTCATCGGTCGC  2067814

Query  241      AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  300
                |||||||| |||||||| || ||||||||||||||||||||||||||| |  | ||| ||
Sbjct  2067815  AAGTTCTCAGACCCCGTGGTGCAGGCCGACATCAAGCACTGGCCGTTCAAGATCACGGCG  2067874

Query  301      GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
                ||  |||||||||| |||||||||||||||||||||||||| ||| ||||||||||||| 
Sbjct  2067875  GGTCCCGGTGACAAACCGCAGATCACGGTGCAGTTCAAGGGTGAGACCAAGACGTTCCAG  2067934

Query  361      CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
                || ||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct  2067935  CCGGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGTGGCCG  2067983

 Score = 511 bits (566),  Expect = 2e-142
 Identities = 359/409 (88%), Gaps = 3/409 (1%)
 Strand=Plus/Minus

Query  1        ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  60
                ||||||||||||||   |||||||||||| || ||||| || || ||||| |||||||||
Sbjct  2065654  ATGACTCAAGCTAC---GTCTGGATACTCGGTGGGCATTGATCTGGGCACGACCTACTCG  2065598

Query  61       TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  120
                || ||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||
Sbjct  2065597  TGTGTGGGCGTGTGGCAGAACGACCGCGTGGAGATCATCGCCAACGACCAGGGCAATCGC  2065538

Query  121      ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  180
                || |||||||| || || || || || ||||||||||| || ||||||||||| ||||||
Sbjct  2065537  ACGACCCCGTCGTATGTGGCGTTTACGGACTCGGAACGTCTGATCGGTGACGCTGCCAAG  2065478

Query  181      AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
                || ||||| || |||||||||  |||||||||||| |||||||| || || ||||| |||
Sbjct  2065477  AACCAGGTCGCTATGAACGCGGCCAACACGGTGTTTGACGCCAAGCGCCTCATCGGTCGC  2065418

Query  241      AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  300
                |||||||| |||||||| || ||||||||||||||||||||||||||| |  | ||| ||
Sbjct  2065417  AAGTTCTCAGACCCCGTGGTGCAGGCCGACATCAAGCACTGGCCGTTCAAGATCACGGCG  2065358

Query  301      GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
                ||  |||||||||| |||||||||||||||||||||||||| ||| ||||||||||||| 
Sbjct  2065357  GGTCCCGGTGACAAACCGCAGATCACGGTGCAGTTCAAGGGTGAGACCAAGACGTTCCAG  2065298

Query  361      CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
                || ||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct  2065297  CCGGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGGTGGCCG  2065249

 Score = 343 bits (380),  Expect = 7e-92
 Identities = 305/379 (80%), Gaps = 2/379 (1%)
 Strand=Plus/Minus

Query  30       CGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGT  89
                ||| || || || || ||||| ||||||||||| || || ||||||||||| || || ||
Sbjct  2075790  CGTTGGTATTGATCTGGGCACGACCTACTCGTGTGTTGGTGTGTGGCAGAATGATCGCGT  2075731

Query  90       GGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGA  149
                ||| ||||| |||||||| ||||| |||||||| |||||||| ||||| || ||||| ||
Sbjct  2075730  GGAGATCATTGCCAACGATCAGGGGAACCGCACGACCCCGTCGTACGTGGCGTTCACCGA  2075671

Query  150      CTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACAC  209
                | |||| || ||||||||||| || |||||||| |||||||| |||||||||||||||||
Sbjct  2075670  CACGGAGCGTCTCATCGGTGATGCAGCCAAGAACCAGGTGGCTATGAACGCGCACAACAC  2075611

Query  210      GGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGA  269
                |||||| || | ||| ||  ||||||| || |||||| | || || |  || ||  | ||
Sbjct  2075610  GGTGTTTGATGTCAAGCGGTTGATCGGACGTAAGTTCACCGATCCAGAGGTGCAATCGGA  2075551

Query  270      CATCAAGCACTGGCCGTTCCAAGTGACGTCG-GGCGCCGGTGACAAGCCGCAGATCACGG  328
                ||| ||||||||||||||  | || |  ||| || ||||    ||| |||||  |   ||
Sbjct  2075550  CATTAAGCACTGGCCGTTTAACGTAAT-TCGTGGTGCCGAAAGCAAACCGCAAGTGGTGG  2075492

Query  329      TGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGA  388
                ||||||||||||| |||   || || |||||||| || ||||||||||||||||||||||
Sbjct  2075491  TGCAGTTCAAGGGGGAGAAGAAAACATTCCAACCAGAAGAGATCTCGTCCATGGTGCTGA  2075432

Query  389      TCAAGATGCGCGAGGACGC  407
                ||||||||||||||| |||
Sbjct  2075431  TCAAGATGCGCGAGGTCGC  2075413

 Score = 164 bits (181),  Expect = 1e-37
 Identities = 186/247 (75%), Gaps = 27/247 (11%)
 Strand=Plus/Minus

Query  1650     GGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAA  1709
                |||||||||||| |||||||| ||  ||||| | | |||||||||   ||||||||||||
Sbjct  2066673  GGAAGTGATCCACTGGCTGGATGCGCACCAGACGTCGGAGAAGGA---GTACGAGTCGAA  2066617

Query  1710     GCAGAAGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGG  1769
                |||||||||  ||||| ||||||| ||||| ||| |||||||| |||||||  |||| ||
Sbjct  2066616  GCAGAAGGAGCTGGAGAGCGTGGCTAACCCGGTGCTGCAGAAGGTGTACGCGTCTGCAGG  2066557

Query  1770     CGGTTCCCCTGGTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGC  1829
                |         |||||||  |||| ||||| || |||  ||||||| |  |||||||||||
Sbjct  2066556  C---------GGTGCTGGTGGTGCTATGCTCGATGGCATGCCGGGTGATATGCCTGGTGC  2066506

Query  1830     T----CC----CC----CT-GCTGGT--GCTGCGGACCAGGGCCCGAAGATCGAGGAGGT  1874
                |    ||    ||    || ||| ||  | ||| || ||||| |||||||||||||||||
Sbjct  2066505  TGGTACCGGGGCCGATTCTCGCTCGTCGGGTGCCGAGCAGGGTCCGAAGATCGAGGAGGT  2066446

Query  1875     CGACTAA  1881
                 ||| ||
Sbjct  2066445  GGACGAA  2066439

 Score = 65.3 bits (71),  Expect = 1e-07
 Identities = 40/43 (93%), Gaps = 0/43 (0%)
 Strand=Plus/Minus

Query  1613     CGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGT  1655
                ||||||  |||||||||| ||||||||||||||||||||||||
Sbjct  2066926  CGGAAGACGACAAGAAGGTGGTGGACGACAAGGTGACGGAAGT  2066884

>PYVX:scaffold_95 pve_scaffold_95 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_95:1:55119:1 
REF
Length=55119

 Score = 1867 bits (2070),  Expect = 0.0
 Identities = 1308/1490 (88%), Gaps = 19/1490 (1%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              ||||||| || |||||||||||||| |||||||| ||||||||||||||||| |||||||
Sbjct  38088  AGGACGCTGGTGCCATTGCCGGCCTGAACGTGCTCCGTATCATCAACGAGCCTACGGCCG  38147

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              | |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||
Sbjct  38148  CTGCCATCGCTTACGGCCTCGACAAGAAGGGCGGCGAGCGCAACGTGCTTATCTTCGACC  38207

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              |||| ||||| |||||||||||||| ||||||  |||||||||||||||||||||||| |
Sbjct  38208  TGGGTGGCGGTACCTTCGATGTGTCGCTCCTGAGCATTGAGGAGGGCATCTTCGAGGTGA  38267

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
              |||| ||||| |||||||| || || |||||||||||||||||||||||||| |||||||
Sbjct  38268  AGGCGACTGCCGGTGACACCCATCTTGGTGGTGAGGACTTCGACAACCGCCTCGTGGACC  38327

Query  641    ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
              ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||
Sbjct  38328  ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGTCGAACCAGCGTGCTC  38387

Query  701    TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
              | ||||||||||| |||||||||||||| || ||||| ||||| ||||||||||| ||||
Sbjct  38388  TGCGTCGTCTGCGCACGGCCTGCGAGCGCGCTAAGCGCACGCTTTCGTCGTCGGCCCAGG  38447

Query  761    CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
              | ||||||||||| ||||| |||||||||||||| |||||||||||||| ||||| ||||
Sbjct  38448  CCTACATCGAGATCGACTCGCTGTTCGACGGCATTGACTTCAACTCGACGATCACGCGTG  38507

Query  821    CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCC-----GTGGA  875
              ||||||||||||||||||||||||||||||||||||||||||||           |||||
Sbjct  38508  CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGNNNNNNNNNNTGTGGA  38567

Query  876    GAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGG  935
              ||||||||| || ||||| ||||||||||||||||||||||||||||| ||||| |||||
Sbjct  38568  GAAGGTGCTTCGTGACGCGAAGCTGTCGAAGAGCCAGGTGCACGAGGTTGTGCTTGTGGG  38627

Query  936    CGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGA  995
               |||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct  38628  TGGCTCGACCCGTATCCCTAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGA  38687

Query  996    GCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGC  1055
              |||   |||||| |||||||| |||||||| || || | ||| || || || ||||| ||
Sbjct  38688  GCCGTGCAAGTCGATCAACCCCGACGAGGCCGTCGCTTTCGGCGCCACGGTCCAGGCTGC  38747

Query  1056   CATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGAC  1115
               |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct  38748  TATCCTGAGCGGCAACGACTCCTCGGAGAAGCTGCAGGACCTGCTTCTGCTTGACGTGAC  38807

Query  1116   GCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAA  1175
               |||||||| || ||||| ||||| ||||| ||||| ||||||||||||||| |||| ||
Sbjct  38808  CCCGCTGTCGCTTGGTCTGGAGACCGCCGGCGGTGTGATGACGACGCTGATCCCGCGTAA  38867

Query  1176   CACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGG  1235
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct  38868  CACGACGGTGCCGACGAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGG  38927

Query  1236   GGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGG  1295
               ||||||||||||||||||||||||||||| || ||||| |||||||||||||| |||||
Sbjct  38928  TGTGCTCATCCAGGTGTTCGAGGGCGAGCGTTCGATGACCCGCGACAACAACCTTCTGGG  38987

Query  1296   CAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGAC  1355
              |||||||||||||||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct  38988  CAAGTTCAACCTGGACGGCATCCCGCCGATGCCGCGTGGTGTGCCGCAGATCGATGTGAC  39047

Query  1356   GTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAA  1415
              ||||||||| ||||||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct  39048  GTTCGACATTGACGCGAACGGAATCCTGAACGTGTCGGCTGTCGAGAAGTCGACGGGCAA  39107

Query  1416   GGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCG  1475
              ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||
Sbjct  39108  GGAGAACAAGATCACGATCACGAACGACAAGGGTCGCCTGTCGCAGGCTGACATTGACCG  39167

Query  1476   CATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGA  1535
              |||||| ||||||||||||||||||||| | ||||||||||| ||||||   ||||||||
Sbjct  39168  CATGGTGTCGGAGGCCGAGAAGTACAAGGCCGAGGACGAGGCGAACAAGGTCCGCATCGA  39227

Query  1536   GGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAA  1595
               || |||||||  |||||||||||| | ||||  ||||| ||||  ||||| ||||||||
Sbjct  39228  CGCGAAGAACGGTCTGGAGAACTACTCGTACAACCTGCGCAACACGCTGAACGACGAGAA  39287

Query  1596   GATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGT  1655
              | |||||    ||||| |||| |  |||   |||||| | |||||||||||||||||   
Sbjct  39288  GCTGAAGAGCCAGATCTCGGAGGAGGACCGCAAGGCGATCGACGACAAGGTGACGGAGAC  39347

Query  1656   GATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAA  1715
              |||| | ||||||||||| ||||||||    |||||||| | || |||| ||||||||||
Sbjct  39348  GATCAACTGGCTGGACGCGAACCAGTCGGCTGAGAAGGAGGAGTTCGAGGCGAAGCAGAA  39407

Query  1716   GGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTC  1775
              |||  |||||||| | || |||||  |  ||||||||||||||||||||||||||     
Sbjct  39408  GGAGCTGGAGGGCATCGCTAACCCCATTCTGCAGAAGATGTACGCTGCTGCTGGC-----  39462

Query  1776   CCCTGGTGCTGAGGGTGGTATGCC---CGGTGGTGTGCCGGGCG-GCATGCCTGGTGCTC  1831
                  || |||  |||||| |||||   ||| ||  |||| |||| | | | |||| ||||
Sbjct  39463  ----GGCGCTCCGGGTGGCATGCCTGGCGGCGGCATGCCCGGCGCGGACG-CTGGCGCTC  39517

Query  1832   CCCCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
              |||||||||| |  ||||||||||||||||||||||||||||||||||||
Sbjct  39518  CCCCTGCTGGCGGCGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  39567

 Score = 491 bits (544),  Expect = 2e-136
 Identities = 338/382 (88%), Gaps = 0/382 (0%)
 Strand=Plus/Plus

Query  28     TCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGT  87
              || ||||| ||||||||||| || || ||||||||||| |||||||||||||||||||||
Sbjct  37625  TCGGTCGGTATCGACCTCGGTACGACGTACTCGTGCGTTGGCGTGTGGCAGAACGACCGT  37684

Query  88     GTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACA  147
              ||||| |||||||||||||||||||| |||||||| || ||||| || || || ||||| 
Sbjct  37685  GTGGAGATCATCGCCAACGACCAGGGTAACCGCACGACGCCGTCGTATGTGGCGTTCACG  37744

Query  148    GACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAAC  207
              |||||||| ||||| |||||||||||||| ||||| |||||||| |||||||||||||||
Sbjct  37745  GACTCGGAGCGCCTGATCGGTGACGCCGCGAAGAACCAGGTGGCGATGAACGCGCACAAC  37804

Query  208    ACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCC  267
              || ||||||||||| || |||||||||||||||||||||||||||||  |||| ||| | 
Sbjct  37805  ACTGTGTTCGACGCGAAGCGTCTGATCGGCCGCAAGTTCTCGGACCCGATCGTGCAGTCG  37864

Query  268    GACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACG  327
              |||||||||||||||||||||    ||||||||||  | || |||||||||||||||  |
Sbjct  37865  GACATCAAGCACTGGCCGTTCACGCTGACGTCGGGTCCGGGCGACAAGCCGCAGATCCAG  37924

Query  328    GTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTG  387
              |||||||||||||||||||| ||||||||||| || |||||||||||||| |||||||||
Sbjct  37925  GTGCAGTTCAAGGGCGAGTCGAAGACGTTCCAGCCGGAGGAGATCTCGTCGATGGTGCTG  37984

Query  388    ATCAAGATGCGCGAGGACGCCG  409
              ||||||||||||||||  ||||
Sbjct  37985  ATCAAGATGCGCGAGGTGGCCG  38006

>HYAP:scaffold_7 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_7:1:905110:1 
REF
Length=905110

 Score = 1808 bits (2004),  Expect = 0.0
 Identities = 1258/1428 (88%), Gaps = 3/1428 (0%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| || || |||||||| || ||||||||||| |||||||| |||||||||||||| |
Sbjct  733985  AGGATGCAGGGGCCATTGCTGGACTCAACGTGCTCCGTATCATTAACGAGCCGACGGCTG  734044

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               | |||||||| ||||| |||||||||||||||||||||||||| ||||| ||||||||||
Sbjct  734045  CGGCCATCGCCTACGGTCTGGACAAGAAGGGCGGCGAGCGCAATGTGCTCATCTTCGACC  734104

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               |||| |||||||| ||||| ||||| || |||  ||||||||| |||||||| ||||| |
Sbjct  734105  TGGGTGGCGGCACTTTCGACGTGTCGCTGCTGAGCATTGAGGACGGCATCTTTGAGGTGA  734164

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               |||| ||||| || ||||||||  |||| || |||||||| ||||||||||| |||||||
Sbjct  734165  AGGCGACTGCAGGGGACACGCATTTGGGCGGAGAGGACTTTGACAACCGCCTCGTGGACC  734224

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               |||||||||||||||| || ||||||||||||||||||||||||||||||||||| || |
Sbjct  734225  ACTTCACGCAGGAGTTTAAACGCAAGCACCGCAAGGACATCACGGAGAACCAGCGCGCGC  734284

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               | ||||||||||| ||||| || |||||||| ||||| ||||||||||||||||| ||||
Sbjct  734285  TCCGTCGTCTGCGCACGGCGTGTGAGCGTGCGAAGCGGACGCTGTCGTCGTCGGCACAGG  734344

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | ||||| |||||||||||||||||||| |||||||||||||||||||||||||| || |
Sbjct  734345  CGTACATTGAGATTGACTCTCTGTTCGATGGCATCGACTTCAACTCGACCATCACGCGCG  734404

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               | |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||
Sbjct  734405  CACGTTTCGAGGACATGTGCGGCGACTATTTCCGCAAGACGATGGAGCCGGTGGAGAAGG  734464

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               ||||||| |||||||||||||||||||| |||||||| ||||||||||| ||||||||||
Sbjct  734465  TGCTGCGTGACGCCAAGCTGTCGAAGAGTCAGGTGCATGAGGTGGTGCTCGTGGGCGGCT  734524

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               ||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
Sbjct  734525  CGACGCGTATCCCGAAGGTGCAGCAGCTGTTGTCGGACTTTTTCAACGGCAAGGAGCCTA  734584

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
               ||||||| || ||||||||||||||||| |||||||||||||| || ||||| || ||  
Sbjct  734585  ACAAGTCGATTAACCCGGACGAGGCTGTCGCGTACGGTGCGACTGTCCAGGCTGCTATTT  734644

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               |||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct  734645  TGAGTGGCAATGACTCGTCGGAGAAGCTGCAGGACCTGCTACTGCTGGACGTGACGCCGC  734704

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
               | || || ||||| ||||||||||| ||||| |||||||||||||| ||||| |||||||
Sbjct  734705  TTTCGCTTGGTCTGGAGACGGCCGGCGGTGTGATGACGACGCTGATTGCGCGCAACACGA  734764

Query  1181    CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
               |||||||||| ||||||||||||||||| || ||||| || ||||||||||| || ||||
Sbjct  734765  CGGTGCCGACGAAGAAGTCGCAGACGTTTTCAACGTATGCGGACAACCAGCCGGGCGTGC  734824

Query  1241    TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
               | || |||||||| || |||||||| || ||||||||||||||||||||||| |||||||
Sbjct  734825  TGATTCAGGTGTTTGAAGGCGAGCGTTCGATGACGCGCGACAACAACCTGCTTGGCAAGT  734884

Query  1301    TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
               ||||  |||| |||||||| |||||||||||||| ||||| |||||||||||||||||||
Sbjct  734885  TCAATTTGGATGGCATCCCGCCCATGCCTCGCGGCGTGCCTCAGATCGACGTGACGTTCG  734944

Query  1361    ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
               |||| || |||||||| || || ||||||||||| ||||||||||| |||||||||||||
Sbjct  734945  ACATTGATGCGAACGGTATTCTAAACGTGTCGGCCGTGGAGAAGTCTACGGGCAAGGAGA  735004

Query  1421    ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
               ||||||||||||||||||||||||||||||| || |||||||| |||||||| |||||||
Sbjct  735005  ACAAGATCACGATCACGAACGACAAGGGCCGTCTGTCGCAGGCCGACATTGATCGCATGG  735064

Query  1481    TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
               | |||||||||||||| |||||||||||||||||||| ||||||   ||||| || || |
Sbjct  735065  TGTCGGAGGCCGAGAAATACAAGTCGGAGGACGAGGCGAACAAGATCCGCATTGAAGCGA  735124

Query  1541    AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
               |||| ||||||||||| ||||| ||||   |||| ||||  ||||| ||||||||| |||
Sbjct  735125  AGAATGCGCTGGAGAATTACGCGTACAACTTGCGCAACACGCTGAACGACGAGAAGTTGA  735184

Query  1601    AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
               ||||  |||| ||||| | ||||| ||||||| | |||||||||||||||||    ||| 
Sbjct  735185  AGGACCAGATTCCGGAGGATGACAGGAAGGCGATCGACGACAAGGTGACGGAGACCATCA  735244

Query  1661    AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
               | ||||| || || ||||||||    |||||||| | ||||||| |||||||||||||| 
Sbjct  735245  ACTGGCTCGATGCGAACCAGTCGGCCGAGAAGGAGGAGTACGAGGCGAAGCAGAAGGAAG  735304

Query  1721    TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
               ||||| |||||||||||||  | |||||||||||||||||||||||||||||| | || |
Sbjct  735305  TGGAGAGCGTGGCCAACCCGATTTTGCAGAAGATGTACGCTGCTGCTGGCGGTGCTCCAG  735364

Query  1781    GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTG  1828
               |||||   || |||||||| |||||| |||| || || ||||||||||
Sbjct  735365  GTGCT---GGCGGTATGCCAGGTGGTATGCCTGGTGGTATGCCTGGTG  735409

 Score = 909 bits (1007),  Expect = 0.0
 Identities = 1025/1366 (75%), Gaps = 10/1366 (1%)
 Strand=Plus/Minus

Query  403     GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
               || || || |||||||| ||  | |||||||||||||| ||||||||||| ||||| |||
Sbjct  654719  GATGCTGGAGCCATTGCTGGTTTGAACGTGCTGCGTATTATCAACGAGCCAACGGCTGCC  654660

Query  463     GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
               || ||||| |||||||||||||||||||||||||| | ||| ||||| |||||||| |||
Sbjct  654659  GCGATCGCCTACGGCCTGGACAAGAAGGGCGGCGAACACAATGTGCTAATCTTCGATCTG  654600

Query  523     GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
               ||||||||||| || || ||||| ||  ||  ||||||||| |||||||| ||||| || 
Sbjct  654599  GGCGGCGGCACGTTTGACGTGTCGCTGTTGAGCATTGAGGACGGCATCTTTGAGGTGAAA  654540

Query  583     GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
               |||||||| |||||||||||  |||| ||||| ||||| ||||||||||| ||||| || 
Sbjct  654539  GCCACTGCCGGTGACACGCATTTGGGCGGTGAAGACTTTGACAACCGCCTTGTGGATCAT  654480

Query  643     TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
               ||       ||||||||||| ||||| ||||| || || |||  |||||| ||||| || 
Sbjct  654479  TTTGTCTCCGAGTTCAAGCGTAAGCATCGCAAAGATATGACGTTGAACCAACGTGCCCTG  654420

Query  703     CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
               ||||| ||||| ||||| |||||||| |||||||| ||  ||||  | || || || || 
Sbjct  654419  CGTCGACTGCGTACGGCATGCGAGCGAGCCAAGCGGACCTTGTCCACTTCTGCGCAAGCG  654360

Query  763     TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
               ||||| |||||||| || ||  | ||||||||||| |||||| ||||||| || || || 
Sbjct  654359  TACATTGAGATTGATTCGCTTCTTGACGGCATCGATTTCAACACGACCATTACGCGAGCG  654300

Query  823     CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
                | || |||||  | |||| ||| | ||| |||||||| |||||||| || |   | || 
Sbjct  654299  AGATTTGAGGATCTATGCGCCGATTTCTTTCGCAAGACAATGGAGCCAGTCGCCCAAGTT  654240

Query  883     CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
                |||||||| | |||||||||||  || | ||||| ||| | || ||||| || ||||| 
Sbjct  654239  TTGCGCGACTCGAAGCTGTCGAAAGGCGAAGTGCATGAGATCGTCCTGGTCGGTGGCTCC  654180

Query  943     ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
               || || ||||| |||||||| ||| |||||   || ||||| ||||| |||||       
Sbjct  654179  ACTCGCATCCCAAAGGTGCAACAGTTGCTGATCGATTTCTTTAACGGAAAGGAATTATTT  654120

Query  1003    AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
               ||||| || || |||||||| ||||||||||| || |||||||| || || || || |||
Sbjct  654119  AAGTCGATTAATCCGGACGAAGCTGTGGCGTATGGAGCGACCGTCCAAGCTGCAATTCTG  654060

Query  1063    AGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTG  1122
               || |||   |   | ||    ||||||||||| || || ||| |||| ||  | ||  ||
Sbjct  654059  AGTGGCGGTGGGGCCTCTTCCAAGCTGCAGGATCTTCTGCTGTTGGATGTAGCACCTTTG  654000

Query  1123    TCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACG  1182
               || || ||  | |||||||| || || |||||||| | ||| ||  | || ||||| |||
Sbjct  653999  TCGCTTGGATTGGAGACGGCAGGCGGAGTCATGACCAAGCTCATTCCACGCAACACTACG  653940

Query  1183    GTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTC  1242
               || ||  | |||||||||||| | ||||||||||| ||||| || |||||||| || || 
Sbjct  653939  GTCCCTGCAAAGAAGTCGCAGTCATTCTCGACGTATGCCGATAATCAGCCTGGTGTACTG  653880

Query  1243    ATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTC  1302
               ||||||||||| || || |||||  | ||||| ||||| ||| | || || |||||||| 
Sbjct  653879  ATCCAGGTGTTTGAAGGTGAGCGGGCGATGACACGCGATAACCATCTTCTAGGCAAGTTT  653820

Query  1303    AACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGAC  1362
               | | |||||||||| || || ||||| || |||||||| ||||| ||||| || || |||
Sbjct  653819  AGCTTGGACGGCATTCCGCCTATGCCGCGTGGTGTGCCTCAGATTGACGTCACATTTGAC  653760

Query  1363    ATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAAC  1422
                | || | ||| ||||| || |||||||| || || |||||||| ||||| || ||||||
Sbjct  653759  GTGGATGTGAATGGCATTCTAAACGTGTCAGCCGTCGAGAAGTCGACGGGGAAAGAGAAC  653700

Query  1423    AAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTA  1482
               ||||||||||| || || || || || || || || ||||| || ||||| |||||||| 
Sbjct  653699  AAGATCACGATTACAAATGATAAAGGTCGGCTATCACAGGCCGAGATTGATCGCATGGTG  653640

Query  1483    TCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAAG  1542
                  || || |||| |||||||    | || ||    ||||||| |||| ||||  | || 
Sbjct  653639  AACGATGCGGAGACGTACAAGGACCAAGATGAACGCAACAAGCTACGCGTCGAATCGAAA  653580

Query  1543    AACGCGCTGGAGAACTA--CGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGA-TG  1599
               || |  |||||||| ||  ||  | |||  |||| | |    |||  || || |||| ||
Sbjct  653579  AATGGACTGGAGAATTATGCGTTTTCAG--TGCGCACCTCAGTGAGCGATGAAAAGATTG  653522

Query  1600    AAG-GAGA-AGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGA  1657
                || || |   | | | ||    ||||||||    || || || |||||  ||||  |  
Sbjct  653521  CAGTGAAACTTAGCACCGA---CGACAAGAAAATTGTTGAGGATAAGGTTGCGGAGATTC  653465

Query  1658    TCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGG  1717
               | || ||||| ||||| ||||| ||    |||||||| | |   ||  ||||||||||||
Sbjct  653464  TGCAATGGCTTGACGCGAACCATTCGGCTGAGAAGGAAGAGATTGACGCGAAGCAGAAGG  653405

Query  1718    AATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGC  1763
               |  | || || ||||| |||||  |  |||| ||||| ||||||||
Sbjct  653404  AGCTTGAAGGAGTGGCGAACCCCATTATGCAAAAGATATACGCTGC  653359

 Score = 460 bits (509),  Expect = 1e-126
 Identities = 337/392 (86%), Gaps = 0/392 (0%)
 Strand=Plus/Plus

Query  18      GTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCA  77
               |||||| ||||| ||||| || ||||||||||| || ||||||||||| |||||||||||
Sbjct  730545  GTCTGGCTACTCGGTCGGTATTGACCTCGGCACGACGTACTCGTGCGTCGGCGTGTGGCA  730604

Query  78      GAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGT  137
               ||||||||| ||||| ||||| || ||||||||||| |||||||| || ||||| |||||
Sbjct  730605  GAACGACCGCGTGGAGATCATTGCGAACGACCAGGGTAACCGCACGACGCCGTCGTACGT  730664

Query  138     CGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAA  197
                || ||||| ||| |||| || || ||||||||||| || ||||| |||||||| |||||
Sbjct  730665  GGCGTTCACGGACACGGAGCGTCTGATCGGTGACGCGGCGAAGAACCAGGTGGCGATGAA  730724

Query  198     CGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGT  257
               ||||||||| |||||||| ||||| || || || || || ||||||||||||||| | ||
Sbjct  730725  CGCGCACAATACGGTGTTTGACGCGAAGCGCCTCATTGGTCGCAAGTTCTCGGACGCGGT  730784

Query  258     CGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCC  317
                || ||||| ||| | ||||||||||||||| |  |||||||||| || || ||||||||
Sbjct  730785  GGTGCAGGCGGACGTGAAGCACTGGCCGTTCAAGCTGACGTCGGGTGCTGGCGACAAGCC  730844

Query  318     GCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTC  377
               |||||||||||||||||||||||||||||| |||||||| || ||||||||||| |||||
Sbjct  730845  GCAGATCACGGTGCAGTTCAAGGGCGAGTCGAAGACGTTTCAGCCCGAGGAGATTTCGTC  730904

Query  378     CATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
               ||||||||| |||||||||||||| |  ||||
Sbjct  730905  CATGGTGCTCATCAAGATGCGCGAAGTGGCCG  730936

 Score = 405 bits (448),  Expect = 2e-110
 Identities = 322/386 (83%), Gaps = 1/386 (0%)
 Strand=Plus/Plus

Query  25      TACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGAC  84
               ||||| ||||| || ||| ||||||| |  |||||| | || ||||||||||||||||||
Sbjct  733519  TACTCGGTCGGTATTGACGTCGGCACGATGTACTCGAGAGTCGGCGTGTGGCAGAACGAC  733578

Query  85      CGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACC-CCGTCATACGTCGCCTT  143
                | ||||| ||||| || || |||||||| |||||||| | | ||||| ||||| || ||
Sbjct  733579  AGCGTGGAGATCATTGCGAAAGACCAGGGTAACCGCACGAGCGCCGTCGTACGTGGCGTT  733638

Query  144     CACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCA  203
               ||| ||| |||| || || ||||||||||| || ||||| |||||||| |||||||||||
Sbjct  733639  CACGGACACGGAGCGTCTGATCGGTGACGCGGCGAAGAACCAGGTGGCGATGAACGCGCA  733698

Query  204     CAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCA  263
               ||| |||||||| ||||  || || || || || ||||||||||||||| | || || ||
Sbjct  733699  CAATACGGTGTTTGACGGGAAGCGCCTCATTGGTCGCAAGTTCTCGGACGCGGTGGTGCA  733758

Query  264     GGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGAT  323
               ||| ||| | ||||||||||||||| |  |||||||||| || || ||||||||||||||
Sbjct  733759  GGCGGACGTGAAGCACTGGCCGTTCAAGCTGACGTCGGGTGCTGGCGACAAGCCGCAGAT  733818

Query  324     CACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGT  383
               |||||||||||||||||||||||| |||||||| ||  |||||||||| |||||||||||
Sbjct  733819  CACGGTGCAGTTCAAGGGCGAGTCGAAGACGTTTCAGTCCGAGGAGATTTCGTCCATGGT  733878

Query  384     GCTGATCAAGATGCGCGAGGACGCCG  409
               ||| ||||||||||| || |  ||||
Sbjct  733879  GCTCATCAAGATGCGTGAAGTGGCCG  733904

 Score = 319 bits (353),  Expect = 3e-84
 Identities = 296/373 (79%), Gaps = 2/373 (1%)
 Strand=Plus/Minus

Query  31      GTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTG  90
               || ||||||||  | ||||| || ||||||||||| |||||||||||||||||||| |||
Sbjct  655181  GTGGGCATCGATTTGGGCACGACGTACTCGTGCGTCGGCGTGTGGCAGAACGACCGCGTG  655122

Query  91      GAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGAC  150
               || || || || |||||||| || |||||||| || || || || || || || || || 
Sbjct  655121  GAGATTATTGCGAACGACCAAGGAAACCGCACGACGCCATCGTATGTGGCGTTTACGGAG  655062

Query  151     TCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACG  210
               || || || || || ||||| || || ||||| || || || |||||||| |||||||||
Sbjct  655061  TCAGAGCGTCTGATTGGTGATGCAGCGAAGAACCAAGTTGCTATGAACGCACACAACACG  655002

Query  211     GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
               |||||||| ||||| ||| ||||||| |||||||| || || || |  || ||| | |||
Sbjct  655001  GTGTTCGATGCCAAGCGTTTGATCGGACGCAAGTTTTCTGATCCAGAAGTGCAGTCGGAC  654942

Query  271     ATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGG-TGACAAGCCGCAGATCACGGT  329
               || || |||||||||||| | ||||| ||| |   |||  ||||| || ||| |    ||
Sbjct  654941  ATTAAACACTGGCCGTTCAAGGTGAC-TCGAGATTCGGCGGACAAACCTCAGGTGGAAGT  654883

Query  330     GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGAT  389
               |||||| || || ||| |||| | |||||| || ||||||||||||||||||||||||||
Sbjct  654882  GCAGTTTAAAGGTGAGACCAAAAGGTTCCAGCCTGAGGAGATCTCGTCCATGGTGCTGAT  654823

Query  390     CAAGATGCGCGAG  402
               ||||||||| |||
Sbjct  654822  CAAGATGCGTGAG  654810

 Score = 313 bits (346),  Expect = 1e-82
 Identities = 214/240 (89%), Gaps = 1/240 (0%)
 Strand=Plus/Plus

Query  763     TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
               ||||| ||||| |||||||||||||| |||||||||||||||||||||||||| ||  | 
Sbjct  480855  TACATTGAGAT-GACTCTCTGTTCGATGGCATCGACTTCAACTCGACCATCACGCGGCCG  480913

Query  823     CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
               |||||||||||||||||||| ||||| ||||| || ||||||||||| | | ||||| ||
Sbjct  480914  CGTTTCGAGGACATGTGCGGTGACTATTTCCGTAAAACGATGGAGCCTGAGAAGAAGATG  480973

Query  883     CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
               |||| ||||||||||||||||||||| |||||||||||||||||||| | |||||| |||
Sbjct  480974  CTGCACGACGCCAAGCTGTCGAAGAGTCAGGTGCACGAGGTGGTGCTTGGGGGCGGTTCG  481033

Query  943     ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
                |||||||||| ||||||||| ||||| |||| ||||| |||||||||||||||||||||
Sbjct  481034  TCGCGTATCCCCAAGGTGCAGAAGCTGTTGTCAGACTTTTTCAACGGCAAGGAGCCCAAC  481093

 Score = 285 bits (315),  Expect = 6e-74
 Identities = 241/298 (81%), Gaps = 9/298 (3%)
 Strand=Plus/Plus

Query  1082    AGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGG  1141
               ||||||||||||| ||||| |||||||||||||||||||| || || ||| | |||||||
Sbjct  481096  AGAAGCTGCAGGATCTGCTACTGCTGGACGTGACGCCGCTTTCCCTTGGTTTGGAGACGG  481155

Query  1142    CCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGC  1201
               |||| ||||| |||||||  |||||  || | |||| |||| || |||| ||||||||||
Sbjct  481156  CCGGCGGTGTGATGACGATACTGATTACGTGCAACAAGACGATGACGACGAAGAAGTCGC  481215

Query  1202    AGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCG  1261
               |||||||||||         |||||||| || || ||||| ||  | || ||  | ||| 
Sbjct  481216  AGACGTTCTCG---------GACAACCATCCAGGCGTGCTGATTTACGTATTTAAAGGCA  481266

Query  1262    AGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTC  1321
               |||||| |||||||||| |||| |||||||| ||||||||||||||| | | |||||| |
Sbjct  481267  AGCGCTACATGACGCGCAACAATAACCTGCTTGGCAAGTTCAACCTGAATGACATCCCGC  481326

Query  1322    CCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCAT  1379
               ||||||||||||| ||||| ||| || ||||| |||| ||||| || || ||||||||
Sbjct  481327  CCATGCCTCGCGGCGTGCCTCAGGTCAACGTGTCGTTTGACATTGATGCAAACGGCAT  481384

 Score = 251 bits (277),  Expect = 1e-63
 Identities = 204/247 (83%), Gaps = 3/247 (1%)
 Strand=Plus/Plus

Query  1582    CTGAATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGAC  1641
               ||||| ||||||||| |||||||  |||| ||||| | ||||| ||||||| | ||||||
Sbjct  732643  CTGAACGACGAGAAGTTGAAGGACCAGATTCCGGAGGATGACAGGAAGGCGATCGACGAC  732702

Query  1642    AAGGTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTAC  1701
               |||||||||||    ||| | ||||| || || ||||||||    |||||||| | ||||
Sbjct  732703  AAGGTGACGGAGACCATCAACTGGCTCGATGCGAACCAGTCGGCCGAGAAGGAGGAGTAC  732762

Query  1702    GAGTCGAAGCAGAAGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCT  1761
               ||| |||||||||||||| ||||| |||||||||||||  | ||||||||||||||||||
Sbjct  732763  GAGGCGAAGCAGAAGGAAGTGGAGAGCGTGGCCAACCCGATTTTGCAGAAGATGTACGCT  732822

Query  1762    GCTGCTGGCGGTTCCCCTGGTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATG  1821
               |||||||||||| | || ||||||   || |||||||| |||||| |||| || || |||
Sbjct  732823  GCTGCTGGCGGTGCTCCAGGTGCT---GGCGGTATGCCAGGTGGTATGCCTGGTGGTATG  732879

Query  1822    CCTGGTG  1828
               |||||||
Sbjct  732880  CCTGGTG  732886

 Score = 178 bits (197),  Expect = 6e-42
 Identities = 315/455 (69%), Gaps = 7/455 (2%)
 Strand=Plus/Plus

Query  785     TCGACGGCATCGACTTCAACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCG  844
               |||||||| |||| |||||   ||||||  | |||||  | || |||||    |||| ||
Sbjct  536059  TCGACGGCGTCGAGTTCAATAGGACCATTTCGCGTGCGAGATTTGAGGATCCATGCGTCG  536118

Query  845     ACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGA  904
               | | | |  ||||||| ||||  || || |   | || |||| |||  | ||||||||||
Sbjct  536119  ATTTCATTTGCAAGACTATGGCACCTGTCGCCCAAGTTCTGCTCGATTCGAAGCTGTCGA  536178

Query  905     AGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGC  964
               || | || ||| ||||| | || ||| | |  ||||  || |||  | | || |||||| 
Sbjct  536179  AGGGTCAAGTGAACGAGATTGTCCTGATCGTTGGCTGTACTCGTGCCTCAAATGTGCAGT  536238

Query  965     AGCTGCTG-TCGGACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAG  1023
               || ||||| ||    ||||||||||  |||| |     |||| ||||| |||||||||||
Sbjct  536239  AGTTGCTGATC--CTTTCTTCAACGAAAAGGTGTTGTTCAAGACCATCGACCCGGACGAG  536296

Query  1024    GCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGA--CTCGTCGG  1081
               ||||| || || |  |||| ||| || || || ||  |||| |||   ||  | | ||  
Sbjct  536297  GCTGTAGCATATGAAGCGATCGTCCAAGCTGCAATTATGAGAGGCGGTGAGGCCCATCTT  536356

Query  1082    AGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGG  1141
                 ||||||||||| || || ||| ||||     | || || || || ||  | |||||||
Sbjct  536357  CCAAGCTGCAGGATCTTCTGCTGTTGGATACAGCACCTCTATCGCTTGGATTGGAGACGG  536416

Query  1142    CCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGC  1201
               | || || |||||||  | ||| ||  | || |  ||  |||| ||  | ||||||||||
Sbjct  536417  CAGGCGGAGTCATGATCAAGCTCATTCCACGTA--ACTGCGGTCCCTGCAAAGAAGTCGC  536474

Query  1202    AGACGTTCTCGACGTACGCCGACAACCAGCCTGGG  1236
               || | ||||||||||  | ||| || ||||| |||
Sbjct  536475  AGTCATTCTCGACGTTTGTCGATAATCAGCCCGGG  536509

 Score = 134 bits (148),  Expect = 7e-29
 Identities = 107/129 (83%), Gaps = 0/129 (0%)
 Strand=Plus/Plus

Query  274     AAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGCAG  333
               ||||||||||||||  |  |||||||||  ||  |  ||| || ||||||||||||||||
Sbjct  477324  AAGCACTGGCCGTTGAAGCTGACGTCGGTTGCTAGCAACAGGCTGCAGATCACGGTGCAG  477383

Query  334     TTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGATCAAG  393
               |||||  ||||||| || ||||| || || | ||||||||||||||||||||| ||||||
Sbjct  477384  TTCAAACGCGAGTCGAATACGTTTCAGCCTGGGGAGATCTCGTCCATGGTGCTCATCAAG  477443

Query  394     ATGCGCGAG  402
               ||||| |||
Sbjct  477444  ATGCGAGAG  477452

 Score = 71.6 bits (78),  Expect = 7e-10
 Identities = 58/71 (82%), Gaps = 6/71 (8%)
 Strand=Plus/Plus

Query  1816    GGCATGCCTGGTG------CTCCCCCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAG  1869
               |||||||||||||      | || ||||| ||||||||||||||||| || |||||||||
Sbjct  733108  GGCATGCCTGGTGGCGGTGCCCCGCCTGCGGGTGCTGCGGACCAGGGTCCCAAGATCGAG  733167

Query  1870    GAGGTCGACTA  1880
               ||||| || ||
Sbjct  733168  GAGGTGGATTA  733178

 Score = 68.0 bits (74),  Expect = 8e-09
 Identities = 68/89 (76%), Gaps = 6/89 (7%)
 Strand=Plus/Plus

Query  1793    GTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCTCCCCCTGCTGGTGCTGCGGACC  1852
               ||| |||||| ||  |||| || ||      |||||| || ||||| ||||||| |||||
Sbjct  481402  GTACGCCCGGAGGAATGCCTGGTGG------TGGTGCCCCGCCTGCGGGTGCTGTGGACC  481455

Query  1853    AGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
               |||   | |||||||||||||| ||||||
Sbjct  481456  AGGCTTCTAAGATCGAGGAGGTGGACTAA  481484

 Score = 64.4 bits (70),  Expect = 1e-07
 Identities = 44/50 (88%), Gaps = 0/50 (0%)
 Strand=Plus/Plus

Query  1831    CCCCCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTA  1880
               || ||||| ||||||||||||||||| || |||||||||||||| || ||
Sbjct  732943  CCGCCTGCGGGTGCTGCGGACCAGGGTCCCAAGATCGAGGAGGTGGATTA  732992

 Score = 64.4 bits (70),  Expect = 1e-07
 Identities = 44/50 (88%), Gaps = 0/50 (0%)
 Strand=Plus/Plus

Query  1831    CCCCCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTA  1880
               || ||||| ||||||||||||||||| || |||||||||||||| || ||
Sbjct  735466  CCACCTGCGGGTGCTGCGGACCAGGGTCCCAAGATCGAGGAGGTGGATTA  735515

>PYIW:scaffold_369 piw_scaffold_369 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_369:1:19900:1 
REF
Length=19900

 Score = 1584 bits (1756),  Expect = 0.0
 Identities = 1246/1490 (84%), Gaps = 21/1490 (1%)
 Strand=Plus/Minus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||||||||||||||| || || ||||||||||| |||||||| ||||||||||| ||||
Sbjct  19881  AGGACGCCGGCGCCATCGCGGGGCTCAACGTGCTCCGTATCATTAACGAGCCGACCGCCG  19822

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              | || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||
Sbjct  19821  CTGCTATCGCCTACGGCCTTGACAAGAAGGGCGGCGAGCGCAACGTGCTCATCTTCGACC  19762

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              | || |||||||||||||| ||||| ||||||  ||||||||||||||||||||||||||
Sbjct  19761  TTGGTGGCGGCACCTTCGACGTGTCGCTCCTGAGCATTGAGGAGGGCATCTTCGAGGTCA  19702

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
              ||||||| || |||||||||||| |||| ||||| ||||| |||||||| || |||||||
Sbjct  19701  AGGCCACGGCCGGTGACACGCACTTGGGCGGTGAAGACTTTGACAACCGTCTCGTGGACC  19642

Query  641    ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
              |||||      |||||||||||||||||||||||||||||||||   |||||||| || |
Sbjct  19641  ACTTCGTCGGCGAGTTCAAGCGCAAGCACCGCAAGGACATCACGTCCAACCAGCGCGCGC  19582

Query  701    TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
              ||||||| ||||| || || || ||||| || ||||||||||| ||||| ||||| ||||
Sbjct  19581  TTCGTCGCCTGCGTACCGCGTGTGAGCGCGCTAAGCGTACGCTCTCGTCCTCGGCCCAGG  19522

Query  761    CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
              | ||||| ||||||||||| || ||||||||  | |||||||||||||| ||||| ||||
Sbjct  19521  CGTACATTGAGATTGACTCGCTTTTCGACGGTGTTGACTTCAACTCGACGATCACGCGTG  19462

Query  821    CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
              | |||||||||||||||||||| ||||||||||||||||| ||||| || || |||||||
Sbjct  19461  CCCGTTTCGAGGACATGTGCGGTGACTACTTCCGCAAGACCATGGACCCTGTCGAGAAGG  19402

Query  881    TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
              |||| || ||| | ||||| || |||   ||||||||||||||||||||||| |||||||
Sbjct  19401  TGCTTCGTGACTCGAAGCTCTCCAAGTCGCAGGTGCACGAGGTGGTGCTGGTCGGCGGCT  19342

Query  941    CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
              ||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||  
Sbjct  19341  CGACGCGTATCCCTAAGGTGCAGCAGCTCCTCTCGGACTTCTTCAACGGCAAGGAGCCGT  19282

Query  1001   ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
               |||| |||||||||| || ||||| || |||| |||||| || |||||||| || ||||
Sbjct  19281  GCAAGGCCATCAACCCTGATGAGGCCGTTGCGTTCGGTGCCACTGTGCAGGCCGCTATCC  19222

Query  1061   TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
              |    |||||||||  |||||||||||| ||||||||||||||| |||| ||||| || |
Sbjct  19221  TTTCGGGCAACGACCAGTCGGAGAAGCTCCAGGACCTGCTTCTGTTGGATGTGACTCCTC  19162

Query  1121   TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
              |||| || ||||||||||||||||| ||||||||||||||||| ||| |||| |||||||
Sbjct  19161  TGTCGCTCGGTCTCGAGACGGCCGGCGGTGTCATGACGACGCTCATCTCGCGTAACACGA  19102

Query  1181   CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
              | ||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||
Sbjct  19101  CCGTGCCAACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCGGGTGTGC  19042

Query  1241   TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
              ||||||||||||||||||||||||| || ||||| || ||||||||||| || |||||||
Sbjct  19041  TCATCCAGGTGTTCGAGGGCGAGCGTTCGATGACTCGTGACAACAACCTTCTCGGCAAGT  18982

Query  1301   TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
              ||||||| ||||||||||| |||||||| || |||||||| ||||| || ||||| ||||
Sbjct  18981  TCAACCTCGACGGCATCCCGCCCATGCCGCGTGGTGTGCCACAGATTGATGTGACTTTCG  18922

Query  1361   ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
              |||| ||||| ||||| || ||||||||||| ||||| || ||||| |||||||||||||
Sbjct  18921  ACATTGACGCCAACGGTATTCTGAACGTGTCTGCTGTCGAAAAGTCGACGGGCAAGGAGA  18862

Query  1421   ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
              |||||||||| ||||| ||||||||||| ||||| || ||||| ||||||||||||||||
Sbjct  18861  ACAAGATCACTATCACCAACGACAAGGGTCGCCTGTCCCAGGCCGACATTGACCGCATGG  18802

Query  1481   TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
              |  | ||||| |||||||||||| | ||||||||| | ||||||   ||||| |||||||
Sbjct  18801  TTGCCGAGGCTGAGAAGTACAAGGCTGAGGACGAGTCGAACAAGGTGCGCATTGAGGCCA  18742

Query  1541   AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
              ||||||  || ||||||||||| ||||  || || ||||  ||  | ||||||||| | |
Sbjct  18741  AGAACGGTCTTGAGAACTACGCATACAACCTCCGCAACACCCTCGACGACGAGAAGCTCA  18682

Query  1601   AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
              ||    ||||| |||| |  |||   |  ||| |  |||||||||| || ||   |||| 
Sbjct  18681  AGAGCCAGATCTCGGAGGAGGACCGCAGCGCGATTAACGACAAGGTCACCGAGACGATCA  18622

Query  1661   AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
              | ||||||||||| ||||||||    |||||||| | || |||| | |||||||||||  
Sbjct  18621  ACTGGCTGGACGCGAACCAGTCGGCCGAGAAGGAGGAGTTCGAGGCCAAGCAGAAGGAGC  18562

Query  1721   TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
              | |||||| | ||||||||  |  |||||||||||||||||||||| ||         ||
Sbjct  18561  TCGAGGGCATTGCCAACCCGATCCTGCAGAAGATGTACGCTGCTGCGGG---------TG  18511

Query  1781   GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCT------CCCC  1834
              | ||    || || ||||| || || |  || ||||| ||||| ||||||      || |
Sbjct  18510  GAGC---CGGCGGCATGCCAGGCGGCGCCCCAGGCGGTATGCCAGGTGCTGGCGCCCCTC  18454

Query  1835   CTGCTGGTGCT-GCG--GACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
              || | |  ||| |||  |||||||||||||||||||||||||||||||||
Sbjct  18453  CTCCGGCCGCTGGCGGCGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  18404

 Score = 1413 bits (1566),  Expect = 0.0
 Identities = 1147/1389 (83%), Gaps = 3/1389 (0%)
 Strand=Plus/Minus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             ||||||||||||||||  | || |||||||| ||||| || |||||||| || |||||||
Sbjct  9808  AGGACGCCGGCGCCATCTCGGGGCTCAACGTACTGCGCATTATCAACGAACCCACGGCCG  9749

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
             | |||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||
Sbjct  9748  CGGCCATCGCCTACGGCCTGGACAAGAAGGGCGGCGAGCACAACGTGCTCATCTTCGACC  9689

Query  521   TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
             ||||||||||||| ||||| || ||  | ||  |||| || |||||||||||||||||||
Sbjct  9688  TGGGCGGCGGCACGTTCGACGTCTCGTTGCTCACCATCGAAGAGGGCATCTTCGAGGTCA  9629

Query  581   AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
             ||||||| || || |||||||||||||| || |||||||| ||||||||||| || ||  
Sbjct  9628  AGGCCACGGCGGGCGACACGCACCTGGGCGGCGAGGACTTTGACAACCGCCTCGTCGAGT  9569

Query  641   ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
              ||||||    ||||||||||||||||| ||||||||||| |||   |||||||| || |
Sbjct  9568  TCTTCACAGCCGAGTTCAAGCGCAAGCATCGCAAGGACATGACGAGCAACCAGCGCGCGC  9509

Query  701   TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
             | ||||||||||| ||||| |||||||| ||||| || ||||| ||||| ||||| ||||
Sbjct  9508  TGCGTCGTCTGCGTACGGCTTGCGAGCGCGCCAAACGCACGCTCTCGTCCTCGGCCCAGG  9449

Query  761   CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
             | ||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||| ||||
Sbjct  9448  CGTACATTGAGATCGACTCGCTGTTCGACGGCATCGACTTCAACTCGACAATCACGCGTG  9389

Query  821   CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
             | || ||||||||| |||||| |||||||||||||||||| |||||||||||||||   |
Sbjct  9388  CGCGCTTCGAGGACCTGTGCGCCGACTACTTCCGCAAGACCATGGAGCCCGTGGAGCGCG  9329

Query  881   TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
             ||||||| ||||||||||| || ||| |||||||| ||||| | |||||||| |||||||
Sbjct  9328  TGCTGCGTGACGCCAAGCTCTCCAAGCGCCAGGTGAACGAGATCGTGCTGGTCGGCGGCT  9269

Query  941   CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
             ||||||| ||||| ||||| |||||  |||| ||||| ||||||||||||||||| |   
Sbjct  9268  CGACGCGCATCCCCAAGGTCCAGCAAATGCTCTCGGAGTTCTTCAACGGCAAGGACCTGT  9209

Query  1001  ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
             ||||||| ||||||||||||||||| ||||| |  || || || || ||||| || ||||
Sbjct  9208  ACAAGTCGATCAACCCGGACGAGGCGGTGGCCTTTGGCGCCACGGTCCAGGCCGCGATCC  9149

Query  1061  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
             | || || || ||   ||||     ||||||||||||||| ||| |||| ||| ||||||
Sbjct  9148  TCAGTGGTAATGATAAGTCGAGTCGGCTGCAGGACCTGCTGCTGTTGGATGTGGCGCCGC  9089

Query  1121  TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
             ||||  |||| |||||||||||||| || |||||||| ||||| ||| |||| |||||||
Sbjct  9088  TGTCCATGGGACTCGAGACGGCCGGCGGCGTCATGACAACGCTCATCCCGCGCAACACGA  9029

Query  1181  CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
             | ||||| || ||||||||||||||||||||||||||||| |||||||| || || ||||
Sbjct  9028  CCGTGCCCACGAAGAAGTCGCAGACGTTCTCGACGTACGCGGACAACCAACCGGGTGTGC  8969

Query  1241  TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
             |||||||||| ||||||||||||||| | ||||||||||||||  ||  |||||||||||
Sbjct  8968  TCATCCAGGTCTTCGAGGGCGAGCGCACAATGACGCGCGACAATCACTCGCTGGGCAAGT  8909

Query  1301  TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
             ||| ||| ||||||||||| |||||||| || || |||||||||||||||||||| || |
Sbjct  8908  TCAGCCTCGACGGCATCCCGCCCATGCCGCGTGGCGTGCCGCAGATCGACGTGACCTTTG  8849

Query  1361  ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
             |||| ||||||||||| ||| ||||||||||||| ||||||||||| || ||||||||||
Sbjct  8848  ACATTGACGCGAACGGGATCTTGAACGTGTCGGCCGTGGAGAAGTCCACAGGCAAGGAGA  8789

Query  1421  ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
             ||||||||||||| ||||| |||||||| |||||||||||||| ||||||||||||||||
Sbjct  8788  ACAAGATCACGATTACGAATGACAAGGGTCGCCTCTCGCAGGCAGACATTGACCGCATGG  8729

Query  1481  TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
             |   ||||||||||   ||||||   |  ||||||   |||||||  ||| |||||||||
Sbjct  8728  TCGAGGAGGCCGAGCGCTACAAGGACGCCGACGAGCGCAACAAGCTGCGCGTCGAGGCCA  8669

Query  1541  AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
             |||||||||| ||||||||||||||| | ||||| |||   ||  | || |||||| || 
Sbjct  8668  AGAACGCGCTCGAGAACTACGCCTACGGGCTGCGCAACTCGCTTCAGGAGGAGAAGCTGC  8609

Query  1601  AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
             |||  ||| |  | |  | |||||||||| || | || |||||| |  | ||   |||| 
Sbjct  8608  AGGCCAAGCTGGCCGCGGATGACAAGAAGACGCTCGAGGACAAGATCGCCGAGACGATCG  8549

Query  1661  AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
              |||||||||||| |||||| |    |||||||| | || |||  | |||||||||||  
Sbjct  8548  CGTGGCTGGACGCCAACCAGGCGGCCGAGAAGGACGAGTTCGACGCCAAGCAGAAGGAGC  8489

Query  1721  TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTG---CTGGCGGTTCCC  1777
             | ||| | |||||||  ||  |  ||||||||||||| ||  | |     |||||  || 
Sbjct  8488  TCGAGAGTGTGGCCAGTCCCATTCTGCAGAAGATGTATGCGACCGACATGGGCGGCGCCA  8429

Query  1778  CTGGTGCTG  1786
             |||||||||
Sbjct  8428  CTGGTGCTG  8420

 Score = 465 bits (515),  Expect = 3e-128
 Identities = 344/401 (86%), Gaps = 3/401 (1%)
 Strand=Plus/Minus

Query  1      ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  60
              ||| ||||||||  | |   |||| | ||||||||||||||||||||||| |||||||||
Sbjct  10295  ATGGCTCAAGCTGTTGC---TGGACAGTCCGTCGGCATCGACCTCGGCACGACCTACTCG  10239

Query  61     TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  120
              ||||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||
Sbjct  10238  TGCGTGGGCGTGTGGCAGAACGACCGTGTCGAAATCATCGCGAACGACCAGGGAAACCGC  10179

Query  121    ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  180
              || || ||||| ||||| |||||||| ||| |||| || || ||||| ||||||||||||
Sbjct  10178  ACGACGCCGTCGTACGTGGCCTTCACGGACACGGAGCGACTTATCGGCGACGCCGCCAAG  10119

Query  181    AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
              || ||||||||||||||| |   ||||||||| ||||||||||| || || || ||||||
Sbjct  10118  AACCAGGTGGCCATGAACCCAGCCAACACGGTCTTCGACGCCAAGCGACTCATTGGCCGC  10059

Query  241    AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  300
              |||||||||||||  ||||| ||||| ||| ||||||||||||| ||| | ||   | ||
Sbjct  10058  AAGTTCTCGGACCAAGTCGTGCAGGCGGACCTCAAGCACTGGCCCTTCAAGGTCGTGGCG  9999

Query  301    GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
              ||||| |   ||||||||||||||   ||||| |||||||||||| ||||||||||||| 
Sbjct  9998   GGCGCGGACAACAAGCCGCAGATCGTCGTGCACTTCAAGGGCGAGACCAAGACGTTCCAG  9939

Query  361    CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGA  401
              ||||||||||| |||||||||||||| ||||||||||||||
Sbjct  9938   CCCGAGGAGATTTCGTCCATGGTGCTCATCAAGATGCGCGA  9898

>SAPA:scaffold_13 supercont2.13 dna:supercontig supercontig:ASM15154v2:supercont2.13:1:731627:1 
REF
Length=731627

 Score = 1544 bits (1712),  Expect = 0.0
 Identities = 1234/1487 (83%), Gaps = 18/1487 (1%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| ||||| ||||||||||||||||||||||| || |||||||||||||| |||||||
Sbjct  652504  AGGATGCCGGTGCCATTGCCGGCCTCAACGTGCTCCGCATCATCAACGAGCCCACGGCCG  652445

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               ||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||| |
Sbjct  652444  CCGCCATCGCGTACGGCCTCGACAAGAAGGGCGGTGAGCGCAACGTGCTCATCTTCGATC  652385

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               | ||||| || ||||||||||| || ||| || | || ||||| ||||||||||| ||||
Sbjct  652384  TTGGCGGTGGTACCTTCGATGTCTCGCTCTTGACGATCGAGGAAGGCATCTTCGAAGTCA  652325

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               ||||||| |||||||| || ||||| |||||||| || |||||||||||||| || ||||
Sbjct  652324  AGGCCACGGCTGGTGATACCCACCTTGGTGGTGAAGATTTCGACAACCGCCTCGTCGACC  652265

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||||||   ||||||||||||||||||||||||||||| ||||  |||||||| || |
Sbjct  652264  ACTTCACGGCTGAGTTCAAGCGCAAGCACCGCAAGGACATGACGGCCAACCAGCGCGCCC  652205

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               | || || || || ||||| |||||||| |||||||| ||||| ||||||||||| ||||
Sbjct  652204  TCCGCCGCCTCCGCACGGCTTGCGAGCGCGCCAAGCGCACGCTCTCGTCGTCGGCCCAGG  652145

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | |||||||| || ||||| || ||||| || ||||||||||||||||||||||| || |
Sbjct  652144  CCTACATCGAAATCGACTCGCTCTTCGATGGTATCGACTTCAACTCGACCATCACGCGCG  652085

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||
Sbjct  652084  CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAACCCGTCGAGAAGG  652025

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               | || |||||| | ||||| |||||||||||||| ||||| || || || || || ||||
Sbjct  652024  TCCTCCGCGACTCGAAGCTCTCGAAGAGCCAGGTCCACGAAGTCGTCCTTGTCGGTGGCT  651965

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               |||| |||||||| ||||| ||||||||||| ||||||||||||||||||||||||||| 
Sbjct  651964  CGACCCGTATCCCCAAGGTCCAGCAGCTGCTCTCGGACTTCTTCAACGGCAAGGAGCCCT  651905

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                |||||| |||||||| || ||||| || || | |||||| || || ||||| || ||||
Sbjct  651904  GCAAGTCGATCAACCCCGATGAGGCCGTCGCCTTCGGTGCCACGGTCCAGGCCGCTATCC  651845

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               |    || |||||||||||||||||||| |||||| |||| || || || || |||||||
Sbjct  651844  TTTCGGGTAACGACTCGTCGGAGAAGCTCCAGGACTTGCTCCTCCTCGATGTCACGCCGC  651785

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
               | || || ||| | ||||||||||| ||||||||||||||||| |||  ||| |||||||
Sbjct  651784  TCTCGCTCGGTTTGGAGACGGCCGGCGGTGTCATGACGACGCTCATCCAGCGTAACACGA  651725

Query  1181    CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
               ||||||| || ||||||||||||||||||||||||||||||||||||||||| || ||  
Sbjct  651724  CGGTGCCCACGAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCCGGTGTCT  651665

Query  1241    TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
               | |||||||| ||||| ||||||||||| |||||||||||||||||| |||| |||||||
Sbjct  651664  TGATCCAGGTTTTCGAAGGCGAGCGCTCGATGACGCGCGACAACAACTTGCTCGGCAAGT  651605

Query  1301    TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
               ||   || ||||||||||| |||||||| || ||||| || ||||| || || |||||||
Sbjct  651604  TCTCGCTCGACGGCATCCCGCCCATGCCCCGTGGTGTCCCCCAGATTGATGTCACGTTCG  651545

Query  1361    ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
               |||| || || ||||| ||| ||||||| ||||| || |||||||| || ||||||||||
Sbjct  651544  ACATTGATGCCAACGGTATCTTGAACGTCTCGGCCGTCGAGAAGTCGACCGGCAAGGAGA  651485

Query  1421    ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
               |||||||||||||||||||||||||||| |||||| |  |||  |||||||| |||||||
Sbjct  651484  ACAAGATCACGATCACGAACGACAAGGGTCGCCTCACCAAGGACGACATTGAGCGCATGG  651425

Query  1481    TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
               |   ||| |||||||||||||||||||| ||||||||||||||||  |||||||| ||||
Sbjct  651424  TCCAGGAAGCCGAGAAGTACAAGTCGGAAGACGAGGCTAACAAGCTCCGCATCGAAGCCA  651365

Query  1541    AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
               ||||||  || ||||||||||| ||||  || || ||||  || || ||||||||| |  
Sbjct  651364  AGAACGGCCTCGAGAACTACGCGTACAACCTCCGCAACACGCTCAACGACGAGAAGCTCC  651305

Query  1601    AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
               |||  ||||||   || || |||||||||||  | || |||||||| || || || ||| 
Sbjct  651304  AGGGCAAGATCGACGAGGCCGACAAGAAGGCCATCGATGACAAGGTCACCGACGTCATCA  651245

Query  1661    AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
               | ||||| ||||| ||||||||    |||||||| | || |||| | |||||||||||  
Sbjct  651244  ACTGGCTCGACGCCAACCAGTCGGCCGAGAAGGAGGAGTTCGAGGCTAAGCAGAAGGAGC  651185

Query  1721    TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
               | || ||| | ||||||||  |  |||||||||||||||||||||||||         ||
Sbjct  651184  TCGAAGGCATTGCCAACCCCATCATGCAGAAGATGTACGCTGCTGCTGG---------TG  651134

Query  1781    GTGCTGAGGGTGGTATGCCCGGTGGTGTGCC------GGGCGGCATGCCTGGTGCTCCCC  1834
               | |||   || ||||||||||| ||  ||||      |||||||    |||| || ||||
Sbjct  651133  GCGCTCCCGGCGGTATGCCCGGCGGCATGCCCGACATGGGCGGC---GCTGGCGCCCCCC  651077

Query  1835    CTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
               || | |   |    | ||||||||| ||||| ||||| |||||||||
Sbjct  651076  CTCCGGCCTCGCACGCCCAGGGCCCCAAGATTGAGGAAGTCGACTAA  651030

 Score = 454 bits (503),  Expect = 5e-125
 Identities = 322/369 (87%), Gaps = 0/369 (0%)
 Strand=Plus/Minus

Query  28      TCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGT  87
               |||||||| ||||| ||||| || |||||||||||||| |||||||||||||||||||| 
Sbjct  652967  TCCGTCGGTATCGATCTCGGTACGACCTACTCGTGCGTCGGCGTGTGGCAGAACGACCGC  652908

Query  88      GTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACA  147
               || || |||||||||||||||||||| |||||||| || || || |||||||||||||| 
Sbjct  652907  GTCGAGATCATCGCCAACGACCAGGGTAACCGCACGACGCCCTCGTACGTCGCCTTCACG  652848

Query  148     GACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAAC  207
               |||||||| |||||||||||||||||||||||||| ||||||||||||||| |   ||||
Sbjct  652847  GACTCGGAGCGCCTCATCGGTGACGCCGCCAAGAACCAGGTGGCCATGAACCCCACCAAC  652788

Query  208     ACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCC  267
               ||||| ||||||||||| || || |||||||||||||||   ||||||| |   ||||||
Sbjct  652787  ACGGTCTTCGACGCCAAGCGCCTCATCGGCCGCAAGTTCAACGACCCCGCCACGCAGGCC  652728

Query  268     GACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACG  327
               ||||||||||||||||| ||| | || ||| | |||||||| |||||||| |||||||||
Sbjct  652727  GACATCAAGCACTGGCCCTTCAAGGTCACGCCCGGCGCCGGCGACAAGCCCCAGATCACG  652668

Query  328     GTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTG  387
               ||  ||||||||||||| |||||||||||||| |||||||| |||||||| ||||| || 
Sbjct  652667  GTCGAGTTCAAGGGCGAATCCAAGACGTTCCAGCCCGAGGAAATCTCGTCGATGGTCCTC  652608

Query  388     ATCAAGATG  396
               |||||||||
Sbjct  652607  ATCAAGATG  652599

>SADI:scaffold_45 supercont1.45 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.45:1:501773:1 
REF
Length=501773

 Score = 1540 bits (1707),  Expect = 0.0
 Identities = 1233/1487 (83%), Gaps = 18/1487 (1%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| ||||| ||||||||||||||||||||||| || ||||| |||||||| |||||||
Sbjct  217968  AGGATGCCGGTGCCATTGCCGGCCTCAACGTGCTCCGCATCATTAACGAGCCCACGGCCG  218027

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               ||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||| |
Sbjct  218028  CCGCCATCGCGTACGGCCTCGACAAGAAGGGCGGTGAGCGCAACGTGCTCATCTTCGATC  218087

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               | ||||| || |||||||||||||| ||| || | || ||||| ||||||||||| ||||
Sbjct  218088  TCGGCGGTGGTACCTTCGATGTGTCGCTCTTGACGATCGAGGAAGGCATCTTCGAAGTCA  218147

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               ||||||| || ||||| || ||||| || ||||| || || ||||||||||| || ||||
Sbjct  218148  AGGCCACGGCCGGTGATACCCACCTTGGCGGTGAAGATTTTGACAACCGCCTCGTCGACC  218207

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||||||   ||||||||||||||||||||||||||||| |||   |||||||| || |
Sbjct  218208  ACTTCACGGCCGAGTTCAAGCGCAAGCACCGCAAGGACATGACGTCCAACCAGCGCGCCC  218267

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               | || || || || ||||| |||||||| |||||||||||||| ||||||||||| ||||
Sbjct  218268  TCCGCCGCCTTCGCACGGCTTGCGAGCGCGCCAAGCGTACGCTCTCGTCGTCGGCCCAGG  218327

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | |||||||| |||||||| || || |||||  |||||||||||||||||||||| ||||
Sbjct  218328  CCTACATCGAAATTGACTCGCTCTTTGACGGTGTCGACTTCAACTCGACCATCACGCGTG  218387

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct  218388  CCCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTCGAGAAGG  218447

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               | || |||||| | ||||| |||||||||||||| ||||| || || || || || ||||
Sbjct  218448  TCCTCCGCGACTCGAAGCTCTCGAAGAGCCAGGTCCACGAAGTCGTCCTTGTCGGTGGCT  218507

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               |||| |||||||| ||||| ||||||||||| ||||||||||||||||||||||||||| 
Sbjct  218508  CGACCCGTATCCCCAAGGTCCAGCAGCTGCTCTCGGACTTCTTCAACGGCAAGGAGCCCT  218567

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                |||||| |||||||| || ||||| || || | ||| || || || ||||| || ||||
Sbjct  218568  GCAAGTCGATCAACCCCGATGAGGCCGTCGCCTTCGGCGCCACGGTTCAGGCCGCTATCC  218627

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               |    || |||||||||||||||||||| |||||| |||| || || || || |||||||
Sbjct  218628  TTTCGGGTAACGACTCGTCGGAGAAGCTCCAGGACTTGCTCCTCCTCGATGTCACGCCGC  218687

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
               | || || ||| | ||||||||||| ||||||||||||||||| |||  ||| |||||||
Sbjct  218688  TCTCGCTCGGTTTGGAGACGGCCGGCGGTGTCATGACGACGCTCATCCAGCGTAACACGA  218747

Query  1181    CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
               ||||||| || ||||||||||||||||||||||||||||||||||||||||| || ||  
Sbjct  218748  CGGTGCCCACGAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCCGGTGTCT  218807

Query  1241    TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
               | |||||||| ||||| ||||| ||||| |||||||||||||||||| |||| |||||||
Sbjct  218808  TGATCCAGGTCTTCGAAGGCGAACGCTCGATGACGCGCGACAACAACTTGCTCGGCAAGT  218867

Query  1301    TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
               ||   || ||||||||||| |||||||| || ||||| || ||||| || || |||||||
Sbjct  218868  TCTCGCTCGACGGCATCCCGCCCATGCCCCGTGGTGTCCCCCAGATTGATGTCACGTTCG  218927

Query  1361    ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
               |||| || || ||||| ||| ||||||| ||||| || |||||||| || ||||||||||
Sbjct  218928  ACATTGATGCCAACGGTATCTTGAACGTCTCGGCCGTCGAGAAGTCGACCGGCAAGGAGA  218987

Query  1421    ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
               |||||||||||||||||||||||||||| |||||| |  |||  |||||||| |||||||
Sbjct  218988  ACAAGATCACGATCACGAACGACAAGGGTCGCCTCACCAAGGACGACATTGAGCGCATGG  219047

Query  1481    TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
               |   ||| |||||||||||||||||||||||||| || |||||||  |||||||| ||||
Sbjct  219048  TCCAGGAAGCCGAGAAGTACAAGTCGGAGGACGAAGCCAACAAGCTCCGCATCGAAGCCA  219107

Query  1541    AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
               ||||||  || ||||||||||| ||||  || || ||||  || || ||||||||| |  
Sbjct  219108  AGAACGGCCTCGAGAACTACGCGTACAACCTCCGCAACACGCTCAACGACGAGAAGCTCC  219167

Query  1601    AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
               |||  ||||||   || || |||||||||||  | ||||||||||| ||||| || ||| 
Sbjct  219168  AGGGCAAGATCGACGAGGCCGACAAGAAGGCCATCGACGACAAGGTCACGGACGTCATCA  219227

Query  1661    AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
               | ||||| ||||| ||||||||    |||||||| | || |||| | |||||||||||  
Sbjct  219228  ACTGGCTCGACGCCAACCAGTCGGCCGAGAAGGAGGAGTTCGAGGCCAAGCAGAAGGAGC  219287

Query  1721    TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
               | |||||| | ||||||||  |  ||||||||||||||||||||||||| ||  ||||  
Sbjct  219288  TCGAGGGCATTGCCAACCCCATCATGCAGAAGATGTACGCTGCTGCTGGTGGCGCCCC--  219345

Query  1781    GTGCTGAGGGTGGTATGCCCGGTGGTGTGCC------GGGCGGCATGCCTGGTGCTCCCC  1834
                       || ||||||||||| ||  ||||      |||||||    ||||||| ||||
Sbjct  219346  -------CGGCGGTATGCCCGGCGGCATGCCCGACATGGGCGGC---GCTGGTGCCCCCC  219395

Query  1835    CTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
               || | |   |    | ||||||||| ||||| ||||| |||||||||
Sbjct  219396  CTCCGGCCTCGCACGCCCAGGGCCCCAAGATTGAGGAAGTCGACTAA  219442

 Score = 454 bits (503),  Expect = 5e-125
 Identities = 322/369 (87%), Gaps = 0/369 (0%)
 Strand=Plus/Plus

Query  28      TCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGT  87
               |||||||| ||||| ||||| || |||||||||||||| |||||||||||||||||||| 
Sbjct  217505  TCCGTCGGTATCGATCTCGGTACGACCTACTCGTGCGTCGGCGTGTGGCAGAACGACCGC  217564

Query  88      GTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACA  147
               || || |||||||||||||||||||| |||||||| || || || |||||||||||||| 
Sbjct  217565  GTCGAGATCATCGCCAACGACCAGGGTAACCGCACGACGCCCTCGTACGTCGCCTTCACG  217624

Query  148     GACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAAC  207
               |||||||| |||||||||||||||||||||||||| ||||||||||||||| |   ||||
Sbjct  217625  GACTCGGAGCGCCTCATCGGTGACGCCGCCAAGAACCAGGTGGCCATGAACCCCACCAAC  217684

Query  208     ACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCC  267
               ||||| ||||||||||| || || || ||||||||||||   ||||||| |   ||||||
Sbjct  217685  ACGGTCTTCGACGCCAAGCGCCTCATTGGCCGCAAGTTCAACGACCCCGCCACGCAGGCC  217744

Query  268     GACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACG  327
               ||||||||||||||||| ||| | || ||| | |||||||| |||||||| |||||||||
Sbjct  217745  GACATCAAGCACTGGCCCTTCAAGGTCACGCCCGGCGCCGGCGACAAGCCCCAGATCACG  217804

Query  328     GTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTG  387
               ||  ||||||||||||| |||||||||||||| |||||||| |||||||| |||||||| 
Sbjct  217805  GTCGAGTTCAAGGGCGAATCCAAGACGTTCCAGCCCGAGGAAATCTCGTCGATGGTGCTC  217864

Query  388     ATCAAGATG  396
               |||||||||
Sbjct  217865  ATCAAGATG  217873

>PHRA:scaffold_35
Length=466101

 Score = 1535 bits (1701),  Expect = 0.0
 Identities = 1059/1197 (88%), Gaps = 7/1197 (1%)
 Strand=Plus/Plus

Query  687     GAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTC  746
               |||||| || || || || |||||||| ||||| |||||||| |||||||| ||||||||
Sbjct  159024  GAACCAACGCGCGCTGCGGCGTCTGCGTACGGCGTGCGAGCGCGCCAAGCGGACGCTGTC  159083

Query  747     GTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTC  806
               ||||||||| ||||| ||||| || || ||||| |||| ||||||| | |||||||||||
Sbjct  159084  GTCGTCGGCCCAGGCCTACATTGAAATCGACTCGCTGTACGACGGCGTGGACTTCAACTC  159143

Query  807     GACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGA  866
               ||||||||| || || |||||||||||| ||||||||||||||||||| ||||| |||||
Sbjct  159144  GACCATCACGCGCGCCCGTTTCGAGGACCTGTGCGGCGACTACTTCCGAAAGACCATGGA  159203

Query  867     GCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGT  926
               |||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||||
Sbjct  159204  GCCCGTGGAGAAGGTGTTGCGCGACGCCAAGCTGTCCAAGAGCCAGGTGAACGAGGTGGT  159263

Query  927     GCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAA  986
               ||| ||||||||||||||||||||||||||||||||||| |||||||| || ||||||||
Sbjct  159264  GCTAGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAACTGCTGTCTGAGTTCTTCAA  159323

Query  987     CGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGT  1046
               ||||||||||||||||||||||||||||||||||||||| || |||||||| || || ||
Sbjct  159324  CGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCCGTAGCGTACGGCGCAACGGT  159383

Query  1047    GCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCT  1106
                ||||||||||||||| ||||||||||||||||||| ||||||||||||||| | ||| |
Sbjct  159384  ACAGGCGGCCATCCTGGGCGGCAACGACTCGTCGGACAAGCTGCAGGACCTGTTGCTGTT  159443

Query  1107    GGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGAT  1166
               |||||||||||||||||||||||| || |||||||| || ||||||||||||||||||||
Sbjct  159444  GGACGTGACGCCGCTGTCTCTGGGCCTGGAGACGGCAGGCGGTGTCATGACGACGCTGAT  159503

Query  1167    CGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAA  1226
               |||||| |||||||||||||| ||||||||| |||||||||||||||||||||| |||||
Sbjct  159504  CGCGCGTAACACGACGGTGCCTACCAAGAAGGCGCAGACGTTCTCGACGTACGCGGACAA  159563

Query  1227    CCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAA  1286
               ||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||  |
Sbjct  159564  CCAGCCTGGTGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCGATGACCCGTGACAATCA  159623

Query  1287    CCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGAT  1346
                || |||||||||||||||||||||| |||||| ||||||||||| ||||| || |||||
Sbjct  159624  TCTTCTGGGCAAGTTCAACCTGGACGCCATCCCGCCCATGCCTCGTGGTGTTCCCCAGAT  159683

Query  1347    CGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTC  1406
                || |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||
Sbjct  159684  TGATGTGACGTTCGACATCGACGCGAACGGGATCCTGAACGTGTCGGCCGTGGAGAAGTC  159743

Query  1407    AACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGA  1466
                ||||||||||||||||||||||| |||||||||||||||||||| || |||||| | ||
Sbjct  159744  GACGGGCAAGGAGAACAAGATCACCATCACGAACGACAAGGGCCGACTGTCGCAGTCCGA  159803

Query  1467    CATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCA  1526
                || |||||||||||  |||||||||||||||||||||||||||||||||| ||||||  
Sbjct  159804  TATCGACCGCATGGTGGCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCCAACAAGGT  159863

Query  1527    ACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAA  1586
                ||||||||||||||||||||||| ||||||||||| |||||| |||| ||||| |||||
Sbjct  159864  GCGCATCGAGGCCAAGAACGCGCTCGAGAACTACGCGTACAGTTTGCGCAACAGCCTGAA  159923

Query  1587    TGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGT  1646
                ||||||||| |||||||| |||||||||| || |||||||||| |||||||||||||||
Sbjct  159924  CGACGAGAAGCTGAAGGAGCAGATCCCGGAGGCCGACAAGAAGGTGGTGGACGACAAGGT  159983

Query  1647    GACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTC  1706
               |||||||  |||||| ||||| |||||| |||||||   ||||| ||| | |||||||||
Sbjct  159984  GACGGAAACGATCCAATGGCTCGACGCACACCAGTCTGCGGAGACGGAGGAGTACGAGTC  160043

Query  1707    GAAGCAGAAGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGC  1766
               ||||||||||||  ||||||||||||| || ||  |  ||||||||||||||||||||||
Sbjct  160044  GAAGCAGAAGGAGCTGGAGGGCGTGGCGAATCCGATCCTGCAGAAGATGTACGCTGCTGC  160103

Query  1767    TGGCGGTTCCCCTGGTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGG  1826
               ||||||  | |||||||| ||||||||  ||||||| ||  |||| ||     |||  ||
Sbjct  160104  TGGCGGCGCTCCTGGTGCCGAGGGTGGCGTGCCCGGCGGCATGCCTGG-----TGCTGGG  160158

Query  1827    --TGCTCCCCCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
                  |||||  |  |||| | |||||||||||||||||||||||| ||||||||||||
Sbjct  160159  GCCGCTCCTTCGTCTGGCGGTGCGGACCAGGGCCCGAAGATCGAAGAGGTCGACTAA  160215

 Score = 1465 bits (1624),  Expect = 0.0
 Identities = 1011/1145 (88%), Gaps = 9/1145 (1%)
 Strand=Plus/Minus

Query  746     CGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACT  805
               |||||||||| ||||| ||||| || || ||||| |||| ||||||| | ||||||||||
Sbjct  153728  CGTCGTCGGCCCAGGCCTACATTGAAATCGACTCGCTGTACGACGGCGTGGACTTCAACT  153669

Query  806     CGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGG  865
               |||||||||| || || |||||||||||| ||||||||||||||||||| ||||| ||||
Sbjct  153668  CGACCATCACGCGCGCCCGTTTCGAGGACCTGTGCGGCGACTACTTCCGAAAGACCATGG  153609

Query  866     AGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGG  925
               ||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||||||
Sbjct  153608  AGCCCGTGGAGAAGGTGTTGCGCGACGCCAAGCTGTCCAAGAGCCAGGTGAACGAGGTGG  153549

Query  926     TGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCA  985
               |||| ||||||||||||||||||||||||||||||||||| |||||||| || |||||||
Sbjct  153548  TGCTAGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAACTGCTGTCTGAGTTCTTCA  153489

Query  986     ACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCG  1045
               |||||||||||||||||||||||||||||||||||||||| || |||||||| || || |
Sbjct  153488  ACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCCGTAGCGTACGGCGCAACGG  153429

Query  1046    TGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGC  1105
               | ||||||||||||||| ||||||||||||||||||| ||||||||||||||| | ||| 
Sbjct  153428  TACAGGCGGCCATCCTGGGCGGCAACGACTCGTCGGACAAGCTGCAGGACCTGTTGCTGT  153369

Query  1106    TGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGA  1165
               ||||||||||||||||||||||||| || |||||||| || |||||||||||||||||||
Sbjct  153368  TGGACGTGACGCCGCTGTCTCTGGGCCTGGAGACGGCAGGCGGTGTCATGACGACGCTGA  153309

Query  1166    TCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACA  1225
               ||||||| |||||||||||||| ||||||||| |||||||||||||||||||||| ||||
Sbjct  153308  TCGCGCGTAACACGACGGTGCCTACCAAGAAGGCGCAGACGTTCTCGACGTACGCGGACA  153249

Query  1226    ACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACA  1285
               |||| ||||| |||||||||||||||||||||||||||||||| ||||| || |||||  
Sbjct  153248  ACCAACCTGGTGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCGATGACCCGTGACAATC  153189

Query  1286    ACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGA  1345
               | || |||||||||||||||||||||| |||||| ||||||||||| ||||| || ||||
Sbjct  153188  ATCTTCTGGGCAAGTTCAACCTGGACGCCATCCCGCCCATGCCTCGTGGTGTTCCCCAGA  153129

Query  1346    TCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGT  1405
               | || |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct  153128  TTGATGTGACGTTCGACATCGACGCGAACGGGATCCTGAACGTGTCGGCCGTGGAGAAGT  153069

Query  1406    CAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTG  1465
               | ||||||||||||||||||||||| |||||||||||||||||||| || |||||| | |
Sbjct  153068  CGACGGGCAAGGAGAACAAGATCACCATCACGAACGACAAGGGCCGACTGTCGCAGTCCG  153009

Query  1466    ACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGC  1525
               | || |||||||||||  ||||||||||||||||||||||||||||| |||| |||||| 
Sbjct  153008  ATATCGACCGCATGGTGGCGGAGGCCGAGAAGTACAAGTCGGAGGACAAGGCCAACAAGG  152949

Query  1526    AACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGA  1585
                 ||||||||||||||||||||||| ||||||||||| ||||||||||| ||||| ||||
Sbjct  152948  TGCGCATCGAGGCCAAGAACGCGCTCGAGAACTACGCGTACAGTCTGCGCAACAGCCTGA  152889

Query  1586    ATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGG  1645
               | ||||||||| |||||||| |||||||||| || |||||||||| ||||||||||||||
Sbjct  152888  ACGACGAGAAGCTGAAGGAGCAGATCCCGGAGGCCGACAAGAAGGTGGTGGACGACAAGG  152829

Query  1646    TGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGT  1705
               |||| ||    ||| | ||||| ||||| ||||||||    |||| ||| | ||||||||
Sbjct  152828  TGACCGAGACCATCAACTGGCTCGACGCCAACCAGTCCGCTGAGACGGAGGAGTACGAGT  152769

Query  1706    CGAAGCAGAAGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTG  1765
               |||||||||||||  ||||||||||||| || ||  |  |||||||||||||||||||||
Sbjct  152768  CGAAGCAGAAGGAGCTGGAGGGCGTGGCGAATCCGATCCTGCAGAAGATGTACGCTGCTG  152709

Query  1766    CTGGCGGTTCCCCTGGTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTG  1825
               |||||||  | |||||||| ||||||||  ||||||| ||  |||| |||||||||||||
Sbjct  152708  CTGGCGGCGCTCCTGGTGCCGAGGGTGGCGTGCCCGGCGGCATGCCCGGCGGCATGCCTG  152649

Query  1826    GT---------GCTCCCCCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCG  1876
               ||         |||||  |  |||| | |||||||||||||||||||||||| |||||||
Sbjct  152648  GTGCTGGGGCCGCTCCTTCGTCTGGCGGTGCGGACCAGGGCCCGAAGATCGAAGAGGTCG  152589

Query  1877    ACTAA  1881
               |||||
Sbjct  152588  ACTAA  152584

 Score = 1212 bits (1343),  Expect = 0.0
 Identities = 1087/1364 (80%), Gaps = 0/1364 (0%)
 Strand=Plus/Plus

Query  403     GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
               || ||||| | |||||| ||  | ||||||||||||||||||||||||||||| ||||||
Sbjct  147923  GATGCCGGTGTCATTGCTGGTTTGAACGTGCTGCGTATCATCAACGAGCCGACAGCCGCC  147982

Query  463     GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
               || || || ||||| |||||||| ||||| || |||| ||||||||||||||||||||||
Sbjct  147983  GCTATTGCCTACGGTCTGGACAAAAAGGGTGGAGAGCACAACGTGCTGATCTTCGACCTG  148042

Query  523     GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
               |||||||| || || || || || || ||  | ||||| || |||||||||||||| |||
Sbjct  148043  GGCGGCGGAACGTTTGACGTCTCGCTTCTTACTATTGAAGACGGCATCTTCGAGGTGAAG  148102

Query  583     GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
               || || || || |||||||||||||| || || ||||||||||||||||| || ||   |
Sbjct  148103  GCGACGGCAGGCGACACGCACCTGGGCGGCGAAGACTTCGACAACCGCCTCGTCGAGTTC  148162

Query  643     TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
               ||   ||| || |||||||||||||| |||||||| || |||| ||||  ||| || || 
Sbjct  148163  TTTGTGCAAGAATTCAAGCGCAAGCATCGCAAGGATATGACGGTGAACTCGCGCGCGCTG  148222

Query  703     CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
               || |||||||| ||||| |||||||||||||||||||| ||||||  ||| || || || 
Sbjct  148223  CGGCGTCTGCGTACGGCGTGCGAGCGTGCCAAGCGTACACTGTCGATGTCTGCGCAAGCG  148282

Query  763     TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
               ||||||||||||||||| ||| | || ||  |||| |||||||| ||||| || || || 
Sbjct  148283  TACATCGAGATTGACTCGCTGCTGGATGGTGTCGATTTCAACTCTACCATTACGCGCGCG  148342

Query  823     CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
               || ||||||||  | || || || | ||| |||||||| ||||| || |||| | |||| 
Sbjct  148343  CGGTTCGAGGATCTTTGTGGTGAATTCTTTCGCAAGACAATGGACCCAGTGGCGCAGGTT  148402

Query  883     CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
               || || ||| | ||||||||||||||||||||| ||||||||||||| ||||||||||||
Sbjct  148403  CTACGAGACTCGAAGCTGTCGAAGAGCCAGGTGAACGAGGTGGTGCTAGTGGGCGGCTCG  148462

Query  943     ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
               || ||||||||||||||||||||| || ||   ||||| |||||||| ||| ||| |  |
Sbjct  148463  ACTCGTATCCCGAAGGTGCAGCAGTTGTTGATCGACTTTTTCAACGGTAAGAAGCTCTTC  148522

Query  1003    AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
               || ||||||||||||||||| ||  | ||||||||||| || ||||||||||||||||||
Sbjct  148523  AAATCCATCAACCCGGACGAAGCCATAGCGTACGGTGCTACAGTGCAGGCGGCCATCCTG  148582

Query  1063    AGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTG  1122
               |||||| | |||||||||   ||| ||||||||||||| || ||||||||| ||||||||
Sbjct  148583  AGCGGCCATGACTCGTCGTCCAAGTTGCAGGACCTGCTGCTACTGGACGTGGCGCCGCTG  148642

Query  1123    TCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACG  1182
               ||||| ||  | |||||||| || || |||||||| | ||||||| |||| ||||| |||
Sbjct  148643  TCTCTTGGCTTGGAGACGGCTGGCGGAGTCATGACCAAGCTGATCCCGCGCAACACCACG  148702

Query  1183    GTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTC  1242
               || ||  |||||||| ||||| |||||||||||||||| ||||||||| | || ||  | 
Sbjct  148703  GTTCCAGCCAAGAAGGCGCAGTCGTTCTCGACGTACGCGGACAACCAGTCCGGTGTCTTG  148762

Query  1243    ATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTC  1302
               ||||| ||||||||||| ||||| || |||||  | |||||  | || ||||||||||| 
Sbjct  148763  ATCCAAGTGTTCGAGGGTGAGCGTTCGATGACCTGTGACAATCATCTTCTGGGCAAGTTT  148822

Query  1303    AACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGAC  1362
               ||| ||||||||||||| ||||||||||||||||||||||| || |||||||||||||||
Sbjct  148823  AACTTGGACGGCATCCCGCCCATGCCTCGCGGTGTGCCGCAAATTGACGTGACGTTCGAC  148882

Query  1363    ATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAAC  1422
                | || |  ||||||||  ||||||||||||| ||||||||||| |||||||||||||||
Sbjct  148883  GTGGATGTCAACGGCATTTTGAACGTGTCGGCCGTGGAGAAGTCGACGGGCAAGGAGAAC  148942

Query  1423    AAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTA  1482
               |||||||  ||||||||||||||||||||  | || ||| | || ||  |||||||||| 
Sbjct  148943  AAGATCATCATCACGAACGACAAGGGCCGGTTATCTCAGTCCGAGATCAACCGCATGGTT  149002

Query  1483    TCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAAG  1542
                  || || ||||||||||||    | || ||    |||||||  ||||||||| | |||
Sbjct  149003  GATGACGCTGAGAAGTACAAGGACCAAGATGAACGCAACAAGCTGCGCATCGAGTCGAAG  149062

Query  1543    AACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGAAG  1602
               |||||||||||||| ||||| | |  |||||| | |     |   || || ||  ||  |
Sbjct  149063  AACGCGCTGGAGAATTACGCGTTCTCTCTGCGCAGCTCGACGCGAGATGAAAAAGTGGCG  149122

Query  1603    GAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCCAG  1662
               |  ||  |    || |  ||||||||| || | || |||||||||  |||     | || 
Sbjct  149123  GCCAAATTGAGCGACGAGGACAAGAAGACGATTGAGGACAAGGTGGTGGAGACCCTGCAC  149182

Query  1663    TGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAATTG  1722
               ||| |||| || |||||| |   || |||||| | || |||  |||||||| ||||  ||
Sbjct  149183  TGGTTGGATGCCAACCAGGCGGCGGGGAAGGAGGAGTTCGACGCGAAGCAGCAGGAGCTG  149242

Query  1723    GAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGC  1766
               ||||| ||| |||||||  |  |||||||||| ||| | || ||
Sbjct  149243  GAGGGTGTGACCAACCCGATCATGCAGAAGATTTACACCGCGGC  149286

 Score = 577 bits (639),  Expect = 7e-162
 Identities = 363/392 (93%), Gaps = 0/392 (0%)
 Strand=Plus/Plus

Query  18      GTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCA  77
               |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct  164328  GTCTGGATACTCGGTCGGCATCGACCTCGGCACGACCTACTCGTGCGTGGGCGTGTGGCA  164387

Query  78      GAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGT  137
               ||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| |||||
Sbjct  164388  GAACGACCGCGTGGAGATCATCGCCAACGACCAGGGCAACCGCACCACGCCGTCCTACGT  164447

Query  138     CGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAA  197
                |||||||| ||| |||| ||||| |||||||| ||||||||||| || |||||||||||
Sbjct  164448  GGCCTTCACGGACACGGAGCGCCTGATCGGTGATGCCGCCAAGAACCAAGTGGCCATGAA  164507

Query  198     CGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGT  257
               ||||||||||||||||||||||||||| || || |||||||||||||||||||||||  |
Sbjct  164508  CGCGCACAACACGGTGTTCGACGCCAAGCGCCTTATCGGCCGCAAGTTCTCGGACCCGAT  164567

Query  258     CGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCC  317
               ||| ||||||||||||||||||||||||||| |  || || |||||||||| ||||||||
Sbjct  164568  CGTGCAGGCCGACATCAAGCACTGGCCGTTCAAGCTGTCGCCGGGCGCCGGCGACAAGCC  164627

Query  318     GCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTC  377
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  164628  GCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTC  164687

Query  378     CATGGTGCTGATCAAGATGCGCGAGGACGCCG  409
               ||||||||| ||||||||||||||||  ||||
Sbjct  164688  CATGGTGCTTATCAAGATGCGCGAGGTGGCCG  164719

 Score = 409 bits (453),  Expect = 2e-111
 Identities = 316/373 (85%), Gaps = 2/373 (1%)
 Strand=Plus/Plus

Query  31      GTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTG  90
               || ||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct  147461  GTGGGCATCGACCTGGGCACGACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGCGTG  147520

Query  91      GAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGAC  150
               || ||||||||||||||||||||||||||||| || ||||| ||||| |||||||| |||
Sbjct  147521  GAGATCATCGCCAACGACCAGGGCAACCGCACGACACCGTCCTACGTGGCCTTCACGGAC  147580

Query  151     TCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACG  210
                |||| ||||| ||||| ||||| |||||||| |||||||||||||||||||||||||||
Sbjct  147581  ACGGAGCGCCTTATCGGCGACGCGGCCAAGAACCAGGTGGCCATGAACGCGCACAACACG  147640

Query  211     GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
               ||||| || | ||| ||| ||||||| ||||||||| | ||||| |  || ||| | |||
Sbjct  147641  GTGTTTGATGTCAAGCGTTTGATCGGGCGCAAGTTCACCGACCCTGAAGTGCAGTCGGAC  147700

Query  271     ATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTG-ACAAGCCGCAGATCACGGT  329
               |||| ||||||||||||  ||||| | ||| |  |||| | | |||||| |  |   |||
Sbjct  147701  ATCAGGCACTGGCCGTTTAAAGTGGC-TCGAGGTCCGGAGAATAAGCCGGAAGTGGTGGT  147759

Query  330     GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGAT  389
               ||||||||| || |||     ||| ||||| ||||||||||||||||||||||||||| |
Sbjct  147760  GCAGTTCAAAGGTGAGCAGGTGACTTTCCAGCCCGAGGAGATCTCGTCCATGGTGCTGGT  147819

Query  390     CAAGATGCGCGAG  402
               |||||||||||||
Sbjct  147820  CAAGATGCGCGAG  147832

 Score = 84.2 bits (92),  Expect = 1e-13
 Identities = 57/63 (90%), Gaps = 1/63 (2%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||||||||| ||||| ||||| || |||||||||||||||||||||||||| || ||||
Sbjct  164801  AGGACGCCGGTGCCATCGCCGGGCTGAACGTGCTGCGTATCATCAACGAGCCCAC-GCCG  164859

Query  461     CCG  463
               |||
Sbjct  164860  CCG  164862

>PYAP:scaffold_139 pag1_scaffold_139 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_139:1:57110:1 
REF
Length=57110

 Score = 1517 bits (1681),  Expect = 0.0
 Identities = 1228/1482 (83%), Gaps = 17/1482 (1%)
 Strand=Plus/Minus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              ||||||| || ||||| ||||| || |||||||| ||||||||||||||||| |||||||
Sbjct  39000  AGGACGCTGGTGCCATCGCCGGTCTTAACGTGCTCCGTATCATCAACGAGCCAACGGCCG  38941

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              |||| || || ||||| || |||||||||||||| |||||||||||||| |||||||| |
Sbjct  38940  CCGCTATTGCTTACGGTCTCGACAAGAAGGGCGGTGAGCGCAACGTGCTCATCTTCGATC  38881

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              | || ||||| |||||||||||||| ||||||  |||||||||||| |||||||||||||
Sbjct  38880  TTGGTGGCGGTACCTTCGATGTGTCGCTCCTGAGCATTGAGGAGGGTATCTTCGAGGTCA  38821

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
              ||||||| ||||||||||| ||||| |||||||||||||||||||| || || || ||||
Sbjct  38820  AGGCCACCGCTGGTGACACCCACCTTGGTGGTGAGGACTTCGACAATCGTCTCGTCGACC  38761

Query  641    ACTTCACGCAG-GAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCT  699
              |||||   ||| ||||||||||||||||||||||||||||||||   |||||||||||| 
Sbjct  38760  ACTTCGT-CAGCGAGTTCAAGCGCAAGCACCGCAAGGACATCACCTCGAACCAGCGTGCC  38702

Query  700    CTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAG  759
              || |||||||| || |||||||| |||||||| ||||||||||| ||||||||||| |||
Sbjct  38701  CTCCGTCGTCTCCGTACGGCCTGTGAGCGTGCTAAGCGTACGCTTTCGTCGTCGGCCCAG  38642

Query  760    GCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGT  819
              || |||||||| || ||||| || || || || || |||||||||||||||||||| |||
Sbjct  38641  GCCTACATCGAAATCGACTCGCTCTTTGATGGTATTGACTTCAACTCGACCATCACGCGT  38582

Query  820    GCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAG  879
              |||||||||||||||||||| || ||||||||||| ||||| |||||||| || ||||||
Sbjct  38581  GCTCGTTTCGAGGACATGTGTGGTGACTACTTCCGTAAGACCATGGAGCCAGTCGAGAAG  38522

Query  880    GTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGC  939
              || || || ||| | ||||| ||||||||||||||||||||||| || || || || || 
Sbjct  38521  GTCCTCCGTGACTCGAAGCTCTCGAAGAGCCAGGTGCACGAGGTTGTCCTTGTCGGTGGT  38462

Query  940    TCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCC  999
              ||||| ||||| || |||||||||||||| || |||||||||||||||||||||||||| 
Sbjct  38461  TCGACCCGTATTCCTAAGGTGCAGCAGCTCCTTTCGGACTTCTTCAACGGCAAGGAGCCT  38402

Query  1000   AACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATC  1059
                |||||| |||||||| || |||||||| || | ||| || ||||| ||||| || |||
Sbjct  38401  TGCAAGTCGATCAACCCTGATGAGGCTGTTGCCTTCGGCGCTACCGTCCAGGCCGCTATC  38342

Query  1060   CTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCG  1119
              ||   ||| ||||||  |||||||||||| ||||||||||| || || || ||||| || 
Sbjct  38341  CTTTCCGGTAACGACCAGTCGGAGAAGCTCCAGGACCTGCTCCTCCTCGATGTGACCCCA  38282

Query  1120   CTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACG  1179
              ||||| || ||||| ||||| ||||||||||||||||| || || ||| | || ||||| 
Sbjct  38281  CTGTCGCTTGGTCTTGAGACTGCCGGTGGTGTCATGACCACCCTTATCCCACGTAACACC  38222

Query  1180   ACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTG  1239
              |||||||| ||||||||| | |||||||||||||| |||||||||||||||||||| |||
Sbjct  38221  ACGGTGCCAACCAAGAAGACCCAGACGTTCTCGACCTACGCCGACAACCAGCCTGGTGTG  38162

Query  1240   CTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAG  1299
              || ||||||||||||||||| ||||| || ||||| |||||||||||||| || || |||
Sbjct  38161  CTTATCCAGGTGTTCGAGGGTGAGCGTTCGATGACCCGCGACAACAACCTCCTCGGTAAG  38102

Query  1300   TTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTC  1359
              |||||||| |||||||| ||||| |||||||| |||||||| |||||||| || || |||
Sbjct  38101  TTCAACCTCGACGGCATTCCTCCAATGCCTCGTGGTGTGCCACAGATCGATGTCACCTTC  38042

Query  1360   GACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAG  1419
              ||||| || || ||||| |||||||||||||||||  | || ||||| || || ||||||
Sbjct  38041  GACATTGATGCCAACGGTATCCTGAACGTGTCGGCCATCGAAAAGTCGACCGGTAAGGAG  37982

Query  1420   AACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATG  1479
              ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct  37981  AACAAGATCACGATCACCAACGATAAGGGTCGCCTCTCGCAGGCTGACATTGACCGCATG  37922

Query  1480   GTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCC  1539
              || |||||||| || ||||||||| | ||||||||||| ||||||   || |||||||| 
Sbjct  37921  GTGTCGGAGGCTGAAAAGTACAAGGCTGAGGACGAGGCCAACAAGATCCGTATCGAGGCT  37862

Query  1540   AAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATG  1599
              |||||||  || ||||||||||||||||  || || ||||  || || ||||||||| ||
Sbjct  37861  AAGAACGGCCTTGAGAACTACGCCTACAACCTCCGCAACACCCTCAACGACGAGAAGCTG  37802

Query  1600   AAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATC  1659
              |||    ||||||| || | ||||   |||||  | ||||||||||| || || ||||||
Sbjct  37801  AAGAGCCAGATCCCAGAGGATGACCGCAAGGCTATTGACGACAAGGTCACTGAGGTGATC  37742

Query  1660   CAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAA  1719
               | ||||| |||||  ||||| | |  |||||||| | || |||| ||||||||||||| 
Sbjct  37741  AACTGGCTCGACGCCCACCAGGCCTCCGAGAAGGAGGAGTTCGAGGCGAAGCAGAAGGAG  37682

Query  1720   TTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCT  1779
               | |||||  | ||||||||| |  | ||||||||||||||  ||     |||     ||
Sbjct  37681  CTAGAGGGTATTGCCAACCCAATCCTTCAGAAGATGTACGC--CT-----CGG-----CT  37634

Query  1780   GGTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCTCCCCCTGCT  1839
              ||||| |  || || ||||| |||| ||  || || | |   || ||  |  ||||  | 
Sbjct  37633  GGTGCCGCCGGCGGCATGCCAGGTGCTGCTCCAGGTGCC---CCAGGCCCAGCCCCATCG  37577

Query  1840   GGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
              | ||  |  ||||||||||| ||||| |||||||||||||||
Sbjct  37576  GCTGGCGGTGACCAGGGCCCAAAGATTGAGGAGGTCGACTAA  37535

 Score = 890 bits (986),  Expect = 0.0
 Identities = 1016/1361 (75%), Gaps = 4/1361 (0%)
 Strand=Plus/Minus

Query  403    GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
              ||||| || |||||||| || || || ||||| || || ||||| |||||||| || || 
Sbjct  31419  GACGCTGGTGCCATTGCTGGTCTGAATGTGCTTCGCATTATCAATGAGCCGACTGCGGCG  31360

Query  463    GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
              || || || || || |||||    || || ||||||| |||||| |||||||| || || 
Sbjct  31359  GCTATTGCTTATGGACTGGATCGAAAAGGAGGCGAGCACAACGTACTGATCTTTGATCTC  31300

Query  523    GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
              || || ||||| || ||||||  |||  || | || || || ||||| ||||| ||||||
Sbjct  31299  GGGGGTGGCACATTTGATGTGAGTCTGTTGACAATCGAAGAAGGCATTTTCGAAGTCAAG  31240

Query  583    GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
              || ||||| || ||||| ||| |||| || |||||||| || ||||||||||| ||  ||
Sbjct  31239  GCTACTGCGGGCGACACTCACTTGGGCGGGGAGGACTTTGATAACCGCCTGGTCGAGTAC  31180

Query  643    TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
              ||   |   ||||| ||||| ||||||||    |||||  |  | ||||| || ||  | 
Sbjct  31179  TTTGTGGGTGAGTTTAAGCGGAAGCACCGTCGAGACATGTCCAACAACCAACGCGCGTTG  31120

Query  703    CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
              |||||  |||| || ||||| ||||| || || || ||||| || |||||||||||||| 
Sbjct  31119  CGTCGCTTGCGCACTGCCTGTGAGCGAGCAAAACGCACGCTTTCCTCGTCGGCTCAGGCG  31060

Query  763    TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
              || || || ||||| || |||| ||| || || || ||||||||||| || || || || 
Sbjct  31059  TATATTGAAATTGATTCGCTGTACGAAGGGATTGATTTCAACTCGACGATTACACGCGCC  31000

Query  823    CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
              || || || ||| | || || ||||  ||||||||||| |||||||| |||||    |||
Sbjct  30999  CGGTTTGAAGACCTTTGTGGAGACTTTTTCCGCAAGACAATGGAGCCGGTGGAACGAGTG  30940

Query  883    CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
               |||||||  |||| ||    |||||||||||||| ||||| |||||||||||||| |||
Sbjct  30939  TTGCGCGATTCCAAACTAAGCAAGAGCCAGGTGCAAGAGGTTGTGCTGGTGGGCGGATCG  30880

Query  943    ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
              |||||||| || ||| | |||||| |||||||||||| ||||||||| || ||||   ||
Sbjct  30879  ACGCGTATTCCAAAGATCCAGCAGATGCTGTCGGACTACTTCAACGGAAAAGAGCTGTAC  30820

Query  1003   AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
              ||||| ||||| ||||| || || ||||| |  || ||||| ||||||||||| ||||| 
Sbjct  30819  AAGTCGATCAATCCGGATGAAGCGGTGGCATTTGGCGCGACAGTGCAGGCGGCGATCCTT  30760

Query  1063   AGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTG  1122
                 |||| ||||  |||    ||||| || || || ||  |||| ||||||||||| || 
Sbjct  30759  TCGGGCAGCGACAAGTCTTCCAAGCTACAAGATCTTCTGTTGCTCGACGTGACGCCTCTT  30700

Query  1123   TCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACG  1182
              ||| ||||| | || || || ||||| ||||||||||||||||| ||||| || || |||
Sbjct  30699  TCTTTGGGTTTGGAAACTGCGGGTGGGGTCATGACGACGCTGATTGCGCGCAATACTACG  30640

Query  1183   GTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTC  1242
              ||||| || |||||||||||||| ||||| || || || || |||||||| || ||  | 
Sbjct  30639  GTGCCAACGAAGAAGTCGCAGACATTCTCCACCTATGCTGATAACCAGCCCGGAGTCTTG  30580

Query  1243   ATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTC  1302
              || ||||| || || || || ||  | ||||| || |||||  ||||  |||| ||||||
Sbjct  30579  ATTCAGGTTTTTGAAGGTGAACGTACAATGACCCGTGACAATCACCTTTTGGGTAAGTTC  30520

Query  1303   AACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGAC  1362
              |  ||||||||  | || || ||||| || ||||| || |||||||||||||||||||||
Sbjct  30519  AGTCTGGACGGGTTGCCACCAATGCCCCGTGGTGTCCCTCAGATCGACGTGACGTTCGAC  30460

Query  1363   ATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAAC  1422
              || || || ||||| ||  |||||||||||||||| ||||| || || ||||| ||||| 
Sbjct  30459  ATTGATGCAAACGGAATTTTGAACGTGTCGGCTGTTGAGAAATCGACTGGCAAAGAGAAT  30400

Query  1423   AAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTA  1482
              ||||| || || ||||||||||| || || || |||||||  || || || |||||||| 
Sbjct  30399  AAGATTACAATTACGAACGACAAAGGACGTCTGTCGCAGGAAGAGATCGATCGCATGGTG  30340

Query  1483   TCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAAG  1542
                 |||||||| ||||||||     | ||||||   ||||| |  ||| | ||||| |||
Sbjct  30339  CAAGAGGCCGAAAAGTACAAAGATCAAGACGAGCGCAACAAACTGCGCGTTGAGGCGAAG  30280

Query  1543   AACGCGCTGGAGAACTACGC--CTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
              || ||  ||||||| || ||   | |  || |   | |||| | || ||||||||  |  
Sbjct  30279  AATGCTTTGGAGAATTATGCATTTTCGCTCCGTTCAGCAGT-TCAA-GACGAGAAACTCG  30222

Query  1601   AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
               |  |||| ||    |||  ||||||||| || | |||      || |  |  |||||  
Sbjct  30221  TGATGAAGCTCGACCAAGACGACAAGAAGACGATCGACTCTGCCGTAAATGGCGTGATTG  30162

Query  1661   AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
              |||||||||||    | ||  ||   ||||| || |  |||||  | ||   ||||||  
Sbjct  30161  AGTGGCTGGACCAGCATCAAGCAGCTGAGAAAGAGGAATACGACGCCAAAATGAAGGAGC  30102

Query  1721   TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCT  1761
              ||||||| ||||| |||||| |  |||||||| ||||||||
Sbjct  30101  TGGAGGGAGTGGCAAACCCAATTATGCAGAAGCTGTACGCT  30061

 Score = 428 bits (474),  Expect = 2e-117
 Identities = 324/382 (85%), Gaps = 0/382 (0%)
 Strand=Plus/Minus

Query  28     TCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGT  87
              || ||||| ||||| ||||| || || |||||||| || || ||||||||||||||||||
Sbjct  39463  TCGGTCGGTATCGATCTCGGTACCACGTACTCGTGTGTCGGTGTGTGGCAGAACGACCGT  39404

Query  88     GTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACA  147
              || |||||||| |||||||||||||| ||||| |||||||| || |||||||| ||||| 
Sbjct  39403  GTCGAAATCATTGCCAACGACCAGGGTAACCGTACCACCCCATCGTACGTCGCTTTCACC  39344

Query  148    GACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAAC  207
              |||   || || ||||||||||| ||||||||||| ||||| ||||||||||| ||||||
Sbjct  39343  GACAGCGAGCGTCTCATCGGTGATGCCGCCAAGAACCAGGTCGCCATGAACGCCCACAAC  39284

Query  208    ACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCC  267
              ||||||||||||||||| |||||||| ||||||||||||   |||||  | |||||||| 
Sbjct  39283  ACGGTGTTCGACGCCAAGCGTCTGATTGGCCGCAAGTTCAGCGACCCAATTGTCCAGGCT  39224

Query  268    GACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACG  327
              ||||||||||||||||| |||   ||| |  | ||||| ||||||||||| |||||||| 
Sbjct  39223  GACATCAAGCACTGGCCTTTCACCGTGTCCCCAGGCGCTGGTGACAAGCCACAGATCACC  39164

Query  328    GTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTG  387
              || || ||||||||||||  |||||| ||||| || |||||||||||||| |||||||| 
Sbjct  39163  GTCCAATTCAAGGGCGAGAGCAAGACCTTCCAGCCAGAGGAGATCTCGTCGATGGTGCTC  39104

Query  388    ATCAAGATGCGCGAGGACGCCG  409
              | ||||||||| |||| |||||
Sbjct  39103  ACCAAGATGCGTGAGGTCGCCG  39082

 Score = 332 bits (367),  Expect = 4e-88
 Identities = 300/375 (80%), Gaps = 2/375 (1%)
 Strand=Plus/Minus

Query  28     TCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGT  87
              || |||||||||||||||||||| || |||||||| || || |||||||| |||||||||
Sbjct  31884  TCGGTCGGCATCGACCTCGGCACGACGTACTCGTGTGTCGGTGTGTGGCAAAACGACCGT  31825

Query  88     GTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACA  147
              || || |||||||| || ||||||||||||||||| ||||| || |||||||||||||| 
Sbjct  31824  GTCGAGATCATCGCGAATGACCAGGGCAACCGCACGACCCCCTCGTACGTCGCCTTCACG  31765

Query  148    GACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAAC  207
              | | | || || ||||| || || || || ||||| || || || ||||| || ||||||
Sbjct  31764  GGCACTGAGCGGCTCATTGGAGATGCGGCGAAGAACCAAGTCGCGATGAATGCCCACAAC  31705

Query  208    ACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCC  267
              ||||||||||||||||| || ||||| ||||||||||||   ||||| ||||| ||||| 
Sbjct  31704  ACGGTGTTCGACGCCAAGCGGCTGATTGGCCGCAAGTTCCGCGACCCAGTCGTACAGGCA  31645

Query  268    GACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGG-TGACAAGCCGCAGATCAC  326
              ||  | ||||||||||| |||||||||    | || |||||  || ||||| ||||||| 
Sbjct  31644  GATCTGAAGCACTGGCCCTTCCAAGTGGTAGCTGG-GCCGGACGATAAGCCCCAGATCAT  31586

Query  327    GGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
               ||  |||||||||| ||   |||   |||| |  | |||||||| ||||| ||||||||
Sbjct  31585  CGTCGAGTTCAAGGGAGAAAGCAAACGGTTCTACGCGGAGGAGATTTCGTCGATGGTGCT  31526

Query  387    GATCAAGATGCGCGA  401
               |  |||||||| ||
Sbjct  31525  TACAAAGATGCGGGA  31511

>PYUU:scaffold_1478 scf1117875581478 dna:supercontig supercontig:pug:scf1117875581478:1:208200:1 
REF
Length=208200

 Score = 1489 bits (1650),  Expect = 0.0
 Identities = 1219/1481 (82%), Gaps = 18/1481 (1%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| ||||| |||||||||||  | |||||||| |||||||| |||||||| |||||||
Sbjct  104043  AGGATGCCGGTGCCATTGCCGGTTTGAACGTGCTCCGTATCATTAACGAGCCTACGGCCG  103984

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               |||| || ||||||||  |||||||||||||||| |||||||||||||| |||||||| |
Sbjct  103983  CCGCTATTGCGTACGGTTTGGACAAGAAGGGCGGTGAGCGCAACGTGCTCATCTTCGATC  103924

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               | || || || |||||||||||||| || |||  ||||||||| || |||||||| ||||
Sbjct  103923  TTGGTGGTGGTACCTTCGATGTGTCGCTGCTGAGCATTGAGGAAGGTATCTTCGAAGTCA  103864

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               |||| || ||||||||||| ||| |||||||||| || ||||||||||| || |||||||
Sbjct  103863  AGGCTACCGCTGGTGACACTCACTTGGGTGGTGAAGATTTCGACAACCGTCTCGTGGACC  103804

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               |||||  ||||||||||||||||||||||||||||||||| |||  |||||||||||| |
Sbjct  103803  ACTTCGTGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATTACGTCGAACCAGCGTGCGC  103744

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               | |||||||| || || || || || ||||| ||||||||| ||||||||||||| ||||
Sbjct  103743  TGCGTCGTCTCCGTACCGCGTGTGAACGTGCTAAGCGTACGTTGTCGTCGTCGGCCCAGG  103684

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | ||||| || |||||||| |||||||| ||  | ||||||||||||||||| || ||||
Sbjct  103683  CGTACATTGAAATTGACTCGCTGTTCGATGGTGTTGACTTCAACTCGACCATTACCCGTG  103624

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               | |||||||||||||||||||| ||||||||||||||||| ||||| || || |||||||
Sbjct  103623  CCCGTTTCGAGGACATGTGCGGTGACTACTTCCGCAAGACCATGGACCCAGTTGAGAAGG  103564

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               |||| || ||| | ||||| |||||||||||||||||||| || ||||| || || || |
Sbjct  103563  TGCTCCGTGACTCGAAGCTCTCGAAGAGCCAGGTGCACGAAGTTGTGCTTGTCGGTGGTT  103504

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               |||| |||||||| |||||||||||| ||||||||||||| |||||||||||||||||  
Sbjct  103503  CGACCCGTATCCCTAAGGTGCAGCAGTTGCTGTCGGACTTTTTCAACGGCAAGGAGCCAT  103444

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                |||||| |||||||| || |||||||| |||| |||||| ||||||||||| || ||| 
Sbjct  103443  GCAAGTCGATCAACCCTGATGAGGCTGTTGCGTTCGGTGCCACCGTGCAGGCCGCTATCT  103384

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               ||   || ||||||  |||||||||||| |||||| || | || || || ||||| || |
Sbjct  103383  TGTCGGGTAACGACCAGTCGGAGAAGCTCCAGGACTTGTTGCTCCTCGATGTGACCCCAC  103324

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
               | || || ||| | || || ||||||||||| ||||||||| ||||| |||| |||||||
Sbjct  103323  TTTCGCTCGGTTTGGAAACCGCCGGTGGTGTGATGACGACGTTGATCTCGCGTAACACGA  103264

Query  1181    CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
               ||||||| || ||||||||||||||||||||||| ||||||||||||||||| || ||| 
Sbjct  103263  CGGTGCCAACGAAGAAGTCGCAGACGTTCTCGACCTACGCCGACAACCAGCCAGGTGTGT  103204

Query  1241    TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
               | |||||||||||||| || ||||| || ||||| || ||||||||| |||| |||||||
Sbjct  103203  TGATCCAGGTGTTCGAAGGTGAGCGTTCGATGACCCGTGACAACAACTTGCTCGGCAAGT  103144

Query  1301    TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
               ||||| |||||||||| ||||| ||||| || |||||||| ||||| || ||||| ||||
Sbjct  103143  TCAACTTGGACGGCATTCCTCCAATGCCACGTGGTGTGCCACAGATTGATGTGACCTTCG  103084

Query  1361    ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
               |||| |||||||| || ||| ||||||||||||| || |||||||| |||||||||||||
Sbjct  103083  ACATTGACGCGAATGGTATCTTGAACGTGTCGGCCGTCGAGAAGTCGACGGGCAAGGAGA  103024

Query  1421    ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
               |||||||||||||||||||||||||||| ||  | |||||||| || || ||||||||||
Sbjct  103023  ACAAGATCACGATCACGAACGACAAGGGTCGTTTGTCGCAGGCCGATATCGACCGCATGG  102964

Query  1481    TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
               |  | || ||||||||||||||| | || |||||| | ||||||   ||||| || ||||
Sbjct  102963  TTGCCGAAGCCGAGAAGTACAAGGCTGAAGACGAGTCGAACAAGGTTCGCATTGAAGCCA  102904

Query  1541    AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
               ||||||  || ||||||||||| ||||   |||| ||||   || | ||||||||| |||
Sbjct  102903  AGAACGGCCTCGAGAACTACGCGTACAACTTGCGCAACACGTTGGACGACGAGAAGTTGA  102844

Query  1601    AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
               ||    ||||| ||||||  |||   |  ||  |  |||||||||| || ||    ||| 
Sbjct  102843  AGAGCCAGATCTCGGAAGAGGACCGCAGCGCCATCAACGACAAGGTCACCGAGACCATCA  102784

Query  1661    AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
               | ||| ||||||| ||||||||   ||||||||| | || |||| | |||||||||||||
Sbjct  102783  ACTGGTTGGACGCGAACCAGTCGGCGGAGAAGGAAGAGTTCGAGGCCAAGCAGAAGGAAT  102724

Query  1721    TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
               |||| ||||| || |||||| | ||||||||||||||||| || || ||         ||
Sbjct  102723  TGGAAGGCGTTGCGAACCCAATCTTGCAGAAGATGTACGCCGCGGCCGG---------TG  102673

Query  1781    GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTGCTCCCCCTGCTG  1840
               ||||    ||||| ||||| |||||     || ||  |  ||| |||||||| || ||||
Sbjct  102672  GTGC---CGGTGGCATGCCAGGTGG-----CGCGCCACCAGCC-GGTGCTCCACCAGCTG  102622

Query  1841    GTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
               | ||  | ||||||||||| ||||| ||||| |||||||||
Sbjct  102621  GCGCCCCAGACCAGGGCCCAAAGATTGAGGAAGTCGACTAA  102581

 Score = 1232 bits (1365),  Expect = 0.0
 Identities = 1093/1364 (80%), Gaps = 2/1364 (0%)
 Strand=Plus/Minus

Query  403    GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
              ||||| |||| |||| | ||| | |||||| |||| ||||| || || ||||| || |||
Sbjct  95778  GACGCTGGCGTCATTTCGGGCTTGAACGTGTTGCGCATCATTAATGAACCGACTGCGGCC  95719

Query  463    GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
              || |||||||||||  ||||||||||||||||||||| ||| || |||||||| ||||| 
Sbjct  95718  GCGATCGCGTACGGGTTGGACAAGAAGGGCGGCGAGCACAATGTCCTGATCTTTGACCTT  95659

Query  523    GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
              ||||||||||| ||||||||||| || ||  | || || || ||||||||||| ||||||
Sbjct  95658  GGCGGCGGCACGTTCGATGTGTCGCTGCTCACGATCGAAGAAGGCATCTTCGAAGTCAAG  95599

Query  583    GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
              ||||| || || || || ||| |||| || || ||||| ||||| ||| | || ||  ||
Sbjct  95598  GCCACGGCCGGCGATACCCACTTGGGCGGCGAAGACTTTGACAATCGCATAGTCGAGTAC  95539

Query  643    TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
              |||  ||| ||||||||||||||||||||||||||||| |||| ||||||||| ||  | 
Sbjct  95538  TTCGTGCAAGAGTTCAAGCGCAAGCACCGCAAGGACATGACGGGGAACCAGCGCGCGTTG  95479

Query  703    CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
              ||||| ||||| || || ||||||||||||||||||||||||||||||||| | ||||| 
Sbjct  95478  CGTCGCCTGCGCACAGCGTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGTCCCAGGCG  95419

Query  763    TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
              ||||| || || ||||| |||||||| ||||| |||||||||   || ||||| ||||| 
Sbjct  95418  TACATTGAAATCGACTCGCTGTTCGAGGGCATTGACTTCAACAGCACGATCACGCGTGCG  95359

Query  823    CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
              || ||||||||  |||||| |||||| ||||||||||| ||||||||||| |||   |||
Sbjct  95358  CGGTTCGAGGATCTGTGCGCCGACTATTTCCGCAAGACCATGGAGCCCGTCGAGCGCGTG  95299

Query  883    CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
               |||| ||||| ||||| ||||||||||||||||||||||| ||||| || |||||||| 
Sbjct  95298  TTGCGTGACGCGAAGCTCTCGAAGAGCCAGGTGCACGAGGTCGTGCTTGTCGGCGGCTCA  95239

Query  943    ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
              ||||| |||||||||||||||||| ||||||||||||| |||||||||||||| |   ||
Sbjct  95238  ACGCGCATCCCGAAGGTGCAGCAGTTGCTGTCGGACTTTTTCAACGGCAAGGACCTATAC  95179

Query  1003   AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
              ||||| |||||||||||||| || || ||||  || || || ||||| || || ||| ||
Sbjct  95178  AAGTCGATCAACCCGGACGAAGCGGTCGCGTTTGGCGCCACGGTGCAAGCCGCGATCTTG  95119

Query  1063   AGCGGCAACGACTCGTCGGAGAAGC-TGCAGGACCTGCTTCTGCTGGACGTGACGCCGCT  1121
              |||||    |||  ||| |||  || ||||||| ||||| ||  |||||||  | ||| |
Sbjct  95118  AGCGGATCGGACAAGTC-GAGTCGCTTGCAGGATCTGCTGCTCTTGGACGTCGCACCGTT  95060

Query  1122   GTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGAC  1181
              |||  |||| ||||||||||||||||| |||||||||||||||||  |||| ||||||||
Sbjct  95059  GTCGATGGGGCTCGAGACGGCCGGTGGCGTCATGACGACGCTGATTCCGCGCAACACGAC  95000

Query  1182   GGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCT  1241
               ||||| || ||||||||||||||||||||||| ||||||||||| || || || ||| |
Sbjct  94999  AGTGCCAACGAAGAAGTCGCAGACGTTCTCGACCTACGCCGACAATCAACCAGGTGTGTT  94940

Query  1242   CATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTT  1301
               ||||| ||||| || ||||||||  |||||||||| |||||| |  |||| ||||||||
Sbjct  94939  GATCCAAGTGTTTGAAGGCGAGCGTGCCATGACGCGTGACAACCATTTGCTCGGCAAGTT  94880

Query  1302   CAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGA  1361
              |||||| ||||| ||||| || ||||| ||||||||||| |||||||||||||| |||||
Sbjct  94879  CAACCTCGACGGTATCCCGCCGATGCCGCGCGGTGTGCCACAGATCGACGTGACCTTCGA  94820

Query  1362   CATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAA  1421
              ||| |||||||| || ||| ||||||||||||| || |||||||| ||||||||||||||
Sbjct  94819  CATTGACGCGAATGGTATCTTGAACGTGTCGGCCGTCGAGAAGTCGACGGGCAAGGAGAA  94760

Query  1422   CAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGT  1481
              |||||| ||||||||||||||||||||||| ||||||||||  || || |||||||||||
Sbjct  94759  CAAGATTACGATCACGAACGACAAGGGCCGACTCTCGCAGGAAGAGATCGACCGCATGGT  94700

Query  1482   ATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAA  1541
                |||| ||||||   ||||||    |||| ||    ||||||  |||  | ||||||||
Sbjct  94699  CACGGACGCCGAGCGCTACAAGGACCAGGATGAACGCAACAAGTTACGTGTTGAGGCCAA  94640

Query  1542   GAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGAA  1601
              ||||   || || |||||||| |||   ||||| ||    ||| | || |||||| ||  
Sbjct  94639  GAACAGCCTCGAAAACTACGCGTACTCGCTGCGCAATTCGCTGCAAGAAGAGAAGTTGGC  94580

Query  1602   GGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCCA  1661
              |   ||| |  |||  |  |||||||||  | ||||||||||| |  | ||    ||| |
Sbjct  94579  GTCCAAGTTATCGGCCGACGACAAGAAGTTGCTGGACGACAAGATCGCCGAGACCATCAA  94520

Query  1662   GTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAATT  1721
               ||| ||||||| |||||| |    |||||||| | || ||     |||||||||||  |
Sbjct  94519  CTGGTTGGACGCGAACCAGGCGGCCGAGAAGGAGGAGTTCGCCGACAAGCAGAAGGAGCT  94460

Query  1722   GGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTG  1765
               |||    | || |||||  | ||||||  ||||||||| ||||
Sbjct  94459  CGAGTCGTTCGCGAACCCGATCTTGCAGCGGATGTACGCGGCTG  94416

 Score = 425 bits (470),  Expect = 3e-116
 Identities = 335/401 (84%), Gaps = 3/401 (1%)
 Strand=Plus/Minus

Query  1       ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  60
               ||| ||||||||  | |   |||| | |||||||| ||||| ||||| || || ||||||
Sbjct  104530  ATGGCTCAAGCTGTTGC---TGGACAATCCGTCGGTATCGATCTCGGTACGACGTACTCG  104474

Query  61      TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  120
               ||||| ||||||||||||||||||||||| ||||||||||| |||||||| || ||||| 
Sbjct  104473  TGCGTCGGCGTGTGGCAGAACGACCGTGTCGAAATCATCGCGAACGACCAAGGTAACCGT  104414

Query  121     ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  180
               || ||||| || ||||| || ||||| ||| | || || || |||||||| ||||| |||
Sbjct  104413  ACGACCCCATCGTACGTGGCGTTCACGGACACTGAGCGTCTGATCGGTGATGCCGCGAAG  104354

Query  181     AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
               || ||||| || ||||||||||||||||||||||||||||| || ||||||||||| |||
Sbjct  104353  AACCAGGTCGCGATGAACGCGCACAACACGGTGTTCGACGCTAAGCGTCTGATCGGTCGC  104294

Query  241     AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  300
               ||||||||||||||  |||| |||||||||  ||||||||||||||||   ||| || | 
Sbjct  104293  AAGTTCTCGGACCCAATCGTGCAGGCCGACTGCAAGCACTGGCCGTTCACTGTGTCGGCT  104234

Query  301     GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
               ||| | || |||||||| |||||||| |||||||||||||| || || ||||||||||| 
Sbjct  104233  GGCCCAGGCGACAAGCCACAGATCACCGTGCAGTTCAAGGGTGAATCGAAGACGTTCCAG  104174

Query  361     CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGA  401
               || || || || ||||| |||||||| ||||||||||| ||
Sbjct  104173  CCAGAAGAAATTTCGTCGATGGTGCTTATCAAGATGCGTGA  104133

 Score = 378 bits (418),  Expect = 3e-102
 Identities = 315/383 (82%), Gaps = 2/383 (1%)
 Strand=Plus/Minus

Query  28     TCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGT  87
              ||||| || ||||| |||||||| || ||||||||||| || ||||||||  ||||||| 
Sbjct  96243  TCCGTGGGAATCGATCTCGGCACGACGTACTCGTGCGTCGGTGTGTGGCAACACGACCGC  96184

Query  88     GTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACA  147
              || ||||||||||| || ||||||||||||||||| || ||||| ||||| || ||||||
Sbjct  96183  GTTGAAATCATCGCGAATGACCAGGGCAACCGCACGACGCCGTCGTACGTTGCGTTCACA  96124

Query  148    GACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAAC  207
              ||| |||||||  | ||||| || || || | ||| ||||| || |||||||||||||||
Sbjct  96123  GACACGGAACGTTTGATCGGCGATGCGGCGAGGAACCAGGTCGCGATGAACGCGCACAAC  96064

Query  208    ACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCC  267
              |||||||| |||||||| ||  |||||||||| |||||| | ||||| ||||| || || 
Sbjct  96063  ACGGTGTTTGACGCCAAGCGCTTGATCGGCCGAAAGTTCACCGACCCAGTCGTTCAAGCG  96004

Query  268    GACATCAAGCACTGGCCGTTCCAAGT-GACGTCGGGCGCCGGTGACAAGCCGCAGATCAC  326
              |||| |||||||||||| ||| | || | || |||||||||    |||||||||||||  
Sbjct  96003  GACACCAAGCACTGGCCATTCAAGGTCGTCG-CGGGCGCCGAGAGCAAGCCGCAGATCGT  95945

Query  327    GGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
               |||||||||||||| || || ||||||||||| || || ||||||||||| ||||||||
Sbjct  95944  CGTGCAGTTCAAGGGTGAATCGAAGACGTTCCAGCCGGAAGAGATCTCGTCGATGGTGCT  95885

Query  387    GATCAAGATGCGCGAGGACGCCG  409
              || |||||||   |||  |||||
Sbjct  95884  GACCAAGATGAAGGAGATCGCCG  95862

>APAS:scaffold_103 supercont1.103 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.103:1:160417:1 
REF
Length=160417

 Score = 1420 bits (1574),  Expect = 0.0
 Identities = 1146/1385 (83%), Gaps = 4/1385 (0%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||||||||| |||||||| ||||| |||||| |||||||||||||||| || |||||||
Sbjct  91604  AGGACGCCGGTGCCATTGCTGGCCTGAACGTGTTGCGTATCATCAACGAACCCACGGCCG  91663

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              ||||||||||||||||  ||||||||||||| ||||| ||||||||| |||| |||||| 
Sbjct  91664  CCGCCATCGCGTACGGTTTGGACAAGAAGGGTGGCGAACGCAACGTGTTGATTTTCGACT  91723

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              |||||||||| ||||| ||||||||| |  || | || || || |||||||| || || |
Sbjct  91724  TGGGCGGCGGGACCTTTGATGTGTCTTTGTTGACGATCGAAGAAGGCATCTTTGAAGTGA  91783

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
              |||| ||||| |||||||||||| |||||||||| || |||||||||||  |||||||||
Sbjct  91784  AGGCAACTGCCGGTGACACGCACTTGGGTGGTGAAGATTTCGACAACCGTTTGGTGGACC  91843

Query  641    ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
              ||||||||   ||||||||||| ||||||||||||||||| || | |||||| ||| | |
Sbjct  91844  ACTTCACGGCTGAGTTCAAGCGTAAGCACCGCAAGGACATGACCGCGAACCAACGTTCCC  91903

Query  701    TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
              | || |||||||| |||||||||||||| |||||||| ||||||||||||||||| || |
Sbjct  91904  TCCGCCGTCTGCGCACGGCCTGCGAGCGCGCCAAGCGCACGCTGTCGTCGTCGGCACAAG  91963

Query  761    CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
              | ||||| || || |||||  ||||||||||||| || ||||||   || ||||| || |
Sbjct  91964  CGTACATTGAAATCGACTCGTTGTTCGACGGCATTGATTTCAACAGCACGATCACCCGCG  92023

Query  821    CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
              | |||||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct  92024  CGCGTTTCGAAGACATGTGCGGTGACTACTTCCGCAAGACGATGGAGCCTGTGGAGAAGG  92083

Query  881    TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
              || |||||||| | ||| |||| |||||||| |||||||| |||||||| |||||||| |
Sbjct  92084  TGTTGCGCGACTCGAAGTTGTCCAAGAGCCAAGTGCACGAAGTGGTGCTTGTGGGCGGGT  92143

Query  941    CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
              |||| |||||||| |||||||| ||| || |||| |||||||||||||||||||||||  
Sbjct  92144  CGACCCGTATCCCCAAGGTGCAACAGTTGTTGTCTGACTTCTTCAACGGCAAGGAGCCGT  92203

Query  1001   ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                ||||| |||||||| ||||| || ||||||| ||| ||||||||||| || || ||| 
Sbjct  92204  GTAAGTCGATCAACCCCGACGAAGCCGTGGCGTTCGGCGCGACCGTGCAAGCCGCGATCT  92263

Query  1061   TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
              ||   |||||||||   ||||||||| |||| ||| || |  || |||||||||||||| 
Sbjct  92264  TGTCGGGCAACGACAGCTCGGAGAAGTTGCAAGACTTGTTGTTGTTGGACGTGACGCCGT  92323

Query  1121   TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
              |||| || ||  | || |||||||| ||||| |||||||||||||||  ||| |||||||
Sbjct  92324  TGTCGCTCGGGTTGGAAACGGCCGGCGGTGTGATGACGACGCTGATCCAGCGCAACACGA  92383

Query  1181   CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
              |||||||||| ||||||||||||||||| ||||||||||| ||||||||||| || ||||
Sbjct  92384  CGGTGCCGACGAAGAAGTCGCAGACGTTTTCGACGTACGCGGACAACCAGCCGGGTGTGC  92443

Query  1241   TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
              | ||||| ||||| || ||||||||||| |||||||||||||||||| || |||||||||
Sbjct  92444  TGATCCAAGTGTTTGAAGGCGAGCGCTCGATGACGCGCGACAACAACTTGTTGGGCAAGT  92503

Query  1301   T----CAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACG  1356
              |         ||||||| ||||| |||||||| ||||| ||||||||| | |||||||||
Sbjct  92504  TTTCGTTGGTTGGACGGGATCCCGCCCATGCCCCGCGGCGTGCCGCAGGTGGACGTGACG  92563

Query  1357   TTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAG  1416
              |||||||| ||||||||||| ||| |||||||||| ||  | || ||||| |||||||||
Sbjct  92564  TTCGACATTGACGCGAACGGGATCTTGAACGTGTCTGCGATCGAAAAGTCGACGGGCAAG  92623

Query  1417   GAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGC  1476
              ||||||||||| |||||||||||||||||||| ||| |     |||  |||||||| |||
Sbjct  92624  GAGAACAAGATTACGATCACGAACGACAAGGGTCGCTTGAGCAAGGACGACATTGAGCGC  92683

Query  1477   ATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAG  1536
              |||||    || || || |||||||||||||||||||| || ||||||   |||||||| 
Sbjct  92684  ATGGTGCAAGAAGCGGAAAAGTACAAGTCGGAGGACGAAGCCAACAAGTTGCGCATCGAA  92743

Query  1537   GCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAG  1596
              |||||||||| |||||| |||||||| ||||  ||||| ||||  || || |||||||||
Sbjct  92744  GCCAAGAACGGGCTGGAAAACTACGCGTACAACCTGCGCAACACGCTCAACGACGAGAAG  92803

Query  1597   ATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTG  1656
               |  |||  ||| |    ||||| ||||||||||  ||||||||||||||||||||   |
Sbjct  92804  CTCCAGGGCAAGTTGGACGAAGCGGACAAGAAGGTCGTGGACGACAAGGTGACGGAGACG  92863

Query  1657   ATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAG  1716
              ||| | ||||||||||| ||||| ||    || ||||| | ||||||  | ||||| |||
Sbjct  92864  ATCAACTGGCTGGACGCGAACCAATCGGCCGAAAAGGAGGAGTACGAAGCCAAGCAAAAG  92923

Query  1717   GAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCC  1776
              ||  | || ||||||||||||||  |  |||| ||| ||||||| ||||  |||||  ||
Sbjct  92924  GAGCTCGAAGGCGTGGCCAACCCGATCATGCAAAAGCTGTACGCGGCTGGCGGCGGCGCC  92983

Query  1777   CCTGG  1781
              || ||
Sbjct  92984  CCCGG  92988

 Score = 1321 bits (1464),  Expect = 0.0
 Identities = 1123/1386 (81%), Gaps = 22/1386 (2%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||||||||| |||||||| ||| | |||||| |||||||||||||||| || |||||||
Sbjct  112845  AGGACGCCGGTGCCATTGCTGGCTTGAACGTGTTGCGTATCATCAACGAACCCACGGCCG  112786

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               ||||||||||||||||  ||||||||||||| ||||| ||||||||| |||| |||||| 
Sbjct  112785  CCGCCATCGCGTACGGTTTGGACAAGAAGGGTGGCGAACGCAACGTGTTGATTTTCGACT  112726

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               |||||||||| ||||| ||||||||| |  || | || || || |||||||| || || |
Sbjct  112725  TGGGCGGCGGGACCTTTGATGTGTCTTTGTTGACGATCGAAGAAGGCATCTTTGAAGTGA  112666

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               |||||||||| |||||||||||| |||||||||| || |||||||||||  |||||||||
Sbjct  112665  AGGCCACTGCCGGTGACACGCACTTGGGTGGTGAAGATTTCGACAACCGTTTGGTGGACC  112606

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||||||   ||||||||||||||||||||||||||||| || | |||||| ||||| |
Sbjct  112605  ACTTCACGGCTGAGTTCAAGCGCAAGCACCGCAAGGACATGACCGCGAACCAACGTGCCC  112546

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               | || |||||||| |||||||||||||| |||||||| ||||||||||||||||| || |
Sbjct  112545  TCCGCCGTCTGCGCACGGCCTGCGAGCGCGCCAAGCGCACGCTGTCGTCGTCGGCGCAAG  112486

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | ||||| || || |||||  ||||||||||||| || ||||||   || ||||| || |
Sbjct  112485  CGTACATTGAAATCGACTCGTTGTTCGACGGCATTGATTTCAACAGCACGATCACCCGCG  112426

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               | |||||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||
Sbjct  112425  CGCGTTTCGAAGACATGTGCGGTGACTACTTCCGCAAGACGATGGAGCCTGTGGAGAAGG  112366

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               || |||||||| | ||| |||| |||||||| |||||||| |||||||| |||||||| |
Sbjct  112365  TGTTGCGCGACTCGAAGTTGTCCAAGAGCCAAGTGCACGAAGTGGTGCTTGTGGGCGGGT  112306

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACG-GCAAGGAGCCC  999
               |||| |||||||| |||||||| ||| || |||| ||||| ||| | | |||||||||| 
Sbjct  112305  CGACCCGTATCCCCAAGGTGCAACAGTTGTTGTCTGACTTTTTCCAGGAGCAAGGAGCCG  112246

Query  1000    AACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATC  1059
                  ||||| |||||||| ||||| || |||                 ||| || || |||
Sbjct  112245  TGTAAGTCGATCAACCCCGACGAAGCCGTG-----------------GCAAGCCGCGATC  112203

Query  1060    CTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCG  1119
                ||   |||||||||   ||||||||| |||| ||| || |  |||||||||||||||||
Sbjct  112202  TTGTCGGGCAACGACAGCTCGGAGAAGTTGCAAGACTTGTTGTTGCTGGACGTGACGCCG  112143

Query  1120    CTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACG  1179
                |||  ||     | || |||||||| ||||| ||| |||||||||||  ||| ||||||
Sbjct  112142  TTGTTGCTCACGTTGGAAACGGCCGGCGGTGTGATGGCGACGCTGATCCAGCGCAACACG  112083

Query  1180    ACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTG  1239
               ||||||||||| |||||||| |||||||| ||||||| |||  |||||||| | || |||
Sbjct  112082  ACGGTGCCGACGAAGAAGTCACAGACGTTTTCGACGTGCGCGAACAACCAGTCGGGTGTG  112023

Query  1240    CTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAG  1299
               || ||||| ||||| || ||||||||||| |||||||||||||||||| || ||||||||
Sbjct  112022  CTGATCCAAGTGTTTGAAGGCGAGCGCTCGATGACGCGCGACAACAACTTGTTGGGCAAG  111963

Query  1300    TT----CAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGAC  1355
               ||         ||||||| ||||| |||||||| ||||| ||||||||  | ||||||||
Sbjct  111962  TTTTCGTTGGTTGGACGGGATCCCGCCCATGCCCCGCGGCGTGCCGCACGTGGACGTGAC  111903

Query  1356    GTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAA  1415
               ||||||||| ||||||||||| ||| |||||||||| ||  | || ||||| ||||||||
Sbjct  111902  GTTCGACATTGACGCGAACGGGATCTTGAACGTGTCTGCGATCGAAAAGTCGACGGGCAA  111843

Query  1416    GGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCG  1475
               |||||||||||| |||||||||||||||||||| ||| |     |||  |||||||| ||
Sbjct  111842  GGAGAACAAGATTACGATCACGAACGACAAGGGTCGCTTGAGCAAGGACGACATTGAGCG  111783

Query  1476    CATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGA  1535
               ||||||    || || || |||||||||||||||||||| || ||||||   ||||||||
Sbjct  111782  CATGGTGCAAGAAGCGGAAAAGTACAAGTCGGAGGACGAAGCCAACAAGTTGCGCATCGA  111723

Query  1536    GGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAA  1595
                |||||||||| |||||| |||||||| ||||  ||||| ||||  || || ||||||||
Sbjct  111722  AGCCAAGAACGGGCTGGAAAACTACGCGTACAACCTGCGCAACACGCTCAACGACGAGAA  111663

Query  1596    GATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGT  1655
               | |  |||  ||| |    ||||| ||||||||||  ||||||||||||||||||||   
Sbjct  111662  GCTCCAGGGCAAGTTGGACGAAGCGGACAAGAAGGTCGTGGACGACAAGGTGACGGAGAC  111603

Query  1656    GATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAA  1715
               |||| | ||||||||||| ||||| ||    |||||||| | ||||||  | ||||| ||
Sbjct  111602  GATCAACTGGCTGGACGCGAACCAATCGGCCGAGAAGGAGGAGTACGAAGCCAAGCAAAA  111543

Query  1716    GGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTC  1775
               |||  | || ||||||||||||||  |  |||| ||| ||||||| ||||  |||||  |
Sbjct  111542  GGAGCTCGAAGGCGTGGCCAACCCGATCATGCAAAAGCTGTACGCGGCTGGCGGCGGCGC  111483

Query  1776    CCCTGG  1781
               ||| ||
Sbjct  111482  CCCCGG  111477

 Score = 422 bits (467),  Expect = 3e-115
 Identities = 313/366 (86%), Gaps = 0/366 (0%)
 Strand=Plus/Minus

Query  31      GTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTG  90
               ||||| ||||| |||||||| ||||| || |||||||| |||||||||||||||||||||
Sbjct  113305  GTCGGTATCGATCTCGGCACGACCTATTCCTGCGTGGGTGTGTGGCAGAACGACCGTGTG  113246

Query  91      GAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGAC  150
               |||||||| ||||||||||| || |||||||| ||||| || ||||| || ||||| || 
Sbjct  113245  GAAATCATTGCCAACGACCAAGGTAACCGCACGACCCCTTCGTACGTGGCGTTCACGGAT  113186

Query  151     TCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACG  210
                  || ||| | |||||||||||||||||||| || ||||| |||||| ||  |||||||
Sbjct  113185  AGCGAGCGCTTGATCGGTGACGCCGCCAAGAACCAAGTGGCGATGAACCCGACCAACACG  113126

Query  211     GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
               |||||||||||||| ||| |||||||||||||||||   ||| | ||  |||| ||||||
Sbjct  113125  GTGTTCGACGCCAAGCGTTTGATCGGCCGCAAGTTCAACGACTCTGTGATCCAAGCCGAC  113066

Query  271     ATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTG  330
               |||||||||||||||||| | |||||| |||| ||||| ||||||||||| |||||||| 
Sbjct  113065  ATCAAGCACTGGCCGTTCAAGGTGACGCCGGGTGCCGGCGACAAGCCGCAAATCACGGTC  113006

Query  331     CAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGATC  390
                |||||||||||||  ||||||||||||| ||||| || |||||||| |||||| |||||
Sbjct  113005  GAGTTCAAGGGCGAAACCAAGACGTTCCAGCCCGAAGAAATCTCGTCGATGGTGTTGATC  112946

Query  391     AAGATG  396
               ||||||
Sbjct  112945  AAGATG  112940

 Score = 408 bits (452),  Expect = 2e-111
 Identities = 310/366 (85%), Gaps = 0/366 (0%)
 Strand=Plus/Plus

Query  31     GTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTG  90
              ||||| ||||| |||||||| ||||| || |||||||| || |||||||| ||||| |||
Sbjct  91144  GTCGGTATCGATCTCGGCACGACCTATTCCTGCGTGGGTGTATGGCAGAATGACCGCGTG  91203

Query  91     GAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGAC  150
              |||||||| ||||||||||| || |||||||| ||||| || ||||| || ||||| |||
Sbjct  91204  GAAATCATTGCCAACGACCAAGGTAACCGCACGACCCCTTCGTACGTGGCATTCACGGAC  91263

Query  151    TCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACG  210
                 || ||| | |||||||||||||||||||| || ||||| |||||| ||  |||||||
Sbjct  91264  AGCGAGCGCTTGATCGGTGACGCCGCCAAGAACCAAGTGGCGATGAACCCGACCAACACG  91323

Query  211    GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
              |||||||||||||| ||| |||||||||||||||||   ||||| ||  |||| ||||||
Sbjct  91324  GTGTTCGACGCCAAGCGTTTGATCGGCCGCAAGTTCAACGACCCTGTGATCCAAGCCGAC  91383

Query  271    ATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTG  330
              |||||||||||||||||| | |||||| | ||  |||| ||||||||||| |||||||| 
Sbjct  91384  ATCAAGCACTGGCCGTTCAAGGTGACGCCAGGTTCCGGCGACAAGCCGCAAATCACGGTC  91443

Query  331    CAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGATC  390
               |||||||||||||  ||||||||||||| ||||| || |||||||| |||||| |||||
Sbjct  91444  GAGTTCAAGGGCGAAACCAAGACGTTCCAGCCCGAAGAAATCTCGTCGATGGTGTTGATC  91503

Query  391    AAGATG  396
              ||||||
Sbjct  91504  AAGATG  91509

>SADI:scaffold_42 supercont1.42 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.42:1:532351:1 
REF
Length=532351

 Score = 1393 bits (1544),  Expect = 0.0
 Identities = 1129/1362 (83%), Gaps = 10/1362 (1%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              ||||||| || ||||||||||| |||||||||||||| |||||||||||||||||||| |
Sbjct  92053  AGGACGCTGGTGCCATTGCCGGTCTCAACGTGCTGCGCATCATCAACGAGCCGACGGCGG  92112

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              | |||||||||||||| || ||||||||||||||||||||||||||||| ||||| ||||
Sbjct  92113  CGGCCATCGCGTACGGTCTCGACAAGAAGGGCGGCGAGCGCAACGTGCTCATCTTTGACC  92172

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              | |||||||||||||| || ||||| ||| || |||| ||||| |||||||| |||||||
Sbjct  92173  TTGGCGGCGGCACCTTTGACGTGTCGCTCTTGACCATCGAGGAAGGCATCTTTGAGGTCA  92232

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
              |||| || || || ||||||||||| || || || ||||| ||||||||||| |||||||
Sbjct  92233  AGGCGACAGCCGGCGACACGCACCTCGGCGGCGAAGACTTTGACAACCGCCTCGTGGACC  92292

Query  641    ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
              ||||||||   ||||| ||||||||||||||||||||||| ||| ||||||||||||| |
Sbjct  92293  ACTTCACGGCCGAGTTTAAGCGCAAGCACCGCAAGGACATGACGCAGAACCAGCGTGCGC  92352

Query  701    TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
              | || |||||||| |||||||||||||| |||||||| ||||||||||||||||| ||||
Sbjct  92353  TGCGCCGTCTGCGCACGGCCTGCGAGCGCGCCAAGCGGACGCTGTCGTCGTCGGCGCAGG  92412

Query  761    CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
              | ||||| || || ||||| || || |||||| |||||||||||||||||||||| || |
Sbjct  92413  CCTACATTGAAATCGACTCGCTCTTTGACGGCGTCGACTTCAACTCGACCATCACGCGCG  92472

Query  821    CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
              | || || |||||  | |||| |||||||||||||||||||||||| || || |||||||
Sbjct  92473  CGCGCTTTGAGGATCTCTGCGCCGACTACTTCCGCAAGACGATGGAACCGGTCGAGAAGG  92532

Query  881    TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
              ||||    ||||||||||| || |||  |||||| ||||| || || || || |||||||
Sbjct  92533  TGCTCAAGGACGCCAAGCTTTCCAAGTCCCAGGTCCACGAAGTCGTCCTCGTCGGCGGCT  92592

Query  941    CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
              ||||||| ||||| |||||||||||||| || || || || |||||||||||||| ||  
Sbjct  92593  CGACGCGCATCCCCAAGGTGCAGCAGCTCCTCTCTGAGTTTTTCAACGGCAAGGAACCGT  92652

Query  1001   ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
               |||||| |||||||||||||| || |||||||  || ||||| |||||||| || || |
Sbjct  92653  GCAAGTCGATCAACCCGGACGAAGCCGTGGCGTTTGGCGCGACTGTGCAGGCCGCGATTC  92712

Query  1061   TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
              | |||||| ||  |  |||||  ||||||||||||||  |  |||| |||||| ||||||
Sbjct  92713  TCAGCGGCGACACCCAGTCGGCCAAGCTGCAGGACCTTTTGTTGCTCGACGTGGCGCCGC  92772

Query  1121   TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
              | || || || |||||||||||||| ||||||||||||||||| || ||||| |||||||
Sbjct  92773  TCTCGCTCGGCCTCGAGACGGCCGGCGGTGTCATGACGACGCTCATTGCGCGCAACACGA  92832

Query  1181   CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
              ||||||| || ||||||||||||||||| ||||||||||||||||||||||| || ||||
Sbjct  92833  CGGTGCCCACGAAGAAGTCGCAGACGTTTTCGACGTACGCCGACAACCAGCCCGGCGTGC  92892

Query  1241   TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
              |||||||||||| |||||||||||||  |||||||  ||||||| |||| || |||||||
Sbjct  92893  TCATCCAGGTGTACGAGGGCGAGCGCAGCATGACGGCCGACAACCACCTCCTCGGCAAGT  92952

Query  1301   TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
              | | ||| || |||||||| || ||||| |||||||| |||||| | ||||||||||| |
Sbjct  92953  TTAGCCTCGATGGCATCCCGCCGATGCCGCGCGGTGTACCGCAGGTGGACGTGACGTTTG  93012

Query  1361   ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
              |||| ||||| ||||||||||| ||||| ||||| || || ||||| ||||||||||| |
Sbjct  93013  ACATTGACGCCAACGGCATCCTCAACGTCTCGGCGGTCGAAAAGTCGACGGGCAAGGAAA  93072

Query  1421   ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
              ||||||| |||||||||||||||||||||||||||||  |||  ||||||||||||||||
Sbjct  93073  ACAAGATTACGATCACGAACGACAAGGGCCGCCTCTCCAAGGACGACATTGACCGCATGG  93132

Query  1481   TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
              |    |||||||||||||||||| |  ||||||| ||  |||||   ||| |||||||||
Sbjct  93133  TGCAAGAGGCCGAGAAGTACAAGGCCCAGGACGAAGCCCACAAGGTGCGCGTCGAGGCCA  93192

Query  1541   AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
              |||||||||| ||||||||||| ||||| || || ||||  || || |||||       |
Sbjct  93193  AGAACGCGCTCGAGAACTACGCGTACAGCCTCCGCAACACGCTCAACGACGA------AA  93246

Query  1601   AGGAGAAGATC-CCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATC  1659
              |||  ||||||  ||  | | |||||||||    ||||||||| |||| ||||   ||||
Sbjct  93247  AGGTCAAGATCGACGTGAAC-GACAAGAAGCGTCTGGACGACATGGTGTCGGACACGATC  93305

Query  1660   CAGTGGCTGGACGCAAACCAGTCA-TTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGA  1718
               | ||||| ||| || | ||  ||   ||||||||| | ||  ||  | |||||||||||
Sbjct  93306  AACTGGCTCGAC-CACAACACGCACGCGGAGAAGGAGGAGTTTGAAGCCAAGCAGAAGGA  93364

Query  1719   ATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGC  1760
                | ||||  || ||||||||  |  |||| |||||||||||
Sbjct  93365  GCTCGAGGCAGTCGCCAACCCCATTATGCAAAAGATGTACGC  93406

 Score = 446 bits (494),  Expect = 8e-123
 Identities = 319/367 (87%), Gaps = 0/367 (0%)
 Strand=Plus/Plus

Query  30     CGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGT  89
              ||| ||||| ||||||||||| || ||||||||||| |||||||||||||||||||| ||
Sbjct  91592  CGTGGGCATTGACCTCGGCACGACGTACTCGTGCGTCGGCGTGTGGCAGAACGACCGCGT  91651

Query  90     GGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGA  149
               |||||||||||||||||||| ||||||||||| || ||||| ||||| || ||||| ||
Sbjct  91652  CGAAATCATCGCCAACGACCAAGGCAACCGCACGACGCCGTCGTACGTGGCGTTCACCGA  91711

Query  150    CTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACAC  209
              | |||| |||||||| |||||||| |||||||| || |||||||||||||||  ||||||
Sbjct  91712  CACGGAGCGCCTCATTGGTGACGCGGCCAAGAACCAAGTGGCCATGAACGCGACCAACAC  91771

Query  210    GGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGA  269
              |||||| |||||||| || || ||||| |||||||||   ||  | || ||||| |||||
Sbjct  91772  GGTGTTTGACGCCAAGCGCCTCATCGGGCGCAAGTTCCACGATGCGGTTGTCCAAGCCGA  91831

Query  270    CATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGT  329
              ||||||||||||||| ||| | ||||||||||||||||  ||||||||||||||||| ||
Sbjct  91832  CATCAAGCACTGGCCCTTCAAGGTGACGTCGGGCGCCGCGGACAAGCCGCAGATCACAGT  91891

Query  330    GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGAT  389
               ||||||||||||||||||||||||||||| ||||| ||||| |||||||||||  ||||
Sbjct  91892  TCAGTTCAAGGGCGAGTCCAAGACGTTCCAGCCCGAAGAGATTTCGTCCATGGTCTTGAT  91951

Query  390    CAAGATG  396
              ||| |||
Sbjct  91952  CAAAATG  91958

 Score = 40.1 bits (43),  Expect = 3.9
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  1852   CAGGGCCCGAAGATCGAGGAGGTCGACTA  1880
              || ||||| | ||||||||||||||||||
Sbjct  93456  CACGGCCCAACGATCGAGGAGGTCGACTA  93484

>SAPA:scaffold_1 supercont2.1 dna:supercontig supercontig:ASM15154v2:supercont2.1:1:1615555:1 
REF
Length=1615555

 Score = 1369 bits (1517),  Expect = 0.0
 Identities = 1124/1368 (82%), Gaps = 6/1368 (0%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| ||||| ||||| |||||||||||||| ||||| |||||||||||||||||||| |
Sbjct  203328  AGGATGCCGGTGCCATCGCCGGCCTCAACGTCCTGCGCATCATCAACGAGCCGACGGCGG  203269

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               | |||||||||||||| || ||||||||||||||||||||||||||||| ||||| ||||
Sbjct  203268  CGGCCATCGCGTACGGTCTCGACAAGAAGGGCGGCGAGCGCAACGTGCTCATCTTTGACC  203209

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               | |||||||||||||| || ||||| ||| || |||| ||||| |||||||| |||||||
Sbjct  203208  TTGGCGGCGGCACCTTTGACGTGTCGCTCTTGACCATCGAGGAAGGCATCTTTGAGGTCA  203149

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               |||| || || || ||||||||||| ||||| || ||||| |||||||| || |||||||
Sbjct  203148  AGGCGACGGCCGGCGACACGCACCTCGGTGGCGAAGACTTTGACAACCGGCTCGTGGACC  203089

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||||||   ||||||||||||||||||||||||||||| ||| ||||||||||||| |
Sbjct  203088  ACTTCACGGCCGAGTTCAAGCGCAAGCACCGCAAGGACATGACGCAGAACCAGCGTGCGC  203029

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               | || |||||||| || ||||||||||| |||||||| ||||||||| ||||||| ||||
Sbjct  203028  TGCGCCGTCTGCGCACCGCCTGCGAGCGCGCCAAGCGGACGCTGTCGGCGTCGGCACAGG  202969

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | ||||| || || ||||| || || |||||| |||||||||||||||||||||| || |
Sbjct  202968  CCTACATTGAAATCGACTCGCTCTTTGACGGCGTCGACTTCAACTCGACCATCACGCGCG  202909

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               | || || |||||| | |||| |||||||||||||||||||||||| || || |||||||
Sbjct  202908  CGCGCTTTGAGGACCTCTGCGCCGACTACTTCCGCAAGACGATGGACCCGGTCGAGAAGG  202849

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               ||||    ||||||||||| || |||  |||||| ||||| || || || || || ||||
Sbjct  202848  TGCTCAAGGACGCCAAGCTCTCCAAGTCCCAGGTCCACGAAGTCGTCCTTGTCGGTGGCT  202789

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               ||||||| ||||| |||||||||||||| || || || || ||||| |||||||| ||  
Sbjct  202788  CGACGCGCATCCCCAAGGTGCAGCAGCTCCTCTCTGAGTTTTTCAATGGCAAGGAACCGT  202729

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                |||||| |||||||||||||| || || ||||  || |||||||| ||||| || ||||
Sbjct  202728  GCAAGTCGATCAACCCGGACGAAGCCGTTGCGTTTGGCGCGACCGTCCAGGCCGCGATCC  202669

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               | |||||  || ||  |||||  ||||||||||||||  | ||||| |||||| ||||||
Sbjct  202668  TCAGCGGTGACAACCAGTCGGCCAAGCTGCAGGACCTTTTGCTGCTCGACGTGGCGCCGC  202609

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
               | || || || ||||||||||| || || |||||||||||||| || ||||| |||||||
Sbjct  202608  TCTCGCTCGGCCTCGAGACGGCTGGCGGCGTCATGACGACGCTCATTGCGCGCAACACGA  202549

Query  1181    CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
               ||||||| || ||||||||||||||||| ||||||||||||||||||||||| || ||||
Sbjct  202548  CGGTGCCCACGAAGAAGTCGCAGACGTTTTCGACGTACGCCGACAACCAGCCCGGCGTGC  202489

Query  1241    TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
               |||||||||||| |||||||||||||  |||||||   ||||||||||| || |||||||
Sbjct  202488  TCATCCAGGTGTACGAGGGCGAGCGCAGCATGACGGCGGACAACAACCTCCTCGGCAAGT  202429

Query  1301    TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
               | | ||| || |||||||| || ||||| ||||||||||||||| | ||||||||||| |
Sbjct  202428  TTAGCCTCGATGGCATCCCGCCGATGCCGCGCGGTGTGCCGCAGGTGGACGTGACGTTTG  202369

Query  1361    ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
               |||| ||||| ||||||||||| ||||| ||||| || || ||||| || ||||||||||
Sbjct  202368  ACATTGACGCCAACGGCATCCTCAACGTCTCGGCGGTCGAAAAGTCGACCGGCAAGGAGA  202309

Query  1421    ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
               ||||||| |||||||||||||||||||||||||||||  |||  |||||||| |||||||
Sbjct  202308  ACAAGATTACGATCACGAACGACAAGGGCCGCCTCTCCAAGGACGACATTGATCGCATGG  202249

Query  1481    TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
               |    |||||||||||||||||| |  ||||||||||  |||||   ||| |||||||||
Sbjct  202248  TGCAAGAGGCCGAGAAGTACAAGGCCCAGGACGAGGCCCACAAGGTGCGCGTCGAGGCCA  202189

Query  1541    AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
               |||||||||| || |||||||| ||||  || || ||||  || || |||||       |
Sbjct  202188  AGAACGCGCTCGAAAACTACGCGTACAACCTCCGCAACACGCTCAACGACGA------AA  202135

Query  1601    AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
               |||  ||||||   |  |  |||||||||    ||||||||| |||||||||   |||| 
Sbjct  202134  AGGTCAAGATCGACGCGGACGACAAGAAGCGTCTGGACGACATGGTGACGGACACGATCA  202075

Query  1661    AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
               | ||||| |||   |||  |     ||||||||| | ||  ||    |||||||||||  
Sbjct  202074  ACTGGCTCGACCACAACTCGCACGCGGAGAAGGAGGAGTTTGAAGGCAAGCAGAAGGAGC  202015

Query  1721    TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTG  1768
               | ||||  ||||| |||||  |  |||| ||||||||||| | || ||
Sbjct  202014  TCGAGGCGGTGGCTAACCCCATCATGCAAAAGATGTACGCCGGTGGTG  201967

 Score = 519 bits (575),  Expect = 2e-144
 Identities = 838/1189 (70%), Gaps = 42/1189 (4%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| |||||  |||||||||||||||  || | ||| |||||||| ||||||||||| |
Sbjct  846456  AGGATGCCGGTACCATTGCCGGCCTCACGGTCCAGCGCATCATCAATGAGCCGACGGCTG  846397

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGC------AACGTGCTGATCT  514
               ||||||| || |||||  | || || |||  || | || |       ||||||||  |||
Sbjct  846396  CCGCCATTGCCTACGGTATCGATAAAAAGAACGCCAAGGGTGAGAAGAACGTGCTCGTCT  846337

Query  515     TCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCG  574
               |||| || ||||| || ||||| |||||  | |||||  | || || |  ||| ||||||
Sbjct  846336  TCGATCTCGGCGGTGGTACCTTTGATGTCACGCTCCTCACGATCGACGGTGGCGTCTTCG  846277

Query  575     AGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGG  634
               |||||    | ||    ||||||||||| || || ||||| ||||||||| | ||| |  
Sbjct  846276  AGGTCCTCTCGACCAACGGTGACACGCATCTCGGCGGTGAAGACTTCGACCAGCGCGTCA  846217

Query  635     TGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAG---GACATCA---CGGAGA  688
               || |   |||||   || |||   ||   |||||    |||   |||||||   |||| |
Sbjct  846216  TGCAGTTCTTCATCAAGAAGTGGCAG---AAGCAGAAGAAGATTGACATCAGCTCGGACA  846160

Query  689     ACCAGCGTGCTCTT----CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTG  744
               | | ||| ||||      | ||| | ||| |  |||   ||||||| ||||||  | || 
Sbjct  846159  AGC-GCGCGCTCCAGAAGCTTCGCC-GCGAA--GCC---GAGCGTGTCAAGCGCGCCCTC  846107

Query  745     TCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAAC  804
               ||| ||  | | |||||   | |||| || || || ||  | ||||||   |||||  ||
Sbjct  846106  TCGACGCAGCCCCAGGCGCGCCTCGAAATCGAGTCGCTCCTTGACGGCGAGGACTTTGAC  846047

Query  805     TCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATG  864
                 |||  |||| || ||||| ||||| ||  |   |  ||||  ||||   |||||| | 
Sbjct  846046  GAGACGCTCACGCGCGCTCGCTTCGAAGAACTTAACAACGACCTCTTCAAGAAGACGCTC  845987

Query  865     GAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTG  924
               | |||||| ||||||||  ||   ||||||   ||   ||||    ||||  ||||| | 
Sbjct  845986  G-GCCCGTCGAGAAGGTCATGAAGGACGCCGGCCTCAAGAAGTCGGAGGTCGACGAGATT  845928

Query  925     GTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTC  984
               ||||| || |||||||||||||| || || ||| | ||||||||  |   ||| ||||||
Sbjct  845927  GTGCTTGTCGGCGGCTCGACGCGCATTCCCAAGATCCAGCAGCTCATCAAGGATTTCTTC  845868

Query  985     AACGGCAAGGAGCC--CAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGA  1042
               ||||||||||||||  |     ||  |||||||| ||||||||||| || ||||| ||  
Sbjct  845867  AACGGCAAGGAGCCGTCGCGCGGT--ATCAACCCCGACGAGGCTGTCGCCTACGGCGCTG  845810

Query  1043    CCGTGCAGGCGGCCATCCTGAGCGG---CAACGACTCGTCGGAGAAGCTGCAGGACCTGC  1099
               |||| ||||  |  || ||   |||   |||||||  | |||   | |   ||||| |  
Sbjct  845809  CCGTCCAGGGTGGTATTCTCGCCGGTGTCAACGAC--GACGGG--ACCA--AGGACATTT  845756

Query  1100    TTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGA  1159
               | || || || ||  | ||||| || || ||| | ||||||| ||| ||||||||||| |
Sbjct  845755  TGCTCCTCGATGTCGCCCCGCTCTCGCTCGGTATTGAGACGGTCGGCGGTGTCATGACCA  845696

Query  1160    CGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACG  1219
                | | |||   || ||||||   ||||| || ||||||||||||||||||||||||||| 
Sbjct  845695  AGATCATCAACCGCAACACGGTCGTGCCCACGAAGAAGTCGCAGACGTTCTCGACGTACC  845636

Query  1220    CCGACAACCAGCCTGGGGTGCTC-ATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGC  1278
                 ||||||||||| |  || ||| |||||||| | ||| ||||||||| | ||||||   
Sbjct  845635  AGGACAACCAGCCCGCCGT-CTCGATCCAGGTCTACGAAGGCGAGCGCACGATGACGAAG  845577

Query  1279    GACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTG  1338
               |||||| || |||| ||||||||  | ||    |||||||| ||   ||| || || |||
Sbjct  845576  GACAACCACATGCTCGGCAAGTTTGAGCTCACGGGCATCCCGCCGGCGCCGCGTGGCGTG  845517

Query  1339    CCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTG  1398
               |||||||| || || ||||||||  |||| || ||||| |||||  | || ||||| | |
Sbjct  845516  CCGCAGATTGAAGTCACGTTCGAGGTCGATGCCAACGGTATCCTCCAGGTCTCGGCCGAG  845457

Query  1399    GAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCG  1458
               || |||   ||||||||||   | |||||||||||||||  ||| ||||| |||||||||
Sbjct  845456  GACAAGGGCACGGGCAAGGCCGAGAAGATCACGATCACGGCCGAGAAGGGTCGCCTCTCG  845397

Query  1459    CAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCT  1518
               ||||  || ||||||||||||||   ||| |||||| || ||     ||| ||| ||   
Sbjct  845396  CAGGAGGAGATTGACCGCATGGTCCAGGAAGCCGAGGAGAACGCCGAGGAAGACAAGAAG  845337

Query  1519    AACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACA  1567
               | |||| | ||||| || | |   ||| |||| ||   ||||  |||||
Sbjct  845336  ATCAAGGACCGCATTGACGGCCGCAACTCGCTCGAAGGCTACCTCTACA  845288

 Score = 446 bits (494),  Expect = 8e-123
 Identities = 319/367 (87%), Gaps = 0/367 (0%)
 Strand=Plus/Minus

Query  30      CGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGT  89
               ||| ||||||||||||||||| || ||||||||||| |||||||||||||||||||| ||
Sbjct  203789  CGTGGGCATCGACCTCGGCACGACGTACTCGTGCGTCGGCGTGTGGCAGAACGACCGCGT  203730

Query  90      GGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGA  149
                |||||||||||||||||||| ||||||||||| || ||||| ||||| |||||||| ||
Sbjct  203729  CGAAATCATCGCCAACGACCAAGGCAACCGCACGACGCCGTCGTACGTGGCCTTCACCGA  203670

Query  150     CTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACAC  209
               |   || ||||||||||| ||||| |||||||| || |||||||||||||||  ||||||
Sbjct  203669  CAACGAGCGCCTCATCGGCGACGCGGCCAAGAACCAAGTGGCCATGAACGCGGCCAACAC  203610

Query  210     GGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGA  269
                ||||| |||||||| || || ||||| |||||||||   ||| | |||||||| |||||
Sbjct  203609  AGTGTTTGACGCCAAGCGCCTCATCGGACGCAAGTTCCACGACGCGGTCGTCCAAGCCGA  203550

Query  270     CATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGT  329
               ||||||||||||||| ||| | |||||| |||||||||  ||||||||||||||||||||
Sbjct  203549  CATCAAGCACTGGCCCTTCAAGGTGACGCCGGGCGCCGCGGACAAGCCGCAGATCACGGT  203490

Query  330     GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGAT  389
                 |||||||||| ||||||||||||||||| ||||| ||||| |||||||||||  ||||
Sbjct  203489  CGAGTTCAAGGGTGAGTCCAAGACGTTCCAGCCCGAAGAGATTTCGTCCATGGTCTTGAT  203430

Query  390     CAAGATG  396
               |||||||
Sbjct  203429  CAAGATG  203423

 Score = 153 bits (169),  Expect = 2e-34
 Identities = 259/370 (70%), Gaps = 14/370 (4%)
 Strand=Plus/Minus

Query  34      GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
               ||||| ||| | ||||| |||||||||||||| |||   |     |||| |   || || 
Sbjct  846913  GGCATTGACTTGGGCACGACCTACTCGTGCGTCGGCCACTACGCCAACGGCAAGGTCGAG  846854

Query  94      ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
               ||||||||||||||||| |||||||||| ||| ||||| ||||| || |     ||||||
Sbjct  846853  ATCATCGCCAACGACCAAGGCAACCGCATCACGCCGTCGTACGTGGCAT---GGGACTCG  846797

Query  154     ------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAAC  207
                     || |||||||| || |||| ||||||||| |||| | | || ||| || | |||
Sbjct  846796  AACGACGAGCGCCTCATTGGCGACGGCGCCAAGAACCAGGCGACGATCAACCCGGAGAAC  846737

Query  208     ACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTC-GTCCAGGC  266
               ||| | || |||| ||| || || || || ||| ||| |   || |  ||| || |||||
Sbjct  846736  ACGCTCTTTGACGTCAAGCGCCTCATTGGTCGCCAGTACAACGA-CAAGTCGGTGCAGGC  846678

Query  267     CGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCAC  326
               |||||  ||||     |||||| |  |  | ||   |   |  | |   ||| | |||  
Sbjct  846677  CGACAAGAAGCTGCTTCCGTTCGAGAT--CATC-AACAAGGAAGGCCGCCCGTACATCCA  846621

Query  327     GGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
               |||  || ||||||||||| |||||||||||    |||| ||| ||||| ||||| | ||
Sbjct  846620  GGTCAAGGTCAAGGGCGAGACCAAGACGTTCTCGGCCGAAGAGGTCTCGGCCATGATCCT  846561

Query  387     GATCAAGATG  396
                | |||||||
Sbjct  846560  CACCAAGATG  846551

 Score = 46.4 bits (50),  Expect = 0.026
 Identities = 28/30 (93%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  1852    CAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
               || ||||||| |||||||||||||||||||
Sbjct  201907  CAAGGCCCGACGATCGAGGAGGTCGACTAA  201878

 Score = 39.2 bits (42),  Expect = 3.9
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  1691    AGGATGCGTACGAGTCGAAGC  1711
               |||||||||||||||||||||
Sbjct  436650  AGGATGCGTACGAGTCGAAGC  436630

>PYIR:scaffold_120 pir_scaffold_120 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_120:1:52041:1 
REF
Length=52041

 Score = 1353 bits (1500),  Expect = 0.0
 Identities = 1096/1324 (83%), Gaps = 17/1324 (1%)
 Strand=Plus/Minus

Query  562    GAGGGCATCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTC  621
              ||||||||||||||||||||||| || ||||||||||| ||| |||| ||||||||||| 
Sbjct  38774  GAGGGCATCTTCGAGGTCAAGGCGACCGCTGGTGACACTCACTTGGGCGGTGAGGACTTT  38715

Query  622    GACAACCGCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATC  681
              |||||||| || ||||||||||||  |   ||||||||||||||||||||||||||||||
Sbjct  38714  GACAACCGTCTCGTGGACCACTTCGTGGGCGAGTTCAAGCGCAAGCACCGCAAGGACATC  38655

Query  682    ACGGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACG  741
              ||    |||||||| || || ||||||||||| || || || || ||||| ||||| |||
Sbjct  38654  ACCTCCAACCAGCGCGCGCTCCGTCGTCTGCGTACCGCGTGTGAACGTGCTAAGCGCACG  38595

Query  742    CTGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTC  801
              |||||||||||||| ||||| ||||| || |||||||| |||||||||||  ||||||||
Sbjct  38594  CTGTCGTCGTCGGCGCAGGCGTACATTGAAATTGACTCGCTGTTCGACGGTGTCGACTTC  38535

Query  802    AACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACG  861
              |||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||| 
Sbjct  38534  AACTCGACCATCACGCGTGCCCGTTTCGAGGACATGTGCGGTGACTACTTCCGCAAGACC  38475

Query  862    ATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAG  921
              ||||| || || ||||||||||| || ||| | ||||| |||||||||||||||||||| 
Sbjct  38474  ATGGACCCAGTCGAGAAGGTGCTTCGTGACTCGAAGCTCTCGAAGAGCCAGGTGCACGAA  38415

Query  922    GTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTC  981
              || || || || ||||||||||| |||||||| ||||||||||||||| |||||||||| 
Sbjct  38414  GTCGTCCTTGTCGGCGGCTCGACCCGTATCCCAAAGGTGCAGCAGCTGTTGTCGGACTTT  38355

Query  982    TTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCG  1041
              |||||||||||||||||   |||| |||||||||| || ||||| || || | |||||||
Sbjct  38354  TTCAACGGCAAGGAGCCTTGCAAGGCCATCAACCCTGATGAGGCCGTTGCCTTCGGTGCG  38295

Query  1042   ACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTT  1101
              |||||||||||||| |||||    || ||||||  |||||||||||| |||||| |||| 
Sbjct  38294  ACCGTGCAGGCGGCTATCCTTTCGGGTAACGACCAGTCGGAGAAGCTCCAGGACTTGCTC  38235

Query  1102   CTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACG  1161
              ||  |||| ||||| || ||||| || ||||| ||||| ||||||||||| |||||||||
Sbjct  38234  CTTTTGGATGTGACTCCTCTGTCGCTCGGTCTGGAGACCGCCGGTGGTGTGATGACGACG  38175

Query  1162   CTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCC  1221
               ||||||| || |||||||| |||||||| |||||||||||||| |||||||| ||||| 
Sbjct  38174  TTGATCGCTCGTAACACGACCGTGCCGACGAAGAAGTCGCAGACCTTCTCGACCTACGCG  38115

Query  1222   GACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGAC  1281
              ||||||||||| || ||| | ||||||||||||||||| ||||| || ||||| ||||||
Sbjct  38114  GACAACCAGCCAGGTGTGTTGATCCAGGTGTTCGAGGGTGAGCGTTCGATGACCCGCGAC  38055

Query  1282   AACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCG  1341
              |||||| |||| |||||||||||| ||||||||||||| || |||||||| || ||||| 
Sbjct  38054  AACAACTTGCTCGGCAAGTTCAACTTGGACGGCATCCCGCCAATGCCTCGTGGCGTGCCA  37995

Query  1342   CAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAG  1401
              |||||||||||||| |||||||| ||||||||||| |||||||||||||| ||||| |||
Sbjct  37994  CAGATCGACGTGACCTTCGACATTGACGCGAACGGTATCCTGAACGTGTCTGCTGTCGAG  37935

Query  1402   AAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAG  1461
              ||||| || || ||||||||||||||||||||||||||||||||||| || || || |||
Sbjct  37934  AAGTCGACCGGTAAGGAGAACAAGATCACGATCACGAACGACAAGGGTCGTCTGTCCCAG  37875

Query  1462   GCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAAC  1521
              || |||||||||||||||||  |||| ||||||||||||||| | ||||||||| | |||
Sbjct  37874  GCCGACATTGACCGCATGGTTGCGGAAGCCGAGAAGTACAAGGCTGAGGACGAGTCGAAC  37815

Query  1522   AAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGT  1581
              |||   ||||| ||||| |||||||  || ||||||||||| ||||  ||||| ||||  
Sbjct  37814  AAGGTGCGCATTGAGGCGAAGAACGGTCTTGAGAACTACGCGTACAACCTGCGCAACACC  37755

Query  1582   CTGAATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGAC  1641
              ||  | ||||||||| |||||    ||||| |||| |  |||   |  ||| |  |||||
Sbjct  37754  CTCGACGACGAGAAGCTGAAGAGCCAGATCTCGGAGGAGGACCGCAGTGCGATTAACGAC  37695

Query  1642   AAGGTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTAC  1701
              |||||||||||    ||  | ||| ||||||| ||||||||   ||||||||| | || |
Sbjct  37694  AAGGTGACGGAGACCATTAACTGGTTGGACGCGAACCAGTCGGCGGAGAAGGAAGAGTTC  37635

Query  1702   GAGTCGAAGCAGAAGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCT  1761
              ||| | |||||||||||  | |||||| | ||||||||  |  |||||||||||||||||
Sbjct  37634  GAGGCCAAGCAGAAGGAGCTCGAGGGCATTGCCAACCCGATCCTGCAGAAGATGTACGCT  37575

Query  1762   GCTGCTGGCGGTTCCCCTGGTGCTGAGGGTGGTATGCCCGGTGGTGTGCC--GGGCGGCA  1819
              ||||| ||         ||||||    ||||| ||||| || || |  ||  | ||  ||
Sbjct  37574  GCTGCGGG---------TGGTGC---CGGTGGCATGCCAGGGGGCGCTCCAGGTGCTCCA  37527

Query  1820   --TGCCTGGTGCTCCCCCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGA  1877
                |||| |||||||| || || | ||  |  |||||||||||||||||||| || |||||
Sbjct  37526  GGTGCC-GGTGCTCCTCCAGCCGCTGGCGGCGACCAGGGCCCGAAGATCGAAGAAGTCGA  37468

Query  1878   CTAA  1881
              ||||
Sbjct  37467  CTAA  37464

 Score = 1172 bits (1299),  Expect = 0.0
 Identities = 1074/1365 (79%), Gaps = 27/1365 (2%)
 Strand=Plus/Minus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCC-  459
              |||||||||| | ||| |||||| | || |||||||||||||||||||||||        
Sbjct  30222  AGGACGCCGGAGTCATCGCCGGCTTGAATGTGCTGCGTATCATCAACGAGCCNNNNNNNN  30163

Query  460    ---GCCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTC  516
                 ||||| ||||| || || || ||||||||||| ||||||| ||| ||||| ||||| 
Sbjct  30162  NNGGCCGCGATCGCCTATGGGCTCGACAAGAAGGGTGGCGAGCACAATGTGCTTATCTTT  30103

Query  517    GACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAG  576
              ||||| ||||| ||||| ||||| ||||| || ||| | || || |||||||||||||||
Sbjct  30102  GACCTCGGCGGTGGCACGTTCGACGTGTCGCTGCTGACGATCGAAGAGGGCATCTTCGAG  30043

Query  577    GTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTG  636
              |||||||| ||||| || || || ||| |||| || |||||||| ||||||||||| || 
Sbjct  30042  GTCAAGGCGACTGCGGGCGATACCCACTTGGGCGGCGAGGACTTTGACAACCGCCTCGTC  29983

Query  637    GACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGT  696
              ||   |||||||   |||||||||||||||  |   |||||||| ||| ||||||| || 
Sbjct  29982  GAGTTCTTCACGGCCGAGTTCAAGCGCAAGTTCAAAAAGGACATGACGCAGAACCAACGC  29923

Query  697    GCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCT  756
               | || ||||| ||||| |||||||||||||| || ||||| ||||||||||||||||| 
Sbjct  29922  TCACTGCGTCGCCTGCGCACGGCCTGCGAGCGCGCGAAGCGCACGCTGTCGTCGTCGGCG  29863

Query  757    CAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACT  816
              ||||| || |||||||| ||||| |||||||| ||||| ||||||||    || ||||| 
Sbjct  29862  CAGGCGTATATCGAGATCGACTCGCTGTTCGATGGCATTGACTTCAATAGCACGATCACG  29803

Query  817    CGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAG  876
              || || || || || ||  ||||||  |||||||| |||||||| |||||||| || |||
Sbjct  29802  CGCGCGCGCTTTGAAGATCTGTGCGCAGACTACTTTCGCAAGACCATGGAGCCGGTCGAG  29743

Query  877    AAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGC  936
                 ||||| || ||||| ||||| |||||| |||||||| ||||| | ||||| || |||
Sbjct  29742  CGCGTGCTCCGTGACGCGAAGCTCTCGAAGCGCCAGGTGAACGAGATCGTGCTCGTTGGC  29683

Query  937    GGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAG  996
              ||||| ||||| ||||| |||||||||||| |||| |||||||| |||||||| ||||| 
Sbjct  29682  GGCTCAACGCGCATCCCCAAGGTGCAGCAGATGCTCTCGGACTTTTTCAACGGGAAGGAC  29623

Query  997    CCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCC  1056
              |   ||||||| |||||||||||||| || || ||||  || ||||||||||||||||| 
Sbjct  29622  CTGTACAAGTCGATCAACCCGGACGAAGCCGTCGCGTTTGGCGCGACCGTGCAGGCGGCG  29563

Query  1057   ATCCTGAGCGGCAACGACTCGTCGGAGAAG-CTGCAGGACCTGCTTCTGCTGGACGTGAC  1115
              |||||||| |||   ||   ||| |||  | ||||||||| |||| ||||| |||||| |
Sbjct  29562  ATCCTGAGTGGCGCGGATAAGTC-GAGTCGCCTGCAGGACTTGCTGCTGCTCGACGTGGC  29504

Query  1116   GCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAA  1175
              ||||||||| ||||| ||||||||||| || || || ||||||||||||||| ||     
Sbjct  29503  GCCGCTGTCGCTGGGGCTCGAGACGGCTGGCGGCGTGATGACGACGCTGATCCCG-----  29449

Query  1176   CACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGG  1235
                                        |||| |||||||| ||||| |||||||| || ||
Sbjct  29448  ----------------NNNNNNNNNNAGACCTTCTCGACCTACGCGGACAACCAACCCGG  29405

Query  1236   GGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGG  1295
               ||||| ||||| ||||| || ||||||||| | |||||||| |||||| ||  | ||||
Sbjct  29404  TGTGCTTATCCAAGTGTTTGAAGGCGAGCGCACGATGACGCGTGACAACCACTCGTTGGG  29345

Query  1296   CAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGAC  1355
              ||| |||||| ||||||||||||| || ||||| || || ||||| ||||||||||||||
Sbjct  29344  CAAATTCAACTTGGACGGCATCCCGCCAATGCCGCGTGGCGTGCCTCAGATCGACGTGAC  29285

Query  1356   GTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAA  1415
              ||| || |||||||||||||| || |||||||||||||| || |||||||| ||||||||
Sbjct  29284  GTTTGATATCGACGCGAACGGGATTCTGAACGTGTCGGCGGTCGAGAAGTCGACGGGCAA  29225

Query  1416   GGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCG  1475
              ||||||||||||||||||||||||||| |||||||| || |||||||  |||||||||||
Sbjct  29224  GGAGAACAAGATCACGATCACGAACGATAAGGGCCGTCTTTCGCAGGAGGACATTGACCG  29165

Query  1476   CATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGA  1535
              ||||||  | |||||||| |||||||||   |  ||||||   || ||||  ||  ||||
Sbjct  29164  CATGGTCGCCGAGGCCGAAAAGTACAAGGACGCCGACGAGCGCAATAAGCTTCGTGTCGA  29105

Query  1536   GGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAA  1595
              ||||||||||||||| ||||||||||| ||| | ||||| |||   ||  | || |||||
Sbjct  29104  GGCCAAGAACGCGCTTGAGAACTACGCGTACGGGCTGCGCAACTCGCTCCAGGAGGAGAA  29045

Query  1596   GATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGT  1655
              |||  ||| |||| || |||  |  |||||||||   |||||||||||| | || ||   
Sbjct  29044  GATCCAGGCGAAGCTCTCGGCGGACGACAAGAAGCGCGTGGACGACAAGATTACCGAGAC  28985

Query  1656   GATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAA  1715
              |||   ||||||||| || |||||| |    |||||||| | ||  ||  | ||||||||
Sbjct  28984  GATTGCGTGGCTGGATGCCAACCAGGCGGCCGAGAAGGAGGAGTTTGACGCCAAGCAGAA  28925

Query  1716   GGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGC  1760
              ||| |||||||| || || || ||  | |||||||||||||||||
Sbjct  28924  GGAGTTGGAGGGTGTCGCGAATCCGATCTTGCAGAAGATGTACGC  28880

 Score = 465 bits (515),  Expect = 3e-128
 Identities = 331/380 (87%), Gaps = 0/380 (0%)
 Strand=Plus/Minus

Query  22     GGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAAC  81
              ||| | |||||||| ||||| ||||| || |||||||||||||| |||||||||||||||
Sbjct  39357  GGACAATCCGTCGGTATCGATCTCGGTACGACCTACTCGTGCGTCGGCGTGTGGCAGAAC  39298

Query  82     GACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCC  141
              ||||| ||||| ||||| || ||||||||||| |||||||| |||||||| ||||| || 
Sbjct  39297  GACCGCGTGGAGATCATTGCGAACGACCAGGGTAACCGCACGACCCCGTCGTACGTGGCG  39238

Query  142    TTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCG  201
              ||||| ||| |||| || ||||||||||| ||||| ||||| ||||| || |||||||||
Sbjct  39237  TTCACGGACACGGAGCGTCTCATCGGTGATGCCGCGAAGAACCAGGTCGCGATGAACGCG  39178

Query  202    CACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTC  261
              |||||||| |||||||||||||| || |||||||| |||||||||||||||||  |||| 
Sbjct  39177  CACAACACTGTGTTCGACGCCAAGCGCCTGATCGGTCGCAAGTTCTCGGACCCGATCGTG  39118

Query  262    CAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAG  321
              ||||||||||| ||||||||||||||| | ||| || | |||||||| ||||||||||||
Sbjct  39117  CAGGCCGACATTAAGCACTGGCCGTTCAAGGTGTCGCCAGGCGCCGGCGACAAGCCGCAG  39058

Query  322    ATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATG  381
              || |||||| |||||||||||||| |||| |||||||| || || ||||||||||| |||
Sbjct  39057  ATTACGGTGGAGTTCAAGGGCGAGACCAAAACGTTCCAGCCAGAAGAGATCTCGTCGATG  38998

Query  382    GTGCTGATCAAGATGCGCGA  401
              ||||| ||||||||||| ||
Sbjct  38997  GTGCTTATCAAGATGCGTGA  38978

 Score = 457 bits (506),  Expect = 4e-126
 Identities = 322/368 (88%), Gaps = 0/368 (0%)
 Strand=Plus/Minus

Query  29     CCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTG  88
              ||||||| ||||| ||||| || |||||||||||||| |||||||||||||||||||| |
Sbjct  30684  CCGTCGGTATCGATCTCGGTACGACCTACTCGTGCGTCGGCGTGTGGCAGAACGACCGCG  30625

Query  89     TGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAG  148
              |||| ||||| || ||||||||||| |||||||| |||||||| ||||| || ||||| |
Sbjct  30624  TGGAGATCATTGCGAACGACCAGGGTAACCGCACGACCCCGTCGTACGTGGCGTTCACGG  30565

Query  149    ACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACA  208
              || |||| || ||||||||||| ||||| ||||| ||||| || ||||||||||||||||
Sbjct  30564  ACACGGAGCGTCTCATCGGTGATGCCGCGAAGAACCAGGTCGCGATGAACGCGCACAACA  30505

Query  209    CGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCG  268
              | |||||||||||||| || |||||||| |||||||||||||||||  |||| |||||||
Sbjct  30504  CTGTGTTCGACGCCAAGCGCCTGATCGGTCGCAAGTTCTCGGACCCGATCGTGCAGGCCG  30445

Query  269    ACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGG  328
              |||| ||||||||||||||| | ||| || | |||||||| |||||||||||||| ||||
Sbjct  30444  ACATTAAGCACTGGCCGTTCAAGGTGTCGCCAGGCGCCGGCGACAAGCCGCAGATTACGG  30385

Query  329    TGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGA  388
              || |||||||||||||| |||| |||||||| || || ||||||||||| |||||||| |
Sbjct  30384  TGGAGTTCAAGGGCGAGACCAAAACGTTCCAGCCAGAAGAGATCTCGTCGATGGTGCTTA  30325

Query  389    TCAAGATG  396
              ||||||||
Sbjct  30324  TCAAGATG  30317

 Score = 86.0 bits (94),  Expect = 3e-14
 Identities = 53/57 (93%), Gaps = 0/57 (0%)
 Strand=Plus/Minus

Query  459    CGCCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTT  515
              |||||| |||||||||||||| |||||||||||||| |||||||||||||| |||||
Sbjct  38844  CGCCGCTATCGCGTACGGCCTTGACAAGAAGGGCGGTGAGCGCAACGTGCTTATCTT  38788

>APIN:scaffold_4 supercont1.4 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.4:1:2763071:1 
REF
Length=2763071

 Score = 1341 bits (1486),  Expect = 0.0
 Identities = 1137/1399 (81%), Gaps = 3/1399 (0%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||||||||| |||||||| ||  | || ||||| |||||||||||||| || || ||||
Sbjct  356493  AGGACGCCGGTGCCATTGCTGGGTTGAATGTGCTTCGTATCATCAACGAACCCACTGCCG  356434

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               | ||||| ||||||||  ||||||||||||| ||||| ||||| ||||| || |||||  
Sbjct  356433  CTGCCATTGCGTACGGTTTGGACAAGAAGGGTGGCGAACGCAATGTGCTCATTTTCGATT  356374

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               ||||||| || ||||| |||||||| ||  || | || || ||||| ||||| || || |
Sbjct  356373  TGGGCGGTGGTACCTTTGATGTGTCGCTGTTGACGATCGAAGAGGGTATCTTTGAAGTGA  356314

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               |||| ||||| |||||||||||| |||||||||| ||||||||||||||| |||| ||||
Sbjct  356313  AGGCGACTGCCGGTGACACGCACTTGGGTGGTGAAGACTTCGACAACCGCTTGGTAGACC  356254

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               |||| |||  |||||||||||||||||||||||||||||| ||  | ||||| ||||| |
Sbjct  356253  ACTTTACGGCGGAGTTCAAGCGCAAGCACCGCAAGGACATGACCCAAAACCAACGTGCCC  356194

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               |||| |||||||| || ||||||||||| ||||||||||| |||||||||||||| || |
Sbjct  356193  TTCGCCGTCTGCGTACTGCCTGCGAGCGCGCCAAGCGTACCCTGTCGTCGTCGGCACAAG  356134

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | |||||||| |||||||| |||||||||||||| |||||||||   || ||||| ||||
Sbjct  356133  CGTACATCGAAATTGACTCGCTGTTCGACGGCATTGACTTCAACAGCACGATCACGCGTG  356074

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               |||||||||| ||||||||||||||||||||||||||||| ||||| || ||||||||||
Sbjct  356073  CTCGTTTCGAAGACATGTGCGGCGACTACTTCCGCAAGACAATGGAACCTGTGGAGAAGG  356014

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               || |||||||| | ||| ||||||||||||| |||||||| |||||||| || || || |
Sbjct  356013  TGTTGCGCGACTCGAAGTTGTCGAAGAGCCAAGTGCACGAAGTGGTGCTTGTCGGTGGTT  355954

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               |||| |||||||| |||||||| || ||| ||||||||||||||||||||||||| ||  
Sbjct  355953  CGACCCGTATCCCCAAGGTGCAACAACTGTTGTCGGACTTCTTCAACGGCAAGGAACCGT  355894

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                |||||| |||||||| || || ||||| |||| |||||| |||||||| || || ||  
Sbjct  355893  GCAAGTCGATCAACCCTGATGAAGCTGTCGCGTTCGGTGCTACCGTGCAAGCCGCGATTT  355834

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               ||   |||||||||   ||||||||| |||||||| ||||  || |||||||||||||  
Sbjct  355833  TGTCGGGCAACGACAGCTCGGAGAAGTTGCAGGACTTGCTGTTGTTGGACGTGACGCCTT  355774

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
               ||||||| ||| | || |||||||| || |||||||||||  |||||  ||| |||||||
Sbjct  355773  TGTCTCTCGGTTTGGAAACGGCCGGCGGCGTCATGACGACTTTGATCCAGCGCAACACGA  355714

Query  1181    CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
               |||||||||| ||||||||||||||||| ||||| |||||||||||||||||||| ||| 
Sbjct  355713  CGGTGCCGACGAAGAAGTCGCAGACGTTTTCGACCTACGCCGACAACCAGCCTGGTGTGT  355654

Query  1241    TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
               | ||||| ||||| || || || ||||| |||||||||||||||||| || |||||||||
Sbjct  355653  TGATCCAAGTGTTTGAAGGTGAACGCTCGATGACGCGCGACAACAACTTGTTGGGCAAGT  355594

Query  1301    TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
               |     ||||||| |||||||||||||||||||||||||| ||  |||||||||| ||||
Sbjct  355593  TTTCGTTGGACGGGATCCCTCCCATGCCTCGCGGTGTGCCTCAAGTCGACGTGACTTTCG  355534

Query  1361    ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
               |||| ||||| ||||| ||| |||||||||| ||  | || ||||| || ||||||||||
Sbjct  355533  ACATTGACGCCAACGGTATCTTGAACGTGTCTGCGATTGAAAAGTCGACCGGCAAGGAGA  355474

Query  1421    ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
               ||||||| ||||| |||||||||||||||||| |  |  |||  |||||||| |||||||
Sbjct  355473  ACAAGATTACGATTACGAACGACAAGGGCCGCTTGACCAAGGACGACATTGAGCGCATGG  355414

Query  1481    TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
               |   ||| ||||| |||||||||||||| ||||| || ||||||   |||||||| ||||
Sbjct  355413  TGCAGGAAGCCGAAAAGTACAAGTCGGAAGACGAAGCCAACAAGGTTCGCATCGAAGCCA  355354

Query  1541    AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
               ||||||   |||| ||||| || ||||   |||| ||||  ||||| ||||| ||| |  
Sbjct  355353  AGAACGGCTTGGAAAACTATGCGTACAACTTGCGCAACACGCTGAACGACGAAAAGCTCC  355294

Query  1601    AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
               | |  ||| |    |  || ||||||||| | || |||||||||||||| ||    ||  
Sbjct  355293  AAGGCAAGTTGGATGCCGCGGACAAGAAGACAGTCGACGACAAGGTGACTGAGACCATTA  355234

Query  1661    AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
                 ||| |||| || ||||||||    |||||||| | ||  ||| | ||||| |||||| 
Sbjct  355233  GCTGGTTGGATGCGAACCAGTCGGCTGAGAAGGAAGAGTTTGAGGCCAAGCAAAAGGAAC  355174

Query  1721    TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
               | || || || || |||||  |  |||| ||| ||||   ||| || |||||| | ||||
Sbjct  355173  TCGAAGGTGTTGCGAACCCGATCATGCAAAAGCTGTA---TGCGGCGGGCGGTGCACCTG  355117

Query  1781    GTGCTGAGGGTGGTATGCC  1799
               | | |   || || |||||
Sbjct  355116  GCGGTCCCGGCGGCATGCC  355098

 Score = 482 bits (534),  Expect = 1e-133
 Identities = 390/472 (83%), Gaps = 10/472 (2%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||||||||| |||||||| ||  | || ||||| |||||||||||||| || || ||||
Sbjct  304867  AGGACGCCGGTGCCATTGCTGGGTTGAATGTGCTTCGTATCATCAACGAACCCACTGCCG  304926

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               | ||||| ||||||||  ||||||||||||| ||||| ||||| ||||| || |||||  
Sbjct  304927  CTGCCATTGCGTACGGTTTGGACAAGAAGGGTGGCGAACGCAATGTGCTCATTTTCGATT  304986

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               ||||||| || ||||| |||||||| ||  || | || || ||||| ||||| || || |
Sbjct  304987  TGGGCGGTGGTACCTTTGATGTGTCGCTGTTGACGATCGAAGAGGGTATCTTTGAAGTGA  305046

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               |||| ||||| |||||||||||| |||||||  | ||||||||||||||| |||| ||||
Sbjct  305047  AGGCGACTGCCGGTGACACGCACTTGGGTGGCAAAGACTTCGACAACCGCTTGGTAGACC  305106

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               |||| |||  |||||||||||||||||||||||||||||| ||  | ||||| ||||| |
Sbjct  305107  ACTTTACGGCGGAGTTCAAGCGCAAGCACCGCAAGGACATGACCCAAAACCAACGTGCCC  305166

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               |||| |||||||| || ||||||||||| ||||||||||| |||||||||||||| || |
Sbjct  305167  TTCGCCGTCTGCGTACTGCCTGCGAGCGCGCCAAGCGTACCCTGTCGTCGTCGGCACAAG  305226

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | |||||||| |||||||| |||||||||||||| |||||||||   || ||||| ||||
Sbjct  305227  CGTACATCGAAATTGACTCGCTGTTCGACGGCATTGACTTCAACAGCACGATCACGCGTG  305286

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGT  872
               |     || | |||||     |||||||||| ||||||||||||||||| ||
Sbjct  305287  C-----TCAAAGACAT-----GCGACTACTTGCGCAAGACGATGGAGCCTGT  305328

 Score = 410 bits (454),  Expect = 6e-112
 Identities = 311/367 (85%), Gaps = 0/367 (0%)
 Strand=Plus/Minus

Query  30      CGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGT  89
               |||||| ||||| |||||||| |||||||||||||| || |||||||| |||||||| ||
Sbjct  356954  CGTCGGTATCGATCTCGGCACGACCTACTCGTGCGTCGGTGTGTGGCAAAACGACCGCGT  356895

Query  90      GGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGA  149
               ||||||||| || ||||||||||| |||||||| |||||||| |||||||| ||||| ||
Sbjct  356894  GGAAATCATTGCGAACGACCAGGGGAACCGCACGACCCCGTCGTACGTCGCGTTCACGGA  356835

Query  150     CTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACAC  209
               |   |||||||| |||||||| ||||||||||| || || || |||||| ||  ||||||
Sbjct  356834  CAGCGAACGCCTGATCGGTGATGCCGCCAAGAACCAAGTCGCGATGAACCCGACCAACAC  356775

Query  210     GGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGA  269
               ||||||||||||||| ||| |||||||||||||||||   ||||| ||  |||| |||||
Sbjct  356774  GGTGTTCGACGCCAAGCGTTTGATCGGCCGCAAGTTCAACGACCCTGTGATCCAAGCCGA  356715

Query  270     CATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGT  329
               ||||||||||||||||||| | || ||  | || || || |||||||| || ||||||||
Sbjct  356714  CATCAAGCACTGGCCGTTCAAGGTCACCCCCGGTGCGGGCGACAAGCCCCAAATCACGGT  356655

Query  330     GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGAT  389
               | | |||||||||||  |||||||||||||||| || || || ||||| |||||| ||||
Sbjct  356654  GGAATTCAAGGGCGAAACCAAGACGTTCCAACCTGAAGAAATTTCGTCGATGGTGTTGAT  356595

Query  390     CAAGATG  396
               |||||||
Sbjct  356594  CAAGATG  356588

 Score = 401 bits (444),  Expect = 3e-109
 Identities = 309/367 (84%), Gaps = 0/367 (0%)
 Strand=Plus/Plus

Query  30      CGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGT  89
               |||||| ||||| |||||||| |||||||| ||||| || |||||||| |||||||| ||
Sbjct  304406  CGTCGGTATCGATCTCGGCACGACCTACTCATGCGTCGGTGTGTGGCAAAACGACCGCGT  304465

Query  90      GGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGA  149
               ||||||||| || ||||||||||| |||||||| |||||||| ||||| || ||||| ||
Sbjct  304466  GGAAATCATTGCGAACGACCAGGGGAACCGCACGACCCCGTCGTACGTTGCGTTCACGGA  304525

Query  150     CTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACAC  209
               |   |||||||| |||||||| ||||||||||| || || || |||||| ||  ||||||
Sbjct  304526  CAGCGAACGCCTGATCGGTGATGCCGCCAAGAACCAAGTCGCGATGAACCCGACCAACAC  304585

Query  210     GGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGA  269
               ||||||||||||||| ||| |||||||||||||||||   ||||| ||  |||| |||||
Sbjct  304586  GGTGTTCGACGCCAAGCGTTTGATCGGCCGCAAGTTCAACGACCCTGTGATCCAAGCCGA  304645

Query  270     CATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGT  329
               ||||||||||||||||||| | || ||  | || || || |||||||| || ||||||||
Sbjct  304646  CATCAAGCACTGGCCGTTCAAGGTCACCCCCGGTGCGGGCGACAAGCCCCAAATCACGGT  304705

Query  330     GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGAT  389
               | | |||||||||||  |||||||||||||||| || || || ||||| |||||| ||||
Sbjct  304706  GGAATTCAAGGGCGAAACCAAGACGTTCCAACCTGAAGAAATTTCGTCGATGGTGTTGAT  304765

Query  390     CAAGATG  396
               |||||||
Sbjct  304766  CAAGATG  304772

 Score = 202 bits (223),  Expect = 5e-49
 Identities = 167/204 (82%), Gaps = 0/204 (0%)
 Strand=Plus/Plus

Query  888     CGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCGACGCG  947
               |||| | ||| ||||||||||||| |||||||| |||||||| || || || ||||| ||
Sbjct  308173  CGACTCGAAGTTGTCGAAGAGCCAAGTGCACGAAGTGGTGCTTGTCGGTGGTTCGACCCG  308232

Query  948     TATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAACAAGTC  1007
               |||||| |||||||| || ||  ||||||||||||||||||||||||||||   ||||||
Sbjct  308233  TATCCCCAAGGTGCAACAACTATTGTCGGACTTCTTCAACGGCAAGGAGCCGTGCAAGTC  308292

Query  1008    CATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTGAGCGG  1067
                |||||||| || || || || ||||||||||| |||||||| || || ||| ||   ||
Sbjct  308293  GATCAACCCTGATGAAGCCGTCGCGTACGGTGCTACCGTGCAAGCCGCGATCTTGTCGGG  308352

Query  1068    CAACGACTCGTCGGAGAAGCTGCA  1091
                ||||||   ||||||||| ||||
Sbjct  308353  TAACGACAGCTCGGAGAAGTTGCA  308376

 Score = 92.4 bits (101),  Expect = 7e-16
 Identities = 158/229 (69%), Gaps = 3/229 (1%)
 Strand=Plus/Plus

Query  1571    TGCGGAACAGTCTGAATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGG  1630
               |||| ||||  ||||| ||||| ||| |  | |  ||| |    |  || ||||||||| 
Sbjct  307451  TGCGCAACACGCTGAACGACGAAAAGCTCCAAGGCAAGTTGGATGCCGCGGACAAGAAGA  307510

Query  1631    CGGTGGACGACAAGGTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGA  1690
               | || |||||||||||||| ||    ||    ||| |||| || ||||||||    ||||
Sbjct  307511  CAGTCGACGACAAGGTGACTGAGACCATTAGCTGGTTGGATGCGAACCAGTCGGCTGAGA  307570

Query  1691    AGGATGCGTACGAGTCGAAGCAGAAGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGA  1750
               |||| | ||  ||| | ||||| |||||| | || || || || |||||  |  |||| |
Sbjct  307571  AGGAAGAGTTTGAGGCCAAGCAAAAGGAACTCGAAGGTGTTGCGAACCCGATCATGCAAA  307630

Query  1751    AGATGTACGCTGCTGCTGGCGGTTCCCCTGGTGCTGAGGGTGGTATGCC  1799
               || ||||   ||| || |||||| | ||||| | |   || || |||||
Sbjct  307631  AGCTGTA---TGCGGCGGGCGGTGCACCTGGCGGTCCCGGCGGCATGCC  307676

>PYVX:scaffold_1036 pve_scaffold_1036 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1036:1:7947:1 
REF
Length=7947

 Score = 1313 bits (1455),  Expect = 0.0
 Identities = 1056/1273 (83%), Gaps = 4/1273 (0%)
 Strand=Plus/Plus

Query  511   ATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATC  570
             ||||||||||||||||||||||| || || ||||| || ||  |||||||||||||||| 
Sbjct  1351  ATCTTCGACCTGGGCGGCGGCACGTTTGACGTGTCGCTGCTTACCATTGAGGAGGGCATT  1410

Query  571   TTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGC  630
             |||||||||||||| || || || ||||| ||| |||| || |||||||| |||||||||
Sbjct  1411  TTCGAGGTCAAGGCGACGGCGGGCGACACCCACTTGGGCGGCGAGGACTTTGACAACCGC  1470

Query  631   CTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAAC  690
             || || || |||||  |    ||||||||||||||| ||||||||||| | |  ||    
Sbjct  1471  CTTGTCGAGCACTTTGCCGCCGAGTTCAAGCGCAAGTACCGCAAGGACTTGAGCGAATCG  1530

Query  691   CAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCG  750
             ||||| || || || || ||||| ||||| || || || |||||||| ||||||||||||
Sbjct  1531  CAGCGGGCACTGCGGCGGCTGCGCACGGCGTGTGAACGCGCCAAGCGCACGCTGTCGTCG  1590

Query  751   TCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACC  810
             ||||| ||||| ||| | ||||| ||||| || | ||||||  ||||||||||| |||||
Sbjct  1591  TCGGCGCAGGCGTACGTTGAGATCGACTCGCTCTACGACGGTGTCGACTTCAACACGACC  1650

Query  811   ATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCC  870
             ||||| || || || |||||||| ||||||||||||||||||||||||||||||||||| 
Sbjct  1651  ATCACACGCGCGCGGTTCGAGGAGATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCG  1710

Query  871   GTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTG  930
             ||||||| |||||||||||||||||||||    ||| |||||||||||||||||||||| 
Sbjct  1711  GTGGAGACGGTGCTGCGCGACGCCAAGCTCGGCAAGGGCCAGGTGCACGAGGTGGTGCTC  1770

Query  931   GTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGC  990
             ||||||||||||||||| ||||| ||||||||||||||||||||| | ||||||||||||
Sbjct  1771  GTGGGCGGCTCGACGCGCATCCCCAAGGTGCAGCAGCTGCTGTCGCAGTTCTTCAACGGC  1830

Query  991   AAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAG  1050
             ||||| ||   |||||| ||||||||||||||||||||||||| ||| ||||| ||||| 
Sbjct  1831  AAGGAACCGTGCAAGTCGATCAACCCGGACGAGGCTGTGGCGTTCGGCGCGACGGTGCAA  1890

Query  1051  GCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGAC  1110
             |||||||||||||||||| |||||||||| |  ||  |||||||| |||| ||||| |||
Sbjct  1891  GCGGCCATCCTGAGCGGCCACGACTCGTCCGCCAAATTGCAGGACTTGCTGCTGCTCGAC  1950

Query  1111  GTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCG  1170
             ||| | ||||| || || ||||||||||||||||| || ||||||||||| || ||| ||
Sbjct  1951  GTGGCCCCGCTCTCGCTCGGTCTCGAGACGGCCGGCGGCGTCATGACGACACTCATCCCG  2010

Query  1171  CGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAG  1230
             || ||||| || |||||  |||||||||||||||||||||| ||||||||||| ||||||
Sbjct  2011  CGCAACACCACCGTGCCCGCCAAGAAGTCGCAGACGTTCTCCACGTACGCCGATAACCAG  2070

Query  1231  CCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTG  1290
             || || |||||||||||||| ||||| ||||||||| |||||||||||||||||||||||
Sbjct  2071  CCGGGCGTGCTCATCCAGGTCTTCGAAGGCGAGCGCACCATGACGCGCGACAACAACCTG  2130

Query  1291  CTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGAC  1350
             || |||||||||||| ||||||   | || |||||||| ||||| |||||||||||||| 
Sbjct  2131  CTCGGCAAGTTCAACTTGGACGCGCTGCCGCCCATGCCCCGCGGCGTGCCGCAGATCGAT  2190

Query  1351  GTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACG  1410
             ||||| ||||||||||||||||||||||| ||||||||| |||| || |||||||| |||
Sbjct  2191  GTGACCTTCGACATCGACGCGAACGGCATTCTGAACGTGACGGCCGTCGAGAAGTCGACG  2250

Query  1411  GGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATT  1470
             || || |||||||||||||| |||||||||||||||||||| ||||| || || ||||| 
Sbjct  2251  GGAAAAGAGAACAAGATCACCATCACGAACGACAAGGGCCGGCTCTCACAAGCCGACATC  2310

Query  1471  GACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGC  1530
             |||||||||||  | ||||| ||||||||||||  | | |||||||   | ||||| |||
Sbjct  2311  GACCGCATGGTGGCCGAGGCGGAGAAGTACAAGCAGCAAGACGAGGTGCAGAAGCAGCGC  2370

Query  1531  ATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGAC  1590
              | ||  |||||||| |||| ||||||||||| ||| | ||||| |||   || || |||
Sbjct  2371  GTGGACTCCAAGAACTCGCTCGAGAACTACGCGTACGGCCTGCGCAACTCGCTCAACGAC  2430

Query  1591  GAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACG  1650
             || ||||| |||||| || || ||||    |||   ||||||||||| ||| | ||||||
Sbjct  2431  GACAAGATCAAGGAGCAGCTCTCGGACAACGACCGCAAGGCGGTGGATGACCAAGTGACG  2490

Query  1651  GAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTG--GAGAAGGATGCGTACGAGTCGA  1708
              |   |||| | ||||||||| | ||||||  || |  |||||||| | || |||  | |
Sbjct  2491  CAGACGATCAACTGGCTGGACTCGAACCAG--ATGGCCGAGAAGGACGAGTTCGACGCCA  2548

Query  1709  AGCAGAAGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTG  1768
             ||||||||||  | | || ||||||||||||  |  ||||||||||||||||  | || |
Sbjct  2549  AGCAGAAGGAGCTCGCGGACGTGGCCAACCCGATCCTGCAGAAGATGTACGCATCAGCGG  2608

Query  1769  GCGGTTCCCCTGG  1781
             | ||| | || ||
Sbjct  2609  GTGGTGCTCCCGG  2621

 Score = 461 bits (510),  Expect = 4e-127
 Identities = 336/390 (86%), Gaps = 0/390 (0%)
 Strand=Plus/Plus

Query  20    CTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGA  79
             ||||  | || |||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct  767   CTGGCCAGTCGGTCGGCATCGACCTCGGCACGACCTACTCGTGCGTGGGCGTGTGGCAGA  826

Query  80    ACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCG  139
             |||| || || || ||||||||||||||||||||||||||||| || ||||| ||||| |
Sbjct  827   ACGAGCGCGTCGAGATCATCGCCAACGACCAGGGCAACCGCACGACGCCGTCCTACGTGG  886

Query  140   CCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACG  199
             ||||||| ||| |||| ||||||||||| |||||||||||||| ||||||||||||||||
Sbjct  887   CCTTCACCGACACGGAGCGCCTCATCGGCGACGCCGCCAAGAACCAGGTGGCCATGAACG  946

Query  200   CGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCG  259
             ||  ||||||||| ||||||||||| || || |||||||||||||||   ||||| || |
Sbjct  947   CGGCCAACACGGTCTTCGACGCCAAGCGGCTCATCGGCCGCAAGTTCAACGACCCGGTGG  1006

Query  260   TCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGC  319
             | |||   ||||||| ||||||||||||| | ||| || ||||  |||    ||||||||
Sbjct  1007  TGCAGCAGGACATCAGGCACTGGCCGTTCAAGGTGTCGGCGGGGTCCGACAGCAAGCCGC  1066

Query  320   AGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCA  379
             ||||||||||||||||| ||||||||  |||||||||||| || ||||||||||||||||
Sbjct  1067  AGATCACGGTGCAGTTCCAGGGCGAGCGCAAGACGTTCCAGCCAGAGGAGATCTCGTCCA  1126

Query  380   TGGTGCTGATCAAGATGCGCGAGGACGCCG  409
             ||||||| || ||||||||||| |  ||||
Sbjct  1127  TGGTGCTCATGAAGATGCGCGACGTGGCCG  1156

 Score = 82.4 bits (90),  Expect = 4e-13
 Identities = 54/60 (90%), Gaps = 0/60 (0%)
 Strand=Plus/Plus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             ||||||| || |  || |||||||||||||||||||| ||||||||||||||||||||||
Sbjct  1238  AGGACGCGGGGGTAATCGCCGGCCTCAACGTGCTGCGCATCATCAACGAGCCGACGGCCG  1297

 Score = 39.2 bits (42),  Expect = 3.9
 Identities = 37/47 (79%), Gaps = 3/47 (6%)
 Strand=Plus/Plus

Query  1838  CTGGTGCTGCGGACCAG---GGCCCGAAGATCGAGGAGGTCGACTAA  1881
             |||| | | ||||| ||   || || ||||||||||||||||| |||
Sbjct  2657  CTGGCGGTTCGGACGAGAAAGGTCCCAAGATCGAGGAGGTCGATTAA  2703

>PHKE:scaffold_1176 scf_22126_1176.1_contig_1 dna:supercontig 
supercontig:PhyKer238_432v1:scf_22126_1176.1_contig_1:1:3079:1 
REF
Length=3079

 Score = 1219 bits (1351),  Expect = 0.0
 Identities = 788/863 (91%), Gaps = 0/863 (0%)
 Strand=Plus/Plus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             |||| || || |||||||||||| | |||||||||||||||||||||||||||||||| |
Sbjct  2217  AGGATGCTGGTGCCATTGCCGGCATGAACGTGCTGCGTATCATCAACGAGCCGACGGCTG  2276

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
             | || || |||||||| ||||||||||||||||||||||| |||||||||||||||||||
Sbjct  2277  CTGCGATTGCGTACGGTCTGGACAAGAAGGGCGGCGAGCGTAACGTGCTGATCTTCGACC  2336

Query  521   TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
             |||| ||||| |||||||||||||| || |||  ||| |||||||| ||||||||||| |
Sbjct  2337  TGGGTGGCGGTACCTTCGATGTGTCGCTGCTGAGCATCGAGGAGGGAATCTTCGAGGTGA  2396

Query  581   AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
             |||| ||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||
Sbjct  2397  AGGCGACTGCGGGTGACACGCACTTGGGTGGTGAGGACTTCGACAACCGTCTGGTGGACC  2456

Query  641   ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
             |||||  |  |||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct  2457  ACTTCGTGTCGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCAC  2516

Query  701   TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
             | |||||||||||||| ||||||||||| ||||||||||||||||| ||||| || ||||
Sbjct  2517  TGCGTCGTCTGCGGACTGCCTGCGAGCGCGCCAAGCGTACGCTGTCATCGTCTGCCCAGG  2576

Query  761   CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
             ||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||| ||||
Sbjct  2577  CTTACATCGAGATCGACTCGCTGTTCGACGGTATCGACTTCAACTCGACCATCACCCGTG  2636

Query  821   CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct  2637  CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGTAAGACGATGGAGCCCGTGGAGAAGG  2696

Query  881   TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
             ||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||| |
Sbjct  2697  TGCTGCGCGACGCGAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTTGTCGGCGGTT  2756

Query  941   CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
             | |||||||||||||||||||||||||| |||||||||||||||||||||||||||||  
Sbjct  2757  CCACGCGTATCCCGAAGGTGCAGCAGCTTCTGTCGGACTTCTTCAACGGCAAGGAGCCGT  2816

Query  1001  ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
              |||||| ||||||||||||||||||||||||| ||| || || |||||||||||||| |
Sbjct  2817  GCAAGTCGATCAACCCGGACGAGGCTGTGGCGTTCGGCGCCACGGTGCAGGCGGCCATTC  2876

Query  1061  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
             ||||||||||||| ||||||||||||||||||||  |||| |||||||| |||||||| |
Sbjct  2877  TGAGCGGCAACGATTCGTCGGAGAAGCTGCAGGATTTGCTGCTGCTGGATGTGACGCCTC  2936

Query  1121  TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
             |||| || ||||| ||||| || |||||||| |||||||||||||||||||| || ||||
Sbjct  2937  TGTCGCTTGGTCTGGAGACCGCGGGTGGTGTGATGACGACGCTGATCGCGCGTAATACGA  2996

Query  1181  CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
             ||||||| || ||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct  2997  CGGTGCCCACGAAGAAGTCGCAGACGTTCTCGACGTACGCGGACAACCAGCCTGGTGTGC  3056

Query  1241  TCATCCAGGTGTTCGAGGGCGAG  1263
             | ||||||||||||||||| |||
Sbjct  3057  TGATCCAGGTGTTCGAGGGTGAG  3079

 Score = 515 bits (570),  Expect = 2e-143
 Identities = 358/406 (88%), Gaps = 3/406 (1%)
 Strand=Plus/Plus

Query  1     ATGACTCAAGCTACTACGTC---TGGATACTCCGTCGGCATCGACCTCGGCACAACCTAC  57
             ||| ||||| |||| || ||   ||||||||| || ||||| ||||| ||||| || |||
Sbjct  1724  ATGGCTCAAACTACGACATCGACTGGATACTCGGTTGGCATTGACCTGGGCACGACATAC  1783

Query  58    TCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAAC  117
             |||||||||||||| |||||||| ||||||||||| ||||||||||| ||||| || |||
Sbjct  1784  TCGTGCGTGGGCGTATGGCAGAATGACCGTGTGGAGATCATCGCCAATGACCAAGGTAAC  1843

Query  118   CGCACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCC  177
             || || ||||| || ||||| |||||||| ||| |||| || || ||||| |||||||||
Sbjct  1844  CGTACGACCCCTTCGTACGTTGCCTTCACGGACACGGAGCGTCTGATCGGAGACGCCGCC  1903

Query  178   AAGAATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGC  237
             ||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||| 
Sbjct  1904  AAGAACCAGGTGGCCATGAATGCGCACAACACGGTGTTCGACGCCAAGCGTCTGATCGGT  1963

Query  238   CGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACG  297
             |||||||||||||||||  |||| ||| | ||||||||||||||||||||| |  || ||
Sbjct  1964  CGCAAGTTCTCGGACCCGATCGTGCAGTCGGACATCAAGCACTGGCCGTTCAAGCTGTCG  2023

Query  298   TCGGGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTC  357
             ||||| |||||||||||||| |||||||||||||||||||||||||| || |||||||||
Sbjct  2024  TCGGGTGCCGGTGACAAGCCCCAGATCACGGTGCAGTTCAAGGGCGAATCGAAGACGTTC  2083

Query  358   CAACCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGG  403
             ||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct  2084  CAACCGGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGG  2129

>PYAR:scaffold_1093 par_scaffold_1093 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1093:1:10436:1 
REF
Length=10436

 Score = 1187 bits (1316),  Expect = 0.0
 Identities = 1078/1358 (79%), Gaps = 0/1358 (0%)
 Strand=Plus/Minus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             |||| ||||| |||||||| |||||||| ||||| ||||||||||||||||||||||| |
Sbjct  8730  AGGATGCCGGGGCCATTGCTGGCCTCAATGTGCTCCGTATCATCAACGAGCCGACGGCGG  8671

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
             | |||||||||||||| || |||   ||||||||||||| ||| || || || ||||| |
Sbjct  8670  CGGCCATCGCGTACGGACTCGACCGCAAGGGCGGCGAGCACAATGTCCTCATTTTCGATC  8611

Query  521   TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
             |||||||||| || ||||| |||  ||| ||  | || || || ||||| ||||| ||||
Sbjct  8610  TGGGCGGCGGTACGTTCGACGTGAGTCTGCTCACGATCGAAGAAGGCATTTTCGAAGTCA  8551

Query  581   AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
             |||| || || || || || ||  |||| ||||| ||||| ||||| |||||||| ||  
Sbjct  8550  AGGCAACGGCCGGCGATACCCATTTGGGCGGTGAAGACTTTGACAATCGCCTGGTCGAGT  8491

Query  641   ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
             | |||  |   |||||||| ||||||||||| |||||||| |||  ||||||||| || |
Sbjct  8490  ATTTCGTGGGCGAGTTCAAACGCAAGCACCGTAAGGACATGACGTCGAACCAGCGCGCAC  8431

Query  701   TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
             | ||||| || || |||||||| |||||||||||||| ||||||||||||||||| ||||
Sbjct  8430  TACGTCGACTTCGCACGGCCTGTGAGCGTGCCAAGCGCACGCTGTCGTCGTCGGCGCAGG  8371

Query  761   CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
             | || |||||||||||||| || | ||| ||| | |||||||||||||| || || ||||
Sbjct  8370  CCTATATCGAGATTGACTCGCTTTACGAAGGCGTGGACTTCAACTCGACGATTACGCGTG  8311

Query  821   CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
             | || || |||||  |||| | |||||  |||||||||||||||||||| || |||   |
Sbjct  8310  CGCGCTTTGAGGATTTGTGTGCCGACTTTTTCCGCAAGACGATGGAGCCGGTCGAGCGCG  8251

Query  881   TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
             |||||||||| |||||||| ||||||| ||| ||||| ||||| |||||||| |||||||
Sbjct  8250  TGCTGCGCGATGCCAAGCTCTCGAAGAACCAAGTGCAAGAGGTCGTGCTGGTCGGCGGCT  8191

Query  941   CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
             ||||||| ||||| ||| | |||||| ||||||||||||||||||||||||||||||   
Sbjct  8190  CGACGCGGATCCCCAAGATCCAGCAGTTGCTGTCGGACTTCTTCAACGGCAAGGAGCTGT  8131

Query  1001  ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
             |||||  ||| |||||||||||||| ||||| |  || || || || ||||| || ||||
Sbjct  8130  ACAAGAGCATTAACCCGGACGAGGCCGTGGCATTTGGGGCCACAGTCCAGGCCGCGATCC  8071

Query  1061  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
             | || ||||  |||  ||||  ||||||||||||| ||||  ||||||| ||||||||  
Sbjct  8070  TCAGTGGCAGTGACAAGTCGTCGAAGCTGCAGGACTTGCTCTTGCTGGATGTGACGCCCT  8011

Query  1121  TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
             |||| || || |||||||| ||||| ||||||||||||||| |||| || || |||||||
Sbjct  8010  TGTCGCTCGGGCTCGAGACAGCCGGCGGTGTCATGACGACGTTGATTGCACGCAACACGA  7951

Query  1181  CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
             | ||||| || || |||||||| || || ||||| ||||||||||||||||| || ||||
Sbjct  7950  CCGTGCCCACGAAAAAGTCGCAAACCTTTTCGACCTACGCCGACAACCAGCCGGGCGTGC  7891

Query  1241  TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
             | |||||||| ||||||||||||||  ||||||| || |||||| || ||||||||||||
Sbjct  7890  TGATCCAGGTCTTCGAGGGCGAGCGTACCATGACTCGTGACAACCACTTGCTGGGCAAGT  7831

Query  1301  TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
             ||   ||||| |   | || || ||||| ||||| ||||| ||||| |||||||| || |
Sbjct  7830  TCTCGCTGGATGCGCTGCCACCGATGCCACGCGGCGTGCCACAGATTGACGTGACATTTG  7771

Query  1361  ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
             |||| ||||| |||||||| || || || ||||| ||||||||||| |||||||||||||
Sbjct  7770  ACATTGACGCCAACGGCATTCTCAATGTCTCGGCCGTGGAGAAGTCGACGGGCAAGGAGA  7711

Query  1421  ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
             ||||||| |||||||||||||||||||| || |||||||||   || |||||||||||||
Sbjct  7710  ACAAGATTACGATCACGAACGACAAGGGGCGTCTCTCGCAGCAAGAGATTGACCGCATGG  7651

Query  1481  TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
             |    |||||||||| |||||||    | ||||||   |||||||  ||| | |||||||
Sbjct  7650  TCAGCGAGGCCGAGACGTACAAGGACCAAGACGAGCGCAACAAGCTGCGCGTGGAGGCCA  7591

Query  1541  AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
             |||||| ||| ||||| ||||| |  |  ||||| ||    ||| | ||||| ||| | |
Sbjct  7590  AGAACGGGCTCGAGAATTACGCGTTTACGCTGCGCAATTCGCTGCAGGACGACAAGGTCA  7531

Query  1601  AGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
              || |||| |    || |  ||||||||| || ||| |||   | |  | || ||| |  
Sbjct  7530  CGGCGAAGCTGGGCGACGAGGACAAGAAGACGCTGGGCGATGCGATTGCCGAGGTGGTTG  7471

Query  1661  AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
              |||||| || |   ||||| |    |||||||| | ||| ||  | |||||||||||  
Sbjct  7470  CGTGGCTCGATGGCCACCAGGCGGCCGAGAAGGAGGAGTATGACGCCAAGCAGAAGGAGC  7411

Query  1721  TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTAC  1758
             |||||  |||||| |  ||  |  | ||||||||||||
Sbjct  7410  TGGAGAACGTGGCGACTCCGATCCTTCAGAAGATGTAC  7373

 Score = 397 bits (439),  Expect = 1e-107
 Identities = 317/382 (83%), Gaps = 0/382 (0%)
 Strand=Plus/Minus

Query  28    TCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGT  87
             || |||||||| ||||| ||||| |||||||||||||| ||||| |||||||||||||| 
Sbjct  9191  TCGGTCGGCATTGACCTGGGCACGACCTACTCGTGCGTCGGCGTCTGGCAGAACGACCGC  9132

Query  88    GTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACA  147
             || || ||||| |||||||| |||||||||||||| ||||| || ||||| |||||||| 
Sbjct  9131  GTCGAGATCATTGCCAACGATCAGGGCAACCGCACGACCCCTTCGTACGTGGCCTTCACC  9072

Query  148   GACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAAC  207
             |||   || || || || || |||||||||||||| ||||| ||||||||||| ||||||
Sbjct  9071  GACAGCGAGCGTCTGATTGGGGACGCCGCCAAGAACCAGGTCGCCATGAACGCTCACAAC  9012

Query  208   ACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCC  267
             || || ||||||||||| ||||| ||||| ||||||||| ||||| | ||||| || |||
Sbjct  9011  ACCGTCTTCGACGCCAAGCGTCTCATCGGACGCAAGTTCACGGACGCGGTCGTGCAAGCC  8952

Query  268   GACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACG  327
             ||||||||||||||||||||||  || | | ||| | | |   |||||||||||||    
Sbjct  8951  GACATCAAGCACTGGCCGTTCCGGGTCATGGCGGACTCGGCCAACAAGCCGCAGATTGTC  8892

Query  328   GTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTG  387
             |||||||||||||||||| | |||| |||| |  |||| |||||||||  ||||||||||
Sbjct  8891  GTGCAGTTCAAGGGCGAGACGAAGAAGTTCTACGCCGAAGAGATCTCGAGCATGGTGCTG  8832

Query  388   ATCAAGATGCGCGAGGACGCCG  409
             | |||||||||||| |  ||||
Sbjct  8831  ACCAAGATGCGCGACGTTGCCG  8810

 Score = 41.0 bits (44),  Expect = 1.1
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  1855  GGCCCGAAGATCGAGGAGGTCGACTAA  1881
             || |||||||||||||| |||||||||
Sbjct  7291  GGTCCGAAGATCGAGGAAGTCGACTAA  7265

>APAS:scaffold_44 supercont1.44 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.44:1:578781:1 
REF
Length=578781

 Score = 1155 bits (1280),  Expect = 0.0
 Identities = 1080/1365 (79%), Gaps = 10/1365 (1%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||| || || ||||||||| | |  ||  |||| ||||||||||| || || ||||
Sbjct  234648  AGGACGCGGGGGCGATTGCCGGCTTGACTGTCATGCGCATCATCAACGAACCCACTGCCG  234707

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               | ||||| |||||||| |||||||| || || ||||||| ||||||||| || |||||| 
Sbjct  234708  CGGCCATTGCGTACGGGCTGGACAAAAAAGGGGGCGAGCACAACGTGCTAATTTTCGACT  234767

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               |||| |||||||| || ||||||||| | ||  | || |||||||| || ||||||||||
Sbjct  234768  TGGGGGGCGGCACGTTTGATGTGTCTTTGCTTACTATCGAGGAGGGTATTTTCGAGGTCA  234827

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               |||| || || || ||||||||  |||| || |||||||| ||||||||||| || ||||
Sbjct  234828  AGGCGACGGCGGGGGACACGCATTTGGGCGGCGAGGACTTTGACAACCGCCTCGTAGACC  234887

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||   | | ||||| ||||| ||| ||||||||||||| | |  ||||||||| ||  
Sbjct  234888  ACTTTGTGGATGAGTTTAAGCGGAAGTACCGCAAGGACATGAAGACGAACCAGCGCGCCT  234947

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               | || || ||||| |||||| ||||||| || ||||| ||||||||||||||| | || |
Sbjct  234948  TGCGCCGCCTGCGCACGGCCAGCGAGCGCGCGAAGCGAACGCTGTCGTCGTCGACGCAAG  235007

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               |  || | ||||||||||| ||||| ||||| || |||| |||| |||| ||||| ||||
Sbjct  235008  CCCACCTTGAGATTGACTCGCTGTTTGACGGGATTGACTACAACACGACAATCACGCGTG  235067

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               | || || || ||  ||||| |||||||||| ||||||||||||| ||| ||||| | ||
Sbjct  235068  CACGGTTTGAAGATTTGTGCAGCGACTACTTTCGCAAGACGATGGGGCCGGTGGAAACGG  235127

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               ||||||||||||||||||||||||||| ||| ||| | ||||| ||||| |||||||| |
Sbjct  235128  TGCTGCGCGACGCCAAGCTGTCGAAGAACCAAGTGAATGAGGTAGTGCTCGTGGGCGGGT  235187

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               |||| || ||||| |||||||||||| |||||   ||||| |||||||| |||||||   
Sbjct  235188  CGACTCGCATCCCCAAGGTGCAGCAGTTGCTGAGTGACTTTTTCAACGGTAAGGAGCTGT  235247

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
               ||||||| ||||| |||||||| || || ||||  || ||||| ||||||||||||||| 
Sbjct  235248  ACAAGTCGATCAATCCGGACGAAGCCGTTGCGTTTGGGGCGACGGTGCAGGCGGCCATCT  235307

Query  1061    TGAGCGGCAACGA-CTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCG  1119
               |||| ||| |||| |  |||  | |||||||||||| ||||  || |||| ||||| |||
Sbjct  235308  TGAGTGGC-ACGAGCGGGTCCCAAAAGCTGCAGGACTTGCTGTTGTTGGATGTGACACCG  235366

Query  1120    CTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACG  1179
                |||| ||||| |||||||| ||||| || || |||||||||||||| ||||| ||||||
Sbjct  235367  TTGTCGCTGGGGCTCGAGACTGCCGGGGGGGTGATGACGACGCTGATTGCGCGCAACACG  235426

Query  1180    ACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTG  1239
               ||||||||||| ||||||||||||||||| || |||||||| |||||||||||||| |||
Sbjct  235427  ACGGTGCCGACTAAGAAGTCGCAGACGTTTTCCACGTACGCGGACAACCAGCCTGGCGTG  235486

Query  1240    CTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAG  1299
               || || || ||||| ||||| ||||||   |||||    ||||||||  |||||||||||
Sbjct  235487  CTGATTCAAGTGTTTGAGGGTGAGCGCGTGATGACAAAGGACAACAATTTGCTGGGCAAG  235546

Query  1300    TTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTC  1359
               || | |||||||||  | || |||||||| || ||  |||| ||  | ||||||||||| 
Sbjct  235547  TTTAGCCTGGACGGGCTGCCCCCCATGCCCCGGGGCATGCCTCAAGTGGACGTGACGTTT  235606

Query  1360    GACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAG  1419
               ||||| |||||||| || ||  ||||||||||||| || || ||||| ||||||||||||
Sbjct  235607  GACATTGACGCGAATGGGATTTTGAACGTGTCGGCGGTCGAAAAGTCGACGGGCAAGGAG  235666

Query  1420    AACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATG  1479
               |||||||| |||||||||||||||||||||||||| ||  |||  || ||||||||||||
Sbjct  235667  AACAAGATTACGATCACGAACGACAAGGGCCGCCTGTCCAAGGACGAGATTGACCGCATG  235726

Query  1480    GTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAA-CAAGCAACGCATCGAGGC  1538
               ||    || || || || |||||| | || |||||    || |  ||  ||||| |||||
Sbjct  235727  GTGAACGATGCGGAAAAATACAAGGCTGAAGACGAAAAAAATCGCGC-GCGCATTGAGGC  235785

Query  1539    CAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGAT  1598
               ||||||||  || || || || || ||||| ||||| ||||  || || ||||| |||||
Sbjct  235786  CAAGAACGGCCTTGAAAATTATGCGTACAGCCTGCGCAACACGCTCAACGACGACAAGAT  235845

Query  1599    -GAAGGAG--AAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGT  1655
                 |||| |    |  ||||   || ||||||||| || | || ||||||||| | ||   
Sbjct  235846  CAAAGGCGCTGTGGACCCG---GCCGACAAGAAGACGCTCGAGGACAAGGTGGCCGACAC  235902

Query  1656    GATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAA  1715
               |||   |||| |||||   |||  | |   ||| ||||| | ||  ||| | |||||  |
Sbjct  235903  GATTGCGTGGATGGACCGCAACTTGGCGGCGGAAAAGGACGAGTTTGAGGCCAAGCAACA  235962

Query  1716    GGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGC  1760
                ||| ||||| |||||||||||||  |  |||||||| |||| ||
Sbjct  235963  AGAACTGGAGAGCGTGGCCAACCCGATTATGCAGAAGTTGTATGC  236007

 Score = 370 bits (410),  Expect = 5e-100
 Identities = 310/380 (82%), Gaps = 0/380 (0%)
 Strand=Plus/Plus

Query  30      CGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGT  89
               |||||| |||||| | ||||| || ||||||||||||||    |||||||||||||| ||
Sbjct  234187  CGTCGGGATCGACTTGGGCACGACGTACTCGTGCGTGGGGACTTGGCAGAACGACCGCGT  234246

Query  90      GGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGA  149
               |||||||||||| ||||||||||||||||||||||| || || || || |||||||| ||
Sbjct  234247  GGAAATCATCGCAAACGACCAGGGCAACCGCACCACGCCTTCGTATGTGGCCTTCACGGA  234306

Query  150     CTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACAC  209
               | |||| ||||| ||||| || ||||||||||| |||||||| |||||| ||   |||||
Sbjct  234307  CACGGAGCGCCTGATCGGAGATGCCGCCAAGAACCAGGTGGCAATGAACCCGTCGAACAC  234366

Query  210     GGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGA  269
               ||||||||| || || || ||||| || ||||||||    || ||| |  |||| |||||
Sbjct  234367  GGTGTTCGATGCGAAGCGGCTGATTGGACGCAAGTTTAACGATCCCATGATCCAAGCCGA  234426

Query  270     CATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGT  329
               ||||||||||||||||||| | ||||   |||| || || |||||||| |||||   |||
Sbjct  234427  CATCAAGCACTGGCCGTTCAAGGTGATTGCGGGGGCGGGGGACAAGCCCCAGATTGTGGT  234486

Query  330     GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGAT  389
                 |||||||||| |||  ||||||||| || || |||||||| ||||| |||||||||||
Sbjct  234487  CGAGTTCAAGGGTGAGCGCAAGACGTTTCAGCCAGAGGAGATTTCGTCGATGGTGCTGAT  234546

Query  390     CAAGATGCGCGAGGACGCCG  409
               |||||||   ||||  ||||
Sbjct  234547  CAAGATGAAGGAGGTGGCCG  234566

>PHPA:scaffold_149 NW_008649135.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.149, whole genome 
shotgun sequence
Length=53536

 Score = 1141 bits (1265),  Expect = 0.0
 Identities = 1003/1250 (80%), Gaps = 0/1250 (0%)
 Strand=Plus/Minus

Query  403    GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
              || || || || ||||| ||  | || |||||||||||||||||||||||||||||||| 
Sbjct  41936  GATGCGGGAGCTATTGCTGGTTTGAATGTGCTGCGTATCATCAACGAGCCGACGGCCGCT  41877

Query  463    GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
              || ||||| || || ||||||||||| || || |||| |||||||||||||||||| || 
Sbjct  41876  GCGATCGCCTATGGGCTGGACAAGAAAGGAGGTGAGCACAACGTGCTGATCTTCGATCTC  41817

Query  523    GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
              |||||||| || |||||||| ||||| ||  | ||||| || ||||||||||||||||||
Sbjct  41816  GGCGGCGGAACGTTCGATGTCTCTCTGCTCACTATTGAAGAAGGCATCTTCGAGGTCAAG  41757

Query  583    GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
              || || || |||||||||||| |||| |||||||||||||||||||| ||||| ||  | 
Sbjct  41756  GCGACAGCGGGTGACACGCACTTGGGAGGTGAGGACTTCGACAACCGTCTGGTCGAGTAT  41697

Query  643    TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
              |||   ||||| |||||||||||| |||||||||| || || | |||||||||||| || 
Sbjct  41696  TTCGTACAGGAATTCAAGCGCAAGTACCGCAAGGATATGACAGTGAACCAGCGTGCGCTG  41637

Query  703    CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
              ||||| ||||| ||||| ||||| || |||||||| ||| ||||  | ||||| ||||| 
Sbjct  41636  CGTCGCCTGCGTACGGCGTGCGAACGCGCCAAGCGGACGTTGTCTACTTCGGCGCAGGCA  41577

Query  763    TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
              ||| | ||||||||||| ||  | || || ||||| ||||||||||||||||| ||||| 
Sbjct  41576  TACCTTGAGATTGACTCGCTACTGGATGGTATCGATTTCAACTCGACCATCACGCGTGCG  41517

Query  823    CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
              || || || ||  ||||| ||||||| ||||| |||||||||||||| || | | |||| 
Sbjct  41516  CGGTTTGAAGATCTGTGCAGCGACTATTTCCGTAAGACGATGGAGCCGGTCGCGCAGGTT  41457

Query  883    CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
               |||| ||| | |||||||| |||| ||||||| ||||| | || ||||| ||||| || 
Sbjct  41456  TTGCGTGACTCAAAGCTGTCCAAGAACCAGGTGGACGAGATCGTCCTGGTCGGCGGATCT  41397

Query  943    ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
              ||||| |||||||||||||||||  |||||  ||  ||||||||||||||||| |    |
Sbjct  41396  ACGCGCATCCCGAAGGTGCAGCAATTGCTGATGGGTTTCTTCAACGGCAAGGATCTGTTC  41337

Query  1003   AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
              ||||| |||||||||||||| || || |||||||| || || ||||||||||| || |||
Sbjct  41336  AAGTCGATCAACCCGGACGAAGCCGTCGCGTACGGCGCCACGGTGCAGGCGGCGATACTG  41277

Query  1063   AGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTG  1122
              || ||||| || || |||   |||||||| |||||||| |||||||||||  | ||| ||
Sbjct  41276  AGTGGCAATGAGTCATCGTCCAAGCTGCAAGACCTGCTACTGCTGGACGTCGCACCGTTG  41217

Query  1123   TCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACG  1182
              ||  ||||| | |||||||||||||| || ||||| | ||| ||  | || ||||| || 
Sbjct  41216  TCGTTGGGTTTGGAGACGGCCGGTGGAGTTATGACCAAGCTCATTCCACGCAACACTACA  41157

Query  1183   GTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTC  1242
              |||||  | |||||| |||||||||||||||||||| | || |||||||| || ||||| 
Sbjct  41156  GTGCCTGCGAAGAAGACGCAGACGTTCTCGACGTACACTGATAACCAGCCGGGCGTGCTG  41097

Query  1243   ATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTC  1302
              ||||| |||||||||||||| ||  |||||||||| || ||| | || ||||||||||||
Sbjct  41096  ATCCAAGTGTTCGAGGGCGAACGAACCATGACGCGTGATAACCATCTTCTGGGCAAGTTC  41037

Query  1303   AACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGAC  1362
              ||||||||||| ||||| |||||||| ||||||||||| ||||| |||||||||||||||
Sbjct  41036  AACCTGGACGGTATCCCGCCCATGCCGCGCGGTGTGCCTCAGATTGACGTGACGTTCGAC  40977

Query  1363   ATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAAC  1422
               | || |  ||||||||  |||| |||||||||||||||||||| |||||||||||||||
Sbjct  40976  GTTGATGTCAACGGCATTTTGAATGTGTCGGCTGTGGAGAAGTCGACGGGCAAGGAGAAC  40917

Query  1423   AAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTA  1482
              |||||||||||||||||||| || || || || |||||| | || || ||||||||||| 
Sbjct  40916  AAGATCACGATCACGAACGATAAAGGTCGACTGTCGCAGTCCGAGATCGACCGCATGGTC  40857

Query  1483   TCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAAG  1542
               | || |||||||||||||||    | || ||    || |||   ||||| ||| | |||
Sbjct  40856  GCCGACGCCGAGAAGTACAAGGACCAAGATGAACGCAATAAGTTGCGCATTGAGTCGAAG  40797

Query  1543   AACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGAAG  1602
              |||||| ||||||||||||| |    ||| ||||||     |   || || ||| ||  |
Sbjct  40796  AACGCGTTGGAGAACTACGCGTTTTCTCTTCGGAACTCGACGCGCGAGGAAAAGTTGGCG  40737

Query  1603   GAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGA  1652
              |  ||| |    | ||  ||||||||| |  | || ||||||||| ||||
Sbjct  40736  GCAAAGCTGAGTGCAGAGGACAAGAAGACCATTGAGGACAAGGTGGCGGA  40687

 Score = 379 bits (419),  Expect = 3e-102
 Identities = 314/381 (82%), Gaps = 2/381 (1%)
 Strand=Plus/Minus

Query  30     CGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGT  89
              ||| ||||| || || ||||| || |||||||| ||||||||||||||||||||||| ||
Sbjct  42399  CGTTGGCATTGATCTGGGCACGACTTACTCGTGTGTGGGCGTGTGGCAGAACGACCGCGT  42340

Query  90     GGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGA  149
              ||| ||||| ||||||||||||||||||||||| |||||||| ||||| || ||||| ||
Sbjct  42339  GGAGATCATTGCCAACGACCAGGGCAACCGCACGACCCCGTCGTACGTGGCGTTCACCGA  42280

Query  150    CTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACAC  209
              | |||| || || ||||| || || |||||||| |||||||| |||||||| ||||||||
Sbjct  42279  CACGGAGCGTCTTATCGGCGATGCTGCCAAGAACCAGGTGGCTATGAACGCACACAACAC  42220

Query  210    GGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGA  269
              |||||| || | ||| ||  ||||||| ||||||||| | || || |  || ||| | ||
Sbjct  42219  GGTGTTTGATGTCAAGCGGTTGATCGGGCGCAAGTTCACCGATCCAGAAGTGCAGTCGGA  42160

Query  270    CATCAAGCACTGGCCGTTCCAAGTGACGTCG-GGCGCCGGTGACAAGCCGCAGATCACGG  328
              |||||||||||||||||| ||||  |  ||| || || |   |||| || ||  |   ||
Sbjct  42159  CATCAAGCACTGGCCGTT-CAAGGTAGTTCGTGGTGCTGAGAACAAACCTCAACTGGTGG  42101

Query  329    TGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGA  388
              ||||||||||||||||||| |||||||||||||| |||||||| ||||| |||||| |||
Sbjct  42100  TGCAGTTCAAGGGCGAGTCGAAGACGTTCCAACCGGAGGAGATTTCGTCTATGGTGTTGA  42041

Query  389    TCAAGATGCGCGAGGACGCCG  409
              |||||||||| ||||  ||||
Sbjct  42040  TCAAGATGCGAGAGGTGGCCG  42020

>APIN:scaffold_21 supercont1.21 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.21:1:1304294:1 
REF
Length=1304294

 Score = 1138 bits (1261),  Expect = 0.0
 Identities = 1070/1359 (79%), Gaps = 8/1359 (1%)
 Strand=Plus/Minus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||| |||||||| ||||| ||| | || ||||| || || ||||||||||| |||||||
Sbjct  1165384  AGGATGCCGGCGCGATTGCTGGCTTGAATGTGCTTCGCATTATCAACGAGCCCACGGCCG  1165325

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                |||| || ||||| ||||||||||||||||||||||||| |||||| |||||||||||| 
Sbjct  1165324  CCGCGATTGCGTATGGCCTGGACAAGAAGGGCGGCGAGCACAACGTCCTGATCTTCGACT  1165265

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                ||||||| ||||| || |||||||| || ||| | || || |||||||| || |||||||
Sbjct  1165264  TGGGCGGGGGCACATTTGATGTGTCGCTGCTGACGATCGAAGAGGGCATTTTTGAGGTCA  1165205

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                |||| || || ||  | |||||| |||| || || |||||||||||||| ||||||||||
Sbjct  1165204  AGGCGACGGCGGGAAATACGCACTTGGGGGGCGAAGACTTCGACAACCGACTGGTGGACC  1165145

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGG---ACATCACGGAGAACCAGCGTG  697
                |||| ||  | ||||| ||||||||| ||   ||||   || | | |  |||||||||||
Sbjct  1165144  ACTTTACCGACGAGTTTAAGCGCAAGTAC---AAGGGCGACTTGAAGACGAACCAGCGTG  1165088

Query  698      CTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTC  757
                | || || ||  |||| ||||| || || || || ||||| |||||||| |||||| | |
Sbjct  1165087  CGCTGCGCCGCTTGCGCACGGCTTGTGAACGGGCGAAGCGCACGCTGTCTTCGTCGACGC  1165028

Query  758      AGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTC  817
                | || ||| | ||||||||||| ||||| ||||| || |||| |||| ||||||| || |
Sbjct  1165027  AAGCGTACCTTGAGATTGACTCGCTGTTTGACGGAATGGACTACAACACGACCATAACGC  1164968

Query  818      GTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGA  877
                | || || || || ||| ||||| |||||||||| ||||||||||||||||||||| |||
Sbjct  1164967  GCGCGCGCTTTGAAGACTTGTGCAGCGACTACTTTCGCAAGACGATGGAGCCCGTGAAGA  1164908

Query  878      AGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCG  937
                  ||| |||  || || |||||||||||||  || ||||| || ||||| || || || |
Sbjct  1164907  GCGTGTTGCAGGATGCAAAGCTGTCGAAGAATCAAGTGCATGAAGTGGTCCTTGTCGGGG  1164848

Query  938      GCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGC  997
                | ||||| || || || || ||||||||| ||||||| ||||| ||  ||||||||||||
Sbjct  1164847  GGTCGACTCGGATTCCCAAAGTGCAGCAGTTGCTGTCCGACTTTTTTCACGGCAAGGAGC  1164788

Query  998      CCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCA  1057
                   ||||||| ||||| || |||||||| || ||||  || || || ||||| ||||| |
Sbjct  1164787  TGTACAAGTCGATCAATCCAGACGAGGCCGTTGCGTTTGGGGCCACGGTGCAAGCGGCGA  1164728

Query  1058     TCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGC  1117
                |  ||||||| | |  |   ||| |||||||||||||  |||||||  ||||||||||||
Sbjct  1164727  TTTTGAGCGGGAGCAGCGGATCGCAGAAGCTGCAGGATTTGCTTCTCTTGGACGTGACGC  1164668

Query  1118     CGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACA  1177
                |  ||||||| || |||||||||||||| ||||| ||||||||||||||  | || ||||
Sbjct  1164667  CCTTGTCTCTAGGGCTCGAGACGGCCGGCGGTGTGATGACGACGCTGATTTCCCGCAACA  1164608

Query  1178     CGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGG  1237
                ||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct  1164607  CGACGGTGCCGACAAAGAAGTCGCAGACGTTTTCGACGTACGCCGACAACCAGCCGGGGG  1164548

Query  1238     TGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCA  1297
                ||||||||||||||| ||| ||||||||| | |||||||  |||||| || |||||||||
Sbjct  1164547  TGCTCATCCAGGTGTACGAAGGCGAGCGCACGATGACGCATGACAACCACTTGCTGGGCA  1164488

Query  1298     AGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGT  1357
                | || | |||||| ||| | || |||||||| || || || || ||| ||||||||||||
Sbjct  1164487  AATTTAGCCTGGATGGCTTGCCCCCCATGCCCCGGGGAGTCCCCCAGGTCGACGTGACGT  1164428

Query  1358     TCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGG  1417
                | ||||| ||||||||||||||| |||||||||| || ||||| ||||| ||||| || |
Sbjct  1164427  TTGACATTGACGCGAACGGCATCTTGAACGTGTCTGCCGTGGAAAAGTCGACGGGGAAAG  1164368

Query  1418     AGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCA  1477
                | |||||||| ||||||||||||||||||||||| || ||  |||  || ||||| ||||
Sbjct  1164367  AAAACAAGATAACGATCACGAACGACAAGGGCCGTCTTTCCAAGGACGAGATTGAGCGCA  1164308

Query  1478     TGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGG  1537
                ||||    || || |||||||||||| | ||||||  |   |||||| | ||| | ||||
Sbjct  1164307  TGGTGAACGACGCGGAGAAGTACAAGGCCGAGGACACGAAGAACAAGGAGCGCGTGGAGG  1164248

Query  1538     CCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGA  1597
                | ||||| | ||| || || |||||||| || ||||| ||||  ||  | || |||||||
Sbjct  1164247  CGAAGAATGGGCTAGAAAATTACGCCTATAGCCTGCGCAACACCCTCCAGGAGGAGAAGA  1164188

Query  1598     -TGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTG  1656
                 | |||| |  |||    | || ||||||||| |   |||| |||||||||   ||  | 
Sbjct  1164187  TTCAAGGCG-CGATGGACGCAGGTGACAAGAAAGTCCTGGAAGACAAGGTGCACGACATC  1164129

Query  1657     ATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAG  1716
                ||   |||| ||||   ||||  | |    || ||||| |  |||||    |||||| ||
Sbjct  1164128  ATTTCGTGGATGGATCGAAACTTGGCCGCCGAAAAGGACGAATACGAAGGCAAGCAGCAG  1164069

Query  1717     GAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATG  1755
                ||  | ||| | || ||||||||  |  |||| ||| ||
Sbjct  1164068  GAGCTCGAGAGTGTAGCCAACCCCATTCTGCAAAAGGTG  1164030

 Score = 395 bits (437),  Expect = 4e-107
 Identities = 745/1091 (68%), Gaps = 20/1091 (2%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| || ||  ||||||| ||  | | |||||  ||||| |||||||| |||||||| |
Sbjct  361735  AGGATGCTGGTACCATTGCTGGTTTGACCGTGCAACGTATTATCAACGAACCGACGGCTG  361676

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGC---GGCGAGCGCAACGTGCTGATCTTCG  517
               |||| || ||||||||  | |||||||||| |   || ||    |||||| || | ||||
Sbjct  361675  CCGCGATTGCGTACGGTATTGACAAGAAGGCCAAGGGTGAAAAGAACGTGTTGGTGTTCG  361616

Query  518     ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
               |  |||| ||||| |||||||||||  |  |  || |||| || |  ||  | || ||||
Sbjct  361615  ATTTGGGTGGCGGTACCTTCGATGTCACCTTGTTGACCATCGATGGTGGTGTGTTTGAGG  361556

Query  578     TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
               |   | | ||    |||||||||||| |||| ||||| ||||||||  | ||| |  || 
Sbjct  361555  TGTTGTCGACCAACGGTGACACGCACTTGGGCGGTGAAGACTTCGATCAGCGCATTATGC  361496

Query  638     ACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAG---GACATCACGGAGAACCAGC  694
               |    ||||   || |||    ||  |||||    |||   |||||  |     || |||
Sbjct  361495  AATTTTTCATCAAGAAGTG---GCAAAAGCAAAAGAAGATCGACATTTCCAGCGACAAGC  361439

Query  695     GTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGG  754
               | ||  | |     || ||    |    ||| |||| ||||||  |  ||||| |   | 
Sbjct  361438  GCGCGTTGCAAAAGCTCCGCCGTGAAGCCGAACGTGTCAAGCGCGCTTTGTCGACCCAGC  361379

Query  755     CTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCA  814
               | || ||     |||| ||||| ||||| || ||||||   || ||| ||   ||  | |
Sbjct  361378  CCCAAGCCCGTCTCGAAATTGAATCTCTCTTGGACGGCGAAGATTTCGACGAAACGCTGA  361319

Query  815     CTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGG  874
               | || |||||||| || ||  ||  |   ||||  |||   |||||| ||   |||||||
Sbjct  361318  CCCGAGCTCGTTTTGAAGAACTGAACAATGACTTGTTCAAAAAGACGTTGACCCCCGTGG  361259

Query  875     AGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGG  934
               | |||||  ||   || ||   | ||  ||||||| | ||  ||||  | ||||| ||||
Sbjct  361258  AAAAGGTAATGAAGGATGCTGGGTTGAAGAAGAGCGAAGTCGACGAAATTGTGCTTGTGG  361199

Query  935     GCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGG  994
               | || ||||| |||||||| ||| | || || ||| |   ||||||||| ||||||||||
Sbjct  361198  GTGGTTCGACTCGTATCCCAAAGATCCAACAACTGATCAAGGACTTCTTTAACGGCAAGG  361139

Query  995     AGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCA-GGCG  1053
               | ||         ||||||||| || || ||||| |||||||||||  ||||||| ||||
Sbjct  361138  AACCTTCGCGCGGCATCAACCCTGATGAAGCTGTCGCGTACGGTGCCGCCGTGCAAGGCG  361079

Query  1054    GCCATCCTGAGCGGC---AACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGAC  1110
               |  ||| || | |||   ||||||||       || ||| | ||  |  |  || |||| 
Sbjct  361078  GT-ATCTTGGGTGGCGAAAACGACTCC------AACCTGAACGAAATCTTGTTGTTGGAT  361026

Query  1111    GTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCG  1170
               ||| ||||  ||||  ||||  | || || | ||||||||||||||| | | | |||   
Sbjct  361025  GTGGCGCCCTTGTCGTTGGGCATTGAAACTGTCGGTGGTGTCATGACCAAGATTATCAAC  360966

Query  1171    CGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAG  1230
               || ||||||   || || |||||||||||||| || |||||||| |||   |||||||| 
Sbjct  360965  CGCAACACGGTCGTCCCCACCAAGAAGTCGCAAACCTTCTCGACCTACCAGGACAACCAA  360906

Query  1231    CCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTG  1290
               || |  |||   ||||| ||||| || || || ||  |||||||    |||||| || | 
Sbjct  360905  CCCGCTGTGTCGATCCAAGTGTTTGAAGGTGAACGTGCCATGACCAAAGACAACCACATT  360846

Query  1291    CTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGAC  1350
               || ||||||||  |  ||  |||||| || ||    ||||| |||||||| || ||||| 
Sbjct  360845  CTCGGCAAGTTTGAATTGACCGGCATTCCCCCTGCTCCTCGTGGTGTGCCCCAAATCGAA  360786

Query  1351    GTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACG  1410
               || ||||| ||  ||||||| ||||| ||| || | ||||| || |  || |||   |||
Sbjct  360785  GTCACGTTTGAAGTCGACGCCAACGGTATCTTGCAAGTGTCTGCAGAAGACAAGGGCACG  360726

Query  1411    GGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATT  1470
               |||||||   | ||||| |||||||||  ||| ||||| ||| | ||||| |  || |||
Sbjct  360725  GGCAAGGCCGAGAAGATTACGATCACGGCCGAAAAGGGTCGCTTGTCGCAAGAAGAAATT  360666

Query  1471    GACCGCATGGT  1481
               |||||||||||
Sbjct  360665  GACCGCATGGT  360655

 Score = 324 bits (359),  Expect = 7e-86
 Identities = 292/367 (80%), Gaps = 0/367 (0%)
 Strand=Plus/Minus

Query  30       CGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGT  89
                |||||| |||||| | ||||| || || |||||||| ||||||||||| |||||||| ||
Sbjct  1165845  CGTCGGGATCGACTTGGGCACGACGTATTCGTGCGTAGGCGTGTGGCAAAACGACCGCGT  1165786

Query  90       GGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGA  149
                 |||||||| || |||||||| ||||||||||| || ||||| ||||| ||||| || ||
Sbjct  1165785  CGAAATCATTGCGAACGACCAAGGCAACCGCACGACGCCGTCGTACGTGGCCTTTACCGA  1165726

Query  150      CTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACAC  209
                | |||| || || || || ||||| |||||||| || || || |||||| ||   |||||
Sbjct  1165725  CACGGAGCGGCTGATTGGAGACGCGGCCAAGAACCAAGTCGCGATGAACCCGTCGAACAC  1165666

Query  210      GGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGA  269
                 ||||| ||||| || ||  ||||||| ||||||||    |||||  |  | ||||| ||
Sbjct  1165665  TGTGTTTGACGCGAAGCGGTTGATCGGGCGCAAGTTTAACGACCCGATGATTCAGGCAGA  1165606

Query  270      CATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGT  329
                ||||||||||||||| ||| | |||  | | ||  | || ||||||||||||||   |||
Sbjct  1165605  CATCAAGCACTGGCCATTCAAGGTGGTGGCCGGGCCGGGCGACAAGCCGCAGATTGTGGT  1165546

Query  330      GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGAT  389
                  | ||||||||||||  |||||||||||| || || ||||| ||||| |||||||||||
Sbjct  1165545  TGAATTCAAGGGCGAGAGCAAGACGTTCCAGCCGGAAGAGATTTCGTCGATGGTGCTGAT  1165486

Query  390      CAAGATG  396
                |||||||
Sbjct  1165485  CAAGATG  1165479

 Score = 118 bits (130),  Expect = 5e-24
 Identities = 158/217 (73%), Gaps = 11/217 (5%)
 Strand=Plus/Minus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGT-GGGCGTGTGGCAGAACGACCGTGTG  90
               |||| ||||| |||||||| || ||||||||||| ||||     ||  |||| |   |||
Sbjct  362194  TCGGTATCGATCTCGGCACGACGTACTCGTGCGTCGGGCACTACGCC-AACGGCAAGGTG  362136

Query  91      GAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGAC  150
               |||||||| || ||||||||||| ||||| | ||| ||||| || ||||| |     |||
Sbjct  362135  GAAATCATTGCGAACGACCAGGGTAACCGTATCACGCCGTCGTATGTCGCGT---GGGAC  362079

Query  151     TCG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCAC  204
               |||      |||||  | || || ||||  |||||||| ||||   | || ||| |  | 
Sbjct  362078  TCGAACGACGAACGTTTGATTGGGGACGGTGCCAAGAACCAGGCCACGATCAACCCCGAA  362019

Query  205     AACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCA  241
               |||||  |||||||||  || ||| ||||||||||||
Sbjct  362018  AACACATTGTTCGACGTGAAGCGTTTGATCGGCCGCA  361982

>PYAP:scaffold_252 pag1_scaffold_252 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_252:1:39965:1 
REF
Length=39965

 Score = 1068 bits (1184),  Expect = 0.0
 Identities = 1050/1350 (78%), Gaps = 4/1350 (0%)
 Strand=Plus/Plus

Query  413    CCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCCGCCATCGCGT  472
              |||| || || ||||||||  |||| |||||||||||||||||||| ||||| |||||||
Sbjct  32090  CCATAGCGGGTCTCAACGTCATGCGCATCATCAACGAGCCGACGGCAGCCGCGATCGCGT  32149

Query  473    ACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTGGGCGGCGGCA  532
              ||||  ||||||||||||||||||||||||||||  ||||||| ||||| || || ||||
Sbjct  32150  ACGGATTGGACAAGAAGGGCGGCGAGCGCAACGTTTTGATCTTTGACCTCGGTGGTGGCA  32209

Query  533    CCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAGGCCACTGCTG  592
              ||||||||||||| || ||   ||| || || || || || || |||||||| || || |
Sbjct  32210  CCTTCGATGTGTCGCTGCTCAGCATCGAAGAAGGTATTTTTGAAGTCAAGGCGACCGCGG  32269

Query  593    GTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCACTTC-ACGCAG  651
              |||| ||||| ||||| || || |||||||||||||||||||| ||  |||||  |||  
Sbjct  32270  GTGATACGCATCTGGGCGGCGAAGACTTCGACAACCGCCTGGTCGAGTACTTCGTCGC-C  32328

Query  652    GAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTTCGTCGTCTG  711
              ||||||||||||||||||   |||||  |||||   ||||| || || || ||||| || 
Sbjct  32329  GAGTTCAAGCGCAAGCACAAGAAGGATCTCACGACCAACCAACGCGCACTGCGTCGACTC  32388

Query  712    CGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCTTACATCGAG  771
              || ||||| || |||||||| || || |||||||| || ||  | ||||||||| |||||
Sbjct  32389  CGTACGGCATGTGAGCGTGCTAAACGCACGCTGTCATCTTCCACACAGGCTTACGTCGAG  32448

Query  772    ATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCTCGTTTCGAG  831
              ||||| || || || || ||||| || ||||||   || ||||| || ||||| || || 
Sbjct  32449  ATTGATTCGCTCTTTGATGGCATTGATTTCAACAGCACTATCACACGAGCTCGATTTGAA  32508

Query  832    GACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTGCTGCGCGAC  891
              |||||||| | |||||||||||||||||||||||| || |||||||||||||| | ||||
Sbjct  32509  GACATGTGTGCCGACTACTTCCGCAAGACGATGGAACCAGTGGAGAAGGTGCTCCACGAC  32568

Query  892    GCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATC  951
              |||||  | |  ||| | || ||||||||||| ||||| || || ||||| || || |||
Sbjct  32569  GCCAAAATTTGCAAGGGTCAAGTGCACGAGGTTGTGCTCGTCGGTGGCTCAACACGAATC  32628

Query  952    CCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATC  1011
              || |||||||||||| |||||   ||||| ||||| || ||||||||   |||||| |||
Sbjct  32629  CCCAAGGTGCAGCAGTTGCTGGTCGACTTTTTCAATGGGAAGGAGCCGTGCAAGTCTATC  32688

Query  1012   AACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAAC  1071
              ||||| ||||| || || || |  || ||  | || ||||| |||||||| || ||| | 
Sbjct  32689  AACCCTGACGAAGCCGTAGCCTTTGGAGCTGCTGTCCAGGCTGCCATCCTCAGTGGCGAT  32748

Query  1072   GACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGT  1131
              |||  |||    ||||| ||||| ||| | ||||| |||||||| |||||||| || || 
Sbjct  32749  GACAAGTCCTCCAAGCTACAGGATCTGTTGCTGCTTGACGTGACTCCGCTGTCACTCGGG  32808

Query  1132   CTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACC  1191
               | |||||||| |||||||||||||| ||||| ||| |||| |||||| | ||||| || 
Sbjct  32809  TTGGAGACGGCTGGTGGTGTCATGACCACGCTCATCCCGCGCAACACGGCAGTGCCAACG  32868

Query  1192   AAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTG  1251
              |||||||| ||||| |||||||||||||| ||||||||||| || ||| | |||||||| 
Sbjct  32869  AAGAAGTCTCAGACATTCTCGACGTACGCTGACAACCAGCCAGGCGTGTTGATCCAGGTT  32928

Query  1252   TTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGAC  1311
              || ||||| || || || |||||    ||||||||||||||||||||||||| ||| |||
Sbjct  32929  TTTGAGGGAGAACGTTCGATGACCAAGGACAACAACCTGCTGGGCAAGTTCAGCCTCGAC  32988

Query  1312   GGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCG  1371
              || ||||| || ||||| ||||||  |||| |||| || || ||||||||||| || || 
Sbjct  32989  GGTATCCCACCAATGCCACGCGGTAAGCCGGAGATTGAAGTCACGTTCGACATTGATGCC  33048

Query  1372   AACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACG  1431
              ||||||||||| |||||||| || || |||||||| || |||||||| ||||||||||||
Sbjct  33049  AACGGCATCCTCAACGTGTCAGCGGTCGAGAAGTCCACAGGCAAGGACAACAAGATCACG  33108

Query  1432   ATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCC  1491
              ||||| |||||||| ||||| || |||||    || || || ||||||||   |||||||
Sbjct  33109  ATCACAAACGACAAAGGCCGTCTATCGCAAAGCGAGATCGATCGCATGGTGAAGGAGGCC  33168

Query  1492   GAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTG  1551
              |||||||||  |  ||| || |  | |||||||  |||  |||| ||||||||  |||| 
Sbjct  33169  GAGAAGTACGCGAAGGAAGATGCTGATAACAAGGCACGAGTCGACGCCAAGAATACGCTC  33228

Query  1552   GAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGAAGGAGAAGATC  1611
              ||||||||||||||||   ||||||||   ||  |||| |      | ||| || |||| 
Sbjct  33229  GAGAACTACGCCTACAACTTGCGGAACTCACTCGATGATGCACCCGTCAAGCAGCAGATG  33288

Query  1612   CCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCCAGTGGCTGGAC  1671
                 || |  |||   |||  | | |||||    ||||  ||    ||| ||||||| |||
Sbjct  33289  AACGAGGACGACCGCAAGAAGATCGACGATGCCGTGAGCGAGACAATCAAGTGGCTTGAC  33348

Query  1672   GCAAACC-AGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAATTGGAGGGCGT  1730
              ||  ||| | | | | |||||| | | ||| |||  ||| ||||||||  | || ||| |
Sbjct  33349  GCCCACCAAATGAGT-GAGAAGCAGGAGTATGAGATGAAACAGAAGGAGCTTGAAGGCAT  33407

Query  1731   GGCCAACCCAGTGTTGCAGAAGATGTACGC  1760
               ||||||||  |  |||| |||||||||||
Sbjct  33408  CGCCAACCCGATTCTGCAAAAGATGTACGC  33437

 Score = 386 bits (427),  Expect = 2e-104
 Identities = 305/366 (83%), Gaps = 0/366 (0%)
 Strand=Plus/Plus

Query  31     GTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTG  90
              || |||||||||||||| || || |||||||| || || || |||||||||||||| || 
Sbjct  31618  GTGGGCATCGACCTCGGTACCACGTACTCGTGTGTCGGTGTCTGGCAGAACGACCGCGTC  31677

Query  91     GAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGAC  150
              || ||||||||||||||||||||||||||||| || || || ||||| || ||||| |||
Sbjct  31678  GAGATCATCGCCAACGACCAGGGCAACCGCACAACACCATCTTACGTGGCGTTCACGGAC  31737

Query  151    TCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACG  210
              ||||| ||||| || ||||| ||||| ||||| ||||| || |||||||||||||| |||
Sbjct  31738  TCGGAGCGCCTGATTGGTGATGCCGCGAAGAACCAGGTCGCGATGAACGCGCACAATACG  31797

Query  211    GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
              || |||||||| || || || ||||||||||||||| ||||||| || || ||||| |||
Sbjct  31798  GTCTTCGACGCTAAGCGCCTCATCGGCCGCAAGTTCACGGACCCAGTGGTGCAGGCTGAC  31857

Query  271    ATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTG  330
              || ||||| ||||| ||  |||||    | || |||||||||||||| |||||||| || 
Sbjct  31858  ATGAAGCATTGGCCATTTAAAGTGGTCACTGGAGCCGGTGACAAGCCACAGATCACAGTC  31917

Query  331    CAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGATC  390
               ||||||||||||||   |||  |||||| || || |||||||||||||||||||||| |
Sbjct  31918  GAGTTCAAGGGCGAGAAGAAGGTGTTCCAGCCAGAAGAGATCTCGTCCATGGTGCTGACC  31977

Query  391    AAGATG  396
              ||||||
Sbjct  31978  AAGATG  31983

>PHKE:scaffold_102 scf_22126_102.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_102.1:1:102537:1 
REF
Length=102537

 Score = 1005 bits (1114),  Expect = 0.0
 Identities = 1040/1360 (76%), Gaps = 9/1360 (1%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||| ||||||||||| || ||  | ||||||||||| || ||||| || || ||||| |
Sbjct  93045  AGGATGCCGGCGCCATCGCTGGATTGAACGTGCTGCGCATTATCAATGAACCAACGGCTG  93104

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              | |||||||| ||||| |||||||||||| | || |||| ||| ||||| || |||||||
Sbjct  93105  CTGCCATCGCATACGGTCTGGACAAGAAGCGTGGGGAGCACAATGTGCTCATTTTCGACC  93164

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              |||||||||||||||| || || ||||| |||   |||||||| || |||||||| || |
Sbjct  93165  TGGGCGGCGGCACCTTTGACGTCTCTCTGCTGAGTATTGAGGAAGGAATCTTCGAAGTGA  93224

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
              |||||||||| ||||| ||||| |||||||| || ||||||||||| || || || ||  
Sbjct  93225  AGGCCACTGCAGGTGATACGCATCTGGGTGGCGAAGACTTCGACAATCGTCTTGTTGAGT  93284

Query  641    ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
              | ||   |   || || |||||||||||||||||||| ||  ||  || |  ||||||  
Sbjct  93285  ATTTTGTGACCGATTTTAAGCGCAAGCACCGCAAGGATATGTCGACGAGCTCGCGTGCGA  93344

Query  701    TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
              | ||||| ||||| ||||| || || || |||||||| ||  ||||  | || || ||||
Sbjct  93345  TGCGTCGCCTGCGCACGGCATGTGAACGGGCCAAGCGCACTTTGTCCACTTCAGCACAGG  93404

Query  761    CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
              | ||||| ||||| ||||| || ||||| ||  | ||||| ||||||||||| || ||||
Sbjct  93405  CGTACATTGAGATCGACTCACTATTCGATGGTGTGGACTTTAACTCGACCATTACACGTG  93464

Query  821    CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
              | || || ||     |||| |  || | ||| |||||||||||||||||||||| | |||
Sbjct  93465  CGCGCTTTGAATCTCTGTGTGATGATTTCTTTCGCAAGACGATGGAGCCCGTGGCGCAGG  93524

Query  881    TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
              || |||  ||||||||||| |||||| |||| ||||| |||||||||||||| ||||| |
Sbjct  93525  TGTTGCATGACGCCAAGCTATCGAAGGGCCACGTGCAGGAGGTGGTGCTGGTAGGCGGGT  93584

Query  941    CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
              | ||||||||||| |||||||||||  ||||| |||| || ||  |||| || || |   
Sbjct  93585  CCACGCGTATCCCCAAGGTGCAGCAATTGCTGACGGATTTTTTTCACGGGAAAGAACTGT  93644

Query  1001   ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
               ||||||||||||||||||||| |||||||||| |||||| || || ||||||||||| |
Sbjct  93645  TCAAGTCCATCAACCCGGACGAAGCTGTGGCGTTCGGTGCTACAGTTCAGGCGGCCATTC  93704

Query  1061   TGAGCGG---CAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGC  1117
              | || ||       ||| | |||   ||| ||||||| ||||| || ||||||||| |||
Sbjct  93705  TAAGTGGGGCTGGTGACACCTCGTCCAAGTTGCAGGATCTGCTGCTACTGGACGTGGCGC  93764

Query  1118   CGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACA  1177
              | || || || || || ||||| || ||||| ||||||||||| ||||||||||| ||||
Sbjct  93765  CACTATCGCTCGGACTGGAGACTGCAGGTGGAGTCATGACGACACTGATCGCGCGTAACA  93824

Query  1178   CGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGG  1237
              | || || ||  | || |||||||||||||||||||||||| | || ||||||||||| |
Sbjct  93825  CCACAGTTCCTTCTAAAAAGTCGCAGACGTTCTCGACGTACTCGGATAACCAGCCTGGTG  93884

Query  1238   TGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCA  1297
              || | || ||||||||||| || || ||  | ||||| || |||||  |||| |||||||
Sbjct  93885  TGTTGATTCAGGTGTTCGAAGGTGAACGGACGATGACTCGTGACAATCACCTACTGGGCA  93944

Query  1298   AGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGT  1357
              |||||||  ||||||| || || || ||||  || ||| | ||||| ||||| ||||| |
Sbjct  93945  AGTTCAATTTGGACGGTATTCCGCCAATGCGCCGTGGTATACCGCAAATCGATGTGACCT  94004

Query  1358   TCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGG  1417
              |||| ||||| ||||| || || || || ||||| || || ||||| || || |||||||
Sbjct  94005  TCGATATCGATGCGAATGGTATTCTCAATGTGTCAGCCGTCGAGAAATCGACTGGCAAGG  94064

Query  1418   AGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCA  1477
              ||||||||||||| ||||||||||||||||| || || |||||||  || ||||||||||
Sbjct  94065  AGAACAAGATCACCATCACGAACGACAAGGGTCGTCTATCGCAGGACGAGATTGACCGCA  94124

Query  1478   TGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGG  1537
              ||||| | ||||| || |||| ||||    | ||||    |||||| |  || |||||  
Sbjct  94125  TGGTAGCAGAGGCTGATAAGTTCAAGGACCAAGACGCACGTAACAAACTTCGTATCGAAA  94184

Query  1538   CCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAAT---GACGAGA  1594
                |||||| || |||| |||||||| |     |||||    |||  || |   || ||||
Sbjct  94185  GTAAGAACTCGGTGGAAAACTACGCGTTTTCACTGCG---TAGTTCGATTCGCGAGGAGA  94241

Query  1595   AGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAG  1654
              |  ||  ||  ||| || | |  |  || ||| ||| | | || ||||| ||| |||| |
Sbjct  94242  AACTGGCGGTTAAGCTCACCGCCGAGGATAAGCAGGTGATTGAGGACAAAGTGGCGGAGG  94301

Query  1655   TGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGA  1714
              |  |    ||| |||| |  |||||| |    ||||| || | ||  ||  |||||||||
Sbjct  94302  TTCTGAGTTGGTTGGAGGTGAACCAGGCGGCTGAGAAAGAAGAGTTTGATGCGAAGCAGA  94361

Query  1715   AGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGAT  1754
              | || ||||||| ||||||||||||  |  || |||||||
Sbjct  94362  AAGAGTTGGAGGACGTGGCCAACCCCATCATGGAGAAGAT  94401

 Score = 422 bits (467),  Expect = 3e-115
 Identities = 323/380 (85%), Gaps = 2/380 (1%)
 Strand=Plus/Plus

Query  31     GTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTG  90
              || || |||||||| ||||| || |||||||||||||| |||||||||||||||||||||
Sbjct  92585  GTGGGTATCGACCTGGGCACGACGTACTCGTGCGTGGGTGTGTGGCAGAACGACCGTGTG  92644

Query  91     GAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGAC  150
              |||||||||||||| ||||| || ||||| || ||||| || ||||| |||||||| |||
Sbjct  92645  GAAATCATCGCCAATGACCAAGGTAACCGTACAACCCCTTCGTACGTTGCCTTCACGGAC  92704

Query  151    TCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACG  210
               |||| || || ||||| |||||||||||||| |||||||||||||| ||||||||||||
Sbjct  92705  ACGGAGCGTCTGATCGGAGACGCCGCCAAGAACCAGGTGGCCATGAATGCGCACAACACG  92764

Query  211    GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
              |||||||||||||| ||||||||||| |||||||||||||||   |  || ||| | || 
Sbjct  92765  GTGTTCGACGCCAAGCGTCTGATCGGTCGCAAGTTCTCGGACTTGGAAGTGCAGTCGGAT  92824

Query  271    ATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGG-TGACAAGCCGCAGATCACGGT  329
              ||||| || ||||||||| | |||  | || |  ||||   | ||||| ||| |   |||
Sbjct  92825  ATCAAACATTGGCCGTTCAAGGTGGTG-CGTGGTCCGGACAATAAGCCTCAGGTGGTGGT  92883

Query  330    GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGAT  389
              |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct  92884  GCAGTTCAAGGGCGAGTCGAAGACGTTCCAACCGGAGGAGATCTCGTCCATGGTGCTGAT  92943

Query  390    CAAGATGCGCGAGGACGCCG  409
              ||||||||| ||||  ||||
Sbjct  92944  CAAGATGCGTGAGGTGGCCG  92963

 Score = 40.1 bits (43),  Expect = 3.9
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  19     TCTGGATACTCCGTCGGCATCGACCTCGG  47
              ||||||||||| ||||| ||||| |||||
Sbjct  98408  TCTGGATACTCGGTCGGTATCGATCTCGG  98380

>PLHA:NW_020189499.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2592, whole genome shotgun sequence
Length=255817

 Score = 925 bits (1025),  Expect = 0.0
 Identities = 724/865 (84%), Gaps = 0/865 (0%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||| || || ||||| || || ||||| || ||||| ||||||||||| ||||| |
Sbjct  216762  AGGACGCTGGTGCAATTGCTGGTCTTAACGTACTTCGTATTATCAACGAGCCTACGGCTG  216821

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               | || || || |||||| |||||||||||||||| || ||||| ||| ||||||| || |
Sbjct  216822  CTGCTATTGCATACGGCTTGGACAAGAAGGGCGGTGAACGCAATGTGTTGATCTTTGATC  216881

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               | || || || ||||||||||| || ||  ||  ||||||||| || ||||| || || |
Sbjct  216882  TTGGTGGAGGTACCTTCGATGTTTCGCTGTTGAGCATTGAGGAAGGTATCTTTGAAGTGA  216941

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               |||| |||||||||||||| ||||| |||||||||||||| ||||| || || || ||||
Sbjct  216942  AGGCTACTGCTGGTGACACCCACCTTGGTGGTGAGGACTTTGACAATCGTCTTGTAGACC  217001

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
Sbjct  217002  ACTTCACGCAGGAGTTCAAACGTAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCCC  217061

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               | |||||| |||| || || || |||||||| ||||||||| |||| ||||| ||||| |
Sbjct  217062  TGCGTCGTTTGCGTACTGCGTGTGAGCGTGCTAAGCGTACGTTGTCTTCGTCAGCTCAAG  217121

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | |||||||| ||||| || || |||||||| |||||||||||||||||||| |||||||
Sbjct  217122  CATACATCGAAATTGATTCGCTTTTCGACGGTATCGACTTCAACTCGACCATTACTCGTG  217181

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               ||||||| || |||||||| || ||||| |||||||| ||||||||||| |||||||| |
Sbjct  217182  CTCGTTTTGAAGACATGTGTGGAGACTATTTCCGCAAAACGATGGAGCCTGTGGAGAAAG  217241

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               ||||||| ||||| ||||| || || || ||||| ||||| |||||||| ||||| || |
Sbjct  217242  TGCTGCGTGACGCGAAGCTTTCTAAAAGTCAGGTACACGAAGTGGTGCTTGTGGGTGGGT  217301

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               |||| ||||| || ||||||||||| ||| |||| |||||||| |||||||| ||||| |
Sbjct  217302  CGACTCGTATTCCCAAGGTGCAGCAACTGTTGTCCGACTTCTTTAACGGCAAAGAGCCAA  217361

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
               ||||||| |||||||| ||||||||||| || || ||||| || |||||||| || ||  
Sbjct  217362  ACAAGTCGATCAACCCCGACGAGGCTGTTGCCTATGGTGCTACAGTGCAGGCTGCGATTT  217421

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               |||| || ||||||||||| || || ||||| || || |||||||| |||||||| || |
Sbjct  217422  TGAGTGGTAACGACTCGTCTGAAAAACTGCAAGATCTTCTTCTGCTCGACGTGACACCAC  217481

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
               | || ||||| |||||||| || ||||||||||||||||| ||||| || || |||||||
Sbjct  217482  TCTCACTGGGACTCGAGACAGCTGGTGGTGTCATGACGACACTGATTGCTCGTAACACGA  217541

Query  1181    CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
               | || || || || ||||||||||| ||||||||||| |||||||||||||| || || |
Sbjct  217542  CAGTTCCCACTAAAAAGTCGCAGACATTCTCGACGTATGCCGACAACCAGCCGGGTGTTC  217601

Query  1241    TCATCCAGGTGTTCGAGGGCGAGCG  1265
               | || ||||| ||||| || || ||
Sbjct  217602  TGATTCAGGTCTTCGAAGGTGAACG  217626

 Score = 370 bits (410),  Expect = 5e-100
 Identities = 313/385 (81%), Gaps = 0/385 (0%)
 Strand=Plus/Plus

Query  19      TCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAG  78
               ||||||||||||||||| || || || || || || ||||| || || || |||||||| 
Sbjct  216290  TCTGGATACTCCGTCGGTATTGATCTTGGTACGACGTACTCCTGTGTCGGTGTGTGGCAA  216349

Query  79      AACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTC  138
               ||||||||||| |||||||| ||||| |||||||| ||||| || || ||||||||||| 
Sbjct  216350  AACGACCGTGTAGAAATCATTGCCAATGACCAGGGTAACCGTACTACTCCGTCATACGTG  216409

Query  139     GCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAAC  198
               || ||||| ||| | || || || || ||||| || || ||||| || ||||||||||||
Sbjct  216410  GCTTTCACCGACACCGAGCGTCTGATTGGTGATGCGGCTAAGAACCAAGTGGCCATGAAC  216469

Query  199     GCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTC  258
               ||||||||||| |||||||| || || ||| |||| || ||||| || ||||||||  | 
Sbjct  216470  GCGCACAACACCGTGTTCGATGCTAAGCGTTTGATTGGTCGCAAATTTTCGGACCCGCTT  216529

Query  259     GTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCG  318
               || ||||| || |||||||||||||| ||| | ||||| || ||||| |||||||| |||
Sbjct  216530  GTTCAGGCTGATATCAAGCACTGGCCATTCAAGGTGACATCTGGCGCTGGTGACAAACCG  216589

Query  319     CAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCC  378
               ||||||   || ||||| |||||||| || || || ||||| || || || || ||||||
Sbjct  216590  CAGATCGTTGTACAGTTTAAGGGCGAATCGAAAACCTTCCAGCCTGAAGAAATTTCGTCC  216649

Query  379     ATGGTGCTGATCAAGATGCGCGAGG  403
               |||||| ||||||| ||||| ||||
Sbjct  216650  ATGGTGTTGATCAAAATGCGTGAGG  216674

>PYAR:scaffold_111 par_scaffold_111 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_111:1:31656:1 
REF
Length=31656

 Score = 808 bits (895),  Expect = 0.0
 Identities = 711/886 (80%), Gaps = 18/886 (2%)
 Strand=Plus/Plus

Query  1002   CAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCT  1061
              |||||| |||||||| || |||||||| || | ||| || || || ||||| ||||| ||
Sbjct  26628  CAAGTCGATCAACCCTGATGAGGCTGTTGCCTTCGGCGCCACGGTCCAGGCCGCCATTCT  26687

Query  1062   GAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCT  1121
               ||||||||||||  |||||||||||| ||||||||||||||||| || ||||| |||||
Sbjct  26688  CAGCGGCAACGACCAGTCGGAGAAGCTCCAGGACCTGCTTCTGCTCGATGTGACCCCGCT  26747

Query  1122   GTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGAC  1181
              ||| | |||||| ||||||||||||||||||||||||  ||| ||| | || ||||| ||
Sbjct  26748  GTCGCAGGGTCTTGAGACGGCCGGTGGTGTCATGACGGTGCTTATCCCCCGTAACACCAC  26807

Query  1182   GGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCT  1241
              ||| || || |||||| | |||||||||||||||||||||||||||||||| || |||||
Sbjct  26808  GGTCCCCACGAAGAAGACCCAGACGTTCTCGACGTACGCCGACAACCAGCCCGGTGTGCT  26867

Query  1242   CATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTT  1301
              ||||||||| || ||||| ||||| || |||||||| ||||||||||| || ||||||||
Sbjct  26868  CATCCAGGTCTTTGAGGGTGAGCGTTCGATGACGCGTGACAACAACCTTCTCGGCAAGTT  26927

Query  1302   CAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGA  1361
              |||||| ||||| ||||| || ||||| || |||||||||||||| ||||| || |||||
Sbjct  26928  CAACCTCGACGGTATCCCGCCGATGCCGCGTGGTGTGCCGCAGATTGACGTCACCTTCGA  26987

Query  1362   CATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAA  1421
              ||| ||||| ||||| ||| ||||||| ||||| || |||||||| ||||||||||||||
Sbjct  26988  CATTGACGCCAACGGTATCTTGAACGTCTCGGCCGTTGAGAAGTCGACGGGCAAGGAGAA  27047

Query  1422   CAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGT  1481
              |||||| || |||||||||||||||||||| ||||||||||| || || || ||||||||
Sbjct  27048  CAAGATTACCATCACGAACGACAAGGGCCGTCTCTCGCAGGCCGATATCGAGCGCATGGT  27107

Query  1482   ATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAA  1541
                | ||||| |||||||||||||||||||||||||| ||||||   ||||| || |||||
Sbjct  27108  CGCCGAGGCTGAGAAGTACAAGTCGGAGGACGAGGCCAACAAGATCCGCATTGAAGCCAA  27167

Query  1542   GAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGAA  1601
              |||||  || ||||||||||| ||||  || ||||||| ||| || ||||||||| |  |
Sbjct  27168  GAACGGCCTTGAGAACTACGCGTACAACCTCCGGAACACTCTCAACGACGAGAAGCTCCA  27227

Query  1602   GGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCCA  1661
              |    ||||||| || | ||||   |||||  | ||||||||||| |||||  | ||| |
Sbjct  27228  GAGCCAGATCCCCGAGGATGACCGCAAGGCCATTGACGACAAGGTCACGGAGATCATCAA  27287

Query  1662   GTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAATT  1721
               ||||| || ||  ||||| | | ||||||||| | ||  ||| | |||||||| ||  |
Sbjct  27288  CTGGCTCGATGCCCACCAGGCCTCGGAGAAGGAGGAGTTTGAGGCCAAGCAGAAAGAGCT  27347

Query  1722   GGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTGG  1781
               |||||  | || |||||  |  ||||||||||||||||  ||     |||     ||||
Sbjct  27348  TGAGGGTATCGCTAACCCCATCCTGCAGAAGATGTACGC--CT-----CGG-----CTGG  27395

Query  1782   TGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGG------CGGCATGCCTGGTGCTCCCCC  1835
              ||| |  || || ||||||||||| | ||||||       ||   ||| ||| |  ||||
Sbjct  27396  TGCCGCTGGCGGCATGCCCGGTGGCGCGCCGGGTGCCCCGGGTGCGCCCGGTCCGGCCCC  27455

Query  1836   TGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
                | | || ||  |||||||||||||||||||||||||||||||||
Sbjct  27456  GTCGGCTGGTGGCGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  27501

 Score = 279 bits (308),  Expect = 2e-72
 Identities = 193/219 (88%), Gaps = 0/219 (0%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||| ||||| ||||||||||| ||||||||||| ||||||||||| |||||||||||||
Sbjct  26203  AGGATGCCGGTGCCATTGCCGGTCTCAACGTGCTCCGTATCATCAATGAGCCGACGGCCG  26262

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              | || ||||||||||| || |||||||||||||| |||||||||||||| |||||||| |
Sbjct  26263  CTGCTATCGCGTACGGTCTCGACAAGAAGGGCGGTGAGCGCAACGTGCTCATCTTCGATC  26322

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              | || ||||| |||||||||||||| || ||   |||||| ||||| |||||||||||||
Sbjct  26323  TTGGTGGCGGTACCTTCGATGTGTCGCTGCTCAGCATTGAAGAGGGTATCTTCGAGGTCA  26382

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACT  619
              ||||||| || ||||| |||||| |||||||||||||||
Sbjct  26383  AGGCCACGGCCGGTGATACGCACTTGGGTGGTGAGGACT  26421

 Score = 217 bits (240),  Expect = 7e-54
 Identities = 171/205 (83%), Gaps = 0/205 (0%)
 Strand=Plus/Plus

Query  20     CTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGA  79
              |||||   |||||||| ||||| || || || || ||||||||||| |||||||||||||
Sbjct  25717  CTGGAGCGTCCGTCGGTATCGATCTTGGTACCACGTACTCGTGCGTCGGCGTGTGGCAGA  25776

Query  80     ACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCG  139
              |||||||||| || || ||||||||||||||||| ||||| || || || || |||||||
Sbjct  25777  ACGACCGTGTCGAGATTATCGCCAACGACCAGGGTAACCGTACGACGCCTTCGTACGTCG  25836

Query  140    CCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACG  199
              ||||||| |||   || || ||||| ||||| ||||||||||| ||||| || |||||||
Sbjct  25837  CCTTCACGGACAGCGAGCGTCTCATTGGTGATGCCGCCAAGAACCAGGTCGCGATGAACG  25896

Query  200    CGCACAACACGGTGTTCGACGCCAA  224
              |  | |||||||| |||||||||||
Sbjct  25897  CCGAGAACACGGTCTTCGACGCCAA  25921

 Score = 137 bits (151),  Expect = 2e-29
 Identities = 92/103 (89%), Gaps = 0/103 (0%)
 Strand=Plus/Plus

Query  301    GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
              || ||||| |||||||||||||||||||||   ||||||||||||  |||||||||||| 
Sbjct  26013  GGTGCCGGCGACAAGCCGCAGATCACGGTGACCTTCAAGGGCGAGAGCAAGACGTTCCAG  26072

Query  361    CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGG  403
              ||||||||||||||||| |||||||||| ||||||||| ||||
Sbjct  26073  CCCGAGGAGATCTCGTCGATGGTGCTGACCAAGATGCGTGAGG  26115

>ALCA:scaffold_7 AcNc2_CONTIG_7_length_223839 dna:supercontig 
supercontig:ASM107853v1:AcNc2_CONTIG_7_length_223839:1:223839:1 
REF
Length=223839

 Score = 803 bits (890),  Expect = 0.0
 Identities = 1037/1427 (73%), Gaps = 6/1427 (0%)
 Strand=Plus/Plus

Query  403    GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
              ||||| || || || |||||  | |||||||| || |||||||| || || || || || 
Sbjct  47653  GACGCGGGTGCGATCGCCGGTTTGAACGTGCTTCGAATCATCAATGAACCAACTGCAGCT  47712

Query  463    GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
              ||||| ||||||||  | || ||||| ||    ||  |||| ||||| |||||||| || 
Sbjct  47713  GCCATTGCGTACGGTTTAGAGAAGAAAGGTCAAGAATGCAATGTGCTCATCTTCGATCTT  47772

Query  523    GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
              || || || || |||||||||||  |  || |||||||||| || || || || || || 
Sbjct  47773  GGTGGAGGTACATTCGATGTGTCCTTGTTGACCATTGAGGACGGAATTTTTGAAGTTAAA  47832

Query  583    GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
              ||||| ||||| ||||| ||| |||||||||| || || |||||||| || || ||||| 
Sbjct  47833  GCCACAGCTGGAGACACCCACTTGGGTGGTGAAGATTTTGACAACCGTCTAGTAGACCAT  47892

Query  643    TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
              ||       || ||||||||||| ||||| || ||||||||   |||||| ||||| || 
Sbjct  47893  TTTGTTGCTGAATTCAAGCGCAAACACCGTAAAGACATCACCACGAACCAACGTGCACTG  47952

Query  703    CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
              ||||| || || ||| | || || ||||||||||||||||| || ||||| |||||||| 
Sbjct  47953  CGTCGACTACGTACGTCATGTGAACGTGCCAAGCGTACGCTTTCTTCGTCTGCTCAGGCA  48012

Query  763    TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
              ||||| || || ||||| ||   ||| || || |||||||||||  |||||||||| |||
Sbjct  48013  TACATTGAAATCGACTCGCTCGCCGATGGAATTGACTTCAACTCATCCATCACTCGAGCT  48072

Query  823    CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
              |||||||| ||  | ||   ||| |||||||| || || ||||| || || || || || 
Sbjct  48073  CGTTTCGAAGATTTATGTTCCGATTACTTCCGTAAAACAATGGACCCTGTCGAAAAAGTC  48132

Query  883    CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
               |||| ||  ||||  |||||||||| || || ||||| || || || || || || || 
Sbjct  48133  TTGCGTGATTCCAAATTGTCGAAGAGTCAAGTACACGAAGTTGTCCTTGTCGGTGGTTCT  48192

Query  943    ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
              || |||||||| |||||||| || ||  | || ||||||||||||  ||| |||||   |
Sbjct  48193  ACCCGTATCCCCAAGGTGCAACAACTCTTATCAGACTTCTTCAACAACAAAGAGCCGTGC  48252

Query  1003   AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
              || || |||||||| || || ||||| || | ||||||||| ||||| || ||||| || 
Sbjct  48253  AAATCGATCAACCCTGATGAAGCTGTTGCATTCGGTGCGACTGTGCAAGCCGCCATTCTT  48312

Query  1063   AGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTG  1122
              || || || ||    || || ||  | || ||  |||| || ||||| ||  | ||| ||
Sbjct  48313  AGTGGTAATGATCAATCCGAAAAATTACAAGATTTGCTGCTACTGGATGTCGCTCCGTTG  48372

Query  1123   TCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACG  1182
              || || ||| | ||||| ||||| ||||| |||||    || ||| || | ||||| || 
Sbjct  48373  TCACTCGGTTTAGAGACTGCCGGAGGTGTAATGACCGTTCTCATCCCGAGAAACACCACC  48432

Query  1183   GTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTC  1242
               | || || ||||| || |||  |||||| || | |   |||||||||    | ||   |
Sbjct  48433  ATCCCTACGAAGAAATCTCAGTTGTTCTCCACATTCCAAGACAACCAGTGCAGTGTATGC  48492

Query  1243   ATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTC  1302
              ||||| || || || || ||| | || ||||| || ||||||||||| || || || |||
Sbjct  48493  ATCCAAGTCTTTGAAGGTGAGAGATCGATGACTCGTGACAACAACCTTCTCGGAAAATTC  48552

Query  1303   AACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTT-CGA  1361
              ||| ||||||| || || || |||||||| || || || || ||||| || | ||| |||
Sbjct  48553  AACTTGGACGGTATTCCGCCAATGCCTCGAGGAGTTCCTCAAATCGAAGT-ATGTTACGA  48611

Query  1362   CATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAA  1421
              ||| ||||| || || ||| | ||||| || ||||| ||||| || || || ||||| ||
Sbjct  48612  CATTGACGCCAATGGTATCTTAAACGTTTCAGCTGTTGAGAAATCGACAGGAAAGGAAAA  48671

Query  1422   CAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGT  1481
              ||||||||| ||||| ||||||||||| ||||| || |||||||| || || ||||||||
Sbjct  48672  CAAGATCACCATCACCAACGACAAGGGTCGCCTATCCCAGGCTGATATCGATCGCATGGT  48731

Query  1482   ATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAA  1541
               ||||| || || || ||||||    | ||||| || |||||    || || || || ||
Sbjct  48732  TTCGGAAGCTGAAAAATACAAGCAACAAGACGAAGCCAACAAAGTCCGAATTGAAGCTAA  48791

Query  1542   GAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGAA  1601
               ||||   | || || |||||||||| ||| || |||   ||||| ||||| ||| ||||
Sbjct  48792  AAACGGATTAGAAAATTACGCCTACAATCTCCGCAACTCCCTGAACGACGAAAAGCTGAA  48851

Query  1602   GGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCCA  1661
              |    || |  | ||||  ||    ||||   |||| |||||| |  | ||    ||   
Sbjct  48852  GAGCCAGCTTTCCGAAGACGATCGAAAGGTCTTGGATGACAAGATCTCTGAGACTATGAG  48911

Query  1662   GTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAATT  1721
               ||||| || || || || ||    || ||||| | ||||||       ||||| || ||
Sbjct  48912  TTGGCTCGATGCCAATCAATCTGCTGAAAAGGAGGAGTACGAAAAACTACAGAAAGATTT  48971

Query  1722   GGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTGG  1781
              ||| | | | ||||||||  |  | || || ||||| |||||||| || ||| |   |||
Sbjct  48972  GGAAGCCATTGCCAACCCGATTCTACAAAAAATGTATGCTGCTGCCGGAGGTGCAGGTGG  49031

Query  1782   --TGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGG  1826
                |||    || |||||||| || ||| |||| || || ||||| ||
Sbjct  49032  AATGC--CAGGAGGTATGCCAGGAGGTATGCCCGGAGGTATGCCAGG  49076

 Score = 555 bits (615),  Expect = 2e-155
 Identities = 776/1084 (72%), Gaps = 7/1084 (1%)
 Strand=Plus/Plus

Query  415    ATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCCGCCATCGCGTAC  474
              ||||| ||  | || || || || ||  |||||||||| || || || || || || |||
Sbjct  43946  ATTGCTGGAATAAATGTACTCCGAATTCTCAACGAGCCTACCGCAGCAGCTATAGCATAC  44005

Query  475    GGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTGGGCGGCGGCACC  534
              || || ||||||||||| || || | ||||||||| || |||||||| || || || || 
Sbjct  44006  GGACTTGACAAGAAGGGTGGAGAACACAACGTGCTAATTTTCGACCTTGGTGGTGGAACG  44065

Query  535    TTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAGGCCACTGCTGGT  594
              || ||||||||  | ||  | || || || ||  | || || || |  || || ||||||
Sbjct  44066  TTTGATGTGTCGTTGCTCACGATCGAAGAAGGGGTTTTTGAAGTAAGAGCTACGGCTGGT  44125

Query  595    GACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCACTTCACGCAGGAG  654
              ||||| ||  |||||||||| ||||| ||||| ||  | || || || |||  |   |||
Sbjct  44126  GACACACATTTGGGTGGTGAAGACTTTGACAATCGGTTAGTAGAGCATTTCTTGGCCGAG  44185

Query  655    TTCAAGCGCAAGCACCGCAAGGA--CATCACGGAGAACCAGCGTGCTCTTCGTCGTCTGC  712
              ||||| || ||  | || || ||   |||||  | || ||||| || || || || || |
Sbjct  44186  TTCAAACGAAAATATCGGAAAGATTTATCAC--AAAATCAGCGAGCACTACGGCGACTTC  44243

Query  713    GGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCTTACATCGAGA  772
              | |  || || || || || || || ||  | ||||||   || || || ||||| ||||
Sbjct  44244  GAAGTGCGTGTGAACGCGCAAAACGAACTTTATCGTCGAGCGCGCAAGCGTACATTGAGA  44303

Query  773    TTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCTCGTTTCGAGG  832
              | || ||  |    || ||  | || ||||||   || ||||| || ||||| || || |
Sbjct  44304  TCGATTCATTACATGAGGGAGTTGATTTCAACAGCACAATCACACGAGCTCGCTTTGAAG  44363

Query  833    ACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTGCTGCGCGACG  892
              |  ||||| |||||||||| || || || |||||||| || || || || || |||||||
Sbjct  44364  ATCTGTGCAGCGACTACTTTCGAAAAACCATGGAGCCAGTTGAAAAAGTACTTCGCGACG  44423

Query  893    CCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCC  952
              | || ||  |||| |  ||| |||| ||  | ||| |||| || ||||| ||||| ||||
Sbjct  44424  CAAAACTCGCGAAAAATCAGCTGCATGAAATCGTGTTGGTCGGTGGCTCCACGCGAATCC  44483

Query  953    CGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCA  1012
              | || || || ||  || | || || || |||||||| || |||| | ||||||| ||||
Sbjct  44484  CAAAAGTACAACAAATGTTATCCGATTTTTTCAACGGAAAAGAGCTCTACAAGTCAATCA  44543

Query  1013   ACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTGAGCG--GCAA  1070
              | || |||||||| || || |||||||| || || ||||| || ||||| || |  |   
Sbjct  44544  ATCCCGACGAGGCAGTCGCATACGGTGCTACGGTCCAGGCCGCTATCCTCAGTGGTGGTT  44603

Query  1071   CGACTC-GTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGG  1129
              ||  ||  || |||| ||| ||| |  |  | ||  | |||||  | ||  ||||  |||
Sbjct  44604  CGGATCAATCTGAGAGGCTACAGAATGTTGTGCTTTTAGACGTTGCTCCATTGTCAATGG  44663

Query  1130   GTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACGGTGCCGA  1189
              | |||||||| |||||||| || |||||     |||| || || || ||||| ||||| |
Sbjct  44664  GGCTCGAGACTGCCGGTGGAGTGATGACTGTCTTGATTGCACGAAATACGACCGTGCCCA  44723

Query  1190   CCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGG  1249
              | |  || ||||||||||| |||||||| ||||| || |||  ||| ||  | || || |
Sbjct  44724  CTAGAAAATCGCAGACGTTTTCGACGTATGCCGATAATCAGAGTGGAGTCTTGATACAAG  44783

Query  1250   TGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGG  1309
              ||| ||| || ||||| || ||||| ||||||||| |  |||| || || |||||| |||
Sbjct  44784  TGTACGAAGGTGAGCGGTCAATGACTCGCGACAACCATTTGCTAGGTAAATTCAACTTGG  44843

Query  1310   ACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACG  1369
              | || || || || ||||| || |||||||| || ||||| || || || ||  |||| |
Sbjct  44844  AGGGAATTCCGCCAATGCCACGAGGTGTGCCTCAAATCGAAGTAACCTTTGAAGTCGATG  44903

Query  1370   CGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCA  1429
              |||| || || || |  ||  | || || |||||||| || || |||||||| || ||||
Sbjct  44904  CGAATGGTATTCTCAGTGTTACTGCGGTTGAGAAGTCGACCGGTAAGGAGAATAAAATCA  44963

Query  1430   CGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGG  1489
              |||| ||||| |||||||| || || ||  |||  || || || || ||||||   || |
Sbjct  44964  CGATAACGAATGACAAGGGACGTCTATCAAAGGAGGAAATAGATCGAATGGTACAAGAAG  45023

Query  1490   CCGA  1493
              ||||
Sbjct  45024  CCGA  45027

 Score = 221 bits (244),  Expect = 6e-55
 Identities = 274/370 (74%), Gaps = 4/370 (1%)
 Strand=Plus/Plus

Query  34     GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
              || || || || || ||||| ||||| || ||||| || ||||| || || || || |||
Sbjct  47194  GGTATTGATCTTGGTACAACTTACTCATGTGTGGGTGTCTGGCAAAATGATCGAGTCGAA  47253

Query  94     ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
              || || || |||||||| || ||||| ||||| ||||| ||||| || ||||| ||| | 
Sbjct  47254  ATTATTGCTAACGACCAAGGAAACCGAACCACTCCGTCCTACGTTGCTTTCACCGACACT  47313

Query  154    GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGC-GCACAACACGGT  212
              ||||| || || ||||| ||||| || || || || ||||||||||| ||| ||||| ||
Sbjct  47314  GAACGTCTTATTGGTGATGCCGCTAAAAACCAAGTAGCCATGAACGCAGCA-AACACCGT  47372

Query  213    GTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACAT  272
               ||||||||||||||| |||| || || |  || ||||||||  ||||||| || |||||
Sbjct  47373  CTTCGACGCCAAACGTTTGATTGGTCGAACTTTTTCGGACCCAATCGTCCAAGCTGACAT  47432

Query  273    CAAGCACTGGCCGTTC-CAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGC  331
               ||||||||||| ||| ||  | |   ||| | | ||  |||||||   ||||   ||  
Sbjct  47433  GAAGCACTGGCCATTCACAGTTCAAAACGGAC-CTGGCAACAAGCCCTTGATCGAAGTCA  47491

Query  332    AGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGATCA  391
                || ||||| ||    || |  || ||||| || || || || || ||||||||  | |
Sbjct  47492  CCTTTAAGGGTGAAAAGAAAATTTTTCAACCTGAAGAAATTTCCTCAATGGTGCTCGTAA  47551

Query  392    AGATGCGCGA  401
              ||||||| ||
Sbjct  47552  AGATGCGTGA  47561

 Score = 187 bits (206),  Expect = 1e-44
 Identities = 272/379 (72%), Gaps = 8/379 (2%)
 Strand=Plus/Plus

Query  28     TCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGT  87
              || || || || || || || || || || ||||||||||| || |||||||| || |||
Sbjct  43469  TCAGTTGGTATTGATCTTGGAACTACTTATTCGTGCGTGGGAGTATGGCAGAATGATCGT  43528

Query  88     GTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACA  147
              || || || |||||||||||||| || ||| | || || ||||| || ||||| || || 
Sbjct  43529  GTCGAGATAATCGCCAACGACCAAGGGAACAGAACGACACCGTCGTATGTCGCTTTTACT  43588

Query  148    GACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAAC  207
              |     ||| | || || ||||| || || ||||| ||||| |||||||| ||| | |||
Sbjct  43589  GGTAATGAAAGGCTGATTGGTGAGGCAGCAAAGAACCAGGTTGCCATGAATGCGGAGAAC  43648

Query  208    ACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCC  267
              || ||||||||||| ||||| || || || ||||| |||   || |  |  ||||||   
Sbjct  43649  ACTGTGTTCGACGCAAAACGGCTTATTGGTCGCAAATTCCACGATCAGGCTGTCCAGCAG  43708

Query  268    GACATCAAGCACTGGCCGTTCCAAGTGACGT---CGGGCGCCGGTGACAAGCCGCAGATC  324
              || | |||||||||||| || |  ||| |||   ||| | | |  ||||| || || |||
Sbjct  43709  GATACCAAGCACTGGCCTTTTC--GTGTCGTATGCGGAC-CAGAGGACAAACCACAAATC  43765

Query  325    ACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTG  384
                 ||| |  |||| || | |   |||| |||  |  |||| ||||| ||| | ||||| 
Sbjct  43766  GTTGTGGAAGTCAAAGGGGCGAAAAAGATGTTTTATGCCGAAGAGATTTCGGCAATGGT-  43824

Query  385    CTGATC-AAGATGCGCGAG  402
               | ||| |||||||| |||
Sbjct  43825  TTTATCGAAGATGCGGGAG  43843

>ALLA:FR824064 dna:supercontig supercontig:ENA1:FR824064:1:197315:1 
REF
Length=197315

 Score = 799 bits (885),  Expect = 0.0
 Identities = 1036/1428 (73%), Gaps = 4/1428 (0%)
 Strand=Plus/Plus

Query  403    GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
              |||||||| ||||| || ||  | || || || || |||||||| || || || || || 
Sbjct  12910  GACGCCGGTGCCATCGCTGGTTTGAATGTTCTTCGAATCATCAATGAACCTACAGCAGCT  12969

Query  463    GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
              || || ||||| ||  | || ||||| ||    ||  |||| || || |||||||| || 
Sbjct  12970  GCTATTGCGTATGGTTTAGAGAAGAAAGGTCAAGAATGCAATGTTCTTATCTTCGATCTT  13029

Query  523    GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
              || || || || |||||||||||  |  || ||||||| || || ||||| || ||||| 
Sbjct  13030  GGTGGAGGTACATTCGATGTGTCCTTGTTGACCATTGAAGACGGAATCTTTGAAGTCAAA  13089

Query  583    GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
              ||||| || |||||||| ||| |||| ||||| ||||| ||||||||  |||||||||||
Sbjct  13090  GCCACCGCAGGTGACACTCACTTGGGAGGTGAAGACTTTGACAACCGTTTGGTGGACCAC  13149

Query  643    TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
              ||       || ||||||||||| |||||||| |||||||||   ||||| |||||  | 
Sbjct  13150  TTTGTTGCTGAATTCAAGCGCAAACACCGCAAAGACATCACGACCAACCAACGTGCGTTG  13209

Query  703    CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
              |||||| |||| ||| | || |||||||| |||||||| || |||||||||||||| || 
Sbjct  13210  CGTCGTTTGCGTACGTCTTGTGAGCGTGCTAAGCGTACTCTTTCGTCGTCGGCTCAAGCG  13269

Query  763    TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
              ||||| || |||||||||||    || || || |||||||||||  ||||||| || || 
Sbjct  13270  TACATTGAAATTGACTCTCTTGCTGATGGTATTGACTTCAACTCATCCATCACCCGAGCA  13329

Query  823    CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
              |||||||| ||  |||||   ||||| ||||| || || ||||| || || || || |||
Sbjct  13330  CGTTTCGAAGATTTGTGCTCTGACTATTTCCGTAAAACTATGGATCCAGTCGAAAAAGTG  13389

Query  883    CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
              || || ||| | ||  |||| ||||| || |||||||| || || || || || || || 
Sbjct  13390  CTACGTGACTCTAAATTGTCCAAGAGTCAAGTGCACGAAGTTGTACTTGTCGGAGGTTCC  13449

Query  943    ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
              || |||||||| ||||| || || ||  |||| ||||||||||||  ||| |||||   |
Sbjct  13450  ACTCGTATCCCCAAGGTTCAACAACTTTTGTCAGACTTCTTCAACAACAAAGAGCCGTGC  13509

Query  1003   AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
              || || |||||||| || || || || || | ||| || || ||||| || ||||| || 
Sbjct  13510  AAATCAATCAACCCTGATGAAGCCGTCGCATTCGGAGCTACTGTGCAAGCTGCCATTCTT  13569

Query  1063   AGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTG  1122
              || || || |||   || || ||||| || || ||||| || || || ||  | ||  ||
Sbjct  13570  AGTGGAAATGACCAATCCGAAAAGCTACAAGATCTGCTGCTTCTAGATGTTGCTCCATTG  13629

Query  1123   TCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACG  1182
              || || ||  | || || || || |||||||||||    |||||| |  | ||||| || 
Sbjct  13630  TCCCTTGGATTAGAAACCGCTGGGGGTGTCATGACTGTTCTGATCCCCAGAAACACCACA  13689

Query  1183   GTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTC  1242
               | || || ||||| || |||  |||||| || | |   |||||||||    | |||  |
Sbjct  13690  ATTCCTACAAAGAAATCTCAGTTGTTCTCTACTTTCCAAGACAACCAGTGCAGTGTGTGC  13749

Query  1243   ATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTC  1302
              ||||| || || || || ||||| || ||||| || ||||||||| | || || || |||
Sbjct  13750  ATCCAAGTCTTTGAAGGAGAGCGATCGATGACTCGTGACAACAACTTACTTGGAAAATTC  13809

Query  1303   AACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGAC  1362
              ||  |||| || || || || |||||||| ||||| || || || || |||   |  |||
Sbjct  13810  AATTTGGATGGTATTCCACCGATGCCTCGTGGTGTTCCTCAAATTGAGGTGTGTTATGAC  13869

Query  1363   ATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAAC  1422
              || ||||| || || ||| | ||||| || || || ||||| || || || |||||||||
Sbjct  13870  ATTGACGCAAATGGTATCTTAAACGTTTCAGCCGTTGAGAAATCTACCGGGAAGGAGAAC  13929

Query  1423   AAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTA  1482
              |||||||| ||||| || ||||||||||| ||||| |||||||| ||||| || ||||| 
Sbjct  13930  AAGATCACCATCACCAATGACAAGGGCCGTCTCTCTCAGGCTGATATTGATCGAATGGTT  13989

Query  1483   TCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAAG  1542
              || || ||||| ||||||||   | | || || ||||||||    || || || ||||||
Sbjct  13990  TCCGAAGCCGAAAAGTACAAACAGCAAGATGAAGCTAACAAAGTTCGAATTGAAGCCAAG  14049

Query  1543   AACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGAAG  1602
              || |   | || || ||||| ||||  || || ||   |||||| ||||||||  |||||
Sbjct  14050  AATGGATTAGAAAATTACGCATACAACCTCCGAAATTCTCTGAACGACGAGAAATTGAAG  14109

Query  1603   -GAGAA-GATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCC  1660
               |  ||  ||||  |||| ||||   |||    |||| || ||| |  | ||    ||  
Sbjct  14110  AGCCAATTATCC--GAAGATGACCGAAAGATTCTGGATGATAAGATCTCAGAGACTATGA  14167

Query  1661   AGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAAT  1720
              | ||||| ||||| || || ||    || || || | ||||||   |   || ||||| |
Sbjct  14168  ACTGGCTCGACGCCAATCAATCGGCTGAAAAAGAAGAGTACGAAAAGTTACAAAAGGATT  14227

Query  1721   TGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTG  1780
              |||| | | | ||||| ||| | || ||||| ||||| || || || || ||| |   ||
Sbjct  14228  TGGAAGCCATTGCCAATCCAATCTTACAGAAAATGTATGCCGCAGCAGGAGGTGCAGGTG  14287

Query  1781   GTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTG  1828
              ||      || |||||||| |||||  |||| || || ||||| ||||
Sbjct  14288  GTATGCCAGGCGGTATGCCTGGTGGAATGCCTGGAGGTATGCCCGGTG  14335

 Score = 606 bits (671),  Expect = 1e-170
 Identities = 828/1154 (72%), Gaps = 3/1154 (0%)
 Strand=Plus/Plus

Query  403    GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
              || || ||||  ||||| ||  | || || || || ||  | |||||||| || || || 
Sbjct  8964   GATGCAGGCGTTATTGCTGGAATAAATGTACTTCGGATTTTGAACGAGCCAACCGCAGCA  9023

Query  463    GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
              || || |||||||| || |||||||| || ||||||| |||||||||||| || ||||| 
Sbjct  9024   GCTATAGCGTACGGGCTTGACAAGAAAGGGGGCGAGCACAACGTGCTGATTTTTGACCTT  9083

Query  523    GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
              ||||| || || || ||||||||  | ||| | ||||| || ||  | || || ||    
Sbjct  9084   GGCGGTGGAACATTTGATGTGTCGTTGCTGACGATTGAAGAAGGAGTTTTTGAAGTACGA  9143

Query  583    GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
              || || ||||||||||| ||  |||| || || ||||||||||| ||  |||| || || 
Sbjct  9144   GCTACGGCTGGTGACACACATTTGGGCGGGGAAGACTTCGACAATCGATTGGTAGAGCAT  9203

Query  643    TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
              ||   |  ||| ||||| |||||  |||| || ||  |  || | |||||  | ||||| 
Sbjct  9204   TTTTTGACGGAATTCAAACGCAAATACCGGAAAGATTTATCGCAAAACCAAAGAGCTCTA  9263

Query  703    CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
              ||||| || || |  || || || || || || || || || || |||   || || || 
Sbjct  9264   CGTCGCCTACGAAGTGCTTGTGAACGAGCAAAACGAACTCTATCATCGAGCGCCCAAGCA  9323

Query  763    TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
              ||||||||||| || ||  ||   || ||  |||| |||||    || ||||| || |||
Sbjct  9324   TACATCGAGATCGATTCATTGCATGAAGGAGTCGATTTCAATAGCACAATCACACGAGCT  9383

Query  823    CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
              || ||||| ||  | ||| |||||||||| || || || ||||| || |||||    || 
Sbjct  9384   CGATTCGAAGATCTATGCAGCGACTACTTTCGAAAAACAATGGATCCAGTGGAACGAGTA  9443

Query  883    CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
              || |||||||| || || |||||||  ||| || | ||  | ||  |||| || || || 
Sbjct  9444   CTTCGCGACGCAAAACTATCGAAGAATCAGCTGAATGAAATCGTCTTGGTCGGTGGGTCT  9503

Query  943    ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
              || || ||||| || ||||| ||  || |||| || ||||||||||| |||||||   ||
Sbjct  9504   ACACGAATCCCAAAAGTGCAACAATTGTTGTCCGATTTCTTCAACGGGAAGGAGCTATAC  9563

Query  1003   AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
              || || ||||| || || ||||| || || ||||| || || || ||||| || ||||| 
Sbjct  9564   AAATCAATCAATCCCGATGAGGCAGTCGCATACGGCGCTACGGTCCAGGCTGCTATCCTC  9623

Query  1063   AGCG--GCAACGACTC-GTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCG  1119
              || |  ||  ||  ||  ||||||| ||| ||  || |  | ||  |||||||  | || 
Sbjct  9624   AGTGGTGCCTCGGATCAATCGGAGAGGCTTCAAAACGTTGTACTTTTGGACGTCGCACCA  9683

Query  1120   CTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACG  1179
               ||||  |||| |||||||| ||||| || || |||||   | ||||  |  | || |||
Sbjct  9684   TTGTCAATGGGACTCGAGACCGCCGGAGGAGTGATGACTGTGTTGATTCCAAGAAATACG  9743

Query  1180   ACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTG  1239
              |||||||| || |  || || || ||||| ||||| || || || || ||||| || || 
Sbjct  9744   ACGGTGCCCACTAGAAAATCACAAACGTTTTCGACATATGCAGATAATCAGCCGGGAGTA  9803

Query  1240   CTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAG  1299
              || || || |||| ||| ||||||||  | ||||| ||||||||| || | || ||||| 
Sbjct  9804   CTGATTCAAGTGTACGAAGGCGAGCGAACTATGACTCGCGACAACCACTTACTTGGCAAA  9863

Query  1300   TTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTC  1359
              ||||||||||| |  || || || ||||| || |||||||| || ||||| || || |||
Sbjct  9864   TTCAACCTGGAGGAAATTCCACCGATGCCGCGAGGTGTGCCTCAAATCGAAGTAACCTTC  9923

Query  1360   GACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAG  1419
              ||  |||| ||||| ||||| || |  ||  | || || |||||||| || || ||||||
Sbjct  9924   GAAGTCGATGCGAATGGCATTCTCAGTGTCACTGCGGTCGAGAAGTCGACCGGTAAGGAG  9983

Query  1420   AACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATG  1479
              ||||| |||||||| ||||| |||||||| ||| | ||| |||  || || ||||| |||
Sbjct  9984   AACAAAATCACGATAACGAATGACAAGGGACGCTTGTCGAAGGAGGAAATCGACCGGATG  10043

Query  1480   GTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCC  1539
              ||    || || ||    ||||||    | ||||||   || |||| |||| | |||  |
Sbjct  10044  GTTCAAGAAGCAGACCTTTACAAGGATCAAGACGAGCGCAATAAGCTACGCGTGGAGTGC  10103

Query  1540   AAGAACGCGCTGGA  1553
              || |||  ||||||
Sbjct  10104  AAAAACAAGCTGGA  10117

 Score = 267 bits (295),  Expect = 2e-68
 Identities = 282/369 (76%), Gaps = 2/369 (1%)
 Strand=Plus/Plus

Query  34     GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
              || ||||| || || ||||| ||||| || ||||| |||||||| ||||| || || || 
Sbjct  12451  GGTATCGATCTTGGAACAACATACTCATGTGTGGGTGTGTGGCAAAACGATCGAGTAGAG  12510

Query  94     ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
              ||||| ||||||||||| || ||||| |||||||| || ||||| || ||||| ||| | 
Sbjct  12511  ATCATTGCCAACGACCAAGGAAACCGAACCACCCCATCCTACGTTGCATTCACTGACACT  12570

Query  154    GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGGTG  213
              ||||| ||||||||||| || || |||||||| || |||||||||||   |||||| || 
Sbjct  12571  GAACGTCTCATCGGTGATGCTGCGAAGAATCAAGTCGCCATGAACGCTGCCAACACCGTC  12630

Query  214    TTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACATC  273
              ||||||||||||||| ||||||| || | ||||||||||||  | ||||| |||||||| 
Sbjct  12631  TTCGACGCCAAACGTTTGATCGGTCGAACGTTCTCGGACCCAATTGTCCAAGCCGACATG  12690

Query  274    AAGCACTGGCCGTTCCAAGT-GACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGCA  332
              ||||| ||||| |||  |||  |   ||| | | ||  |||| ||   ||||   ||   
Sbjct  12691  AAGCATTGGCCTTTCACAGTCCAAAACGGAC-CTGGCAACAAACCCTTGATCGAAGTCAT  12749

Query  333    GTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGATCAA  392
               || ||||| ||    || |  |||||||| || || ||||| |||||||| ||  | ||
Sbjct  12750  CTTTAAGGGAGAAAAGAAAATCTTCCAACCTGAAGAAATCTCTTCCATGGTTCTTGTGAA  12809

Query  393    GATGCGCGA  401
              |||||| ||
Sbjct  12810  GATGCGTGA  12818

 Score = 163 bits (180),  Expect = 1e-37
 Identities = 261/375 (70%), Gaps = 0/375 (0%)
 Strand=Plus/Plus

Query  28    TCCGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGT  87
             || || ||||||||  | || || || || ||||||||||| || |||||||| || |||
Sbjct  8499  TCTGTTGGCATCGATTTGGGAACGACTTATTCGTGCGTGGGAGTATGGCAGAATGATCGT  8558

Query  88    GTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACA  147
             ||||| || || ||||| ||||| || ||| | || || ||||| || ||||| ||||| 
Sbjct  8559  GTGGAGATTATTGCCAATGACCAAGGAAACAGAACGACACCGTCTTATGTCGCTTTCACC  8618

Query  148   GACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAAC  207
             |     ||||| || || || || || || ||||| ||||| || ||||| ||| | |||
Sbjct  8619  GGTAACGAACGTCTGATTGGGGAGGCAGCAAAGAACCAGGTTGCTATGAATGCGGAGAAC  8678

Query  208   ACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCC  267
             || || || || || ||||| || || || ||||||||    ||||     ||||||   
Sbjct  8679  ACTGTCTTTGATGCAAAACGGCTCATTGGTCGCAAGTTTCATGACCAGACTGTCCAGCAG  8738

Query  268   GACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACG  327
             || |  ||||| ||||| |||   ||    |  ||| | |  ||||| || || |||   
Sbjct  8739  GATACTAAGCATTGGCCTTTCTCTGTCGTATGTGGCCCGGAAGACAAACCTCAAATCGTT  8798

Query  328   GTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTG  387
             ||| |  |||| ||||     || | |||| |  ||||||| || ||| | ||||| |||
Sbjct  8799  GTGGAAGTCAATGGCGCAAAAAAAATGTTCTATGCCGAGGAAATTTCGGCAATGGTCCTG  8858

Query  388   ATCAAGATGCGCGAG  402
                || ||||| |||
Sbjct  8859  TCAAAAATGCGTGAG  8873

>PLHA:NW_020188283.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_1368, whole genome shotgun sequence
Length=1591

 Score = 776 bits (860),  Expect = 0.0
 Identities = 628/760 (83%), Gaps = 0/760 (0%)
 Strand=Plus/Plus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             |||| ||||| || ||||| |||||||||||||||||||| || ||||||||||| || |
Sbjct  832   AGGATGCCGGTGCGATTGCTGGCCTCAACGTGCTGCGTATAATTAACGAGCCGACAGCTG  891

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
             | || || |||||||| ||||| ||||||||||| || ||||||||| ||||||| ||||
Sbjct  892   CTGCGATTGCGTACGGTCTGGATAAGAAGGGCGGTGAACGCAACGTGTTGATCTTTGACC  951

Query  521   TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
             | || || || ||||| |||||||| ||  ||  ||| ||||| || |||||||||||||
Sbjct  952   TCGGTGGTGGAACCTTTGATGTGTCGCTGTTGAGCATCGAGGAAGGTATCTTCGAGGTCA  1011

Query  581   AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
             | ||||| || ||||| |||||  |||| || |||||||| |||||||| || || || |
Sbjct  1012  AAGCCACGGCGGGTGATACGCATTTGGGCGGCGAGGACTTTGACAACCGTCTTGTCGATC  1071

Query  641   ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
             | |||   || || || || || ||||| ||||||||| |  |  |||| || |||||||
Sbjct  1072  ATTTCGTCCAAGAATTTAAACGGAAGCATCGCAAGGACCTGTCACAGAATCAACGTGCTC  1131

Query  701   TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
             | ||||||||||| || || || |||||||| ||||||||| |||| ||||| ||||| |
Sbjct  1132  TCCGTCGTCTGCGTACAGCGTGTGAGCGTGCTAAGCGTACGTTGTCTTCGTCAGCTCAAG  1191

Query  761   CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
             | |||||||| ||||| || || |||||||| |||||||||||||||||||| |||||||
Sbjct  1192  CATACATCGAAATTGATTCGCTTTTCGACGGTATCGACTTCAACTCGACCATTACTCGTG  1251

Query  821   CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
             ||||||| || |||||||| || ||||| |||||||| ||||||||||| |||||||| |
Sbjct  1252  CTCGTTTTGAAGACATGTGTGGAGACTATTTCCGCAAAACGATGGAGCCTGTGGAGAAAG  1311

Query  881   TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
             ||||||| ||||| ||||| || || || ||||| ||||| |||||||| ||||| || |
Sbjct  1312  TGCTGCGTGACGCGAAGCTTTCTAAAAGTCAGGTACACGAAGTGGTGCTTGTGGGTGGGT  1371

Query  941   CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
             |||| ||||| || ||||||||||| ||| |||| |||||||| |||||||| ||||| |
Sbjct  1372  CGACTCGTATTCCCAAGGTGCAGCAACTGTTGTCCGACTTCTTTAACGGCAAAGAGCCAA  1431

Query  1001  ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
             ||||||| |||||||| ||||||||||| || || ||||| || |||||||| || ||  
Sbjct  1432  ACAAGTCGATCAACCCCGACGAGGCTGTTGCCTATGGTGCTACAGTGCAGGCTGCGATTT  1491

Query  1061  TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
             |||| || ||||||||||| || || ||||| || || |||||||| |||||||| || |
Sbjct  1492  TGAGTGGTAACGACTCGTCTGAAAAACTGCAAGATCTTCTTCTGCTCGACGTGACACCAC  1551

Query  1121  TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGAC  1160
             | || ||||| |||||||| || |||||||||||||||||
Sbjct  1552  TCTCACTGGGACTCGAGACAGCTGGTGGTGTCATGACGAC  1591

 Score = 383 bits (424),  Expect = 8e-104
 Identities = 327/403 (81%), Gaps = 3/403 (1%)
 Strand=Plus/Plus

Query  1    ATGACTCAAGCTACTACGTCTGGATACTCCGTCGGCATCGACCTCGGCACAACCTACTCG  60
            |||||||||||||||   ||||||||||| || |||||||| || ||||| || || |||
Sbjct  345  ATGACTCAAGCTACT---TCTGGATACTCAGTGGGCATCGATCTTGGCACGACTTATTCG  401

Query  61   TGCGTGGGCGTGTGGCAGAACGACCGTGTGGAAATCATCGCCAACGACCAGGGCAACCGC  120
            || || || || |||||||| ||||| || || ||||| || |||||||| |||||||||
Sbjct  402  TGTGTAGGTGTATGGCAGAATGACCGCGTCGAGATCATTGCTAACGACCAAGGCAACCGC  461

Query  121  ACCACCCCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAG  180
            || || || || || || || ||||||||||| || ||||| || |||||||||||||||
Sbjct  462  ACTACTCCATCGTATGTTGCATTCACAGACTCAGAGCGCCTTATTGGTGACGCCGCCAAG  521

Query  181  AATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
            |||||||| || |||||  ||  |||||||||||| ||||||||||| || || || |||
Sbjct  522  AATCAGGTTGCAATGAATTCGTCCAACACGGTGTTTGACGCCAAACGCCTTATTGGTCGC  581

Query  241  AAGTTCTCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCG  300
            || |  || |||||||||||  ||||||| |||||||||||||| ||| | |||||  | 
Sbjct  582  AAATATTCAGACCCCGTCGTAAAGGCCGATATCAAGCACTGGCCATTCAAGGTGACAGCT  641

Query  301  GGCGCCGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAA  360
            ||  | ||||| ||||| ||||| || || || |||||||||||| | ||||| || || 
Sbjct  642  GGTCCTGGTGATAAGCCTCAGATTACAGTTCAATTCAAGGGCGAGACAAAGACATTTCAG  701

Query  361  CCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGCGAGG  403
            ||||||||||| || || ||||||||||| || ||||| ||||
Sbjct  702  CCCGAGGAGATTTCATCTATGGTGCTGATTAAAATGCGTGAGG  744

>PHIF:NW_003303721.1 Phytophthora infestans T30-4 supercont1.38 
genomic scaffold, whole genome shotgun sequence
Length=1642046

 Score = 736 bits (815),  Expect = 0.0
 Identities = 622/765 (81%), Gaps = 0/765 (0%)
 Strand=Plus/Minus

Query  403     GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
               || || || || ||||| ||  | ||||||||||||||||| || ||||||||||| || 
Sbjct  893042  GATGCTGGAGCTATTGCTGGTTTGAACGTGCTGCGTATCATTAATGAGCCGACGGCTGCT  892983

Query  463     GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
               || ||||| || || || |||||||| || ||||||| |||||||||||||||||| || 
Sbjct  892982  GCGATCGCCTATGGGCTCGACAAGAAAGGAGGCGAGCACAACGTGCTGATCTTCGATCTC  892923

Query  523     GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
               || |||||||| ||||| || || || ||  | ||||| || || |||||||||||||||
Sbjct  892922  GGAGGCGGCACGTTCGACGTCTCACTGCTAACTATTGAAGACGGGATCTTCGAGGTCAAG  892863

Query  583     GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
               || || || |||||||||||| |||| |||||||||||||||||||| ||||| ||   |
Sbjct  892862  GCGACGGCGGGTGACACGCACTTGGGCGGTGAGGACTTCGACAACCGTCTGGTCGAGTTC  892803

Query  643     TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
               |||  |   ||||||||||| |||||||||||||| || |||   |||||||| ||||| 
Sbjct  892802  TTCGTGACCGAGTTCAAGCGTAAGCACCGCAAGGATATGACGTCCAACCAGCGAGCTCTG  892743

Query  703     CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
               |||||||| || ||||| ||||| || |||||||| |||||||   | ||||| ||||| 
Sbjct  892742  CGTCGTCTTCGTACGGCGTGCGAACGCGCCAAGCGGACGCTGTTCACTTCGGCGCAGGCG  892683

Query  763     TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
               ||||||||||| ||||| ||||  |||||| | |||||||||||||||||||| || || 
Sbjct  892682  TACATCGAGATCGACTCGCTGTATGACGGCGTGGACTTCAACTCGACCATCACGCGCGCG  892623

Query  823     CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
               || ||||| ||| ||||| |||| || ||||||||||| ||||| || || | | |||| 
Sbjct  892622  CGGTTCGAAGACTTGTGCAGCGATTATTTCCGCAAGACCATGGATCCTGTTGCGCAGGTT  892563

Query  883     CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
                | || ||| | || ||||| |||| ||||||| ||||| | || ||||| || ||||||
Sbjct  892562  TTACGAGACTCTAAACTGTCCAAGAACCAGGTGAACGAGATCGTCCTGGTCGGAGGCTCG  892503

Query  943     ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
               ||||| |||||||||||||||||| |||||  ||| |||||||||||  ||||||    |
Sbjct  892502  ACGCGCATCCCGAAGGTGCAGCAGTTGCTGAAGGATTTCTTCAACGGGTAGGAGCTGTTC  892443

Query  1003    AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
               |||||||||||||||||||| || || |||||||| || ||||||||||| || || |||
Sbjct  892442  AAGTCCATCAACCCGGACGAAGCCGTCGCGTACGGCGCCACCGTGCAGGCTGCGATTCTG  892383

Query  1063    AGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTG  1122
               || |||||||| |||||   |||||||||||||||| | || ||||||||  ||||| ||
Sbjct  892382  AGTGGCAACGAGTCGTCTTCGAAGCTGCAGGACCTGTTGCTACTGGACGTCGCGCCGTTG  892323

Query  1123    TCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATC  1167
               || ||||| || ||||| |||||||| |||||||| | ||| |||
Sbjct  892322  TCGCTGGGCCTGGAGACAGCCGGTGGCGTCATGACTAAGCTCATC  892278

>PHIF:NW_003303736.1 Phytophthora infestans T30-4 supercont1.23 
genomic scaffold, whole genome shotgun sequence
Length=2389742

 Score = 728 bits (806),  Expect = 0.0
 Identities = 622/767 (81%), Gaps = 2/767 (0%)
 Strand=Plus/Plus

Query  403      GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
                || || || || ||||| ||  | ||||||||||||||||| || ||||||||||| || 
Sbjct  1495702  GATGCTGGAGCTATTGCTGGTTTGAACGTGCTGCGTATCATTAATGAGCCGACGGCTGCT  1495761

Query  463      GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
                || ||||| || || || |||||||| || ||||||| |||||||||||||||||| || 
Sbjct  1495762  GCGATCGCCTATGGGCTCGACAAGAAAGGAGGCGAGCACAACGTGCTGATCTTCGATCTC  1495821

Query  523      GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
                || |||||||| ||||| || || || ||  | ||||| || || |||||||||||||||
Sbjct  1495822  GGAGGCGGCACGTTCGACGTCTCACTGCTAACTATTGAAGACGGGATCTTCGAGGTCAAG  1495881

Query  583      GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
                || || || || ||||||||| |||| ||||||||||||||| |||| ||||| ||   |
Sbjct  1495882  GCGACGGCGGGCGACACGCACTTGGGCGGTGAGGACTTCGACCACCGTCTGGTCGAGTTC  1495941

Query  643      TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATC--ACGGAGAACCAGCGTGCTC  700
                |||  |   ||||||||||| |||||||||||||| ||   |||  ||||||||| ||||
Sbjct  1495942  TTCGTGACCGAGTTCAAGCGTAAGCACCGCAAGGATATATGACGTCGAACCAGCGAGCTC  1496001

Query  701      TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
                | |||||||| || ||||| ||||| || |||||||| ||||||||  | ||||| ||||
Sbjct  1496002  TGCGTCGTCTTCGTACGGCGTGCGAACGCGCCAAGCGGACGCTGTCCACTTCGGCGCAGG  1496061

Query  761      CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
                | ||||||||||| ||||  ||||| |||||| | |||||||||||||||||||| || |
Sbjct  1496062  CGTACATCGAGATCGACTTGCTGTTTGACGGCGTGGACTTCAACTCGACCATCACGCGCG  1496121

Query  821      CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
                | || ||||| ||| ||||| |||| || ||||||||||| ||||| || || | | |||
Sbjct  1496122  CGCGGTTCGAAGACTTGTGCAGCGATTATTTCCGCAAGACCATGGATCCTGTTGCGCAGG  1496181

Query  881      TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                |  | || ||| | || ||||| |||| ||||||| ||||| | || ||||| || ||||
Sbjct  1496182  TTTTACGAGACTCTAAACTGTCCAAGAACCAGGTGAACGAGATCGTCCTGGTCGGAGGCT  1496241

Query  941      CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
                ||||||| |||||||||||||||||| |||||  ||| ||||| ||||| |||||||   
Sbjct  1496242  CGACGCGCATCCCGAAGGTGCAGCAGTTGCTGAAGGATTTCTTTAACGGGAAGGAGCTGT  1496301

Query  1001     ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                 ||||||||||||||||||||| || || |||||||| || ||||||||||| || || |
Sbjct  1496302  TCAAGTCCATCAACCCGGACGAAGCCGTCGCGTACGGCGCCACCGTGCAGGCTGCGATTC  1496361

Query  1061     TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
                |||| |||||||| |||||   |||||||||||||||| | || ||||||||  ||||| 
Sbjct  1496362  TGAGTGGCAACGAGTCGTCTTCGAAGCTGCAGGACCTGTTGCTACTGGACGTCGCGCCGT  1496421

Query  1121     TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATC  1167
                |||| ||||| || ||||| |||||||| |||||||| | ||| |||
Sbjct  1496422  TGTCGCTGGGCCTGGAGACAGCCGGTGGCGTCATGACTAAGCTCATC  1496468

>PHIF:NW_003303722.1 Phytophthora infestans T30-4 supercont1.37 
genomic scaffold, whole genome shotgun sequence
Length=1588622

 Score = 719 bits (797),  Expect = 0.0
 Identities = 623/772 (81%), Gaps = 3/772 (0%)
 Strand=Plus/Plus

Query  406     GCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCCGCC  465
               || || || ||||| ||  | ||||||||||||||||| || ||||||||||| || || 
Sbjct  167516  GCTGGAGCTATTGCTGGTTTGAACGTGCTGCGTATCATTAATGAGCCGACGGCTGCTGCG  167575

Query  466     ATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTGGGC  525
               ||||| || || || |||||||| || ||||||| |||||||||||||||||| || || 
Sbjct  167576  ATCGCCTATGGGCTCGACAAGAAAGGAGGCGAGCACAACGTGCTGATCTTCGATCTCGGA  167635

Query  526     GGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAGGCC  585
               |||||||| ||||| || || || ||  | ||||| || || ||||||||||||||||| 
Sbjct  167636  GGCGGCACGTTCGACGTCTCACTGCTAACTATTGAAGACGGGATCTTCGAGGTCAAGGCG  167695

Query  586     ACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCACTTC  645
               || || |||||||||||| |||| ||||| |||||||||||||| ||||| ||   ||||
Sbjct  167696  ACGGCGGGTGACACGCACTTGGGCGGTGAAGACTTCGACAACCGTCTGGTCGAGTTCTTC  167755

Query  646     ACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTTCGT  705
                 |   ||||||||||| |||||||||||||| || |||  ||||||||| ||||| |||
Sbjct  167756  GTGACCGAGTTCAAGCGTAAGCACCGCAAGGATATGACGTCGAACCAGCGAGCTCTACGT  167815

Query  706     CGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCTTAC  765
               ||||| || ||||| ||||| || |||||||| ||| ||||  | ||||| ||||| |||
Sbjct  167816  CGTCTTCGTACGGCGTGCGAACGCGCCAAGCGGACGTTGTCCACTTCGGCGCAGGCGTAC  167875

Query  766     ATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCTCGT  825
               |||||||| ||||| ||||| |||||| | |||||||||||||||||||| ||||| || 
Sbjct  167876  ATCGAGATCGACTCGCTGTTTGACGGCGTGGACTTCAACTCGACCATCACGCGTGCGCGG  167935

Query  826     TTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTGCTG  885
               ||||| ||| ||||| |||| || ||||||||||| ||||| || || | | ||||  | 
Sbjct  167936  TTCGAAGACTTGTGCAGCGATTATTTCCGCAAGACCATGGATCCTGTTGCGCAGGTTTTA  167995

Query  886     CGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCGACG  945
               || ||| | || ||||| |||| ||||||| ||||| | ||  |||| ||  ||||||||
Sbjct  167996  CGAGACTCTAAACTGTCCAAGAACCAGGTGAACGAGATCGTATTGGTCGGAAGCTCGACG  168055

Query  946     CGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAACAAG  1005
               |||    |||||||||||||| |||||  ||| ||||||||||| |||||||    ||||
Sbjct  168056  CGT---TCGAAGGTGCAGCAGTTGCTGAAGGATTTCTTCAACGGGAAGGAGCTGTTCAAG  168112

Query  1006    TCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTGAGC  1065
               ||||||||||||||||| || || |||||||| || ||||||||||| || || ||||| 
Sbjct  168113  TCCATCAACCCGGACGAAGCCGTCGCGTACGGCGCCACCGTGCAGGCTGCGATTCTGAGT  168172

Query  1066    GGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTGTCT  1125
               |||||||| |||||    ||||||||||||||| | || ||||||||  ||||| |||| 
Sbjct  168173  GGCAACGAGTCGTCTTCAAAGCTGCAGGACCTGTTGCTACTGGACGTCGCGCCGTTGTCG  168232

Query  1126    CTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACA  1177
               ||||| || ||||| |||||||| |||||||| | ||| ||  | || ||||
Sbjct  168233  CTGGGCCTGGAGACAGCCGGTGGCGTCATGACTAAGCTCATTCCACGCAACA  168284

>PHIF:NW_003303667.1 Phytophthora infestans T30-4 supercont1.92 
genomic scaffold, whole genome shotgun sequence
Length=551618

 Score = 719 bits (797),  Expect = 0.0
 Identities = 621/767 (81%), Gaps = 3/767 (0%)
 Strand=Plus/Plus

Query  403     GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
               || || || || ||||| ||  | ||||||||||||||||| || ||||||||||| || 
Sbjct  326301  GATGCTGGAGCTATTGCTGGTTTGAACGTGCTGCGTATCATTAATGAGCCGACGGCTGCT  326360

Query  463     GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
               || ||||| || || || |||||||| || ||||||| |||||||||||||||||| || 
Sbjct  326361  GCGATCGCCTATGGGCTCGACAAGAAAGGAGGCGAGCACAACGTGCTGATCTTCGATCTC  326420

Query  523     GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
               || |||||||| ||||| || || || ||  | ||||| || || |||||||||||||||
Sbjct  326421  GGAGGCGGCACGTTCGACGTCTCACTGCTAACTATTGAAGACGGGATCTTCGAGGTCAAG  326480

Query  583     GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
               || || || |||||||||||| |||| ||||||||||||||| |||| ||||| ||   |
Sbjct  326481  GCGACGGCGGGTGACACGCACTTGGGCGGTGAGGACTTCGACCACCGTCTGGTCGAGTTC  326540

Query  643     TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATC--ACGGAGAACCAGCGTGCTC  700
               |||  |   ||||||||||| |||||||||||||| ||   |||  ||||||||| ||||
Sbjct  326541  TTCGTGACCGAGTTCAAGCGTAAGCACCGCAAGGATATATGACGTCGAACCAGCGAGCTC  326600

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               | |||||||| || ||||| ||||| || |||||||| ||||||||  | ||||| ||||
Sbjct  326601  TGCGTCGTCTTCGTACGGCGTGCGAACGCGCCAAGCGGACGCTGTCCACTTCGGCGCAGG  326660

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | ||||||||||| ||||  ||||| |||||| | |||||||||||||||||||| || |
Sbjct  326661  CGTACATCGAGATCGACTTGCTGTTTGACGGCGTGGACTTCAACTCGACCATCACGCGCG  326720

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               | |  ||||| ||| ||||| |||| || ||||||||||| ||||| || || | | |||
Sbjct  326721  CGCAGTTCGAAGACTTGTGCAGCGATTATTTCCGCAAGACCATGGATCCTGTTGCGCAGG  326780

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
               |  | || ||| | || ||||| |||| ||||||| ||||| | || ||||| || ||||
Sbjct  326781  TT-TACGAGACTCTAAACTGTCCAAGAACCAGGTGAACGAGATCGTCCTGGTCGGAGGCT  326839

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
               ||||||| |||||||||||||||||| |||||  ||| |||||||||||  |||| |   
Sbjct  326840  CGACGCGCATCCCGAAGGTGCAGCAGTTGCTGAAGGATTTCTTCAACGGGTAGGAACTGT  326899

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                ||||||||||||||||||||| || || |||||||| || ||||||||||| || || |
Sbjct  326900  TCAAGTCCATCAACCCGGACGAAGCCGTCGCGTACGGCGCCACCGTGCAGGCTGCGATTC  326959

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               |||| |||||||| |||||   |||||||||||||||| | || ||||||||  ||||| 
Sbjct  326960  TGAGTGGCAACGAGTCGTCTTCGAAGCTGCAGGACCTGTTGCTACTGGACGTCGCGCCGT  327019

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATC  1167
               |||| ||||| || ||||| |||||||| |||||||| | ||| |||
Sbjct  327020  TGTCGCTGGGCCTGGAGACAGCCGGTGGCGTCATGACTAAGCTCATC  327066

 Score = 710 bits (787),  Expect = 0.0
 Identities = 621/772 (80%), Gaps = 3/772 (0%)
 Strand=Plus/Plus

Query  406     GCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCCGCC  465
               || || || ||||| ||  | ||||||||||||||||| || ||||||||||| || || 
Sbjct  321479  GCTGGAGCTATTGCTGGTTTGAACGTGCTGCGTATCATTAATGAGCCGACGGCTGCTGCG  321538

Query  466     ATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTGGGC  525
               ||||| || || || |||||||| || ||||||| |||||||||||||||||| || |  
Sbjct  321539  ATCGCCTATGGGCTCGACAAGAAAGGAGGCGAGCACAACGTGCTGATCTTCGATCTCGAA  321598

Query  526     GGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAGGCC  585
                ||||||| ||||| || || || ||  | ||||| || || ||||||||||||||||| 
Sbjct  321599  AGCGGCACGTTCGACGTCTCACTGCTAACTATTGAAGACGGGATCTTCGAGGTCAAGGCG  321658

Query  586     ACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCACTTC  645
               || || |||||||||||| |||| ||||| |||||||||||||| ||||| ||   ||||
Sbjct  321659  ACGGCGGGTGACACGCACTTGGGCGGTGAAGACTTCGACAACCGTCTGGTCGAGTTCTTC  321718

Query  646     ACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTTCGT  705
                 |   ||||||||||| |||||||||||||| || |||  ||||||||| ||||| |||
Sbjct  321719  GTGACCGAGTTCAAGCGTAAGCACCGCAAGGATATGACGTCGAACCAGCGAGCTCTGCGT  321778

Query  706     CGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCTTAC  765
               ||||| || ||||| |||||||| |||||||| ||| ||||  | ||||| ||||| |||
Sbjct  321779  CGTCTTCGTACGGCGTGCGAGCGCGCCAAGCGGACGTTGTCCACTTCGGCGCAGGCGTAC  321838

Query  766     ATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCTCGT  825
               |||||||| ||||| ||||| |||||| | |||||||||||||||||||| ||||| || 
Sbjct  321839  ATCGAGATCGACTCGCTGTTTGACGGCGTGGACTTCAACTCGACCATCACGCGTGCGCGG  321898

Query  826     TTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTGCTG  885
               ||||| ||| ||||| |||| || ||||||||||| |  || || || | | ||||  | 
Sbjct  321899  TTCGAAGACTTGTGCAGCGATTATTTCCGCAAGACCACAGATCCTGTTGCGCAGGTTTTA  321958

Query  886     CGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCGACG  945
               || ||| | || ||||| |||| ||||||| ||||| | ||  |||| || |||||||||
Sbjct  321959  CGAGACTCTAAACTGTCCAAGAACCAGGTGAACGAGATCGTATTGGTCGGAGGCTCGACG  322018

Query  946     CGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAACAAG  1005
               |||    |||||||||||||| |||||  ||| || |||||||| |||||||    ||||
Sbjct  322019  CGT---TCGAAGGTGCAGCAGTTGCTGAAGGATTTGTTCAACGGGAAGGAGCTGTTCAAG  322075

Query  1006    TCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTGAGC  1065
               ||||||||||||||||| || || |||||||| || ||||||||||| || || ||||| 
Sbjct  322076  TCCATCAACCCGGACGAAGCCGTCGCGTACGGCGCCACCGTGCAGGCTGCGATTCTGAGT  322135

Query  1066    GGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTGTCT  1125
               |||||||| |||||   |||||||||||||||| | || ||||||||  ||||| |||| 
Sbjct  322136  GGCAACGAGTCGTCTTCGAAGCTGCAGGACCTGTTGCTACTGGACGTCGCGCCGTTGTCG  322195

Query  1126    CTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACA  1177
               ||||| || ||||| |||||||| |||||||| | ||| ||  | || ||||
Sbjct  322196  CTGGGCCTGGAGACAGCCGGTGGCGTCATGACTAAGCTCATTCCACGCAACA  322247

>PHKE:scaffold_535 scf_22126_535.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_535.1:1:20628:1 
REF
Length=20628

 Score = 714 bits (791),  Expect = 0.0
 Identities = 578/708 (82%), Gaps = 30/708 (4%)
 Strand=Plus/Plus

Query  1204  ACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAG  1263
             ||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||| |||
Sbjct  1     ACGTTCTCGACGTACGCGGACAACCAGCCTGGTGTGCTGATCCAGGTGTTCGAGGGTGAG  60

Query  1264  CGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCC  1323
             || || ||||| || ||||||||||| ||||||||||||||||||||||||||||| || 
Sbjct  61    CGTTCGATGACCCGGGACAACAACCTACTGGGCAAGTTCAACCTGGACGGCATCCCACCG  120

Query  1324  ATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTG  1383
             |||||||| ||||| || |||||||| |||||||||||||| || || ||||| ||||||
Sbjct  121   ATGCCTCGTGGTGTCCCCCAGATCGATGTGACGTTCGACATTGATGCCAACGGTATCCTG  180

Query  1384  AACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGAC  1443
             |||||||| ||||| |||||||| |||||||||||||| |||||||||||||||||||||
Sbjct  181   AACGTGTCTGCTGTCGAGAAGTCTACGGGCAAGGAGAATAAGATCACGATCACGAACGAC  240

Query  1444  AAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAG  1503
             ||||| || || ||||||||||||||||||||||||||  ||||||| ||||||||||||
Sbjct  241   AAGGGTCGTCTATCGCAGGCTGACATTGACCGCATGGTGGCGGAGGCTGAGAAGTACAAG  300

Query  1504  TCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCC  1563
             || ||||| ||||||||||||   || || ||||| |||||||| |||||||||||||| 
Sbjct  301   TCAGAGGATGAGGCTAACAAGATCCGGATTGAGGCGAAGAACGCACTGGAGAACTACGCG  360

Query  1564  TACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGAC  1623
             ||||  ||||| |||| ||| || ||||||||| |||||||  ||||| |||| | ||||
Sbjct  361   TACAACCTGCGCAACACTCTCAACGACGAGAAGCTGAAGGACCAGATCACGGAGGATGAC  420

Query  1624  AAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCA  1683
             ||||||||  | |||||||||||||| ||    ||  | ||||| ||||| |||||||| 
Sbjct  421   AAGAAGGCCATCGACGACAAGGTGACTGAGACCATTAACTGGCTCGACGCCAACCAGTCC  480

Query  1684  TTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAATTGGAGGGCGTGGCCAACCCAGTG  1743
                |||||||| | || ||||   |||||||||||  | ||||| || ||||||||  | 
Sbjct  481   GCTGAGAAGGAGGAGTTCGAGGGCAAGCAGAAGGAGCTCGAGGGTGTTGCCAACCCGATC  540

Query  1744  TTGCAGAAGATGTACGCTGCTGCTGGCGGTTCCCCTGGTGCTGAGGGTGGTATGCCCGGT  1803
              |||||||||||||||| |||||||| ||| | ||||| || |||||||| |||||||| 
Sbjct  541   CTGCAGAAGATGTACGCCGCTGCTGGAGGTGCTCCTGGCGCCGAGGGTGGCATGCCCGGC  600

Query  1804  GGTGTGCCGGGCGGCATGCCT------------------------------GGTGCTCCC  1833
             ||| |||| ||||| ||||||                              ||||| || 
Sbjct  601   GGTATGCCTGGCGGTATGCCTGGCGGTATGCCTGGTGGCATGCCTGGTGCCGGTGCCCCG  660

Query  1834  CCTGCTGGTGCTGCGGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
             |||||||| ||  ||||||||||||| |||||||||||||||||||||
Sbjct  661   CCTGCTGGCGCCCCGGACCAGGGCCCCAAGATCGAGGAGGTCGACTAA  708

>PHIF:NW_003303750.1 Phytophthora infestans T30-4 supercont1.9 
genomic scaffold, whole genome shotgun sequence
Length=4027111

 Score = 700 bits (775),  Expect = 0.0
 Identities = 614/765 (80%), Gaps = 0/765 (0%)
 Strand=Plus/Plus

Query  403     GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
               || || || || ||||| ||  | ||||||||||||||||| || ||||||||||| || 
Sbjct  161235  GATGCTGGAGCTATTGCTGGTTTGAACGTGCTGCGTATCATTAATGAGCCGACGGCTGCT  161294

Query  463     GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
               || ||||| || || || ||| |||| || ||||||  |||||||||||||||||| || 
Sbjct  161295  GCGATCGCCTATGGGCTCGACGAGAAAGGAGGCGAGAACAACGTGCTGATCTTCGATCTC  161354

Query  523     GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
               || |||||||| ||||| || || || ||  | ||||| || || ||||| |||||||||
Sbjct  161355  GGAGGCGGCACGTTCGACGTCTCACTGCTAACTATTGAAGACGGGATCTTTGAGGTCAAG  161414

Query  583     GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
               || || || |||||||||||| |||| |||| |||||||||||||||  |||| ||   |
Sbjct  161415  GCGACGGCGGGTGACACGCACTTGGGCGGTGGGGACTTCGACAACCGTATGGTCGAGTTC  161474

Query  643     TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
               |||  |   ||| ||||||| |||||||||||||| || |||  |||| |||| ||||| 
Sbjct  161475  TTCGTGACCGAGGTCAAGCGTAAGCACCGCAAGGATATGACGTCGAACTAGCGAGCTCTG  161534

Query  703     CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
               | |||||| || ||||| ||||| ||  ||||||| ||||||||  | ||||| ||||| 
Sbjct  161535  CATCGTCTTCGTACGGCGTGCGAACGCACCAAGCGGACGCTGTCCACTTCGGCGCAGGCG  161594

Query  763     TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
               ||||||||||| ||||| ||||| |||||| | |||||||||||||||||||| || || 
Sbjct  161595  TACATCGAGATCGACTCGCTGTTTGACGGCGTGGACTTCAACTCGACCATCACGCGCGCG  161654

Query  823     CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
               || ||||| ||| ||||| |||| || ||||||||||| ||||| || || | | |||| 
Sbjct  161655  CGGTTCGAAGACTTGTGCAGCGATTATTTCCGCAAGACCATGGATCCTGTTGCGCAGGTT  161714

Query  883     CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
                | || ||| | || ||||| |||| ||||| | ||||| | || ||||| || ||||||
Sbjct  161715  TTACGAGACTCTAAACTGTCCAAGAACCAGGGGAACGAGATCGTCCTGGTCGGAGGCTCG  161774

Query  943     ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
               ||||| |||||||||||||||||| |||||  ||| ||||||||||| |||||||    |
Sbjct  161775  ACGCGCATCCCGAAGGTGCAGCAGTTGCTGAAGGATTTCTTCAACGGGAAGGAGCTGTTC  161834

Query  1003    AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
               |||||| ||||||||||||| || || |||||||| || ||||||||||| || || |||
Sbjct  161835  AAGTCCGTCAACCCGGACGAAGCCGTCGCGTACGGCGCCACCGTGCAGGCTGCGATTCTG  161894

Query  1063    AGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTG  1122
               || |||||||| |||||   |||||||||||||||| | || ||||||||  ||||| ||
Sbjct  161895  AGTGGCAACGAGTCGTCTTCGAAGCTGCAGGACCTGTTGCTACTGGACGTCGCGCCGTTG  161954

Query  1123    TCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATC  1167
               || ||||| || ||||| |||||| | |||||||| | ||| |||
Sbjct  161955  TCGCTGGGCCTGGAGACAGCCGGTAGCGTCATGACTAAGCTCATC  161999

 Score = 561 bits (621),  Expect = 5e-157
 Identities = 490/609 (80%), Gaps = 3/609 (0%)
 Strand=Plus/Plus

Query  406      GCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCCGCC  465
                || || || ||||| ||  | ||||||||||||||||| || ||||||||||| || || 
Sbjct  2505146  GCTGGAGCTATTGCTGGTTTGAACGTGCTGCGTATCATTAATGAGCCGACGGCTGCTGCG  2505205

Query  466      ATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTGGGC  525
                ||||| || || || |||||||| || ||||||| |||||||||||||||||| || || 
Sbjct  2505206  ATCGCCTATGGGCTCGACAAGAAAGGAGGCGAGCACAACGTGCTGATCTTCGATCTCGGA  2505265

Query  526      GGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAGGCC  585
                |||||||| ||||| || || || ||    ||||| || || ||||||||||||||||| 
Sbjct  2505266  GGCGGCACGTTCGACGTCTCACTGCTAAATATTGAAGACGGGATCTTCGAGGTCAAGGCG  2505325

Query  586      ACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCACTTC  645
                || || |||||||||||| |||| |||||||||||||||||||| ||||| ||   ||||
Sbjct  2505326  ACGGCGGGTGACACGCACTTGGGCGGTGAGGACTTCGACAACCGTCTGGTCGAGTTCTTC  2505385

Query  646      ACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTTCGT  705
                  |   ||||||||| | |||||||||||||| || |||  ||||||||| ||||| |||
Sbjct  2505386  GTGACCGAGTTCAAGTGTAAGCACCGCAAGGATATGACGTCGAACCAGCGAGCTCTGCGT  2505445

Query  706      CGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCTTAC  765
                ||||| || ||||| ||||| || |||||||| ||||||||  | ||||| ||||| |||
Sbjct  2505446  CGTCTTCGTACGGCGTGCGAACGCGCCAAGCGGACGCTGTCCACTTCGGCGCAGGCGTAC  2505505

Query  766      ATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCTCGT  825
                |||||||| ||||| ||||| |||||| | ||||||||||||| |||||| || || || 
Sbjct  2505506  ATCGAGATCGACTCGCTGTTTGACGGCGTGGACTTCAACTCGATCATCACGCGCGCGCGG  2505565

Query  826      TTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTGCTG  885
                ||||| ||| ||||| |||| || ||||||||||| ||||| || || | | ||||  | 
Sbjct  2505566  TTCGAAGACTTGTGCAGCGATTATTTCCGCAAGACCATGGATCCTGTTGCGCAGGTTTTA  2505625

Query  886      CGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCGACG  945
                || ||| | || ||||  |||| ||||||| ||||| | || ||||| || |||| ||||
Sbjct  2505626  CGAGACTCTAAACTGTTCAAGAACCAGGTGAACGAGATCGTCCTGGTCGGAGGCTTGACG  2505685

Query  946      CGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAACAAG  1005
                ||   |||||||||||||||| |||||  ||| ||||||||||  |||||||    ||||
Sbjct  2505686  CG---CCCGAAGGTGCAGCAGTTGCTGAAGGATTTCTTCAACGAGAAGGAGCTGTTCAAG  2505742

Query  1006     TCCATCAAC  1014
                |||||||||
Sbjct  2505743  TCCATCAAC  2505751

>ALCA:scaffold_45 AcNc2_CONTIG_45_length_119008 dna:supercontig 
supercontig:ASM107853v1:AcNc2_CONTIG_45_length_119008:1:119008:1 
REF
Length=119008

 Score = 686 bits (760),  Expect = 0.0
 Identities = 1015/1434 (71%), Gaps = 12/1434 (1%)
 Strand=Plus/Minus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              ||||||| ||||| ||||| ||  | || ||||||||||| || || ||||| || || |
Sbjct  89530  AGGACGCAGGCGCGATTGCAGGGTTAAATGTGCTGCGTATAATTAATGAGCCAACTGCAG  89471

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              | || |||||||| ||  |||||| |||||| ||||| || ||  |  |||| || || |
Sbjct  89470  CGGCTATCGCGTATGGATTGGACAGGAAGGGAGGCGAACGAAATATTTTGATATTTGATC  89411

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              | || |||||||| || ||||| || || ||  | || || || ||||| ||||||||||
Sbjct  89410  TTGGTGGCGGCACATTTGATGTATCACTACTTACAATCGAAGAAGGCATTTTCGAGGTCA  89351

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
              | || || |||||||| || ||  |||| || || || || || || || || || || |
Sbjct  89350  AAGCAACCGCTGGTGATACACATTTGGGCGGAGAAGATTTTGATAATCGACTAGTCGATC  89291

Query  641    ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
              | ||       || |||||  | ||||| || ||||| || ||    || || ||||| |
Sbjct  89290  ATTTTGTTGCCGAATTCAACAGAAAGCATCGAAAGGATATTACAACAAATCAACGTGCAC  89231

Query  701    TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
              |||| ||||| || || || || ||||| || ||||| || || || || || ||||| |
Sbjct  89230  TTCGCCGTCTACGCACAGCTTGTGAGCGAGCAAAGCGCACCCTTTCTTCATCCGCTCAAG  89171

Query  761    CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
              |  |||| || |||||||| |||||||| ||  | || ||||| || || |||||  | |
Sbjct  89170  CACACATTGAAATTGACTCGCTGTTCGAGGGAGTGGATTTCAATTCTACAATCACGAGGG  89111

Query  821    CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
              | || ||||| ||  | || |  || ||||||||    || ||||| || ||||||||||
Sbjct  89110  CACGATTCGAAGATTTATGTGCAGATTACTTCCGTCGAACAATGGAACCAGTGGAGAAGG  89051

Query  881    TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
              || |||| ||  | ||  |||| || || ||||||||||| || || || ||||| ||||
Sbjct  89050  TGTTGCGTGATTCTAAATTGTCAAAAAGTCAGGTGCACGAAGTTGTACTCGTGGGTGGCT  88991

Query  941    CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
              |||| ||||| || || ||||| |||||  |||| || || |||||||| |||||     
Sbjct  88990  CGACTCGTATTCCTAAAGTGCAACAGCTATTGTCTGAGTTTTTCAACGGTAAGGAATTGT  88931

Query  1001   ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
               |||||| || ||||||||||| || || || |  ||||| || || || || |||||  
Sbjct  88930  GCAAGTCGATAAACCCGGACGAAGCCGTCGCTTTTGGTGCAACTGTACAAGCCGCCATTT  88871

Query  1061   TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
              | || || |  ||    || || ||||||||||| ||  | ||  |||| ||  | ||||
Sbjct  88870  TAAGTGGAACTGAGCAATCCGAAAAGCTGCAGGATCTATTACTATTGGATGTTGCTCCGC  88811

Query  1121   TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
              |||| ||||| || ||||| || ||||| || ||||| || |||||| | || || || |
Sbjct  88810  TGTCGCTGGGACTTGAGACAGCGGGTGGAGTGATGACCACACTGATCCCACGTAATACCA  88751

Query  1181   CGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGC  1240
              || | || || || ||||| || | ||| || || |||   || |||||||| || ||  
Sbjct  88750  CGCTACCTACGAAAAAGTCTCAAATGTTTTCAACATACCAAGAAAACCAGCCAGGTGTAT  88691

Query  1241   TCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGT  1300
               ||| || || || ||||| |||||||||||||| || ||||||||||| || || ||||
Sbjct  88690  GCATACAAGTATTTGAGGGAGAGCGCTCCATGACTCGGGACAACAACCTTCTCGGAAAGT  88631

Query  1301   TCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCG  1360
              |||| || ||||| || || |||||||| |||||||| || || || || || || ||||
Sbjct  88630  TCAATCTTGACGGAATACCGCCCATGCCGCGCGGTGTACCTCAAATTGAAGTCACATTCG  88571

Query  1361   ACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGA  1420
              | ||||| || || || ||  |||| ||    ||  | ||||| || ||   |||||| |
Sbjct  88570  ATATCGATGCCAATGGAATTTTGAATGTAAGCGCGATCGAGAAATCGACCAACAAGGAAA  88511

Query  1421   ACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGG  1480
              | ||||| |||||||| ||||| || || || || || || || || || || || ||||
Sbjct  88510  ATAAGATTACGATCACAAACGATAAAGGACGGCTGTCTCAAGCGGATATCGATCGTATGG  88451

Query  1481   TATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCA  1540
              |    || || ||||| || ||   |||||| || || ||||     || || || || |
Sbjct  88450  TCAGTGAAGCTGAGAAATATAAAAAGGAGGATGAAGCCAACAGAATTCGAATTGAAGCAA  88391

Query  1541   AGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGA  1600
              |||| |  || || |||||||| |  |  ||  | | ||  ||  | ||||| || || |
Sbjct  88390  AGAATGGACTAGAAAACTACGCATTTAACCTAAGAAGCACACTTGACGACGAAAAAATCA  88331

Query  1601   AGGA--GAAGATC-CCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGA  1657
              |  |   || ||| || |||   ||   || | | || ||  ||||||| | ||||||| 
Sbjct  88330  AAAATCAAATATCTCCCGAA---GATCGGACGACCGTTGAAAACAAGGTCAAGGAAGTGG  88274

Query  1658   TCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGG  1717
              |    ||| | || ||||||||||||   |||||||| | ||  |||   |||||||| |
Sbjct  88273  TGAGCTGGTTAGATGCAAACCAGTCAGCTGAGAAGGAAGAGTTTGAGCACAAGCAGAAAG  88214

Query  1718   AATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTA---CGCTGCTGCTGGCGGTT  1774
              |  | || |  ||||| || ||| |  ||||||| |||||     | ||  |||| ||  
Sbjct  88213  ATCTTGAAGCGGTGGCAAATCCAATTATGCAGAAAATGTATTCATCCGCCACTGGAGG--  88156

Query  1775   CCCCTGGTGCTGAGGGTGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGTG  1828
                 | |||      ||||| |||||||||||  |||| || || ||||| ||||
Sbjct  88155  -AGCAGGTATGCCTGGTGGGATGCCCGGTGGGATGCCCGGTGGGATGCCCGGTG  88103

>PLHA:NW_020187350.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_430, whole genome shotgun sequence
Length=1405462

 Score = 679 bits (752),  Expect = 0.0
 Identities = 967/1361 (71%), Gaps = 0/1361 (0%)
 Strand=Plus/Minus

Query  403      GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
                || || || || ||||| ||  | || ||||| || || ||||| || || || || || 
Sbjct  1101521  GATGCGGGTGCAATTGCTGGTTTGAATGTGCTTCGAATTATCAATGAACCAACTGCTGCG  1101462

Query  463      GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
                || |||||||| || ||||||||||| || ||||||| | | ||| |||| || || || 
Sbjct  1101461  GCAATCGCGTATGGACTGGACAAGAAAGGAGGCGAGCACCATGTGTTGATTTTTGATCTC  1101402

Query  523      GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
                || || || || || || || || ||  || | ||||| || || ||||| || |||| |
Sbjct  1101401  GGAGGTGGAACGTTTGACGTTTCACTTTTGACTATTGAAGAAGGTATCTTTGAAGTCATG  1101342

Query  583      GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
                || ||||| |||||||| ||| | || || || || || ||||| ||  | || ||  | 
Sbjct  1101341  GCAACTGCCGGTGACACCCACTTAGGAGGAGAAGATTTTGACAATCGATTAGTTGAGTAT  1101282

Query  643      TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
                ||      ||| || |||||||| || || |||||  |  |||  || || |||||| | 
Sbjct  1101281  TTTGTTGCGGAATTTAAGCGCAAACATCGAAAGGATTTGTCGGTCAATCAACGTGCTTTA  1101222

Query  703      CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
                |||||||| || ||||| |||||||| || ||||| ||| ||||  |||| || ||||| 
Sbjct  1101221  CGTCGTCTTCGTACGGCATGCGAGCGCGCAAAGCGGACGTTGTCTACGTCAGCCCAGGCG  1101162

Query  763      TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
                ||| |||| ||||| ||  | || ||||||||||| || ||||||||||| || || || 
Sbjct  1101161  TACCTCGAAATTGATTCGTTATTTGACGGCATCGATTTTAACTCGACCATTACACGAGCG  1101102

Query  823      CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
                ||||| || ||  | || |  || ||||| || ||||| ||||| |||||||   | || 
Sbjct  1101101  CGTTTTGAAGATCTTTGTGCTGAGTACTTTCGGAAGACCATGGATCCCGTGGCTCAAGTA  1101042

Query  883      CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
                || || ||  |||||||||| || || |||||| | ||  | || || || || || || 
Sbjct  1101041  CTACGAGATTCCAAGCTGTCCAAAAGTCAGGTGAATGAAATTGTTCTTGTAGGAGGTTCA  1100982

Query  943      ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
                ||||| || || |||||||||||  |||||  |||||| || ||||||||||| |     
Sbjct  1100981  ACGCGAATTCCAAAGGTGCAGCAAATGCTGATGGACTTTTTTAACGGCAAGGATCTGTTT  1100922

Query  1003     AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
                || || |||||||| || |||||||| ||||| ||||| || ||||||||||| ||  | 
Sbjct  1100921  AAATCGATCAACCCAGATGAGGCTGTAGCGTATGGTGCTACAGTGCAGGCGGCAATTTTA  1100862

Query  1063     AGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTG  1122
                || || |  || || || | |||  |||| |||||  | ||  | |||||| ||||  ||
Sbjct  1100861  AGTGGAAGTGAGTCTTCTGCGAAATTGCAAGACCTTTTGCTATTAGACGTGGCGCCTTTG  1100802

Query  1123     TCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACG  1182
                ||||| || || || || || ||||| || ||||| | ||| ||  | || |||||||| 
Sbjct  1100801  TCTCTTGGACTAGAAACTGCTGGTGGAGTTATGACCAAGCTCATTCCTCGCAACACGACA  1100742

Query  1183     GTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTC  1242
                || ||| | ||||||  |||  ||||||| || ||  | || |||||| |||| ||| | 
Sbjct  1100741  GTCCCGGCAAAGAAGATGCAATCGTTCTCAACATATACTGATAACCAGTCTGGCGTGTTG  1100682

Query  1243     ATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTC  1302
                || || ||||| || ||||| ||  | ||||| || |||||  |  | |||||||| |||
Sbjct  1100681  ATTCAAGTGTTTGAAGGCGAACGGACTATGACACGTGACAATCATTTACTGGGCAAATTC  1100622

Query  1303     AACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGAC  1362
                |  ||||| || || || || ||||| ||||||||||| || || ||||| || || |||
Sbjct  1100621  AGTCTGGATGGTATTCCGCCTATGCCGCGCGGTGTGCCTCAAATTGACGTCACATTTGAC  1100562

Query  1363     ATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAAC  1422
                 | || | ||| || ||  | || |||||||| ||||| |||||||| || || || || 
Sbjct  1100561  GTTGATGTGAATGGAATTTTAAATGTGTCGGCCGTGGAAAAGTCAACAGGAAAAGAAAAT  1100502

Query  1423     AAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTA  1482
                ||||| ||||| ||||| |||||||| ||  | || ||| | || || ||||| ||||| 
Sbjct  1100501  AAGATTACGATAACGAATGACAAGGGACGATTATCTCAGTCAGAAATCGACCGAATGGTT  1100442

Query  1483     TCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAAG  1542
                 | || ||||| || || ||     | || ||    || ||||  ||||||||| | |||
Sbjct  1100441  GCTGATGCCGATAAATATAAAGATCAAGATGAACGCAATAAGCTGCGCATCGAGTCAAAG  1100382

Query  1543     AACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGAAG  1602
                ||  |||| || || | ||| |    ||| || | |    | ||||| || ||  ||   
Sbjct  1100381  AATTCGCTAGAAAATTTCGCATTTTCTCTTCGTAGCTCAATTAATGATGAAAAAGTGGTT  1100322

Query  1603     GAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCCAG  1662
                | ||| ||    | ||  ||    |||  | | || |  || ||| | |||  | | |||
Sbjct  1100321  GCGAAAATTAGTGCAGAAGATCGAAAGCTGATTGATGGTAAAGTGGCTGAAACGCTGCAG  1100262

Query  1663     TGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAATTG  1722
                |||||||| ||||||||  |    || || |  | ||  ||  | |||||| ||||  | 
Sbjct  1100261  TGGCTGGAGGCAAACCAAGCGGCAGAAAAAGGGGAGTTTGATGCTAAGCAGCAGGAGCTA  1100202

Query  1723     GAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGC  1763
                ||||| ||||| || ||  |  ||||||||||||| |||||
Sbjct  1100201  GAGGGTGTGGCAAATCCTATCATGCAGAAGATGTATGCTGC  1100161

 Score = 288 bits (319),  Expect = 5e-75
 Identities = 287/372 (77%), Gaps = 0/372 (0%)
 Strand=Plus/Minus

Query  31       GTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTG  90
                || || |||||  | || || || |||||||||||||| |||||||| |||||||| |||
Sbjct  1101983  GTGGGTATCGATTTGGGTACGACGTACTCGTGCGTGGGTGTGTGGCAAAACGACCGAGTG  1101924

Query  91       GAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGAC  150
                || ||||| || |||||||||||||| || ||||| ||||||||||| || || || || 
Sbjct  1101923  GAGATCATAGCTAACGACCAGGGCAATCGTACCACTCCGTCATACGTAGCATTTACCGAT  1101864

Query  151      TCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACG  210
                 | ||||| || || || || || ||||||||||||||||| ||||| || |||||||||
Sbjct  1101863  ACTGAACGTCTAATTGGAGATGCTGCCAAGAATCAGGTGGCAATGAATGCACACAACACG  1101804

Query  211      GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
                || ||||||| ||||||  |||| || ||||||||  | ||  |||  || ||  | || 
Sbjct  1101803  GTATTCGACGTCAAACGGTTGATTGGTCGCAAGTTTGCCGATTCCGAGGTACAATCGGAT  1101744

Query  271      ATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTG  330
                |||||||||||||||||| ||||    |  ||  | |   ||||||| ||  |   ||||
Sbjct  1101743  ATCAAGCACTGGCCGTTCAAAGTCGTTTGTGGTCCTGAAAACAAGCCTCAAGTGGTGGTG  1101684

Query  331      CAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGATC  390
                || ||||| ||||| || || || || || || |||||||| || || |||||||| || 
Sbjct  1101683  CAATTCAAAGGCGAATCAAAAACTTTTCAGCCTGAGGAGATTTCATCGATGGTGCTCATT  1101624

Query  391      AAGATGCGCGAG  402
                |||||||| |||
Sbjct  1101623  AAGATGCGTGAG  1101612

>ALLA:FR824052 dna:supercontig supercontig:ENA1:FR824052:1:241751:1 
REF
Length=241751

 Score = 648 bits (718),  Expect = 0.0
 Identities = 863/1199 (72%), Gaps = 0/1199 (0%)
 Strand=Plus/Plus

Query  403     GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
               ||||| || || ||||| ||  | || ||| | |||||||| || ||||| || || || 
Sbjct  162548  GACGCGGGTGCGATTGCAGGATTGAATGTGTTACGTATCATAAATGAGCCAACTGCGGCA  162607

Query  463     GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
               || |||||||| ||  |||||| ||| || |||||||| ||  | || ||||| || || 
Sbjct  162608  GCTATCGCGTATGGATTGGACAGGAAAGGAGGCGAGCGTAATATTCTTATCTTTGATCTT  162667

Query  523     GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
               || ||||| || || ||||| || || ||  | ||||| || || || || ||||| || 
Sbjct  162668  GGTGGCGGTACATTTGATGTATCACTACTCACTATTGAAGAAGGTATTTTTGAGGTGAAA  162727

Query  583     GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
               || || || ||||| || ||| ||||||| || ||||| || || || || || || || 
Sbjct  162728  GCAACCGCCGGTGATACACACTTGGGTGGAGAAGACTTTGATAATCGACTAGTCGATCAT  162787

Query  643     TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
               ||       || |||||  | ||||| || || || ||| ||  ||| || ||||| |||
Sbjct  162788  TTTGTTGCCGAATTCAACAGGAAGCATCGAAAAGATATCGCGACGAATCAACGTGCACTT  162847

Query  703     CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
               || ||||| || || || || || || || |||||||| ||||| || || |||||||| 
Sbjct  162848  CGGCGTCTACGCACAGCTTGTGAACGAGCAAAGCGTACCCTGTCTTCATCTGCTCAGGCA  162907

Query  763     TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
                | || || ||||| ||  ||||||| ||  | |||||||| || |||||||| || |||
Sbjct  162908  CAAATTGAAATTGATTCATTGTTCGAAGGGGTAGACTTCAATTCTACCATCACACGAGCT  162967

Query  823     CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
                | || || ||  |||| || |||||||| ||    || ||||| || ||||| ||||||
Sbjct  162968  AGATTTGAAGATCTGTGTGGTGACTACTTTCGTCGAACAATGGAACCAGTGGAAAAGGTG  163027

Query  883     CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
               ||||| ||  ||||  |||| ||||| ||||| || || || || || || ||||| || 
Sbjct  163028  CTGCGTGATTCCAAATTGTCAAAGAGTCAGGTACATGAAGTCGTACTCGTTGGCGGATCA  163087

Query  943     ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAAC  1002
               || || || || || ||||| |||||||| ||||| || || || ||||| ||      |
Sbjct  163088  ACTCGCATTCCCAAAGTGCAACAGCTGCTATCGGAATTTTTTAATGGCAAAGATTTGTGC  163147

Query  1003    AAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTG  1062
               || || || ||||||||||||||||| || |  || || || || || || |||||  | 
Sbjct  163148  AAATCGATAAACCCGGACGAGGCTGTCGCTTTTGGAGCAACTGTTCAAGCTGCCATTTTA  163207

Query  1063    AGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGCTG  1122
               || || | |||    || |||||||| || || || || || || || ||  | || || 
Sbjct  163208  AGTGGTACCGAAAAATCCGAGAAGCTACAAGATCTACTACTTCTAGATGTTGCTCCCCTT  163267

Query  1123    TCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGACG  1182
               ||  |||| ||||| || || ||||| || ||||| ||  ||||| | || ||||| || 
Sbjct  163268  TCGTTGGGACTCGAAACAGCTGGTGGGGTGATGACCACATTGATCCCCCGCAACACTACT  163327

Query  1183    GTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTC  1242
                |||| ||||||||||| || ||||| || |||||    || || ||||| || ||    
Sbjct  163328  TTGCCTACCAAGAAGTCTCAAACGTTTTCAACGTATCAAGAAAATCAGCCCGGTGTATGT  163387

Query  1243    ATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTC  1302
               || || ||||| ||||| |||||||| |||||||| |||||||| || || || || |||
Sbjct  163388  ATTCAAGTGTTTGAGGGAGAGCGCTCAATGACGCGGGACAACAATCTTCTTGGAAAATTC  163447

Query  1303    AACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGAC  1362
               || ||||| || || || ||||||||||| || || || || ||||| || || || || 
Sbjct  163448  AATCTGGATGGTATACCGCCCATGCCTCGTGGAGTACCTCAAATCGAGGTCACCTTTGAT  163507

Query  1363    ATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAAC  1422
               ||||| ||||| || ||  |||| || || || || |||||||| ||   ||||||||||
Sbjct  163508  ATCGATGCGAATGGAATTTTGAATGTTTCTGCGGTCGAGAAGTCGACCAACAAGGAGAAC  163567

Query  1423    AAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTA  1482
               ||||| || ||||| ||||| || || || || || || || || || || |  ||||| 
Sbjct  163568  AAGATTACAATCACAAACGATAAAGGGCGACTATCTCAAGCCGATATCGATCTTATGGTT  163627

Query  1483    TCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAAG  1542
                  || || || ||||||||   |||||| || || |||      ||  | || || |||
Sbjct  163628  AGCGAAGCAGAAAAGTACAAAAAGGAGGATGAAGCCAACCGAATTCGTGTTGAAGCAAAG  163687

Query  1543    AACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGAA  1601
               || |  || || |||||| ||| ||  ||  | | ||  ||  | |||||||| || ||
Sbjct  163688  AATGGTCTAGAAAACTACACCTTCAACCTAAGAAGCACACTTGACGACGAGAAAATCAA  163746

>PHSO:scaffold_5
Length=6830280

 Score = 636 bits (705),  Expect = 8e-180
 Identities = 883/1226 (72%), Gaps = 33/1226 (3%)
 Strand=Plus/Plus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||| |||||  |||||||||||||||  |||| |||||||||||||||||| |||||||
Sbjct  4460457  AGGATGCCGGTACCATTGCCGGCCTCACGGTGCAGCGTATCATCAACGAGCCCACGGCCG  4460516

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGG-GC--GGCGAGCGCAACGTGCTGATCTTCG  517
                ||||||| || |||||| | |||||||||  ||  ||||||   ||||||||| ||||||
Sbjct  4460517  CCGCCATTGCCTACGGCATTGACAAGAAGTCGCAGGGCGAGAAGAACGTGCTGGTCTTCG  4460576

Query  518      ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
                ||||||| || || |||||||||||| | || ||| |||| || |  ||  | |||||||
Sbjct  4460577  ACCTGGGTGGAGGTACCTTCGATGTGACCCTGCTGGCCATCGACGGCGGTGTGTTCGAGG  4460636

Query  578      TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
                |   ||||||    |||||||| |||||||| ||||||||||||||| | ||  |  || 
Sbjct  4460637  TGCTGGCCACCAACGGTGACACCCACCTGGGCGGTGAGGACTTCGACCAGCGTATCATGC  4460696

Query  638      ACCACTTCACGCAGGAGTTCAAGCG---CAAGCACCGCAAGGACATCACGGAGAACCAGC  694
                |  ||||||   || |||  |||     |||| ||| | | | |  | |||| ||   ||
Sbjct  4460697  AGTACTTCATCAAGAAGTGGAAGAAGGACAAGAACCTCGATGTCGCCTCGGACAA---GC  4460753

Query  695      GTGCTCTTC-GTCG-TCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTC  752
                | || || | |  | || || |   | |  |||||||| ||||||| | |||||| |   
Sbjct  4460754  GCGCCCTGCAGAAGCTCCGCCGTGAGGC--CGAGCGTGTCAAGCGTGCCCTGTCGGCCCA  4460811

Query  753      GGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCAT  812
                ||| ||||||    | ||||| || || ||| | || |||   |||||||    | || |
Sbjct  4460812  GGCCCAGGCTCGTCTTGAGATCGAGTCGCTGCTGGATGGCGAGGACTTCACGGAGTCCCT  4460871

Query  813      CACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGT  872
                 |  || || ||||||||| |  |   ||  |||   |||   |||||| | |  |||||
Sbjct  4460872  GAGCCGCGCCCGTTTCGAGAAGCTCAACGAGGACCTGTTCAAGAAGACGCTCGGCCCCGT  4460931

Query  873      GGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGT  932
                 ||||||||| ||   |||||| | ||   ||||    ||||  | ||| | ||| ||||
Sbjct  4460932  CGAGAAGGTGATGAAGGACGCCGACCTCAAGAAGTCGGAGGTCGATGAGATTGTGTTGGT  4460991

Query  933      GGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAA  992
                |||||| || || |||||||| ||||||||||||||| |   ||||| ||||||||||||
Sbjct  4460992  GGGCGGTTCCACCCGTATCCCCAAGGTGCAGCAGCTGATCAAGGACTACTTCAACGGCAA  4461051

Query  993      GGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGC  1052
                |||||||          | ||||| || ||||| || || ||||||||  ||||||||| 
Sbjct  4461052  GGAGCCCTCGCGCGGTGTGAACCCCGATGAGGCCGTCGCCTACGGTGCTGCCGTGCAGGG  4461111

Query  1053     GGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGC---AGGACCTGCTTCTGCTGGA  1109
                 | ||||||||| ||| |  |      |||  | |||    ||||| |||||||| | ||
Sbjct  4461112  CGGCATCCTGAGTGGCGAGCA------GGACGACCTGACCAAGGACGTGCTTCTGATCGA  4461165

Query  1110     CGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGC  1169
                 |||  ||| ||||||| |||| | ||||| |  || ||||||||||| | |||||||  
Sbjct  4461166  TGTGGTGCCTCTGTCTCAGGGTATTGAGACCGTGGGCGGTGTCATGACCAAGCTGATCAA  4461225

Query  1170     GCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCA  1229
                 || |||||   | | |||||||||||||||||||| ||||||||||||   ||||||||
Sbjct  4461226  CCGTAACACTGTGATCCCGACCAAGAAGTCGCAGACCTTCTCGACGTACCAGGACAACCA  4461285

Query  1230     GCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCT  1289
                ||| |  ||||| ||||||||||||||||| |||||  |||||||    ||||||   ||
Sbjct  4461286  GCCCGCTGTGCTGATCCAGGTGTTCGAGGGTGAGCGTGCCATGACCAAGGACAACCGTCT  4461345

Query  1290     GCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGA  1349
                 |||||||||||| | |||   ||| | || ||    || || || ||||| ||||| ||
Sbjct  4461346  TCTGGGCAAGTTCGAGCTGACTGGCCTGCCGCCTGCTCCGCGTGGCGTGCCCCAGATTGA  4461405

Query  1350     CGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAAC  1409
                 |||||||| || |||||||| ||||| |||||| | ||||| |||| ||| |||   ||
Sbjct  4461406  GGTGACGTTTGAGATCGACGCCAACGGTATCCTGCAGGTGTCCGCTGAGGACAAGGGCAC  4461465

Query  1410     GGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACAT  1469
                ||||||||   | | ||||||||||||   ||| |||||||| || || ||||  || ||
Sbjct  4461466  GGGCAAGGCCGAGACGATCACGATCACTGCCGAGAAGGGCCGTCTGTCCCAGGAGGAGAT  4461525

Query  1470     TGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCG--GAGGACGAGGCTAACAAGCAA  1527
                 |||||||||||   ||||||||   ||| |  | ||  |||||| ||     |||| | 
Sbjct  4461526  CGACCGCATGGTCCAGGAGGCCGCTGAGTTC--GCCGACGAGGACAAGAAGGTCAAGGAC  4461583

Query  1528     CGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACA--GTCTGA  1585
                |||||||| | |   ||||| ||||||  ||||   ||||| |||  |||||  |||   
Sbjct  4461584  CGCATCGACGGCCGCAACGCTCTGGAGGGCTACCTGTACAGCCTGAAGAACAACGTC---  4461640

Query  1586     ATGACGAGAAGATGAAGGAGAAGATC  1611
                  || |||||| |  |||| ||||||
Sbjct  4461641  --GAGGAGAAGCTCGAGGACAAGATC  4461664

 Score = 195 bits (215),  Expect = 8e-47
 Identities = 272/375 (73%), Gaps = 20/375 (5%)
 Strand=Plus/Plus

Query  32       TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
                ||||||| ||||| ||||| |||||||||||||||||| | |   || || |    || |
Sbjct  4459998  TCGGCATTGACCTGGGCACGACCTACTCGTGCGTGGGCATCTACAAGGACCAGAAGGTCG  4460057

Query  92       AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
                | ||||| |||||||||||||||||||| | ||| || || ||||||||||     ||||
Sbjct  4460058  AGATCATTGCCAACGACCAGGGCAACCGTATCACACCCTCGTACGTCGCCT---GGGACT  4460114

Query  152      CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
                ||      || ||||| |||||||||| ||||||||| ||||   | || ||| || | |
Sbjct  4460115  CGAACGACGAGCGCCTGATCGGTGACGGCGCCAAGAACCAGGCCACGATCAACCCGGAGA  4460174

Query  206      ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTC-GTCCAG  264
                | ||| ||||||||| ||| ||||| ||||||||||||| |   || |  ||| || |||
Sbjct  4460175  AGACGCTGTTCGACGTCAAGCGTCTCATCGGCCGCAAGTACAACGA-CAAGTCGGTGCAG  4460233

Query  265      GCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATC  324
                |||||||  ||||    ||| | | |  |  ||| |  |   | || ||||||    |||
Sbjct  4460234  GCCGACAAGAAGCTGCTGCCCTACGAGCT--CGT-GAACAAGGATGGCAAGCCCTTCATC  4460290

Query  325      ACGGTGCAGTTCAAGGGCGAGTCCAAG---ACGTTCCAACCCGAGGAGATCTCGTCCATG  381
                  |||| || |||||||||||   |||     ||||   ||||||||| ||||| |||||
Sbjct  4460291  CAGGTGGAGGTCAAGGGCGAG---AAGCGCCAGTTCGCCCCCGAGGAGGTCTCGGCCATG  4460347

Query  382      GTGCTGATCAAGATG  396
                ||||| | |||||||
Sbjct  4460348  GTGCTCACCAAGATG  4460362

 Score = 41.0 bits (44),  Expect = 1.1
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  877      AAGGTGCTGCGCGACGCCAAGCTGTCG  903
                |||| ||||||||||||||||||| ||
Sbjct  4360111  AAGGCGCTGCGCGACGCCAAGCTGCCG  4360137

 Score = 40.1 bits (43),  Expect = 3.9
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  196      AACGCGCACAACACGGTGTTCGACGCCAA  224
                |||||||| ||||  ||||||||||||||
Sbjct  2757649  AACGCGCAGAACATCGTGTTCGACGCCAA  2757677

>PHPA:scaffold_38 NW_008649024.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.38, whole genome shotgun 
sequence
Length=690105

 Score = 636 bits (704),  Expect = 8e-180
 Identities = 620/805 (77%), Gaps = 54/805 (7%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||| |||| ||| ||||| || ||||||| ||| | | ||| |||| |||||   |
Sbjct  147945  AGGACGCTGGCGACATCGCCGGTCTGAACGTGCCGCGCACCTTCAGCGAGTCGACGATTG  148004

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               | |  || || ||||||| |||||||||||  |||||| |||| |||||| |||||||||
Sbjct  148005  CTGTTATTGCCTACGGCCAGGACAAGAAGGATGGCGAGAGCAAAGTGCTGGTCTTCGACC  148064

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               || | ||| | |||||  ||| ||| || ||| ||||||| | ||||||||| ||||| |
Sbjct  148065  TGAGTGGCAGAACCTTTAATGAGTCGCTGCTGCCCATTGAAGCGGGCATCTTTGAGGTTA  148124

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               |||||||||   || |||||||||||||||  ||||||||||||||    |||||||| |
Sbjct  148125  AGGCCACTGACCGTAACACGCACCTGGGTGACGAGGACTTCGACAA--AACTGGTGGAGC  148182

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||| || | ||||| |||||      ||||||| || |||||||||||||||||||  
Sbjct  148183  ACTTCGCGAAAGAGTTAAAGCG------CCGCAAGTACGTCACGGAGAACCAGCGTGCGT  148236

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               |||||||||||||| | ||||||||||| ||  |||||||||| ||||||| |||  |||
Sbjct  148237  TTCGTCGTCTGCGGGCTGCCTGCGAGCGCGCTGAGCGTACGCTATCGTCGTGGGC-GAGG  148295

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | ||||| ||| | ||||||||||| | ||| |||||||| ||||  |||||||    | 
Sbjct  148296  CCTACATTGAGGTCGACTCTCTGTTTGTCGGGATCGACTTTAACTTAACCATCATGTTTA  148355

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               | | |||||| | |||||||||| |||||||||||||||| ||||| || |||||||   
Sbjct  148356  CCCATTTCGAAGCCATGTGCGGCTACTACTTCCGCAAGACAATGGATCCGGTGGAGA---  148412

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                ||| |||||||||||||||   ||| ||||||||||||||||                 
Sbjct  148413  -GCTTCGCGACGCCAAGCTGCTCAAGCGCCAGGTGCACGAGGT-----------------  148454

Query  941     CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
                  |||                    ||||||||||||||||||||| | |||||| |||
Sbjct  148455  ---CGC--------------------CTGCTGTCGGACTTCTTCAACAGGAAGGAGTCCA  148491

Query  1001    ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                |||||  |||||  | |||| ||||||| | || || || ||||| ||||| ||||| |
Sbjct  148492  TCAAGTTGATCAAATC-GACGGGGCTGTGACCTATGGCGCCACCGTACAGGCTGCCATTC  148550

Query  1061    TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
               ||||| ||||||||||||||||||||| | || ||||||||||||||||||||||| |||
Sbjct  148551  TGAGCCGCAACGACTCGTCGGAGAAGCCGTAGAACCTGCTTCTGCTGGACGTGACGTCGC  148610

Query  1121    TGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGA  1180
               |||| ||| || |   |||||||| ||  | |  ||||||||||||| | || |||||||
Sbjct  148611  TGTCGCTGAGTATGATGACGGCCGATGCAGACTCGACGACGCTGATCACACGTAACACGA  148670

Query  1181    CGGTGCCGACCAAGAAGTCGCAGAC  1205
               |||||||||||| ||| ||||||||
Sbjct  148671  CGGTGCCGACCACGAAATCGCAGAC  148695

 Score = 48.2 bits (52),  Expect = 0.008
 Identities = 32/36 (89%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  364     GAGGAGATCTCGTCCATGGTGCTGATCAAGATGCGC  399
               |||||||||||| |||  ||||||||||| ||||||
Sbjct  147818  GAGGAGATCTCGCCCAACGTGCTGATCAACATGCGC  147853

>PYVX:scaffold_160 pve_scaffold_160 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_160:1:42618:1 
REF
Length=42618

 Score = 634 bits (702),  Expect = 3e-179
 Identities = 960/1353 (71%), Gaps = 31/1353 (2%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              ||||||||||| | || || ||| | |  |||| ||| |||||||||||||| ||||| |
Sbjct  25262  AGGACGCCGGCACGATCGCTGGCATGACGGTGCAGCGCATCATCAACGAGCCTACGGCTG  25321

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGC---GGCGAGCGCAACGTGCTGATCTTCG  517
              | ||||| || |||||| | ||||||||||     ||||||   ||||||||| | ||||
Sbjct  25322  CTGCCATTGCCTACGGCATTGACAAGAAGGCTCAGGGCGAGAAGAACGTGCTGGTGTTCG  25381

Query  518    ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
              ||||||| ||||| |||||||||||| | || ||  ||||||| |  ||  | |||||||
Sbjct  25382  ACCTGGGTGGCGGTACCTTCGATGTGACGCTGCTCGCCATTGACGGCGGTGTGTTCGAGG  25441

Query  578    TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
              |   ||||||    ||||||||||| || |||||||||||||||||| | ||| |  || 
Sbjct  25442  TGCTGGCCACCAACGGTGACACGCATCTCGGTGGTGAGGACTTCGACCAGCGCATCATGC  25501

Query  638    ACCACTTCACGCAGGAGTTCAAGCGCAAGCAC----CGCAAGGACATCACGGAGAACCAG  693
              |  ||||||   || |||  |||   ||| ||    ||   ||||||      | || ||
Sbjct  25502  AGTACTTCATCAAGAAGTGGAAG---AAGGACAAGTCGGT-GGACATTGGTTCGGACAAG  25557

Query  694    CGTGCTCTTCGTCGTCTGCGGACGGCCTGC-GAGCGTGCCAAGCGTACGCTGTCGTCGTC  752
              || || || |     |||||  ||    || ||||| | ||||||| | |||||| ||  
Sbjct  25558  CGCGCACTCCAGAAGCTGCGT-CGCGAGGCTGAGCGCGTCAAGCGTGCTCTGTCGACGCA  25616

Query  753    GGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCAT  812
              ||||||||||    |||||||||| || ||| | ||||||   |||||||    | |  |
Sbjct  25617  GGCTCAGGCTCGTCTCGAGATTGAGTCGCTGCTGGACGGCGAGGACTTCACGGAGTCGCT  25676

Query  813    CACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGT  872
               |  ||||||||||||||| |  |   ||  |||   |||   |||||| | |  || ||
Sbjct  25677  GAGCCGTGCTCGTTTCGAGAAGCTTAACGAGGACCTGTTCAAGAAGACGCTCGGCCCTGT  25736

Query  873    GGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGT  932
               ||||||||||||   |||||    |||  ||||    ||||  ||||| | ||||| ||
Sbjct  25737  TGAGAAGGTGCTGAAGGACGCTGGTCTGAAGAAGTCGGAGGTTGACGAGATCGTGCTTGT  25796

Query  933    GGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAA  992
               ||||| ||||| ||||||||||||||||||  |||| |   ||||| ||||||||||||
Sbjct  25797  TGGCGGTTCGACCCGTATCCCGAAGGTGCAGACGCTGATCAAGGACTACTTCAACGGCAA  25856

Query  993    GGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGC  1052
              ||||||         | | ||||||||||||||||| |||||||||||  | ||||||| 
Sbjct  25857  GGAGCCTTCGCGCGGCGTGAACCCGGACGAGGCTGTTGCGTACGGTGCTGCTGTGCAGGG  25916

Query  1053   GGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGT  1112
               |  || ||  | |||   |||  | || ||  |  | ||||| |||| ||  | |||||
Sbjct  25917  CGGTATTCTCGGTGGCGCGGAC--GACG-AGCTGACGAAGGACGTGCTGCTCATCGACGT  25973

Query  1113   GACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCG  1172
                  || ||||| | |||| | ||||||| ||||||||||||||| | |||||||   ||
Sbjct  25974  CGTCCCTCTGTCGCAGGGTATTGAGACGGTCGGTGGTGTCATGACCAAGCTGATCAACCG  26033

Query  1173   GAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCC  1232
               |||||   | | ||||| |||||||||||||||||||||||||||   |||||||||||
Sbjct  26034  CAACACTGTGATCCCGACGAAGAAGTCGCAGACGTTCTCGACGTACCAGGACAACCAGCC  26093

Query  1233   TGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCT  1292
              ||  ||||| |||||||||||||||||||||||  ||||||||   ||||||   |||||
Sbjct  26094  TGCTGTGCTGATCCAGGTGTTCGAGGGCGAGCGTGCCATGACGAAGGACAACCGTCTGCT  26153

Query  1293   GGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGT  1352
               ||||||||| | |||   ||| | || ||    || || || |||||||||||||| ||
Sbjct  26154  CGGCAAGTTCGAGCTGACTGGCCTGCCGCCTGCTCCGCGTGGCGTGCCGCAGATCGAGGT  26213

Query  1353   GACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGG  1412
               |||||||| || |||||||||||||||||| | ||    || | ||| |||   |||||
Sbjct  26214  TACGTTCGAGATTGACGCGAACGGCATCCTGCAGGTCGGTGCCGAGGACAAGGGCACGGG  26273

Query  1413   CAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGA  1472
              |||||   |   |||||||||||||   || |||||||| || |||||||  || || ||
Sbjct  26274  CAAGGCCGAGTCGATCACGATCACGGCTGAGAAGGGCCGTCTGTCGCAGGAGGAGATCGA  26333

Query  1473   CCGCATGGTATCGGAGGCCGAGAAGTACAAGTCG--GAGGACGAGGCTAACAAGCAACGC  1530
              |||||||||   |||||| |   ||| |  | ||  |||||| ||      ||| | |||
Sbjct  26334  CCGCATGGTGCAGGAGGCTGCTGAGTTC--GCCGACGAGGACAAGCTCGTGAAGGAGCGC  26391

Query  1531   ATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACA--GTCTGAATG  1588
              ||||| | |   ||||| ||||||  ||||   ||||| |||  |||||  |||     |
Sbjct  26392  ATCGACGGCCGCAACGCTCTGGAGGGCTACCTGTACAGCCTGAAGAACAACGTC-----G  26446

Query  1589   ACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTG--GACGACAAGGT  1646
              | || ||| ||  ||| ||||||   || |  |||||| |  |||||  |||| |   ||
Sbjct  26447  AGGACAAGCTGGCGGACAAGATCGACGAGGACGACAAGGACACGGTGCTGACGGC--CGT  26504

Query  1647   GACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTC  1706
              |  ||| | |||  | |||||||| |  ||||||     | | ||||| |  |  ||  |
Sbjct  26505  GCAGGACGCGATGGACTGGCTGGAGGACAACCAGGAGGCGAACAAGGAGGACTTTGACGC  26564

Query  1707   GAAGCAGAAGGAATTGGAGGGCGTGGCCAACCC  1739
               |||||||||||  |||||   ||||  |||||
Sbjct  26565  CAAGCAGAAGGAGGTGGAGAAGGTGGTGAACCC  26597

 Score = 205 bits (227),  Expect = 4e-50
 Identities = 277/378 (73%), Gaps = 26/378 (7%)
 Strand=Plus/Plus

Query  32     TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
              ||||||||||||| ||||| || |||||||||||||||||||   || || |    ||||
Sbjct  24803  TCGGCATCGACCTGGGCACGACGTACTCGTGCGTGGGCGTGTACAAGGACCAGAAGGTGG  24862

Query  92     AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
              | |||||||||||||| ||||||||||| | ||| ||||| ||||| || |     ||||
Sbjct  24863  AGATCATCGCCAACGATCAGGGCAACCGTATCACGCCGTCGTACGTGGCGT---GGGACT  24919

Query  152    CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
              ||      || ||||| ||||| ||||  |||||||| |||| | | || ||| |  | |
Sbjct  24920  CGAACGACGAGCGCCTGATCGGCGACGGTGCCAAGAACCAGGCGACGATCAACCCTGAGA  24979

Query  206    ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTC-GTCCAG  264
              | ||| ||||||| | ||| || |||||||||||||||| | |||| |  ||| || |||
Sbjct  24980  AGACGCTGTTCGATGTCAAGCGCCTGATCGGCCGCAAGTACGCGGA-CAAGTCGGTGCAG  25038

Query  265    GCCGACATCAAGCACTGGCCGTTCCA-AGTGACGTCGGGC--GCCGGTGACAAGCCGCAG  321
              |||||||  ||||    ||||| ||| | ||    ||| |  || |  | |||||||   
Sbjct  25039  GCCGACAAGAAGCTGCTGCCGTACCACATTG----CGGACAAGCAG--GGCAAGCCGTTC  25092

Query  322    ATCACGGTGCAGTTCAAGGGCGAGTCCAAG---ACGTTCCAACCCGAGGAGATCTCGTCC  378
              |||  ||||  | | |||||||||   |||     ||||   ||||||||| ||||| ||
Sbjct  25093  ATCGAGGTGACGGTGAAGGGCGAG---AAGCGCCAGTTCGCTCCCGAGGAGGTCTCGGCC  25149

Query  379    ATGGTGCTGATCAAGATG  396
              |||||||||| |||||||
Sbjct  25150  ATGGTGCTGACCAAGATG  25167

>PHCA:scaffold_65 PHYCAscaffold_65
Length=307771

 Score = 613 bits (679),  Expect = 9e-173
 Identities = 943/1333 (71%), Gaps = 33/1333 (2%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| |||||  |||||||||| ||||  |||| |||||| || ||||| || ||||| |
Sbjct  116707  AGGATGCCGGTACCATTGCCGGTCTCACTGTGCAGCGTATTATTAACGAACCTACGGCTG  116766

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGG-GC--GGCGAGCGCAACGTGCTGATCTTCG  517
               | ||||| || |||||  | |||||||||| ||  ||||||   ||||||||| ||||||
Sbjct  116767  CTGCCATTGCTTACGGTATTGACAAGAAGGCGCAGGGCGAGAAGAACGTGCTGGTCTTCG  116826

Query  518     ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
               ||||||| ||||| |||||||||||| | || ||  ||||||| |  ||| | |||||||
Sbjct  116827  ACCTGGGTGGCGGTACCTTCGATGTGACGCTGCTTGCCATTGATGGCGGCGTGTTCGAGG  116886

Query  578     TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
               ||  |||||||   |||||||| ||| |||||||||||||||| ||| | ||  |  || 
Sbjct  116887  TCCTGGCCACTAACGGTGACACTCACTTGGGTGGTGAGGACTTTGACCAGCGTATCATGC  116946

Query  638     ACCACTTCACGCAGGAGTTCAAGCG---CAAGCACCGCAAGGACATCACGGAGAACCAGC  694
               |  ||||||   || |||  |||     |||| |||     ||| || ||  | || |||
Sbjct  116947  AGTACTTCATCAAGAAGTGGAAGAAGGACAAGAACCTT---GACGTCGCGTCGGACAAGC  117003

Query  695     GTGCTCTTCGTCGTCTGCGGACGGCCTGC-GAGCGTGCCAAGCGTACGCTGTCGTCGTCG  753
               ||||||| |     || ||  ||    || ||||||| ||||||| | |||||| |   |
Sbjct  117004  GTGCTCTGCAGAAGCTCCGT-CGTGAAGCTGAGCGTGTCAAGCGTGCCCTGTCGGCCCAG  117062

Query  754     GCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATC  813
               |||||||||    | |||||||| |||||  | || ||    |||||||    | |  | 
Sbjct  117063  GCTCAGGCTCGTCTTGAGATTGAGTCTCTTCTGGATGGTGAGGACTTCACGGAGTCTTTG  117122

Query  814     ACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTG  873
               |  ||||| ||||||||| |  |   ||  |||   |||   |||||  | |  || || 
Sbjct  117123  AGCCGTGCCCGTTTCGAGAAGCTTAACGAGGACCTGTTCAAGAAGACCCTCGGCCCTGTC  117182

Query  874     GAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTG  933
               ||||||||| ||   || ||| | ||   ||||    ||||| ||||| | |||||||||
Sbjct  117183  GAGAAGGTGATGAAGGATGCCGACCTTAAGAAGTCGGAGGTGGACGAGATTGTGCTGGTG  117242

Query  934     GGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAG  993
               ||||| || || |||||||| ||||||||||||||| |   ||||| |||||||||||||
Sbjct  117243  GGCGGTTCTACCCGTATCCCCAAGGTGCAGCAGCTGATCAAGGACTACTTCAACGGCAAG  117302

Query  994     GAGCCCAACAAGTCCA-TCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGC  1052
               ||||||  |  ||    | ||||| || ||||| || |||||||||||  ||||||||| 
Sbjct  117303  GAGCCCT-CGCGTGGTGTGAACCCTGATGAGGCCGTCGCGTACGGTGCTGCCGTGCAGGG  117361

Query  1053    GGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGC---AGGACCTGCTTCTGCTGGA  1109
                |  |||||  | ||| |  |      |||  | ||     ||||| |||||||| | ||
Sbjct  117362  CGGTATCCTTGGTGGCGAGCA------GGACGACCTAACCAAGGACGTGCTTCTGATCGA  117415

Query  1110    CGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGC  1169
                |||   || ||||| | |||| | ||||| |  ||||| |||||||| | |||||||  
Sbjct  117416  TGTGGTTCCTCTGTCCCAGGGTATTGAGACTGTGGGTGGCGTCATGACCAAGCTGATCAA  117475

Query  1170    GCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCA  1229
                || |||||     | |||||||||||||||||||| ||||| ||||||   ||||||||
Sbjct  117476  CCGTAACACTGTTATCCCGACCAAGAAGTCGCAGACTTTCTCCACGTACCAGGACAACCA  117535

Query  1230    GCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCT  1289
               ||| |  ||||| ||||||||||||||||| |||||  |||||||    ||||||   ||
Sbjct  117536  GCCCGCTGTGCTGATCCAGGTGTTCGAGGGTGAGCGTGCCATGACCAAGGACAACCGTCT  117595

Query  1290    GCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGA  1349
                |||||||||||| | |||   ||| | ||||||   || || |||||||| ||||| ||
Sbjct  117596  TCTGGGCAAGTTCGAGCTGACTGGCCTGCCTCCCGCCCCGCGTGGTGTGCCCCAGATTGA  117655

Query  1350    CGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAAC  1409
                ||||||||||| ||||| || || || |||||| | ||||| || | ||| |||   ||
Sbjct  117656  AGTGACGTTCGAGATCGATGCCAATGGTATCCTGCAGGTGTCCGCCGAGGACAAGGGCAC  117715

Query  1410    GGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACAT  1469
               ||||||||   | | ||||||||||||   ||| |||||||| || || ||||  || ||
Sbjct  117716  GGGCAAGGCTGAGACGATCACGATCACTGCCGAGAAGGGCCGTCTGTCCCAGGAGGAGAT  117775

Query  1470    TGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACG  1529
               |||||||||||||  |||||| |   ||| |      |||||| ||     |||| | ||
Sbjct  117776  TGACCGCATGGTACAGGAGGCTGCTGAGTTCGCTGACGAGGACAAGAAGGTCAAGGACCG  117835

Query  1530    CATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACA--GTCTGAAT  1587
               |||||| | |   ||||| || |||  ||||   ||||| |||  |||||  |||     
Sbjct  117836  CATCGATGGCCGTAACGCTCTTGAGGGCTACCTGTACAGCCTGAAGAACAACGTC-----  117890

Query  1588    GACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGT--GGACGACAAGG  1645
               || |||||| |  |||| ||||||   || | ||||||| |  ||||    ||  |   |
Sbjct  117891  GAAGAGAAGCTTGAGGACAAGATCGACGAGGATGACAAGGACACGGTCCTTACTGC--CG  117948

Query  1646    TGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGT  1705
               ||  ||| |  ||  | ||||| || |  ||||||     ||| ||||| |  | |||| 
Sbjct  117949  TGCAGGATGCCATGGACTGGCTTGAGGACAACCAGGAGGCGGACAAGGAGGACTTCGAGG  118008

Query  1706    CGAAGCAGAAGGA  1718
               | |||||||||||
Sbjct  118009  CCAAGCAGAAGGA  118021

 Score = 168 bits (185),  Expect = 1e-38
 Identities = 266/375 (71%), Gaps = 20/375 (5%)
 Strand=Plus/Plus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               ||||||| ||||| ||||| |||||||||||||||||| | |   || || |    ||||
Sbjct  116248  TCGGCATTGACCTGGGCACGACCTACTCGTGCGTGGGCATCTACAAGGACCAGAAGGTGG  116307

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               | |||||||||||||||||||| ||||| |  || ||||| ||||||||||     ||||
Sbjct  116308  AGATCATCGCCAACGACCAGGGAAACCGTATTACGCCGTCGTACGTCGCCT---GGGACT  116364

Query  152     CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
               ||      || || || || |||||||  |||||||| ||||   | || ||| || | |
Sbjct  116365  CGAACGACGAGCGTCTGATTGGTGACGGTGCCAAGAACCAGGCCACGATCAACCCGGAGA  116424

Query  206     ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTC-GTCCAG  264
               | ||| ||||||| | ||| ||||| || |||||||||| |   || |  ||| || |||
Sbjct  116425  AGACGTTGTTCGATGTCAAGCGTCTCATTGGCCGCAAGTACAATGA-CAAGTCGGTGCAG  116483

Query  265     GCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATC  324
               || ||||  ||||    ||||| | || |  ||||   |   |  | |||||||   || 
Sbjct  116484  GCTGACAAGAAGCTGCTGCCGTACGAAAT--CGTC-AACAAAGAAGGCAAGCCGTTCATT  116540

Query  325     ACGGTGCAGTTCAAGGGCGAGTCCAAG---ACGTTCCAACCCGAGGAGATCTCGTCCATG  381
                 |||| || | |||||||||   |||     ||||   ||||||||| | ||| | |||
Sbjct  116541  GAGGTGGAGGTTAAGGGCGAG---AAGCGCCAGTTCGCCCCCGAGGAGGTGTCGGCTATG  116597

Query  382     GTGCTGATCAAGATG  396
               ||||||| |||||||
Sbjct  116598  GTGCTGACCAAGATG  116612

>PHRA:scaffold_1
Length=1244001

 Score = 599 bits (663),  Expect = 2e-168
 Identities = 939/1334 (70%), Gaps = 35/1334 (3%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||| |||| || || ||||  |||| ||| |||||||||||||| |||||||
Sbjct  770672  AGGACGCCGGCACCATCGCTGGACTCACGGTGCAGCGCATCATCAACGAGCCCACGGCCG  770613

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGC---GGCGAGCGCAACGTGCTGATCTTCG  517
               | ||||| || |||||| | ||||||||||     ||||||   ||||||||| | || |
Sbjct  770612  CTGCCATTGCCTACGGCATTGACAAGAAGGCACAGGGCGAGAAGAACGTGCTGGTGTTTG  770553

Query  518     ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
               ||||||| || ||||||||||||||| | || ||| |||| || |  ||| | |||||||
Sbjct  770552  ACCTGGGTGGTGGCACCTTCGATGTGACGCTGCTGGCCATCGACGGTGGCGTGTTCGAGG  770493

Query  578     TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
               |   ||||||    || |||||||||||||| || || ||||||||| | ||  |  || 
Sbjct  770492  TGCTGGCCACCAACGGCGACACGCACCTGGGCGGCGAAGACTTCGACCAGCGTATCATGC  770433

Query  638     ACCACTTCACGCAGGAGTTCAAGCG---CAAGCACCGCAAGGACATCACGGAGAACCAGC  694
               |  ||||||   || |||  |||     |||| ||| | | |    | |||| ||   ||
Sbjct  770432  AGTACTTCATTAAGAAGTGGAAGAAGGACAAGAACCTCGACGTGGCCTCGGACAA---GC  770376

Query  695     GTGCTCTTCGTCGTCTGCGGACGGCCTGCG-AGCGTGCCAAGCGTACGCTGTCGTCGTCG  753
               |||| || |     |||||  ||    ||| |||||| ||||||  | |||||| |   |
Sbjct  770375  GTGCGCTGCAGAAGCTGCGT-CGCGAGGCGGAGCGTGTCAAGCGCGCCCTGTCGGCCCAG  770317

Query  754     GCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATC  813
               || |||||     | ||||| || || ||| | ||||||   ||||||| |  | |  | 
Sbjct  770316  GCCCAGGCGCGTCTTGAGATCGAGTCGCTGCTGGACGGCGAGGACTTCACCGAGTCTCTG  770257

Query  814     ACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTG  873
               |  || || ||||||||| |  |   ||  |||   |||   |||||| | |  ||||| 
Sbjct  770256  AGCCGCGCCCGTTTCGAGAAACTTAACGAGGACCTGTTCAAGAAGACGCTCGGCCCCGTC  770197

Query  874     GAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTG  933
               |||| |||  ||   |||||  | ||   ||||    ||||| ||||| | |||||||||
Sbjct  770196  GAGAGGGTCATGAAGGACGCAGACCTCAAGAAGTCGGAGGTGGACGAGATTGTGCTGGTG  770137

Query  934     GGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAG  993
               ||||| ||||| |||||||| ||||||||||||||| |   ||||| |||||||||||| 
Sbjct  770136  GGCGGTTCGACCCGTATCCCCAAGGTGCAGCAGCTGATCAAGGACTACTTCAACGGCAAA  770077

Query  994     GAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCG  1053
               ||||||          | ||||| ||||||||||| || ||||||||  | |||||||  
Sbjct  770076  GAGCCCTCGCGCGGTGTGAACCCCGACGAGGCTGTTGCCTACGGTGCTGCTGTGCAGGGC  770017

Query  1054    GCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGC---AGGACCTGCTTCTGCTGGAC  1110
               |  |||||| | ||| |  |      |||  | |||    ||||| |||||||| | || 
Sbjct  770016  GGTATCCTGGGTGGCGAGCA------GGACGACCTGACCAAGGACGTGCTTCTGATCGAT  769963

Query  1111    GTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCG  1170
               |||  ||| ||||| | |||| | ||||| |  ||||| |||||||| | ||| ||    
Sbjct  769962  GTGGTGCCTCTGTCCCAGGGTATTGAGACTGTGGGTGGCGTCATGACCAAGCTCATTAAC  769903

Query  1171    CGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAG  1230
               || |||||   | | |||||||||||||||||||| |||||||| |||   |||||||||
Sbjct  769902  CGCAACACTGTGATCCCGACCAAGAAGTCGCAGACCTTCTCGACCTACCAGGACAACCAG  769843

Query  1231    CCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTG  1290
               || |  ||||| |||||||||||||||||||||||  |||||||    ||||||   || 
Sbjct  769842  CCCGCTGTGCTTATCCAGGTGTTCGAGGGCGAGCGTGCCATGACCAAGGACAACCGTCTT  769783

Query  1291    CTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGAC  1350
               |||||||||||| | ||    ||| | || |||   || || |||||||| ||||| || 
Sbjct  769782  CTGGGCAAGTTCGAGCTCACTGGCCTGCCGCCCGCCCCGCGTGGTGTGCCCCAGATTGAG  769723

Query  1351    GTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACG  1410
               ||||||||||| || ||||| ||||| |||||| | ||||| |||| ||| |||   |||
Sbjct  769722  GTGACGTTCGAGATTGACGCCAACGGTATCCTGCAGGTGTCCGCTGAGGACAAGGGCACG  769663

Query  1411    GGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATT  1470
               |||||||   | | ||||||||||||   ||| |||||||| || |||||||  || || 
Sbjct  769662  GGCAAGGCCGAGACGATCACGATCACTGCCGAGAAGGGCCGTCTGTCGCAGGAGGAGATC  769603

Query  1471    GACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCG--GAGGACGAGGCTAACAAGCAAC  1528
               |||||||||||   |||||||| | ||| |  | ||  |||||| ||     |||| | |
Sbjct  769602  GACCGCATGGTCCAGGAGGCCGCGGAGTTC--GCCGACGAGGACAAGAAGGTCAAGGACC  769545

Query  1529    GCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACA--GTCTGAA  1586
               ||||||| | |   || ||  |||||  ||||   ||||| ||   |||||  |||    
Sbjct  769544  GCATCGACGGCCGCAATGCTTTGGAGGGCTACCTATACAGCCTCAAGAACAACGTC----  769489

Query  1587    TGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGT--GGACGACAAG  1644
                || |||||  |  |||| ||||||   || |  |||||| |  ||||   |||| |   
Sbjct  769488  -GAGGAGAAACTCGAGGACAAGATCGACGAGGACGACAAGGACACGGTCCTGACGGC--C  769432

Query  1645    GTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAG  1704
               |||  ||| |  ||  | |||||||| |  ||||||      || ||||| |  | ||||
Sbjct  769431  GTGCAGGACGCCATGGACTGGCTGGAGGACAACCAGGAGGCTGACAAGGAGGACTTCGAG  769372

Query  1705    TCGAAGCAGAAGGA  1718
                 ||||||||||||
Sbjct  769371  GAGAAGCAGAAGGA  769358

 Score = 178 bits (196),  Expect = 6e-42
 Identities = 269/374 (72%), Gaps = 18/374 (5%)
 Strand=Plus/Minus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               ||||||||||||| ||||| |||||||||||||||||| | |   || || |    ||||
Sbjct  771131  TCGGCATCGACCTGGGCACGACCTACTCGTGCGTGGGCATCTACAAGGACCAGAAGGTGG  771072

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               | |||||||||||||||||||||||||| | ||| || || |||||||| |     ||||
Sbjct  771071  AGATCATCGCCAACGACCAGGGCAACCGTATCACGCCCTCGTACGTCGCGT---GGGACT  771015

Query  152     CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
               ||      || ||||| ||||| |||| ||| ||||| ||||   |||| ||| || | |
Sbjct  771014  CGAACGACGAGCGCCTGATCGGCGACGGCGCGAAGAACCAGGCCACCATCAACCCGGAGA  770955

Query  206     ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTC-GTCCAG  264
               | ||| ||||||||| ||| || || || || ||||||| |   || |  ||| || |||
Sbjct  770954  AGACGCTGTTCGACGTCAAGCGCCTCATTGGTCGCAAGTACAACGA-CAAGTCGGTGCAG  770896

Query  265     GCCGACATCAAGCACTGGCCGTTCCAAGTGA-CGTCGGGCGCCGGTGACAAGCCGCAGAT  323
                ||||||  ||||    ||||| | |  | | |  |  | | |||   ||||||    ||
Sbjct  770895  TCCGACAAGAAGCTGCTGCCGTACGAGATCATCAACAAG-GACGG---CAAGCCTTTCAT  770840

Query  324     CACGGTGCAGTTCAAGGGCGAG-TCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGG  382
               |  |||  || |||||||||||   |  || ||||   ||||||||| ||||| ||||||
Sbjct  770839  CCAGGTTGAGGTCAAGGGCGAGAAGCGCGA-GTTCGCGCCCGAGGAGGTCTCGGCCATGG  770781

Query  383     TGCTGATCAAGATG  396
               |||| | |||||||
Sbjct  770780  TGCTCACCAAGATG  770767

 Score = 41.0 bits (44),  Expect = 1.1
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  877     AAGGTGCTGCGCGACGCCAAGCTGTCG  903
               |||| ||||||||||||||||||| ||
Sbjct  901475  AAGGCGCTGCGCGACGCCAAGCTGCCG  901449

>PHPA:scaffold_15 NW_008649001.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.15, whole genome shotgun 
sequence
Length=1176021

 Score = 565 bits (626),  Expect = 1e-158
 Identities = 930/1331 (70%), Gaps = 29/1331 (2%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| |||||  |||||||||| || |  || | ||||||||| |||||||| ||||| |
Sbjct  893102  AGGATGCCGGTACCATTGCCGGTCTGACTGTCCAGCGTATCATTAACGAGCCCACGGCTG  893161

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGC---GGCGAGCGCAACGTGCTGATCTTCG  517
               | ||||| || |||||  | ||||||||||     ||||||   ||||||||  | ||||
Sbjct  893162  CTGCCATTGCCTACGGTATTGACAAGAAGGCTCAGGGCGAGAAGAACGTGCTAGTGTTCG  893221

Query  518     ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
               | ||||| ||||| |||||||||||| | || ||| ||||||| |  ||  | || ||||
Sbjct  893222  ATCTGGGTGGCGGTACCTTCGATGTGACGCTGCTGGCCATTGACGGTGGTGTGTTTGAGG  893281

Query  578     TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
               |   ||||||    |||||||| ||| |||| ||||||||||| ||| | ||  |  || 
Sbjct  893282  TGCTGGCCACCAACGGTGACACTCACTTGGGCGGTGAGGACTTTGACCAGCGTATCATGC  893341

Query  638     ACCACTTCACGCAGGAGTTCAAGCG---CAAGCACCGCAAGGACATCACGGAGAACCAGC  694
               |  ||||||   || |||  |||     |||| ||| | | |    | |||| ||   ||
Sbjct  893342  AGTACTTCATCAAGAAGTGGAAGAAGGACAAGAACCTCGACGTGGCCTCGGACAA---GC  893398

Query  695     GTGCTCTTCGTCGTCTGCGGACGGCCTGC-GAGCGTGCCAAGCGTACGCTGTCGTCGTCG  753
               ||||||| |     || ||  ||    || || |||| ||||||| | |||||| |   |
Sbjct  893399  GTGCTCTGCAGAAGCTCCGT-CGTGAGGCTGAACGTGTCAAGCGTGCTCTGTCGGCTCAG  893457

Query  754     GCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATC  813
               |||||||||    | ||||| || || ||  | || ||    ||||||| |  | || | 
Sbjct  893458  GCTCAGGCTCGTCTTGAGATCGAGTCGCTTCTGGATGGTGAGGACTTCACCGAGTCCCTG  893517

Query  814     ACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTG  873
               | |||||||||||||||| |  |   ||  || |  |||   |||||| |||  || |||
Sbjct  893518  AGTCGTGCTCGTTTCGAGAAGCTTAACGAGGATTTGTTCAAGAAGACGTTGGGCCCTGTG  893577

Query  874     GAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTG  933
               ||||||||| ||   |||||  | ||   ||||    ||||  ||||| | |||||||| 
Sbjct  893578  GAGAAGGTGATGAAGGACGCTGACCTCAAGAAGTCGGAGGTCGACGAGATTGTGCTGGTT  893637

Query  934     GGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAG  993
               || ||||| || |||||||| ||||||||||||||| |   ||||| |||||||||||||
Sbjct  893638  GGTGGCTCTACTCGTATCCCCAAGGTGCAGCAGCTGATCAAGGACTACTTCAACGGCAAG  893697

Query  994     GAGCCCAACAAGTCCA-TCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGC  1052
               || |||  |  ||    | ||||| || |||||||| || ||||||||  | || |||| 
Sbjct  893698  GAACCCT-CGCGTGGTGTGAACCCCGATGAGGCTGTCGCTTACGGTGCTGCTGTCCAGGG  893756

Query  1053    GGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGC---AGGACCTGCTTCTGCTGGA  1109
                |  |||||| | ||| |  |      |||  |  ||    ||||| |||||||  | ||
Sbjct  893757  CGGTATCCTGGGTGGCGAGCA------GGACGACTTGACCAAGGACGTGCTTCTTATCGA  893810

Query  1110    CGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGC  1169
                |||  ||| ||||| | |||| | ||||| |  |||||||||||||||| |||||||  
Sbjct  893811  TGTGGTGCCTCTGTCCCAGGGTATTGAGACTGTGGGTGGTGTCATGACGAAGCTGATCAA  893870

Query  1170    GCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCA  1229
                || |||||     | |||||||||||||||||||| ||||||||||||   ||||||||
Sbjct  893871  CCGTAACACTGTTATCCCGACCAAGAAGTCGCAGACCTTCTCGACGTACCAGGACAACCA  893930

Query  1230    GCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCT  1289
               |||||  ||||| ||||||||||||||||| |||||  |||||||    ||||||   ||
Sbjct  893931  GCCTGCTGTGCTGATCCAGGTGTTCGAGGGTGAGCGTGCCATGACCAAGGACAACCGTCT  893990

Query  1290    GCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGA  1349
                |||||||||||| | ||    ||  | || ||    || || |||||||| ||||| ||
Sbjct  893991  TCTGGGCAAGTTCGAGCTCACTGGTCTGCCCCCTGCTCCGCGTGGTGTGCCCCAGATTGA  894050

Query  1350    CGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAAC  1409
                ||||||||||| |||||||| ||||| |||||| | ||||| |||| ||| |||   ||
Sbjct  894051  AGTGACGTTCGAGATCGACGCCAACGGTATCCTGCAGGTGTCTGCTGAGGACAAGGGCAC  894110

Query  1410    GGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACAT  1469
                || ||||   | | ||||||||||||    || |||||||| || || ||||  || ||
Sbjct  894111  TGGTAAGGCCGAGACGATCACGATCACTGCTGAGAAGGGCCGTCTGTCCCAGGAGGAGAT  894170

Query  1470    TGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCG--GAGGACGAGGCTAACAAGCAA  1527
                |||||||||||   |||||||| | ||| |  | ||  |||||| ||     |||| | 
Sbjct  894171  CGACCGCATGGTCCAGGAGGCCGCGGAGTTC--GCCGACGAGGACAAGAAGGTCAAGGAC  894228

Query  1528    CGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAAT  1587
               || ||||| | |   ||||| || |||   |||   ||||| |||  |||||   ||   
Sbjct  894229  CGTATCGATGGCCGCAACGCTCTCGAGGGATACCTGTACAGCCTGAAGAACAACGTG---  894285

Query  1588    GACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTG  1647
               || |||||| |  |||| ||||||   || |  |||||| |  |||||  |      |||
Sbjct  894286  GAGGAGAAGCTCGAGGACAAGATCGACGAGGACGACAAGGACACGGTGCTCACTGCTGTG  894345

Query  1648    ACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCG  1707
                 ||| |  ||  | ||||| || |  ||||||      || ||||| |  | |||| | 
Sbjct  894346  CAGGACGCCATGGACTGGCTCGAGGACAACCAGGAGGCCGACAAGGAAGACTTCGAGGCC  894405

Query  1708    AAGCAGAAGGA  1718
               |||||||||||
Sbjct  894406  AAGCAGAAGGA  894416

 Score = 147 bits (162),  Expect = 1e-32
 Identities = 186/253 (74%), Gaps = 11/253 (4%)
 Strand=Plus/Plus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               |||| |||||||| ||||| |||||||||||||||||| | |   || || |    ||||
Sbjct  892643  TCGGTATCGACCTGGGCACGACCTACTCGTGCGTGGGCATTTACAAGGACCAGAAGGTGG  892702

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               |||||||||| ||||||||||| ||||| | ||| || || ||||||||||     ||||
Sbjct  892703  AAATCATCGCTAACGACCAGGGTAACCGTATCACGCCCTCGTACGTCGCCT---GGGACT  892759

Query  152     CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
               ||      || || || || || || |  |||||||| ||||   | || ||| || | |
Sbjct  892760  CGAACGACGAGCGTCTGATTGGCGATGGTGCCAAGAACCAGGCCACTATCAACCCGGAGA  892819

Query  206     ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTC-GTCCAG  264
               | ||| ||||||| | ||| ||||| ||||| ||||||| |   || |  ||| || |||
Sbjct  892820  AGACGCTGTTCGATGTCAAGCGTCTCATCGGTCGCAAGTACAACGA-CAAGTCGGTGCAG  892878

Query  265     GCCGACATCAAGC  277
               |||||||  ||||
Sbjct  892879  GCCGACAAGAAGC  892891

>PHRA:scaffold_1454
Length=4640

 Score = 557 bits (617),  Expect = 6e-156
 Identities = 472/581 (81%), Gaps = 0/581 (0%)
 Strand=Plus/Minus

Query  403   GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
             || ||||| | |||||| ||  | |||||||| |||||||||||||||||||| ||||||
Sbjct  2874  GATGCCGGTGTCATTGCTGGTTTGAACGTGCTACGTATCATCAACGAGCCGACAGCCGCC  2815

Query  463   GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
             || || || ||||| |||||||| ||||| || |||| ||||||||||||||||||||| 
Sbjct  2814  GCTATTGCCTACGGTCTGGACAAAAAGGGTGGAGAGCACAACGTGCTGATCTTCGACCTT  2755

Query  523   GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
             || || || || || || || || || ||  | ||||| || |||||||||||||| |||
Sbjct  2754  GGTGGAGGAACGTTTGACGTCTCGCTTCTTACTATTGAAGACGGCATCTTCGAGGTGAAG  2695

Query  583   GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCAC  642
             || || || || |||||||||||||| || || ||||||||||||||||| || ||   |
Sbjct  2694  GCGACGGCAGGCGACACGCACCTGGGCGGCGAAGACTTCGACAACCGCCTCGTCGAGTTC  2635

Query  643   TTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTT  702
             ||   ||| || |||||||||||||| |||||||| || |||| ||||  ||| || || 
Sbjct  2634  TTTGTGCAAGAATTCAAGCGCAAGCATCGCAAGGATATGACGGTGAACTCGCGCGCGCTG  2575

Query  703   CGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCT  762
             || |||||||| ||||| |||||||||||||||||||| ||||||  ||| || || || 
Sbjct  2574  CGGCGTCTGCGTACGGCGTGCGAGCGTGCCAAGCGTACACTGTCGATGTCTGCGCAAGCG  2515

Query  763   TACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCT  822
             ||||||||||||||||| ||| | || ||  |||| |||||||| ||||| || || || 
Sbjct  2514  TACATCGAGATTGACTCGCTGCTGGATGGTGTCGATTTCAACTCTACCATTACGCGCGCG  2455

Query  823   CGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTG  882
             || ||||||||  | || || || | ||| |||||||| ||||| || |||| | |||| 
Sbjct  2454  CGGTTCGAGGATCTTTGTGGTGAATTCTTTCGCAAGACAATGGACCCAGTGGCGCAGGTT  2395

Query  883   CTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCG  942
             || || ||| | ||||||||||||||||||||| ||||||||||||| ||||||||||||
Sbjct  2394  CTACGAGACTCGAAGCTGTCGAAGAGCCAGGTGAACGAGGTGGTGCTAGTGGGCGGCTCG  2335

Query  943   ACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTT  983
             || ||||||||||||||||||||| || ||   ||||| ||
Sbjct  2334  ACTCGTATCCCGAAGGTGCAGCAGTTGTTGATCGACTTTTT  2294

 Score = 468 bits (518),  Expect = 2e-129
 Identities = 483/631 (77%), Gaps = 1/631 (0%)
 Strand=Plus/Minus

Query  1137  GACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACGAC-GGTGCCGACCAAGA  1195
             |||||| || || |||||||| | ||||||| |||| ||||| || ||| ||  ||||||
Sbjct  2087  GACGGCTGGCGGAGTCATGACCAAGCTGATCCCGCGCAACACCACNGGTTCCAGCCAAGA  2028

Query  1196  AGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCG  1255
             || ||||| |||||||||||||||| ||||||||| | || ||  | ||||| |||||||
Sbjct  2027  AGGCGCAGTCGTTCTCGACGTACGCGGACAACCAGTCCGGTGTCTTGATCCAAGTGTTCG  1968

Query  1256  AGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCA  1315
             |||| ||||| || |||||  | |||||  | || ||||||||||| ||| |||||||||
Sbjct  1967  AGGGTGAGCGTTCGATGACCTGTGACAATCATCTTCTGGGCAAGTTTAACTTGGACGGCA  1908

Query  1316  TCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACG  1375
             |||| ||||||||||||||||||||||| || ||||||||||||||| | || |  ||||
Sbjct  1907  TCCCGCCCATGCCTCGCGGTGTGCCGCAAATTGACGTGACGTTCGACGTGGATGTCAACG  1848

Query  1376  GCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCA  1435
             ||||  ||||||||||||| ||||||||||| ||||||||||||||||||||||  ||||
Sbjct  1847  GCATTTTGAACGTGTCGGCCGTGGAGAAGTCGACGGGCAAGGAGAACAAGATCATCATCA  1788

Query  1436  CGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGA  1495
             ||||||||||||||||  | || ||| | || ||  ||||||||||    || || ||||
Sbjct  1787  CGAACGACAAGGGCCGGTTATCTCAGTCCGAGATCAACCGCATGGTTGATGACGCTGAGA  1728

Query  1496  AGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGA  1555
             ||||||||    | || ||    |||||||  ||||||||| | ||||||||||||||||
Sbjct  1727  AGTACAAGGACCAAGATGAACGCAACAAGCTGCGCATCGAGTCGAAGAACGCGCTGGAGA  1668

Query  1556  ACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGAAGATGAAGGAGAAGATCCCGG  1615
             | ||||| | |  |||||| | |     |   || || ||  ||  ||  ||  |    |
Sbjct  1667  ATTACGCGTTCTCTCTGCGCAGCTCGACGCGAGATGAAAAAGTGGCGGCCAAATTGAGCG  1608

Query  1616  AAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAGTGATCCAGTGGCTGGACGCAA  1675
             | |  ||||||||| || | || |||||||||  |||     | || ||| |||| || |
Sbjct  1607  ACGAGGACAAGAAGACGATTGAGGACAAGGTGGTGGAGACCCTGCACTGGTTGGATGCCA  1548

Query  1676  ACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGAAGGAATTGGAGGGCGTGGCCA  1735
             ||||| |   || |||||| | || |||  |||||||| ||||  ||||||| ||| |||
Sbjct  1547  ACCAGGCGGCGGGGAAGGAGGAGTTCGACGCGAAGCAGCAGGAGCTGGAGGGTGTGACCA  1488

Query  1736  ACCCAGTGTTGCAGAAGATGTACGCTGCTGC  1766
             ||||  |  |||||||||| ||| | || ||
Sbjct  1487  ACCCGATCATGCAGAAGATTTACACCGCGGC  1457

 Score = 405 bits (448),  Expect = 2e-110
 Identities = 315/373 (84%), Gaps = 2/373 (1%)
 Strand=Plus/Minus

Query  31    GTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTG  90
             || ||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct  3336  GTGGGCATCGACCTGGGCACGACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGCGTG  3277

Query  91    GAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGAC  150
             || ||||| || |||||||||||||||||||| || ||||| ||||| |||||||| |||
Sbjct  3276  GAGATCATTGCGAACGACCAGGGCAACCGCACGACACCGTCCTACGTGGCCTTCACGGAC  3217

Query  151   TCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACG  210
              |||| ||||| ||||| ||||| |||||||| |||||||||||||||||||||||||||
Sbjct  3216  ACGGAGCGCCTTATCGGCGACGCGGCCAAGAACCAGGTGGCCATGAACGCGCACAACACG  3157

Query  211   GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
             ||||| || | ||| ||| ||||||| ||||||||| | ||||| |  || ||| | |||
Sbjct  3156  GTGTTTGATGTCAAGCGTTTGATCGGGCGCAAGTTCACCGACCCTGAAGTGCAGTCGGAC  3097

Query  271   ATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTG-ACAAGCCGCAGATCACGGT  329
             |||| ||||||||||||  ||||| | ||| |  |||| | | |||||| || |   |||
Sbjct  3096  ATCAGGCACTGGCCGTTTAAAGTGGC-TCGAGGTCCGGAGAATAAGCCGGAGGTGGTGGT  3038

Query  330   GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGAT  389
             ||||||||| || |||     ||| ||||| ||||||||||||||||||||||||||| |
Sbjct  3037  GCAGTTCAAAGGTGAGCAGGTGACTTTCCAGCCCGAGGAGATCTCGTCCATGGTGCTGGT  2978

Query  390   CAAGATGCGCGAG  402
             |||||||||||||
Sbjct  2977  CAAGATGCGCGAG  2965

>PHIF:NW_003303758.1 Phytophthora infestans T30-4 supercont1.1 
genomic scaffold, whole genome shotgun sequence
Length=6928287

 Score = 549 bits (608),  Expect = 9e-154
 Identities = 929/1334 (70%), Gaps = 35/1334 (3%)
 Strand=Plus/Minus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                ||||||||||  | ||||| || || |  || | ||||||||| |||||||| ||||| |
Sbjct  2771986  AGGACGCCGGTACTATTGCTGGTCTTACGGTCCAGCGTATCATTAACGAGCCCACGGCTG  2771927

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGC---GGCGAGCGCAACGTGCTGATCTTCG  517
                | ||||| || |||||  | || |||||||     ||||||   |||||| || | ||||
Sbjct  2771926  CTGCCATTGCCTACGGTATTGATAAGAAGGCACAGGGCGAGAAGAACGTGTTGGTGTTCG  2771867

Query  518      ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
                ||||||||||||| |||||||||||| | || ||| ||||||| |  ||  | |||||||
Sbjct  2771866  ACCTGGGCGGCGGTACCTTCGATGTGACGCTGCTGGCCATTGACGGCGGTGTGTTCGAGG  2771807

Query  578      TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
                |   ||||||    || ||||| ||| ||||||| |||||||||||| | ||  |  || 
Sbjct  2771806  TGCTGGCCACCAACGGAGACACTCACTTGGGTGGCGAGGACTTCGACCAGCGTATCATGC  2771747

Query  638      ACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAG---GACATCACGGAGAACCAGC  694
                |  ||||||   || |||  |||   ||| ||   |||   ||| |  |   | || |||
Sbjct  2771746  AGTACTTCATCAAGAAGTGGAAG---AAGGACAAGAAGATCGACGTGGCTTCGGACAAGC  2771690

Query  695      GTGCTCTTCGTCGTCTGCGGACGGCCTGC-GAGCGTGCCAAGCGTACGCTGTCGTCGTCG  753
                ||||||| |     || ||  ||    || ||||||| ||||||| | |||||  |   |
Sbjct  2771689  GTGCTCTGCAGAAGCTCCGT-CGTGAGGCTGAGCGTGTCAAGCGTGCTCTGTCTGCTCAG  2771631

Query  754      GCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATC  813
                |||||||||    | |||||||| |||||  | |||||    |||||||    | |  | 
Sbjct  2771630  GCTCAGGCTCGTCTTGAGATTGAGTCTCTTCTGGACGGTGAGGACTTCACTGAGTCTCTG  2771571

Query  814      ACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTG  873
                |  ||||||||||||||| |  |   ||  ||||  |||   |||||  |||  || |||
Sbjct  2771570  AGCCGTGCTCGTTTCGAGAAGCTTAACGAGGACTTGTTCAAGAAGACCTTGGGCCCTGTG  2771511

Query  874      GAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTG  933
                ||||||||| ||   |||||  | ||   ||||    ||||  ||||| | |||||||| 
Sbjct  2771510  GAGAAGGTGATGAAGGACGCTGACCTCAAGAAGTCGGAGGTCGACGAGATCGTGCTGGTC  2771451

Query  934      GGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAG  993
                || ||||| ||||||||||| ||||||||||||||| |   ||||| |||||||||||||
Sbjct  2771450  GGTGGCTCTACGCGTATCCCCAAGGTGCAGCAGCTGATCAAGGACTACTTCAACGGCAAG  2771391

Query  994      GAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCG  1053
                |||||      |    | ||||| ||||||||||| || ||||||||  | || ||||  
Sbjct  2771390  GAGCCTTCGCGGGGTGTGAACCCCGACGAGGCTGTCGCTTACGGTGCTGCTGTCCAGGGC  2771331

Query  1054     GCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGC---AGGACCTGCTTCTGCTGGAC  1110
                |  ||| || | ||| |  |      |||  | |||    ||||| |||||||  | || 
Sbjct  2771330  GGTATCTTGGGTGGCGAGCA------GGACGACCTGACCAAGGACGTGCTTCTTATTGAT  2771277

Query  1111     GTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCG  1170
                |||  ||| ||||| | |||| | ||||| |  ||||| |||||||| | ||| |||   
Sbjct  2771276  GTGGTGCCTCTGTCCCAGGGTATTGAGACTGTGGGTGGCGTCATGACCAAGCTTATCAAC  2771217

Query  1171     CGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAG  1230
                || |||||     | |||||||||||||||||||| ||||| ||||||   |||||||||
Sbjct  2771216  CGTAACACTGTCATCCCGACCAAGAAGTCGCAGACCTTCTCCACGTACCAGGACAACCAG  2771157

Query  1231     CCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTG  1290
                ||||  ||| | ||||||||||| ||||| |||||  | |||||    ||||||   || 
Sbjct  2771156  CCTGCTGTGTTGATCCAGGTGTTTGAGGGTGAGCGTGCTATGACCAAGGACAACCGTCTT  2771097

Query  1291     CTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCG--GTGTGCCGCAGATCG  1348
                || ||||||||| | ||  ||||  |  | ||| |||| ||||  ||||||| ||||| |
Sbjct  2771096  CTTGGCAAGTTCGAGCTC-ACGGGTTTGCCCCC-TGCCCCGCGTGGTGTGCCCCAGATTG  2771039

Query  1349     ACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAA  1408
                | ||||||||||| || ||||| ||||| |||||| | ||||| |||| ||| |||   |
Sbjct  2771038  AAGTGACGTTCGAGATTGACGCTAACGGTATCCTGCAAGTGTCTGCTGAGGACAAGGGCA  2770979

Query  1409     CGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACA  1468
                |||||||||   | | ||||||||||||   ||| |||||||| || || ||||  || |
Sbjct  2770978  CGGGCAAGGCCGAGACGATCACGATCACTGCCGAGAAGGGCCGTCTGTCCCAGGAAGAGA  2770919

Query  1469     TTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGAC--GAGGCTAACAAGCA  1526
                | |||||||||||   ||||||||   ||| |      ||||||  |||| |  |||| |
Sbjct  2770918  TCGACCGCATGGTCCAGGAGGCCGCTGAGTTCGCTGACGAGGACAAGAGGGT--CAAGGA  2770861

Query  1527     ACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACA--GTCTG  1584
                 || ||||| | |   ||||  || |||   |||   ||||| |||  |||||  |||  
Sbjct  2770860  CCGTATCGATGGCCGCAACGGCCTCGAGGGATACCTGTACAGCCTGAAGAACAACGTC--  2770803

Query  1585     AATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAG  1644
                   || |||||| |  |||| ||||||   || |  |||||| |  |||||  |      
Sbjct  2770802  ---GAGGAGAAGCTCGAGGACAAGATCGACGAGGACGACAAGGACACGGTGCTCACTGCT  2770746

Query  1645     GTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAG  1704
                |||  ||| |  ||  | ||| |||| |  ||||||      || ||||| |  | ||||
Sbjct  2770745  GTGCAGGACGCCATGGACTGGTTGGAGGACAACCAGGAGGCCGACAAGGAGGACTTCGAG  2770686

Query  1705     TCGAAGCAGAAGGA  1718
                 | |||||||||||
Sbjct  2770685  GCCAAGCAGAAGGA  2770672

 Score = 138 bits (152),  Expect = 5e-30
 Identities = 162/219 (74%), Gaps = 9/219 (4%)
 Strand=Plus/Minus

Query  32       TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
                ||||||| ||||| ||||| || ||||||||||||||| | |   || || |    ||||
Sbjct  2772445  TCGGCATTGACCTGGGCACGACGTACTCGTGCGTGGGCATCTACAAGGACCAGAAAGTGG  2772386

Query  92       AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
                | |||||||| ||||||||||| ||||| | ||| || || || ||||| |     ||||
Sbjct  2772385  AGATCATCGCGAACGACCAGGGTAACCGTATCACGCCCTCGTATGTCGCTT---GGGACT  2772329

Query  152      CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
                ||      || || || ||||||||||  |||||||| ||||   | || ||| || | |
Sbjct  2772328  CGAACGACGAGCGTCTGATCGGTGACGGTGCCAAGAACCAGGCCACTATCAACCCGGAGA  2772269

Query  206      ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGT  244
                | ||| ||||||| | ||| ||||| || ||||||||||
Sbjct  2772268  AGACGCTGTTCGATGTCAAGCGTCTCATTGGCCGCAAGT  2772230

>SADI:scaffold_8 supercont1.8 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.8:1:1177252:1 
REF
Length=1177252

 Score = 546 bits (605),  Expect = 1e-152
 Identities = 835/1183 (71%), Gaps = 29/1183 (2%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||  |||||||||||||||  || | ||||||||||||||||||||||||||
Sbjct  830981  AGGACGCCGGTACCATTGCCGGCCTCACGGTCCAGCGTATCATCAACGAGCCGACGGCCG  831040

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGC------AACGTGCTGATCT  514
               ||||||| || |||||  | ||||| |||  || | || ||      || |||||  |||
Sbjct  831041  CCGCCATTGCCTACGGTATCGACAAAAAGAACGCCAAGGGCGAGAAGAATGTGCTCGTCT  831100

Query  515     TCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCG  574
               |||| || ||||| || ||||| |||||  | |||||  | || || |  ||| |||| |
Sbjct  831101  TCGATCTCGGCGGTGGTACCTTTGATGTCACGCTCCTCACGATCGACGGCGGCGTCTTTG  831160

Query  575     AGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGG  634
               ||||     | ||    || ||||| || || || ||||| || |||||  | ||  |  
Sbjct  831161  AGGTGCTCTCGACCAACGGCGACACCCATCTCGGCGGTGAAGATTTCGATCAGCGTGTCA  831220

Query  635     TGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAG---GACATCACGGAGAACC  691
               || |   |||||   || |||   ||   |||||    |||   |||||||    | || 
Sbjct  831221  TGCAGTTCTTCATCAAGAAGTGGCAG---AAGCAAAAGAAGATTGACATCAGCTCGGACA  831277

Query  692     AGCGTGCTCTTC-GTCG-TCTGCGGACG--GCCTGCGAGCGTGCCAAGCGTACGCTGTCG  747
               |||| || || | |  | || || | ||  |||   ||||||| ||||||  | || |||
Sbjct  831278  AGCGCGCGCTCCAGAAGCTCCGCCG-CGAAGCC---GAGCGTGTCAAGCGCGCCCTCTCG  831333

Query  748     TCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCG  807
                ||  | | |||||   | |||| ||||| || ||  ||||||||   |||||  ||  |
Sbjct  831334  ACGCAGCCCCAGGCGCGCCTCGAAATTGAGTCGCTCCTCGACGGCGAGGACTTTGACGAG  831393

Query  808     ACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAG  867
               ||  |||| |||||||| || || ||  |   |  ||||  ||||   |||||| | |  
Sbjct  831394  ACGCTCACGCGTGCTCGCTTTGAAGAGCTCAACAACGACCTCTTCAAGAAGACGCTCGGC  831453

Query  868     CCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTG  927
               ||||| ||||||||  ||   ||||||   ||   ||||    ||||  ||||| | |||
Sbjct  831454  CCCGTCGAGAAGGTCATGAAGGACGCCGGCCTCAAGAAGTCGGAGGTCGACGAGATTGTG  831513

Query  928     CTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAAC  987
               || || |||||||||||||| || || ||| | ||||||||  |   ||| |||||||||
Sbjct  831514  CTTGTCGGCGGCTCGACGCGCATTCCCAAGATCCAGCAGCTCATCAAGGATTTCTTCAAC  831573

Query  988     GGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTG  1047
               ||||||||||||         |||||||| ||||||||||| |||||||||||  |||| 
Sbjct  831574  GGCAAGGAGCCCTCGCGCGGTATCAACCCCGACGAGGCTGTCGCGTACGGTGCTGCCGTC  831633

Query  1048    CAGGCGGCCATCCT---GAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTG  1104
               ||||  |  |||||   | ||| |||||||  ||||   |||      ||| |  | || 
Sbjct  831634  CAGGGCGGTATCCTCGCGGGCGTCAACGACGAGTCGACCAAG------GACATTTTGCTT  831687

Query  1105    CTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTG  1164
               || || ||| | ||||| || || ||| | ||||||| ||| ||||||||||| | | | 
Sbjct  831688  CTCGATGTGGCCCCGCTCTCGCTCGGTATTGAGACGGTCGGCGGTGTCATGACCAAGATC  831747

Query  1165    ATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGAC  1224
               |||   || ||||||  |||||| || |||||||||||||||||||||||||||   |||
Sbjct  831748  ATCAACCGCAACACGGTGGTGCCCACGAAGAAGTCGCAGACGTTCTCGACGTACCAGGAC  831807

Query  1225    AACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAAC  1284
               ||||| || |  |||   |||||||| | ||| ||||||||| | |||||    ||||||
Sbjct  831808  AACCAACCCGCTGTGTCGATCCAGGTCTACGAAGGCGAGCGCACGATGACCAAGGACAAC  831867

Query  1285    AACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAG  1344
                || |||| ||||||||  | ||    |||||||| ||   ||| || || |||||||||
Sbjct  831868  CACATGCTCGGCAAGTTTGAGCTCACGGGCATCCCGCCGGCGCCGCGTGGCGTGCCGCAG  831927

Query  1345    ATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAG  1404
               || || || ||||||||  ||||||| |||||||||||  | || ||||| | ||| |||
Sbjct  831928  ATTGAAGTCACGTTCGAGGTCGACGCCAACGGCATCCTCCAGGTCTCGGCCGAGGACAAG  831987

Query  1405    TCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCT  1464
                  ||||||||||   | ||||| |||||||||  ||| |||||||||||||||||||  
Sbjct  831988  GGCACGGGCAAGGCTGAGAAGATTACGATCACGGCCGAGAAGGGCCGCCTCTCGCAGGAG  832047

Query  1465    GACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAG  1524
               || ||||| ||||||||   ||| |||||| || ||     ||| ||| ||   | ||||
Sbjct  832048  GAGATTGATCGCATGGTCCAGGAAGCCGAGGAGAACGCCGAGGAAGACAAGAAGATCAAG  832107

Query  1525    CAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACA  1567
                | ||||| || | |   ||| |||| ||   ||||  |||||
Sbjct  832108  GACCGCATTGACGGCCGCAACTCGCTCGAAGGCTACCTCTACA  832150

 Score = 145 bits (160),  Expect = 4e-32
 Identities = 259/374 (69%), Gaps = 22/374 (6%)
 Strand=Plus/Plus

Query  34      GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
               ||||||||| | ||||| |||||||||||||| |||   |     |||| |   || || 
Sbjct  830524  GGCATCGACTTGGGCACGACCTACTCGTGCGTCGGCCACTACGCCAACGGCAAGGTCGAG  830583

Query  94      ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
               |||||||||||||||||||| ||||||| ||| || || || || || |     ||||||
Sbjct  830584  ATCATCGCCAACGACCAGGGTAACCGCATCACGCCCTCGTATGTGGCAT---GGGACTCG  830640

Query  154     ------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAAC  207
                     || |||||||| || |||| ||||||||| |||| | | || ||| || | |||
Sbjct  830641  AACGACGAGCGCCTCATTGGCGACGGCGCCAAGAACCAGGCGACGATCAACCCGGAGAAC  830700

Query  208     ACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTC-GTCCAGGC  266
               ||| | || |||| ||| || || ||||| ||| ||| |   || |  ||| || |||||
Sbjct  830701  ACGCTCTTTGACGTCAAGCGCCTTATCGGTCGCCAGTACAACGA-CAAGTCGGTGCAGGC  830759

Query  267     CGACATCAAGCACTGGCCGTTCCA-AGTG---ACGTCGGGCGCCGGTGACAAGCCGCAGA  322
                ||||  ||||    ||||| | | | ||   ||   | | ||||        ||| | |
Sbjct  830760  GGACAAGAAGCTGCTGCCGTACGAGATTGTCAACAAGGAGGGCCG-------CCCGTACA  830812

Query  323     TCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGG  382
               ||  ||||    ||||||||||| |||||||||||    |||| ||  ||||| ||||| 
Sbjct  830813  TCCAGGTGATTGTCAAGGGCGAGACCAAGACGTTCTCGGCCGAAGAAGTCTCGGCCATGA  830872

Query  383     TGCTGATCAAGATG  396
               | || | |||||||
Sbjct  830873  TTCTCACCAAGATG  830886

>PHCA:scaffold_50 PHYCAscaffold_50
Length=475612

 Score = 536 bits (594),  Expect = 6e-150
 Identities = 817/1143 (71%), Gaps = 48/1143 (4%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||  ||||||| || ||  ||||   ||||||||||||||||||||||||||
Sbjct  179419  AGGACGCCGGTTCCATTGCTGGTCTGGACGTCAAGCGTATCATCAACGAGCCGACGGCCG  179478

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGC---GA-------GC--GCAACGTGC  508
               ||||||||||||||||||||||||  || |  |||   ||       ||  |||||||||
Sbjct  179479  CCGCCATCGCGTACGGCCTGGACACCAACGCTGGCACGGACGGTAAGGCTTGCAACGTGC  179538

Query  509     TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  179539  TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  179598

Query  569     TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
               |||||| ||||||| | || |  || |||||  |||||||  ||||||||||||||||| 
Sbjct  179599  TCTTCGGGGTCAAGTCGACGGGCGGAGACACCTACCTGGGAAGTGAGGACTTCGACAACA  179658

Query  629     GCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAA---GGA--CATCAC  683
                | ||||||| ||| |   |   ||||||||||||||| |||||||   |||  | || |
Sbjct  179659  ACATGGTGGAGCACCTGTTGACCGAGTTCAAGCGCAAGAACCGCAACCTGGACCCGTC-C  179717

Query  684     GGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCT  743
               |||    |  |||||| | ||||||||||| |||||||| |||   |||||||||| |||
Sbjct  179718  GGATCGGC-CCGTGCTATGCGTCGTCTGCGTACGGCCTGTGAGTCGGCCAAGCGTATGCT  179776

Query  744     GTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAA  803
               |||| |  || ||   ||||   | ||| | |||||||||||||| ||| | ||||||  
Sbjct  179777  GTCGACCACGACTTCCGCTTCGGTGGAGGTGGACTCTCTGTTCGAGGGCGTGGACTTCTC  179836

Query  804     CTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGA-CTACTTCCGCAAGACGA  862
                || ||  | || ||||||   ||||||    ||  ||  || ||  |   ||    |||
Sbjct  179837  GTCCACTGTGACCCGTGCTAAGTTCGAGTCGTTGAACGAGGAGCTGTTCAAGCGTTGCGA  179896

Query  863     TGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGG  922
                |||| |||||   ||||||||    ||||||||| ||  |  |    | |||   ||| 
Sbjct  179897  -GGAGACCGTGCTTAAGGTGCTCGAGGACGCCAAGATGAAGCCGGAGGACGTGACGGAGC  179955

Query  923     TGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACT-TC  981
               ||||||| || ||||| || ||||||||||| |||||||||    |||||||  ||| | 
Sbjct  179956  TGGTGCTTGTAGGCGGTTCCACGCGTATCCCCAAGGTGCAGACCATGCTGTC-CACTCTG  180014

Query  982     TTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCG  1041
               |||  |||||||||||    ||||||||||||||| || |||||||| || |||||||| 
Sbjct  180015  TTCGGCGGCAAGGAGCTGTCCAAGTCCATCAACCCCGATGAGGCTGTTGCCTACGGTGCT  180074

Query  1042    ACCGTGCAGGCGGCCATCCTGAGCGGCA-ACGACTCGTCGGAGAAGCTGCAGGACCTGCT  1100
                |||||||||  |||||||||  |||||  ||   || ||    | |  |  |  |||||
Sbjct  180075  GCCGTGCAGGGCGCCATCCTGGACGGCATCCGTAACGACG--CCACCAACTCG--CTGCT  180130

Query  1101    TCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGAC  1160
                ||| |||| || || || |||||||||||| | |||||||  ||    |||||| |   
Sbjct  180131  GCTGGTGGATGTCACCCCTCTGTCTCTGGGTATTGAGACGGTTGGCAAGGTCATGTCTGT  180190

Query  1161    GCTGATCGCGCGGAACACGACGGTGCC---GACCAAGAAGTCGCAGACGTTCTCGACGTA  1217
               |||||||  ||| |||||| |  | ||   |  |||||   | |    || | | ||| |
Sbjct  180191  GCTGATCAAGCGTAACACGGCCATCCCCGTGCGCAAGA---CCCGTGTGTACACTACGGA  180247

Query  1218    CGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCG  1277
                |  ||| ||||| |    |||  | |     | | |||||| ||||| | | || || |
Sbjct  180248  GGAGGACTACCAGACGTCTGTGGACGTGTGCATCTACGAGGGTGAGCG-TGCCTG-CGTG  180305

Query  1278    CGA---CAACAACCTGCTGGGCAAGTTCAAC----CTGGACGGCATCCCTCCCATGCCTC  1330
                ||   |||||||  ||||||  ||||||||    ||||   | | | | || |     |
Sbjct  180306  -GAGTCCAACAACAAGCTGGGTGAGTTCAACATCTCTGGCTTGGAGCGCGCCAA----GC  180360

Query  1331    GCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGT  1390
               | || | ||||||| | || ||||||||||| |||||||| |||||||||||||||||||
Sbjct  180361  GTGGCGAGCCGCAGGTGGAGGTGACGTTCGAGATCGACGCTAACGGCATCCTGAACGTGT  180420

Query  1391    CGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCC  1450
               | ||    || |||   || |||    ||  | |||  || ||| ||||| ||   ||||
Sbjct  180421  CCGCCCGCGACAAGAAGACCGGCGCCAAGGCCGAGACGACCATCTCGAACAACCGCGGCC  180480

Query  1451    GCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGG  1510
               | ||    ||||  ||||| |||||||||||  | |||||||| ||||  |||  ||| |
Sbjct  180481  GTCTGAGCCAGGAGGACATCGACCGCATGGTTGCTGAGGCCGACAAGTTTAAGAAGGACG  180540

Query  1511    ACG  1513
               |||
Sbjct  180541  ACG  180543

 Score = 155 bits (171),  Expect = 7e-35
 Identities = 246/353 (70%), Gaps = 0/353 (0%)
 Strand=Plus/Plus

Query  34      GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
               || || || ||||| || ||||||||||||||||| || ||| || |||  |  ||||| 
Sbjct  178962  GGTATTGATCTCGGAACGACCTACTCGTGCGTGGGTGTCTGGAAGGACGGTCAGGTGGAG  179021

Query  94      ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
               ||||| ||||||  | |||| ||||| || |||||||| |  || || ||||  ||    
Sbjct  179022  ATCATTGCCAACAGCGAGGGTAACCGTACTACCCCGTCGTGGGTTGCTTTCAACGAGAGC  179081

Query  154     GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGGTG  213
               || || ||||| ||||| || || ||||  ||||  |||   |||||   ||||||||||
Sbjct  179082  GAGCGTCTCATTGGTGAGGCTGCTAAGATCCAGGCTGCCGGTAACGCCACCAACACGGTG  179141

Query  214     TTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACATC  273
               |||||||| || ||| | || |||||   ||||   |||   || ||  ||   |||   
Sbjct  179142  TTCGACGCTAAGCGTATCATTGGCCGTTCGTTCAGCGACGAAGTGGTGAAGAAGGACGCG  179201

Query  274     AAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGCAG  333
               |  ||||  || |||    | | |  |||||  |  ||||||   | |||   |||  ||
Sbjct  179202  ACCCACTTCCCCTTCACGATCAAGGAGGGCGATGACGACAAGGTCCTGATTGAGGTCGAG  179261

Query  334     TTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
               ||||||  ||||   ||||  |||   ||||||||||||||||||||||||||
Sbjct  179262  TTCAAGAACGAGAAGAAGAGCTTCACCCCCGAGGAGATCTCGTCCATGGTGCT  179314

>PLHA:NW_020188106.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_1191, whole genome shotgun sequence
Length=526

 Score = 530 bits (587),  Expect = 9e-148
 Identities = 433/526 (82%), Gaps = 0/526 (0%)
 Strand=Plus/Plus

Query  1210  TCGACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCC  1269
             |||||||| |||||||||||||| || || || || ||||| ||||| || || || || 
Sbjct  1     TCGACGTATGCCGACAACCAGCCGGGTGTTCTGATTCAGGTCTTCGAAGGTGAACGATCG  60

Query  1270  ATGACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCT  1329
             ||||| || ||||||||||||||||| || |||||| |||| || ||||| |||||||||
Sbjct  61    ATGACTCGTGACAACAACCTGCTGGGTAAATTCAACTTGGATGGTATCCCGCCCATGCCT  120

Query  1330  CGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTG  1389
             || || || ||||||||||| |||||||| || |||||||| || || ||  ||||||| 
Sbjct  121   CGTGGCGTACCGCAGATCGATGTGACGTTTGATATCGACGCTAATGGTATTTTGAACGTC  180

Query  1390  TCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGC  1449
             |||||||| ||||||||||| || |||||||||||||| || ||||| ||||||||||| 
Sbjct  181   TCGGCTGTTGAGAAGTCAACCGGTAAGGAGAACAAGATTACCATCACAAACGACAAGGGT  240

Query  1450  CGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAG  1509
             ||||||||||| || || || || ||||||||| | || ||||| |||||||| || |||
Sbjct  241   CGCCTCTCGCAAGCCGAGATCGATCGCATGGTAGCCGAAGCCGACAAGTACAAATCAGAG  300

Query  1510  GACGAGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGT  1569
             || || || |||||   |||| | ||||||||||||||||| || || ||||| ||||||
Sbjct  301   GATGAAGCGAACAAAGTACGCGTTGAGGCCAAGAACGCGCTTGAAAATTACGCTTACAGT  360

Query  1570  CTGCGGAACAGTCTGAATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAG  1629
             || || || |||||||| || ||||| ||||||||    || ||  | || |||||||||
Sbjct  361   CTACGCAATAGTCTGAACGAAGAGAAAATGAAGGAATCAATTCCAAAGGCAGACAAGAAG  420

Query  1630  GCGGTGGACGACAAGGTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAG  1689
             | ||||||||||||||||||||||||||| ||||||||||| ||| ||||||| | ||| 
Sbjct  421   GTGGTGGACGACAAGGTGACGGAAGTGATTCAGTGGCTGGATGCACACCAGTCGTCGGAA  480

Query  1690  AAGGATGCGTACGAGTCGAAGCAGAAGGAATTGGAGGGCGTGGCCA  1735
             ||||| | ||||||| | || ||||||||| ||||||  || ||||
Sbjct  481   AAGGAAGAGTACGAGACCAAACAGAAGGAACTGGAGGCTGTTGCCA  526

>PYIW:scaffold_1469 piw_scaffold_1469 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1469:1:8739:1 
REF
Length=8739

 Score = 525 bits (581),  Expect = 4e-146
 Identities = 927/1336 (69%), Gaps = 39/1336 (3%)
 Strand=Plus/Plus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             |||| || ||  ||||||||||  | |  |||| ||| |||||||||||||||||||| |
Sbjct  1600  AGGATGCTGGTACCATTGCCGGTATGACTGTGCAGCGCATCATCAACGAGCCGACGGCGG  1659

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGC---GGCGAGCGCAACGTGCTGATCTTCG  517
             | || ||||| |||||| | |||||||||| |   ||||||   ||||||||  ||||||
Sbjct  1660  CTGCAATCGCCTACGGCATTGACAAGAAGGCCCAGGGCGAGAAGAACGTGCTCGTCTTCG  1719

Query  518   ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
             |||| || || ||||||||||||||| | |||||  | ||||| |  ||  |||| ||||
Sbjct  1720  ACCTCGGTGGTGGCACCTTCGATGTGACCCTCCTCGCGATTGACGGCGGTGTCTTTGAGG  1779

Query  578   TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
             |    || ||    || || || ||| |||| ||||||||||| ||| | ||| |  || 
Sbjct  1780  TGCTCGCGACCAACGGCGATACCCACTTGGGCGGTGAGGACTTTGACCAGCGCATCATGC  1839

Query  638   ACCACTTCACGCAGGAGTTCAAGCGCAAGCAC----CGCAAGGACAT---CACGGAGAAC  690
             |   |||||   || |||  |||   ||| ||    || | ||||||   |||||| || 
Sbjct  1840  AGTTCTTCATCAAGAAGTGGAAG---AAGGACAAGTCG-ATGGACATTGGCACGGACAAG  1895

Query  691   CAGCGTGCTCTTC--GT--CGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTC  746
             | ||| ||||     ||  |||| |||   ||||   ||||||| ||||||| |||| ||
Sbjct  1896  C-GCGCGCTCCAGAAGTTGCGTC-GCGA--GGCC---GAGCGTGTCAAGCGTGCGCTCTC  1948

Query  747   GTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTC  806
               ||  ||| |||||     ||||||| || || ||  | ||||||   ||||||| |  
Sbjct  1949  CACGCAGGCCCAGGCGCGTCTCGAGATCGAGTCGCTCCTTGACGGCGAGGACTTCACCGA  2008

Query  807   GACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGA  866
             | |  || | ||||||||||||||| |  |   ||  |||   |||   |||||  | | 
Sbjct  2009  GTCGCTCTCGCGTGCTCGTTTCGAGAAGCTCAACGAAGACCTGTTCAAGAAGACCCTCGG  2068

Query  867   GCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGT  926
              || || |||||||||||    ||||||    ||  ||||    ||||  ||||| | ||
Sbjct  2069  CCCAGTCGAGAAGGTGCTCAAGGACGCCGGCTTGAAGAAGTCGGAGGTCGACGAGATCGT  2128

Query  927   GCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAA  986
             ||| || ||||||||||| |||||||| ||||||||||||||  |   ||||| ||||||
Sbjct  2129  GCTCGTCGGCGGCTCGACCCGTATCCCCAAGGTGCAGCAGCTCATCAAGGACTACTTCAA  2188

Query  987   CGGCAAGGAGCCCAACAAGTCCA-TCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCG  1045
             |||||||||||| | |  ||    | ||||| || |||||||| || ||||||||  | |
Sbjct  2189  CGGCAAGGAGCC-ATCGCGTGGTGTGAACCCAGATGAGGCTGTTGCCTACGGTGCCGCTG  2247

Query  1046  TGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGC---AGGACCTGCTTC  1102
             | ||||  |  |||||  ||||| |  |      |||  |||||    ||||| |||| |
Sbjct  2248  TTCAGGGCGGTATCCTCGGCGGCGAGCA------GGACGAGCTGACCAAGGACGTGCTCC  2301

Query  1103  TGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGC  1162
             |  | |||||    || ||||| |  ||  | ||||| | ||| ||||||||||| | ||
Sbjct  2302  TCATCGACGTCGTCCCCCTGTCGCAAGGCATTGAGACTGTCGGCGGTGTCATGACCAAGC  2361

Query  1163  TGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCG  1222
             | ||    || |||||   | | || || |||||||||||||||||||| ||||||   |
Sbjct  2362  TCATTAACCGCAACACTGTGATCCCAACGAAGAAGTCGCAGACGTTCTCTACGTACCAGG  2421

Query  1223  ACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACA  1282
             |||||||||| | |||||| ||||||||||||||||| |||||  | |||||    ||||
Sbjct  2422  ACAACCAGCCAGCGGTGCTGATCCAGGTGTTCGAGGGTGAGCGTGCGATGACCAAGGACA  2481

Query  1283  ACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGC  1342
             ||  ||| || ||||||||| | ||    ||| |||| |||   || || || ||||| |
Sbjct  2482  ACCGCCTTCTCGGCAAGTTCGAGCTCACGGGCCTCCCACCCGCTCCACGTGGCGTGCCAC  2541

Query  1343  AGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGA  1402
             ||||||| ||||| || || || |||||||||||||||||| | ||    || | ||| |
Sbjct  2542  AGATCGAAGTGACCTTTGAGATTGACGCGAACGGCATCCTGCAGGTCGGCGCCGAGGACA  2601

Query  1403  AGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGG  1462
             ||   ||||||||||   | ||||||||||| ||   ||| |||||||| || || ||||
Sbjct  2602  AGGGCACGGGCAAGGCTGAGAAGATCACGATTACAGCCGAGAAGGGCCGTCTGTCCCAGG  2661

Query  1463  CTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACA  1522
               || ||||||||||||||   ||||||||   || ||     ||||||| ||      |
Sbjct  2662  AGGAGATTGACCGCATGGTCCAGGAGGCCGCTGAGAACGCCGAGGAGGACAAGAAGGTGA  2721

Query  1523  AGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTC  1582
             || | |||||||| | |   ||||  || |||  ||||  |||||| ||   ||||  ||
Sbjct  2722  AGGACCGCATCGACGGCCGTAACGGCCTCGAGGGCTACCTCTACAGCCTCAAGAAC--TC  2779

Query  1583  TGAATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACA  1642
              |   || || ||| |    || ||||||  ||| |  |||||| |  |||||  | | |
Sbjct  2780  -GGTCGAGGACAAGCTCGCCGACAAGATCGAGGAGGACGACAAGGACACGGTGCTCAAGA  2838

Query  1643  AGGTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACG  1702
               |||  ||| |  ||  | ||||| || |  ||||||      || ||||| |  |  |
Sbjct  2839  GCGTGCAGGACGCCATGGACTGGCTCGAGGACAACCAGGAGGCCGACAAGGAGGACTTTG  2898

Query  1703  AGTCGAAGCAGAAGGA  1718
             || | |||||||||||
Sbjct  2899  AGGCCAAGCAGAAGGA  2914

 Score = 194 bits (214),  Expect = 8e-47
 Identities = 276/385 (72%), Gaps = 14/385 (4%)
 Strand=Plus/Plus

Query  32    TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
             ||||||||||||||||||| || |||||||| |||||  | |   || || |    || |
Sbjct  1141  TCGGCATCGACCTCGGCACGACGTACTCGTGTGTGGGTATCTACAAGGACCAGAAGGTCG  1200

Query  92    AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
             | |||||||||||||||||||||||||||| ||| ||||| ||||| || |     ||||
Sbjct  1201  AGATCATCGCCAACGACCAGGGCAACCGCATCACGCCGTCCTACGTGGCGT---GGGACT  1257

Query  152   CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
             ||      || || |||||||| |||| ||||||||| |||| | | || ||  || |  
Sbjct  1258  CGAACGACGAGCGTCTCATCGGCGACGGCGCCAAGAACCAGGCGACGATCAATCCGGAGC  1317

Query  206   ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGG  265
             | ||| ||||||||| ||| || || |||||||||   | |   |||     ||||||||
Sbjct  1318  AGACGTTGTTCGACGTCAAGCGCCTCATCGGCCGCGGCTACAACGACAAGTCCGTCCAGG  1377

Query  266   CCGACATCAAGCACTGGCCGTTCCAAGTGA-CGTCGGGCGCCGGTGACAAGCCGCAGATC  324
             ||||||  |||| |  ||||| | |  | | |  |  | | |||   ||||||||  || 
Sbjct  1378  CCGACAAGAAGCTCCTGCCGTACAACATCATCAACAAG-GACGG---CAAGCCGCTCATT  1433

Query  325   ACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTG  384
               ||||  | |||||||||||   |||||||||   ||||||||| ||||| ||||| | 
Sbjct  1434  GAGGTGTCGGTCAAGGGCGAGAAGAAGACGTTCTCCCCCGAGGAGGTCTCGGCCATGATC  1493

Query  385   CTGATCAAGATGCGCGAGGACGCCG  409
             |||| |||||||    ||| |||||
Sbjct  1494  CTGACCAAGATGAAGCAGGTCGCCG  1518

>PHSO:scaffold_10
Length=2388181

 Score = 523 bits (579),  Expect = 1e-145
 Identities = 837/1186 (71%), Gaps = 52/1186 (4%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||  | || || |||||  ||||   |||||||||||||||||| |||||||
Sbjct  425097  AGGACGCCGGTTCGATCGCTGGCCTGGACGTCAAGCGTATCATCAACGAGCCCACGGCCG  425038

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGC---GA-------GC--GCAACGTGC  508
               | ||| |||| ||||||||||||| ||| | ||||   ||       ||  |||||||||
Sbjct  425037  CTGCCCTCGCCTACGGCCTGGACACGAACGCCGGCACGGACGGCAAGGCCTGCAACGTGC  424978

Query  509     TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
               | |||||||||||||| ||||| ||||||||||||||  ||||||| || ||| | ||||
Sbjct  424977  TCATCTTCGACCTGGGTGGCGGTACCTTCGATGTGTCGATCCTGTCGATCGAGAACGGCA  424918

Query  569     TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
               |||||||||||||| |||| |  |||||||||||||||||||| ||||||||||||||| 
Sbjct  424917  TCTTCGAGGTCAAGTCCACGGGCGGTGACACGCACCTGGGTGGCGAGGACTTCGACAACA  424858

Query  629     GCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAA---GGA--CATCAC  683
                | ||||||| |||||   |  |||||||||||||||| |||||||   |||  | ||  
Sbjct  424857  ACATGGTGGAGCACTTGCTGACGGAGTTCAAGCGCAAGAACCGCAACCTGGACCCGTCTG  424798

Query  684     GGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCT  743
               |     ||  || ||  | || |||||||| |||||||| |||   |||||||| | |||
Sbjct  424797  GCTCGGCC--CGCGCCATGCGCCGTCTGCGCACGGCCTGTGAGTCGGCCAAGCGCATGCT  424740

Query  744     GTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAA  803
               |||| |  || |    || |   | ||| | ||||| || ||||| ||| | ||||||  
Sbjct  424739  GTCGACCACGACGAGCGCCTCGGTGGAGGTGGACTCGCTCTTCGAGGGCGTTGACTTCTC  424680

Query  804     CTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGA-CTACTTCCGCAAGACGA  862
                |||||| | || |||||    ||||||    |   ||  || ||  |   ||    |||
Sbjct  424679  GTCGACCGTGACCCGTGCCAAGTTCGAGTCGCTCAACGAGGAGCTGTTCAAGCGCTGCGA  424620

Query  863     TGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAG---GTGCACG  919
                |||| ||||   |||||||||    ||||||||| |   ||||  | ||   |||   |
Sbjct  424619  -GGAGACCGTCCTGAAGGTGCTCGAGGACGCCAAGAT---GAAGCCCGAGGATGTGACGG  424564

Query  920     AGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACT  979
               || ||||||||||||||||||| ||||||||||| |||||||||    ||||||||    
Sbjct  424563  AGCTGGTGCTGGTGGGCGGCTCCACGCGTATCCCCAAGGTGCAGACCATGCTGTCGACGC  424504

Query  980     TCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTG  1039
               | |||  |||||||||||    |||||| ||||||||||||||||| || || |||||||
Sbjct  424503  TGTTCGGCGGCAAGGAGCTGTCCAAGTCGATCAACCCGGACGAGGCCGTCGCCTACGGTG  424444

Query  1040    CGACCGTGCAGGCGGCCATCCTGAGCGGCA-ACGACTCGTCGGAGAAGCTGCAGGACCTG  1098
               |  |||||||||  |||||||||  |||||  ||   || ||    | |  |  |  |||
Sbjct  424443  CCGCCGTGCAGGGCGCCATCCTGGACGGCATCCGCAACGACG--CCACCAACTCG--CTG  424388

Query  1099    CTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACG  1158
               || ||| |||||||||| |||||||| || ||  | ||||| |  ||    |||||| ||
Sbjct  424387  CTGCTGGTGGACGTGACCCCGCTGTCGCTCGGCATTGAGACCGTGGGCAAGGTCATGTCG  424328

Query  1159    ACGCTGATCGCGCGGAACACGACGGTGCC---GACCAAGAAGTCGCAGACGTTCTCGACG  1215
                 ||| |||  ||| |||||| |  | ||   |  |||||   |||    || | | |||
Sbjct  424327  GTGCTCATCAAGCGTAACACGGCCATCCCCGTGCGCAAGA---CGCGCGTGTACACCACG  424271

Query  1216    TACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACG  1275
                | |  ||| ||||| |    |||  | |     | | ||||||||||||| |  |  ||
Sbjct  424270  GAGGAGGACTACCAGACGTCCGTGGACGTGTGCATCTACGAGGGCGAGCGCGC--TTGCG  424213

Query  1276    CGCGA---CAACAACCTGCTGGGCAAGTTCAAC----CTGGACGGCATCCCTCCCATGCC  1328
                | ||   |||||||  ||||||| ||||||||    | || | | | | | || |    
Sbjct  424212  TG-GAGTCCAACAACAAGCTGGGCGAGTTCAACATCTCGGGCCTGGAGCGCGCCAA----  424158

Query  1329    TCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGT  1388
                ||||| | ||||||| |||| ||||||||||| |||||||| |||||||||||||||||
Sbjct  424157  GCGCGGCGAGCCGCAGGTCGAGGTGACGTTCGAGATCGACGCCAACGGCATCCTGAACGT  424098

Query  1389    GTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGG  1448
               ||| ||    || |||   ||||||    ||  | ||| ||| ||| | ||| ||   ||
Sbjct  424097  GTCCGCCCGCGACAAGAAGACGGGCGCCAAGGCCGAGACCACCATCTCCAACAACCGCGG  424038

Query  1449    CCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGA  1508
               ||| ||    ||||  ||||| |||||||||||  | |||||||| |||| ||||  |||
Sbjct  424037  CCGTCTGAGCCAGGAGGACATCGACCGCATGGTCGCCGAGGCCGACAAGTTCAAGAAGGA  423978

Query  1509    GGACGAGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAG  1554
                ||||  |  |    ||  ||||| ||||||   ||||  ||||||
Sbjct  423977  CGACGCCGAGATGCTGCGCCGCATTGAGGCCCGCAACGACCTGGAG  423932

 Score = 246 bits (272),  Expect = 1e-62
 Identities = 268/356 (75%), Gaps = 0/356 (0%)
 Strand=Plus/Minus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               ||||||| ||||| ||||| |||||||||||||||||||| ||| || ||| ||  || |
Sbjct  425556  TCGGCATTGACCTGGGCACGACCTACTCGTGCGTGGGCGTCTGGAAGGACGGCCAGGTCG  425497

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               | ||||||||||||  | |||| ||||||||||| || || |  ||||||||||  ||  
Sbjct  425496  AGATCATCGCCAACAGCGAGGGTAACCGCACCACGCCCTCGTGGGTCGCCTTCAACGAGA  425437

Query  152     CGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGG  211
                 || || ||||||||||| ||||||||||  ||||  |||   |||||   ||||||||
Sbjct  425436  GCGAGCGTCTCATCGGTGAGGCCGCCAAGATCCAGGCCGCCGGTAACGCCACCAACACGG  425377

Query  212     TGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACA  271
               ||||||||||||| ||| | ||||||||||  |||   |||   |||||| ||   ||| 
Sbjct  425376  TGTTCGACGCCAAGCGTATCATCGGCCGCAGCTTCAGCGACGAGGTCGTCAAGAAGGACG  425317

Query  272     TCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGC  331
                || |||||  || |||    | | |   |||| ||  ||||||   |  |||  |||  
Sbjct  425316  CCACGCACTTCCCTTTCACGATCAAGGAAGGCGACGACGACAAGGTCCTCATCGAGGTCG  425257

Query  332     AGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTG  387
               ||||||||||||||  |||||  |||   |||||||||||||||||||||||||||
Sbjct  425256  AGTTCAAGGGCGAGAACAAGAGCTTCACCCCCGAGGAGATCTCGTCCATGGTGCTG  425201

 Score = 223 bits (246),  Expect = 2e-55
 Identities = 420/610 (69%), Gaps = 26/610 (4%)
 Strand=Plus/Minus

Query  403      GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
                |||||||||||  | || ||||| || |||   ||  | |||| || | |||| || || 
Sbjct  2276338  GACGCCGGCGCTGTAGCAGGCCTGAATGTGGCCCGCTTGATCAGCGCGTCGACAGCTGCG  2276279

Query  463      GCCATCGCGTACGGCCTGGA---CAAGA---AGGGCGGCGAGCGCAACGTGCTGATCTTC  516
                ||||||||| ||||||||||   |||||   ||| |||  |||| ||| || || |  | 
Sbjct  2276278  GCCATCGCGCACGGCCTGGAGAACAAGACCAAGGCCGGACAGCGGAACCTGTTGGTGCTT  2276219

Query  517      GACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAG  576
                |||||||| || |||||||| || ||||| ||  || |||| ||||| |  |||| ||||
Sbjct  2276218  GACCTGGGTGGTGGCACCTTGGACGTGTCGCTGGTGGCCATCGAGGAAGAGATCTACGAG  2276159

Query  577      GTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTG  636
                ||   |||||| |||||  || | ||  |||| || |||||||| |||   ||  |||| 
Sbjct  2276158  GTGCTGGCCACGGCTGGGAACGCTCATTTGGGCGGCGAGGACTTTGACTCTCGGTTGGTA  2276099

Query  637      GACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGT  696
                || |||| |  |   || |||||||| | ||||||||| ||| |    ||| || |  | 
Sbjct  2276098  GAGCACTGCGTGGCTGAATTCAAGCGAATGCACCGCAAAGACCT----GAGCACAAATGC  2276043

Query  697      GCTCTTCGT----CGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGT-CGTC--  749
                || |  | |    || ||||| | |||||||||  |||| ||| |  |  ||| || |  
Sbjct  2276042  GCGCGCCATGATGCGCCTGCGTATGGCCTGCGAAAGTGCTAAGAGAGCTTTGTTCGCCCC  2275983

Query  750      ---GTCGGCTCAG--GCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAAC  804
                   |||||   ||  |||  ||| ||| | ||| |  ||| ||| |||||||||||| ||
Sbjct  2275982  CGAGTCGGTGGAGAAGCT--CATTGAGCTCGACGCCTTGTACGAGGGCATCGACTTCCAC  2275925

Query  805      TCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCG-CAAGACGAT  863
                 |||  ||||| |||||||  |||||  |  ||||||  |||   ||||| | | |  ||
Sbjct  2275924  ACGAAGATCACGCGTGCTCAGTTCGAAAAGTTGTGCGCGGAC-CTTTCCGACGATATCAT  2275866

Query  864      GGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGT  923
                |  ||| ||| || | |||||| | || || |   | | || |||  | ||| | |||||
Sbjct  2275865  GTTGCCTGTGCAGCAAGTGCTGAGTGATGCTAGCGTCTTGAGGAGTAAAGTGGATGAGGT  2275806

Query  924      GGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTT  983
                |||  |||||||||| || | ||||||| | |||||  |  | ||  ||  ||| || ||
Sbjct  2275805  GGTTATGGTGGGCGGATCCATGCGTATCACCAAGGTCGAAGAACTTTTGAAGGAGTTTTT  2275746

Query  984      CAACGGCAAG  993
                 |||||||||
Sbjct  2275745  TAACGGCAAG  2275736

 Score = 150 bits (166),  Expect = 9e-34
 Identities = 192/262 (73%), Gaps = 2/262 (1%)
 Strand=Plus/Minus

Query  127      CCGTCATACGTCGCCTTCACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAG  186
                ||||| | ||| || ||||| ||| |||| || ||| | || |||| |||||||   || 
Sbjct  2276704  CCGTCGTTCGTAGCGTTCACGGACACGGAGCGACTCGTTGGCGACGTCGCCAAGCGCCAA  2276645

Query  187      GTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTC  246
                ||||||| ||||| | ||||||||||||||| | |||  || || |||||||||||||| 
Sbjct  2276644  GTGGCCACGAACGTGAACAACACGGTGTTCGGCACCACGCGCCTCATCGGCCGCAAGTTT  2276585

Query  247      TCGGACCCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTCCAAGT-GACGTCGGGCGC  305
                |||||||  |  || ||||  ||| | ||||||||||||||| |||| |  | ||||| |
Sbjct  2276584  TCGGACCTGGAAGTACAGGAAGACTTGAAGCACTGGCCGTTCAAAGTGGTTGGCGGGC-C  2276526

Query  306      CGGTGACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGA  365
                   |||    ||||   |   |||||||     |||| || ||||||||||||  || | 
Sbjct  2276525  AAATGATGGCCCGCTAGTGGAGGTGCAGGCTGCGGGCCAGACCAAGACGTTCCGGCCAGT  2276466

Query  366      GGAGATCTCGTCCATGGTGCTG  387
                |||||||  | ||||| | |||
Sbjct  2276465  GGAGATCCTGGCCATGCTCCTG  2276444

 Score = 124 bits (137),  Expect = 1e-25
 Identities = 272/407 (67%), Gaps = 3/407 (1%)
 Strand=Plus/Plus

Query  706      CGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCTTAC  765
                || ||||| |  || |||||||  |||||| |  |  | ||| | ||  |  ||||  | 
Sbjct  2278478  CGCCTGCGTAGCGCTTGCGAGCAAGCCAAGAGAGCAGTATCGACTTCAACGGAGGCACAA  2278537

Query  766      ATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCTCGT  825
                |||||| |||| ||  |||  || ||||| ||| |||||||||| ||  ||||  | |||
Sbjct  2278538  ATCGAGCTTGAGTCATTGTATGAAGGCATTGACCTCAACTCGACGATATCTCGCCCCCGT  2278597

Query  826      TTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTGCTG  885
                ||  | ||| |||||| |||||  ||    ||| |  ||| | | ||   ||||||||||
Sbjct  2278598  TTTAACGACTTGTGCGCCGACTTGTTTGATAAGGCATTGGGGGCGGTATCGAAGGTGCTG  2278657

Query  886      CGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCGACG  945
                || || ||||||  ||| ||||  |  ||| ||||| | ||||| || || || ||  ||
Sbjct  2278658  CGAGATGCCAAGAAGTCAAAGACTCGAGTGGACGAGATTGTGCTCGTCGGAGGTTCTCCG  2278717

Query  946      CGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCAACAAG  1005
                ||||| || |   ||||||| ||  ||   || ||||| ||||| ||| ||   ||   |
Sbjct  2278718  CGTATACCAAGAATGCAGCAACTATTGGAAGATTTCTTTAACGGAAAGAAGGTAAAGGGG  2278777

Query  1006     TCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCCTGAGC  1065
                 | ||   | | || ||| | | ||||  ||| || ||  |||| || ||| |||| |  
Sbjct  2278778  CCGAT---CGCAGAGGAGTCCGCGGCGACCGGCGCAACAATGCAAGCTGCCGTCCTCACT  2278834

Query  1066     GGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGT  1112
                ||   |||  ||||   ||||||| | ||  | ||  ||||||| ||
Sbjct  2278835  GGTGGCGATGCGTCACCGAAGCTGGAAGATTTACTGTTGCTGGATGT  2278881

 Score = 116 bits (128),  Expect = 2e-23
 Identities = 229/339 (68%), Gaps = 0/339 (0%)
 Strand=Plus/Minus

Query  34       GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
                ||||||||||||||  | |  || ||  | ||||  |||||||  || || || || || 
Sbjct  2274923  GGCATCGACCTCGGGTCCAAGTATTCCCGAGTGGCTGTGTGGCTAAATGATCGCGTAGAG  2274864

Query  94       ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
                ||| |  | | | |    ||| ||||    || ||| |   ||| || ||||||||  | 
Sbjct  2274863  ATCGTGCCTAGCAAGTCCGGCGACCGATTTACGCCGACGATCGTGGCGTTCACAGAGACC  2274804

Query  154      GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGGTG  213
                |||   |||||||| ||  | ||||   | ||| ||     ||| ||||| |||||| | 
Sbjct  2274803  GAAGTGCTCATCGGCGAGCCTGCCACTCACCAGTTGCTGCAGAATGCGCAAAACACGATC  2274744

Query  214      TTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACATC  273
                ||||||  ||  ||  |||||||||||||||||||||| || |   ||||||  | ||||
Sbjct  2274743  TTCGACATCACGCGCTTGATCGGCCGCAAGTTCTCGGATCCTGAGATCCAGGAAGGCATC  2274684

Query  274      AAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGCAG  333
                |||| |||||| ||| | |||   |  ||| | | |||||| || |   |   ||||  |
Sbjct  2274683  AAGCTCTGGCCCTTCAAGGTGGTCTGCGGCCCGGATGACAAACCCCTAGTGGTGGTGACG  2274624

Query  334      TTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATC  372
                || ||||||| ||| ||| | ||  || | | |||||||
Sbjct  2274623  TTTAAGGGCGCGTCGAAGTCATTTGAAGCAGTGGAGATC  2274585

 Score = 109 bits (120),  Expect = 3e-21
 Identities = 248/365 (68%), Gaps = 20/365 (5%)
 Strand=Plus/Plus

Query  30       CGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGT  89
                ||||||||| ||||| ||||| ||    ||| |||||||||||||||  || || || ||
Sbjct  2287493  CGTCGGCATTGACCTGGGCACGACGGGATCGCGCGTGGGCGTGTGGCGCAATGAGCGCGT  2287552

Query  90       GGAAATCATCGCCAAC-GAC--CAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCAC  146
                |||  ||||| ||||| |||  |||| | || |    || ||||| || || || |||||
Sbjct  2287553  GGAGTTCATCCCCAACAGACAGCAGGCCTACTG---GACGCCGTCGTATGTGGCGTTCAC  2287609

Query  147      AGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAA  206
                 ||  |||  |  ||| | ||||| || ||||||   ||  || | |  ||| |  | ||
Sbjct  2287610  GGAGACGGCGCTGCTCGTTGGTGAAGCTGCCAAGCGCCAACTGACAACCAACCCAGAGAA  2287669

Query  207      CACGGTGTTCGACGCCAAACG---TCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCA  263
                |||||| || ||  |  ||||   | || |||||||||||||||| || |      | | 
Sbjct  2287670  CACGGTCTTTGA--CTTAACGCAATTTG-TCGGCCGCAAGTTCTCAGAAC------TGCG  2287720

Query  264      GGCCGACATCAAGCACTGGCCGTTCCAAGTGACGT-CGGGCGCCGGTGACAAGCCGCAGA  322
                 |    | |||   ||||||||||| | |||  || ||||| | |  || | ||| ||  
Sbjct  2287721  AGAAAGCGTCATTGACTGGCCGTTCAAGGTGGAGTGCGGGC-CGGAAGATACGCCTCAAG  2287779

Query  323      TCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGG  382
                |   |||||||| |||||||||| ||||||  |||   || |  ||||||  | ||||  
Sbjct  2287780  TGGTGGTGCAGTACAAGGGCGAGACCAAGAGCTTCATGCCGGTCGAGATCATGGCCATAC  2287839

Query  383      TGCTG  387
                |||||
Sbjct  2287840  TGCTG  2287844

 Score = 104 bits (115),  Expect = 1e-19
 Identities = 252/379 (66%), Gaps = 2/379 (1%)
 Strand=Plus/Plus

Query  615      GGACTTCGACAACCGCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAA  674
                ||| ||||| |  || || || || |||||| ||   |||||| || | | |||| ||||
Sbjct  2288166  GGAGTTCGATAGTCGGCTCGTTGAACACTTCGCGGCCGAGTTCCAGAGAAGGCACGGCAA  2288225

Query  675      GGACAT-CACGGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCA  733
                |||| | | |   ||  |  | |||  |    ||| |||| ||||| || || | ||| |
Sbjct  2288226  GGACCTTCGCTCTGATTCCTC-TGCGGTGATGCGTTTGCGTACGGCTTGTGAACATGCTA  2288284

Query  734      AGCGTACGCTGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCA  793
                |  |  | ||||| ||||||    |||| | ||| ||| | ||  | ||   ||| ||||
Sbjct  2288285  AAAGGGCTCTGTCCTCGTCGATGGAGGCGTTCATTGAGCTCGATGCACTCCACGATGGCA  2288344

Query  794      TCGACTTCAACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCC  853
                || ||||  |||| |  ||||   | |   |  | |||    ||||||  ||||  ||  
Sbjct  2288345  TCAACTTTTACTCAATGATCAGATGCGTGTGGATGGAGCGTTTGTGCGCTGACTTGTTTG  2288404

Query  854      GCAAGACGATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGG  913
                 ||||| | ||  || |||||||||  ||||| | || || |  |||  ||||  |||||
Sbjct  2288405  ACAAGATGCTGAGGCTCGTGGAGAAATTGCTGAGAGAGGCGAGACTGAGGAAGGACCAGG  2288464

Query  914      TGCACGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGT  973
                || | ||| | ||||| |||||||| ||||| |   | ||||||||||| ||    ||| 
Sbjct  2288465  TGGATGAGATCGTGCTCGTGGGCGGATCGACTCACGTTCCGAAGGTGCAACAAAAACTGA  2288524

Query  974      CGGACTTCTTCAACGGCAA  992
                 |||||||||||| || ||
Sbjct  2288525  AGGACTTCTTCAATGGGAA  2288543

 Score = 100 bits (110),  Expect = 1e-18
 Identities = 232/349 (66%), Gaps = 12/349 (3%)
 Strand=Plus/Plus

Query  34       GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
                ||||||||||| ||  | |  || ||  | ||||| || ||||  || ||||| ||||| 
Sbjct  2277739  GGCATCGACCTGGGGTCCAAGTATTCCCGAGTGGGTGTCTGGCGAAATGACCGCGTGGAG  2277798

Query  94       ATCATCGCCAA-CGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTC  152
                ||| | ||||| | |   |||  ||||  |||| ||| |    || || ||||||||  |
Sbjct  2277799  ATCGT-GCCAAGCAAGTCGGGAGACCGGTCCACACCGACCATTGTGGCGTTCACAGAGGC  2277857

Query  153      GGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGGT  212
                 |||   |||||||| ||  | |||| | | ||| ||     ||| |||   ||||||||
Sbjct  2277858  CGAAGTGCTCATCGGCGAGCCGGCCACGCACCAGTTGCTGCAGAATGCGGGAAACACGGT  2277917

Query  213      GTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACAT  272
                | |||            || ||||||||||||||||||| || |   ||||||  | |||
Sbjct  2277918  GGTCGCT----------TGGTCGGCCGCAAGTTCTCGGATCCTGAGATCCAGGAAGGCAT  2277967

Query  273      CAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGCA  332
                ||||| |||||| ||| | |||   |  ||| | | |||||| ||     |    |||  
Sbjct  2277968  CAAGCTCTGGCCCTTCAAGGTGGTCTGCGGCCCGGATGACAAACCTGTACTGGTAGTGAC  2278027

Query  333      GTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATG  381
                |||| |||| ||||| | | | || ||||| | |||||||  | |||||
Sbjct  2278028  GTTCGAGGGTGAGTCGAGGTCATTTCAACCGGTGGAGATCCTGGCCATG  2278076

 Score = 94.2 bits (103),  Expect = 2e-16
 Identities = 385/599 (64%), Gaps = 10/599 (2%)
 Strand=Plus/Minus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||| ||||| ||||| ||||   |  | ||  |||| || |||| |    | || || |
Sbjct  2273114  AGGATGCCGGTGCCATCGCCGAAATTCAGGTCATGCGAATGATCAGCCGATCAACTGCGG  2273055

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                || | ||  |||||||  |  |||||||||||   || || |  |||||  || | ||||
Sbjct  2273054  CCTCGATATCGTACGGTATCAACAAGAAGGGCTCAGAACGAAGGGTGCTAGTCGTTGACC  2272995

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAG--GT  578
                | ||||   ||||  | ||||||||  |  ||   ||||| || |||| ||| |||  ||
Sbjct  2272994  TAGGCGCTAGCACGCTTGATGTGTCGGTGGTGGAGATTGAAGACGGCAACTTTGAGGTGT  2272935

Query  579      CAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGA  638
                    |  ||||| || ||     || ||||||| || ||||| ||||  |||||||| ||
Sbjct  2272934  GTGTGGTACTGCGGGGGATGTCAACTTGGGTGGCGATGACTTTGACAGTCGCCTGGTAGA  2272875

Query  639      CCACTTCACGCAG--GAGTTCAAGCGCAAGCACCGCAAGGACATCACGGA-GAACCAGCG  695
                 ||  |  || ||  ||||||| |    | ||  || | ||  | | | |  |||   ||
Sbjct  2272874  TCA--TTGCGTAGCTGAGTTCATGAAAGACCATAGCCAAGATCT-ATGCACCAACTCACG  2272818

Query  696      TGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGC  755
                 ||  | | ||| ||||| | |||||||||| | ||||| ||   | ||||    || ||
Sbjct  2272817  GGCGATGCTTCGCCTGCGCAAGGCCTGCGAGGGGGCCAAACGAGTGTTGTCTCTATCAGC  2272758

Query  756      TCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCAC  815
                  || ||   || ||  ||||  | |||| ||||||  |  | ||| | | ||  |||||
Sbjct  2272757  GGAGACTACGATTGATCTTGAAGCACTGTGCGACGGACTTAATTTCCAGTTGAAAATCAC  2272698

Query  816      TCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGA  875
                ||| || |  |||||   | |||| |  || |  |||  |   |   ||  | ||||  |
Sbjct  2272697  TCGCGCGCTGTTCGAAAGCTTGTGTGAGGATTTATTCGACCGTATCCTGTGGTCCGTACA  2272638

Query  876      GAAGGTGCTGCGCGACGCCAAGCTG-TCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGG  934
                | |||| ||| |||| ||||| ||| || |||| | || | || |  || ||||  |  |
Sbjct  2272637  GCAGGTACTGAGCGATGCCAACCTGATCAAAGA-CAAGATTCATGCCGTCGTGCATGCCG  2272579

Query  935      GCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAG  993
                | || || || || |||||||| ||  ||||  || |  | || || |||||||| |||
Sbjct  2272578  GAGGATCAACTCGAATCCCGAAAGTCAAGCAAGTGTTAACAGAGTTTTTCAACGGGAAG  2272520

 Score = 92.4 bits (101),  Expect = 7e-16
 Identities = 183/265 (69%), Gaps = 6/265 (2%)
 Strand=Plus/Minus

Query  34       GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
                ||||| ||  |||| ||  | |||||  | ||||   | ||||| || ||||| | ||||
Sbjct  2273583  GGCATTGATATCGGAACGGCATACTCCAGGGTGGCTATTTGGCACAAAGACCGCGCGGAA  2273524

Query  94       ATCATCGCCAA-CGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTC  152
                ||| |  |||| |||   ||| || ||    ||  |||| ||||| || ||||| |||||
Sbjct  2273523  ATCCTTCCCAATCGATTCGGG-AATCGGTTGACATCGTCGTACGTGGCATTCACCGACTC  2273465

Query  153      GGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGC--CATGAACGCGCACAACACG  210
                | ||   ||| | ||||| |||||     | ||   |||  ||  |||||  | ||||| 
Sbjct  2273464  GAAAGTTCTCGTGGGTGATGCCGCAGCCGACCAAC-GGCTTCAA-AACGCTGAGAACACA  2273407

Query  211      GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
                |||||||     | ||| ||  ||||||||||||| |||||||| |  ||||| |    |
Sbjct  2273406  GTGTTCGGTATAACACGGCTACTCGGCCGCAAGTTTTCGGACCCTGAAGTCCAAGAGCGC  2273347

Query  271      ATCAAGCACTGGCCGTTCCAAGTGA  295
                |||||||| ||||| ||| ||||||
Sbjct  2273346  ATCAAGCATTGGCCATTCAAAGTGA  2273322

 Score = 77.0 bits (84),  Expect = 2e-11
 Identities = 183/279 (66%), Gaps = 11/279 (4%)
 Strand=Plus/Plus

Query  715      ACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCTTACATCGAGATT  774
                ||||| || ||||  ||||| ||  |  |||| || |||    || | | ||| ||| ||
Sbjct  2290586  ACGGCTTGTGAGCACGCCAAACGAGCCTTGTCTTCTTCGTTGGAGACGTTCATTGAGCTT  2290645

Query  775      GACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCTCGTTTCGAGGAC  834
                ||  | || | ||| |||||||| ||  |||| || || || || || ||  | ||   |
Sbjct  2290646  GATGCGCTATACGATGGCATCGATTTTTACTCAACAATTACACGCGCGCGGCTGGAAAGC  2290705

Query  835      ATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCC  894
                 ||||||  ||||  ||    || | |||   || ||| || ||| |||||   || || 
Sbjct  2290706  GTGTGCGCTGACTTGTTTGATAAAATGATACGGCTCGTCGAAAAGTTGCTGGAAGATGCA  2290765

Query  895      AAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCG  954
                ||||           || ||| ||||  | |||||  |||| || || || ||  | || 
Sbjct  2290766  AAGC-----------CAAGTGGACGAAATTGTGCTCATGGGTGGATCTACTCGCGTTCCA  2290814

Query  955      AAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAG  993
                |||||||| ||  |||||  ||| |||||||||||||||
Sbjct  2290815  AAGGTGCAACAAATGCTGAAGGAATTCTTCAACGGCAAG  2290853

 Score = 73.4 bits (80),  Expect = 2e-10
 Identities = 151/225 (67%), Gaps = 0/225 (0%)
 Strand=Plus/Plus

Query  30       CGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGT  89
                |||||||||||| |||||||| || | |||| |||  || |||||||  || ||    ||
Sbjct  2289740  CGTCGGCATCGATCTCGGCACGACGTGCTCGCGCGACGGTGTGTGGCGCAATGAGGACGT  2289799

Query  90       GGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGA  149
                ||| || ||| | ||||   | ||      | | || ||||| || || || ||||||||
Sbjct  2289800  GGAGATTATCCCTAACGGAGACGGTGCATACTCGACACCGTCGTATGTGGCGTTCACAGA  2289859

Query  150      CTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACAC  209
                | | |     || | |||  |||| |||||    ||   | | | ||||||  | |||||
Sbjct  2289860  CACTGCGTTGCTGACCGGCAACGCTGCCAAACGCCAACCGACAAGGAACGCTGAGAACAC  2289919

Query  210      GGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCC  254
                 || ||  |   | | |  ||||||||||| ||||| ||||||||
Sbjct  2289920  AGTCTTTAATATCCATCAACTGATCGGCCGGAAGTTTTCGGACCC  2289964

 Score = 68.9 bits (75),  Expect = 8e-09
 Identities = 57/70 (81%), Gaps = 0/70 (0%)
 Strand=Plus/Plus

Query  1364     TCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACA  1423
                |||| || || |||  |||||  |||||||| |||||||| || || ||||||||||| |
Sbjct  2288909  TCGATGCAAATGGCTCCCTGACAGTGTCGGCGGTGGAGAAATCGACTGGCAAGGAGAAAA  2288968

Query  1424     AGATCACGAT  1433
                | ||||||||
Sbjct  2288969  AAATCACGAT  2288978

 Score = 51.8 bits (56),  Expect = 6e-04
 Identities = 61/83 (73%), Gaps = 0/83 (0%)
 Strand=Plus/Minus

Query  1343     AGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGA  1402
                || |||| || ||| | || || ||||| |||  ||||  ||  |  ||||  ||| |||
Sbjct  2274274  AGTTCGATGTAACGATGGATATTGACGCAAACCTCATCTGGAGTGCATCGGTGGTGCAGA  2274215

Query  1403     AGTCAACGGGCAAGGAGAACAAG  1425
                | || |||||||||||||| |||
Sbjct  2274214  AATCGACGGGCAAGGAGAAGAAG  2274192

 Score = 49.1 bits (53),  Expect = 0.008
 Identities = 88/129 (68%), Gaps = 0/129 (0%)
 Strand=Plus/Plus

Query  1307     TGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCG  1366
                ||||||| || |  || ||||||||| |  |  || | ||||  || || ||  |  |||
Sbjct  2291135  TGGACGGTATTCTGCCGATGCCTCGCCGCTTATCGGAAATCGTGGTAACTTTTCATGTCG  2291194

Query  1367     ACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGA  1426
                | |  || |||   || |  ||||| ||||||||||| | ||| |||||  ||||  |  
Sbjct  2291195  ATGGAAATGGCTCTCTTACAGTGTCAGCTGTGGAGAAATTAACCGGCAAACAGAAAGAAC  2291254

Query  1427     TCACGATCA  1435
                ||| |||||
Sbjct  2291255  TCAAGATCA  2291263

 Score = 41.9 bits (45),  Expect = 1.1
 Identities = 45/60 (75%), Gaps = 0/60 (0%)
 Strand=Plus/Minus

Query  327      GGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
                |||||||||||  ||  || ||||||  ||||| || | | |||| | |||| || ||||
Sbjct  2273278  GGTGCAGTTCAGAGGACAGACCAAGATTTTCCACCCTGTGCAGATTTTGTCCTTGCTGCT  2273219

 Score = 40.1 bits (43),  Expect = 3.9
 Identities = 86/129 (67%), Gaps = 0/129 (0%)
 Strand=Plus/Minus

Query  1102     CTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACG  1161
                ||| |||| ||||||||||| || || ||  || |||  | ||       || | ||   
Sbjct  2275624  CTGTTGGATGTGACGCCGCTCTCGCTCGGAGTCAAGATTGACGACACGAACACGTCGGTT  2275565

Query  1162     CTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCC  1221
                 ||||| |||| | ||| ||| | || || | |||| | | ||| || |||||||     
Sbjct  2275564  ATGATCCCGCGCAGCACCACGATTCCAACAAGGAAGACACGGACATTTTCGACGTCTCAG  2275505

Query  1222     GACAACCAG  1230
                |||||||||
Sbjct  2275504  GACAACCAG  2275496

>PYAR:scaffold_717 par_scaffold_717 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_717:1:14068:1 
REF
Length=14068

 Score = 521 bits (577),  Expect = 4e-145
 Identities = 930/1341 (69%), Gaps = 35/1341 (3%)
 Strand=Plus/Plus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             ||||||||||  ||||||||||  | |  |||| ||||||||| |||||||||||||| |
Sbjct  2028  AGGACGCCGGTACCATTGCCGGTATGACGGTGCAGCGTATCATTAACGAGCCGACGGCTG  2087

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGC---GGCGAGCGCAACGTGCTGATCTTCG  517
             | ||||| || |||||  | |||||||||| |   ||||||   ||||||||  | ||||
Sbjct  2088  CGGCCATTGCCTACGGTATCGACAAGAAGGCCCAGGGCGAGAAGAACGTGCTCGTGTTCG  2147

Query  518   ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
             | || |||||||||||||| |||||| | |||||||| ||||| |  ||  |||| ||||
Sbjct  2148  ATCTTGGCGGCGGCACCTTTGATGTGACGCTCCTGTCGATTGACGCCGGTGTCTTTGAGG  2207

Query  578   TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
             |    || ||    || ||||||||| |||||||||||||||| ||| | ||  |  || 
Sbjct  2208  TGCTCGCGACCAACGGCGACACGCACTTGGGTGGTGAGGACTTTGACCAGCGTGTCATGC  2267

Query  638   ACCACTTCACGCAGGAGTTCAAGCG---CAAGCACCGCAAGGACAT---CACGGAGAACC  691
             |  ||||||   || |||  |||     |||| ||   |  |||||   |||||| || |
Sbjct  2268  AGTACTTCATCAAGAAGTGGAAGAAGGACAAGAAC---ATTGACATTGGCACGGACAAGC  2324

Query  692   AGCGTGCTCTTCGTCGTCTGCG----GACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCG  747
              ||| ||||   |  | |||||    || ||||   ||||||| ||||||| | ||||||
Sbjct  2325  -GCGCGCTCCA-GAAG-CTGCGTCGCGA-GGCC---GAGCGTGTCAAGCGTGCTCTGTCG  2377

Query  748   TCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCG  807
              |   ||| |||||     |||||||||| || ||  | |||||    |||||||    |
Sbjct  2378  ACCCAGGCGCAGGCGCGTCTCGAGATTGAGTCGCTCCTTGACGGTGAGGACTTCACGGAG  2437

Query  808   ACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAG  867
              |  |  | ||||||||||||||| |  |   ||  |||   |||   |||||| | |  
Sbjct  2438  GCGCTGTCGCGTGCTCGTTTCGAGAAGCTCAACGAAGACCTGTTCAAGAAGACGCTCGGT  2497

Query  868   CCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTG  927
             ||||| |||||||||||    ||||    |||   ||||    ||||  | ||| | |||
Sbjct  2498  CCCGTCGAGAAGGTGCTCAAGGACGGTGGGCTCAAGAAGTCGGAGGTCGATGAGATTGTG  2557

Query  928   CTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAAC  987
             || || || |||||||| |||||||| ||||| ||||||||  |   ||||| |||||||
Sbjct  2558  CTTGTCGGTGGCTCGACCCGTATCCCCAAGGTCCAGCAGCTCATCAAGGACTACTTCAAC  2617

Query  988   GGCAAGGAGCCCAACAAGTCCA-TCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGT  1046
             |||||||| ||   |  ||    | |||||||| ||||| || |||| ||||||  ||||
Sbjct  2618  GGCAAGGAACCGT-CGCGTGGTGTGAACCCGGATGAGGCCGTTGCGTTCGGTGCTGCCGT  2676

Query  1047  GCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCT  1106
              ||||  |  |||||  | ||| |  |   | || | | |    ||||| | || ||  |
Sbjct  2677  CCAGGGCGGTATCCTCGGTGGCGAGCAG--GACG-ACACGAACAAGGACATTCTGCTCAT  2733

Query  1107  GGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGAT  1166
              || ||  ||||||||||||| ||| | ||||| |  || ||||||||||| | ||| ||
Sbjct  2734  TGATGTCGCGCCGCTGTCTCTCGGTATTGAGACTGTGGGCGGTGTCATGACCAAGCTAAT  2793

Query  1167  CGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAA  1226
             |   || ||||||    | |||||||||||||||||||||||||||||||||   |||||
Sbjct  2794  CAACCGTAACACGGTCATTCCGACCAAGAAGTCGCAGACGTTCTCGACGTACCAGGACAA  2853

Query  1227  CCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAA  1286
             |||||| |  |||||||||||||| ||||| || || || || |||||    ||||||  
Sbjct  2854  CCAGCCGGCCGTGCTCATCCAGGTCTTCGAAGGTGAACGTTCGATGACCAAGGACAACCG  2913

Query  1287  CCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGAT  1346
               |||| || |||||| | ||    ||  | || ||   ||| || || |||||||||||
Sbjct  2914  TATGCTCGGTAAGTTCGAGCTCACGGGTCTGCCGCCGGCGCCGCGTGGCGTGCCGCAGAT  2973

Query  1347  CGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTC  1406
              || || |  || ||  ||||||||||||| || ||  | ||    || | ||| |||  
Sbjct  2974  TGAGGTCAGCTTTGAGCTCGACGCGAACGGAATTCTCCAGGTCGGTGCCGAGGACAAGGG  3033

Query  1407  AACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGA  1466
              ||||||||||   | ||||| |||||||||  ||||||||| || || |||||||  ||
Sbjct  3034  CACGGGCAAGGCCGAGAAGATTACGATCACGGCCGACAAGGGTCGTCTGTCGCAGGAAGA  3093

Query  1467  CATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCG--GAGGACGAGGCTAACAAG  1524
               | || ||||||||   |||||||||| ||| |  | ||  |||||| ||   | ||||
Sbjct  3094  AGTCGAGCGCATGGTCAAGGAGGCCGAGGAGTTC--GCCGACGAGGACAAGAAGATCAAG  3151

Query  1525  CAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTG  1584
              | ||||| || | |   |||||||| ||   ||||   ||||| ||   ||||||  | 
Sbjct  3152  GACCGCATTGACGGCCGCAACGCGCTTGAAGGCTACCTTTACAGCCTCAAGAACAGCGT-  3210

Query  1585  AATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAG  1644
                || || ||| |   ||| |||||   ||| |  |||||| || |||||  | |    
Sbjct  3211  --CGAAGACAAGCTCGCGGACAAGATTGAGGAGGACGACAAGGAGTCGGTGCTCAAGGCT  3268

Query  1645  GTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAG  1704
             |||  ||| |  ||  | ||||| || |  ||||||   | ||| ||||| |  | ||||
Sbjct  3269  GTGCAGGATGCCATGGACTGGCTCGAGGACAACCAGGAGTCGGACAAGGACGACTTCGAG  3328

Query  1705  TCGAAGCAGAAGGAATTGGAG  1725
              | |||||||||||  |||||
Sbjct  3329  GCCAAGCAGAAGGAGGTGGAG  3349

 Score = 124 bits (137),  Expect = 1e-25
 Identities = 255/373 (68%), Gaps = 16/373 (4%)
 Strand=Plus/Plus

Query  32    TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
             |||| ||||| |||||||| || ||||||||||||||| | |   || || |    || |
Sbjct  1569  TCGGTATCGATCTCGGCACGACGTACTCGTGCGTGGGCATCTACAAGGACCAGAAGGTCG  1628

Query  92    AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
             | ||||| || ||||||||||||||||| | ||| ||||| ||||| || |     ||||
Sbjct  1629  AGATCATTGCGAACGACCAGGGCAACCGTATCACGCCGTCGTACGTGGCGT---GGGACT  1685

Query  152   CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
             ||      || || || || || ||||  |||||||| ||||   | || ||| || | |
Sbjct  1686  CGAACGACGAGCGTCTGATTGGCGACGGTGCCAAGAACCAGGCCACGATCAACCCGGAGA  1745

Query  206   ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTC-GTCCAG  264
             | ||| | ||||| | ||| ||||| || |||||   || |   || |  ||| ||||||
Sbjct  1746  AGACGCTCTTCGATGTCAAGCGTCTCATTGGCCGTCCGTACAACGA-CAAGTCGGTCCAG  1804

Query  265   GCCGACATCAAGCACTGGCCGTTCCA-AGTGACGTCGGGCGCCGGTGACAAGCCGCAGAT  323
             |||||||  ||||    ||||||  | | || |  |  | | |||   |||||||   ||
Sbjct  1805  GCCGACAAGAAGCTGCTGCCGTTTGACATTGTCAACAAG-GACGG---CAAGCCGTTCAT  1860

Query  324   CACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGT  383
             |  |||   | ||||||| ||    |||  |||    ||||| ||||| ||| |||||||
Sbjct  1861  CCAGGTCACGATCAAGGGAGAAAAGAAGCAGTTTTCGCCCGAAGAGATTTCGGCCATGGT  1920

Query  384   GCTGATCAAGATG  396
               ||  |||||||
Sbjct  1921  CTTGTCCAAGATG  1933

>PLHA:NW_020187567.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_650, whole genome shotgun sequence
Length=2891727

 Score = 520 bits (576),  Expect = 4e-145
 Identities = 563/754 (75%), Gaps = 33/754 (4%)
 Strand=Plus/Plus

Query  1161    GCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGC  1220
               |||||| || || |||||||| || || || || || |||||||| || |||||||| ||
Sbjct  708585  GCTGATTGCTCGTAACACGACAGTTCCCACTAAAAAATCGCAGACATTTTCGACGTATGC  708644

Query  1221    CGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGA  1280
               |||||||||||| || || || || ||||| ||||| || || || || ||||| || ||
Sbjct  708645  CGACAACCAGCCGGGTGTTCTGATTCAGGTCTTCGAAGGTGAACGATCGATGACTCGTGA  708704

Query  1281    CAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCC  1340
               ||||||||||||||| || |||||| |||| || ||||| ||||||||||| || || ||
Sbjct  708705  CAACAACCTGCTGGGTAAATTCAACTTGGATGGTATCCCGCCCATGCCTCGTGGCGTACC  708764

Query  1341    GCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGA  1400
               ||||||||| |||||||| || |||||||| || || ||  ||||||| |||||||| ||
Sbjct  708765  GCAGATCGATGTGACGTTTGATATCGACGCTAATGGTATTTTGAACGTCTCGGCTGTTGA  708824

Query  1401    GAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCA  1460
               ||||||||| || |||||||||||||| || || || ||||||||||| |||||||||||
Sbjct  708825  GAAGTCAACCGGTAAGGAGAACAAGATTACTATTACAAACGACAAGGGTCGCCTCTCGCA  708884

Query  1461    GGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAA  1520
                || || || ||||||||||| || ||||||||||| |||||||| ||||| || || ||
Sbjct  708885  AGCCGATATCGACCGCATGGTTTCTGAGGCCGAGAAATACAAGTCTGAGGATGAAGCGAA  708944

Query  1521    CAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAG  1580
               |||    || || || ||||||||||  || ||||||||||| ||||   |||| |||| 
Sbjct  708945  CAAAGTTCGTATTGAAGCCAAGAACGGTCTTGAGAACTACGCTTACAACTTGCGTAACAC  709004

Query  1581    TCTGAATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGA  1640
                || || || |||||| | ||||   |  |  |||| |  || ||||| ||  | |||||
Sbjct  709005  CCTCAACGATGAGAAGCTTAAGGGCCAACTTTCGGATGACGATAAGAAAGCTATCGACGA  709064

Query  1641    CAAGGTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTA  1700
               |||||| || |||   ||| | ||||| ||||| ||||| ||    || ||||| |  | 
Sbjct  709065  CAAGGTCACTGAAACAATCAACTGGCTTGACGCTAACCAATCGGCTGAAAAGGAAGAATT  709124

Query  1701    CGAGTCGAAGCAGAAGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGC  1760
                ||    |||||||| ||  | ||||| || || || ||| |  | ||||| ||||| ||
Sbjct  709125  TGAAGGCAAGCAGAAAGAGCTTGAGGGTGTTGCAAATCCAATTCTCCAGAAAATGTATGC  709184

Query  1761    TGCTGCTGGCGGTTCCCCTGGTGCTGA------------------------------GGG  1790
                || || || ||| ||||||| |||||                              |||
Sbjct  709185  CGCAGCCGGTGGTGCCCCTGGAGCTGATGGTATGCCTGGTATGCCAGGTGGAATGCCGGG  709244

Query  1791    TGGTATGCCCGGTGGTGTGCCGGGCGGCATGCCTGGT---GCTCCCCCTGCTGGTGCTGC  1847
               |||||||||||||||| |||| || || ||| |||||   || || |||||||| ||  |
Sbjct  709245  TGGTATGCCCGGTGGTATGCCTGGTGGTATGACTGGTGGCGCCCCACCTGCTGGAGCACC  709304

Query  1848    GGACCAGGGCCCGAAGATCGAGGAGGTCGACTAA  1881
                |||||||| || ||||| |||||||| ||||||
Sbjct  709305  TGACCAGGGTCCAAAGATTGAGGAGGTTGACTAA  709338

 Score = 40.1 bits (43),  Expect = 3.9
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  1081     GAGAAGCTGCAGGACCTGCTTCTGCTGGA  1109
                ||| |||||||| ||||||||||||| ||
Sbjct  2745380  GAGGAGCTGCAGTACCTGCTTCTGCTCGA  2745408

>PYIW:scaffold_4899 piw_scaffold_4899 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_4899:1:1708:1 
REF
Length=1708

 Score = 517 bits (572),  Expect = 5e-144
 Identities = 814/1158 (70%), Gaps = 16/1158 (1%)
 Strand=Plus/Plus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             ||||||| ||| | || || |||||||  |||| ||| |||||||||||||||||||| |
Sbjct  557   AGGACGCGGGCACGATCGCTGGCCTCACGGTGCAGCGCATCATCAACGAGCCGACGGCGG  616

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGCG---GCGAGCGCAACGTGCTGATCTTCG  517
             | || ||||| |||||| | |||||| || |||   | |||    |||||||| |||| |
Sbjct  617   CTGCAATCGCCTACGGCATCGACAAGCAGAGCGAGGGTGAGAAGCACGTGCTGGTCTTTG  676

Query  518   ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
             | ||||||||||| || ||||| ||| | || ||  | || || |  ||| | ||||| |
Sbjct  677   ATCTGGGCGGCGGTACGTTCGACGTGACGCTGCTCGCGATCGAAGGCGGCGTGTTCGAAG  736

Query  578   TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
             |   ||| ||    || || || ||| |||| ||||||||||| ||| | ||  || || 
Sbjct  737   TACTGGCGACGAACGGCGATACCCACTTGGGCGGTGAGGACTTTGACCAACGAGTGATGC  796

Query  638   ACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGC---AAGGACATCACGGAGAACCAGC  694
             |    ||||   || |||  |||   ||| || |    |  ||||||     | || |||
Sbjct  797   AGTTTTTCATCAAGAAGTGGAAG---AAGGACAGGGGAATTGACATCGGTTCGGACAAGC  853

Query  695   GTGCTCTTCGTCGTCTGCGGACGGCCTGC-GAGCGTGCCAAGCGTACGCTGTCGTCGTCG  753
             | || || |     || || |||    || |||||||  |||||  | |||||| |   |
Sbjct  854   GCGCGCTCCAGAAGCTCCG-ACGCGAAGCTGAGCGTGTGAAGCGCGCACTGTCGACCCAG  912

Query  754   GCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATC  813
              | ||||||    ||||||||||||| ||| |||| ||    |||||||    |||  ||
Sbjct  913   ACCCAGGCTCGACTCGAGATTGACTCGCTGCTCGATGGTGAAGACTTCAGTGAGACGCTC  972

Query  814   ACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTG  873
             | ||| || || || ||| |  |   ||  ||||  |||   |||||| ||  |||||||
Sbjct  973   AGTCGCGCACGCTTTGAGAAGCTCAACGAAGACTTGTTCAAGAAGACGCTGACGCCCGTG  1032

Query  874   GAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTG  933
             ||||| ||| ||   |||||   | |   ||||  | ||||  ||||| | ||||| |||
Sbjct  1033  GAGAAAGTGTTGAAGGACGCTGGGATCAAGAAGTCCGAGGTAGACGAGATCGTGCTCGTG  1092

Query  934   GGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAG  993
             ||||||||||| || ||||| ||||||||||||||  |   |||||||||||| ||||| 
Sbjct  1093  GGCGGCTCGACACGGATCCCCAAGGTGCAGCAGCTCATCAAGGACTTCTTCAATGGCAAA  1152

Query  994   GAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCA-GGC  1052
             |||||||    |  | | ||||||||||| || ||||| || || ||  |||| || |||
Sbjct  1153  GAGCCCAGTCGGGGCGTGAACCCGGACGAAGCCGTGGCCTATGGCGCTGCCGTCCAAGGC  1212

Query  1053  GGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGT  1112
             ||  |||||  |||| |   ||  |  |||    |||   ||| |  | ||| | |||||
Sbjct  1213  GGG-ATCCTCGGCGGTATGAACCAGAAGGAT---CTGGGCGACATCGTGCTGATTGACGT  1268

Query  1113  GACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCG  1172
             |  ||| || || | |||| ||||||| | ||||||||| ||||| | |||||||   ||
Sbjct  1269  GGTGCCACTCTCACAGGGTATCGAGACCGTCGGTGGTGTGATGACCAAGCTGATCAACCG  1328

Query  1173  GAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCC  1232
             ||||||| || | |||| ||||||||| |||  |||||||||  ||| ||||||||| ||
Sbjct  1329  GAACACGGCGATCCCGAACAAGAAGTCACAGGTGTTCTCGACTCACGTCGACAACCAACC  1388

Query  1233  TGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCT  1292
              |  |||   ||| |||||| ||| || |||||| |  ||      |||||| || ||||
Sbjct  1389  AGCCGTGTCGATCAAGGTGTACGAAGGTGAGCGCACGTTGGTCAAGGACAACCACTTGCT  1448

Query  1293  GGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGT  1352
             ||| |||||| | ||    |||||||||||    || |||||  | ||||| ||||| ||
Sbjct  1449  GGGAAAGTTCGATCTCACGGGCATCCCTCCGGCTCCACGCGGGATCCCGCAAATCGAAGT  1508

Query  1353  GACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGG  1412
             |||||| || ||||||||||||||||||||| | || || || | ||| |||   |||||
Sbjct  1509  GACGTTTGAGATCGACGCGAACGGCATCCTGCAGGTCTCAGCAGAGGACAAGGGCACGGG  1568

Query  1413  CAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTGA  1472
             ||| |   | |||||||||||||||  ||| || || || ||||| |||||||| || ||
Sbjct  1569  CAAAGCCGAGAAGATCACGATCACGGCCGAGAAAGGACGGCTCTCTCAGGCTGAGATCGA  1628

Query  1473  CCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCAT  1532
              |||||  |   |||||||||| ||| |     ||||||| ||     |||  | |||||
Sbjct  1629  TCGCATCATTGAGGAGGCCGAGCAGTTCGCCGAGGAGGACAAGAAGGTCAAAGAGCGCAT  1688

Query  1533  CGAGGCCAAGAACGCGCT  1550
             |||    |||||||||||
Sbjct  1689  CGACAGTAAGAACGCGCT  1706

 Score = 170 bits (188),  Expect = 9e-40
 Identities = 263/372 (71%), Gaps = 14/372 (4%)
 Strand=Plus/Plus

Query  32   TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
            |||||||||||||||||||||| |||||||| ||||||||||   || || |    || |
Sbjct  98   TCGGCATCGACCTCGGCACAACGTACTCGTGTGTGGGCGTGTACAAGGACCAGAAGGTCG  157

Query  92   AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
            | |||||||||||||||||||||||||||| ||| ||||| ||||| || |     ||||
Sbjct  158  AGATCATCGCCAACGACCAGGGCAACCGCATCACGCCGTCCTACGTGGCGT---GGGACT  214

Query  152  CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
            ||      || || |||||||| |||| ||||||||| |||| | | || ||  || | |
Sbjct  215  CGAACGACGAGCGTCTCATCGGCGACGGCGCCAAGAACCAGGCGACGATCAATCCGGAGA  274

Query  206  ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGG  265
            | ||  | ||||||| ||| || || ||||| ||  | | |   |||     ||| ||||
Sbjct  275  AGACAATCTTCGACGTCAAGCGCCTCATCGGGCGTGACTACAGCGACAAGTCCGTGCAGG  334

Query  266  CCGACATCAAGCACTGGCCGTTCCA-AGTGACGTCGGGCGCCGGTGACAAGCCGCAGATC  324
            ||||||  |||| |  ||||| ||| | ||    |  | | |||   ||| ||   ||||
Sbjct  335  CCGACAAGAAGCTCCTGCCGTACCATATTGTGAACAAG-GACGG---CAAACCCATGATC  390

Query  325  ACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTG  384
              ||| | | |||||||||||   |||  ||||   || || ||||| ||  | ||| | 
Sbjct  391  GAGGTCCTGATCAAGGGCGAGAAGAAGCTGTTCTCGCCTGAAGAGATTTCTGCGATGATC  450

Query  385  CTGATCAAGATG  396
            |||| |||||||
Sbjct  451  CTGACCAAGATG  462

>PHKE:scaffold_183 scf_22126_183.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_183.1_contig_1:1:67272:1 
REF
Length=67272

 Score = 517 bits (572),  Expect = 5e-144
 Identities = 838/1195 (70%), Gaps = 32/1195 (3%)
 Strand=Plus/Minus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             |||| |||||  |||||||||| || |  |||| ||||||||| |||||||| || || |
Sbjct  6239  AGGATGCCGGTACCATTGCCGGTCTGACTGTGCAGCGTATCATTAACGAGCCTACTGCTG  6180

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGC---GGCGAGCGCAACGTGCTGATCTTCG  517
             | ||||| || |||||  | ||||||||||     ||||||   || |||||| |||| |
Sbjct  6179  CTGCCATTGCTTACGGTATTGACAAGAAGGCACAGGGCGAGAAGAATGTGCTGGTCTTTG  6120

Query  518   ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
             |||| || ||||| |||||||||||| | || ||| | ||||| |  ||  | |||||||
Sbjct  6119  ACCTTGGTGGCGGTACCTTCGATGTGACGCTTCTGGCTATTGACGGCGGTGTGTTCGAGG  6060

Query  578   TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
             |    || ||    |||||||||||| |||| ||||||||||| ||| | ||  |  || 
Sbjct  6059  TGCTTGCTACCAACGGTGACACGCACTTGGGCGGTGAGGACTTTGACCAGCGTATCATGC  6000

Query  638   ACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATC-ACGGAGA-----ACC  691
             |  ||||||   || |||  |||   ||| ||   ||| ||||  |||  |      || 
Sbjct  5999  AGTACTTCATTAAGAAGTGGAAG---AAGGAC---AAGAACATTGACGTGGCCTCGGACA  5946

Query  692   AGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCG-AGCGTGCCAAGCGTACGCTGTCGTCG  750
             |||||||||| |     |||||  ||    ||| |||||| ||||||  | || ||  | 
Sbjct  5945  AGCGTGCTCTGCAGAAGCTGCGT-CGTGAAGCGGAGCGTGTCAAGCGCGCTCTATCCGCT  5887

Query  751   TCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACC  810
               ||||||||||    | |||||||| || ||| | |||||    ||||| |    | | 
Sbjct  5886  CAGGCTCAGGCTCGTCTTGAGATTGAGTCGCTGCTGGACGGTGAGGACTTTACTGAGTCT  5827

Query  811   ATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCC  870
              | |  ||||| ||||||||| |  |   ||  |||   |||   |||||  | |  |||
Sbjct  5826  CTGAGCCGTGCCCGTTTCGAGAAGCTCAACGAGGACCTGTTCAAGAAGACCCTTGGCCCC  5767

Query  871   GTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTG  930
             |||||||  ||| ||   |||||  |  ||  ||||    ||||  | ||| | ||||||
Sbjct  5766  GTGGAGAGAGTGATGAAGGACGCTGACTTGAAGAAGTCGGAGGTCGATGAGATTGTGCTG  5707

Query  931   GTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGC  990
             || || ||||| || |||||||| ||||||||||||||| |   ||||| ||||||||||
Sbjct  5706  GTTGGTGGCTCCACCCGTATCCCCAAGGTGCAGCAGCTGATCAAGGACTACTTCAACGGC  5647

Query  991   AAGGAGCCCAACAAGTCCA-TCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCA  1049
             |||||||||  |  ||    | ||||| || |||||||| || ||||||||  | |||||
Sbjct  5646  AAGGAGCCCT-CGCGTGGTGTGAACCCCGATGAGGCTGTTGCCTACGGTGCTGCTGTGCA  5588

Query  1050  GGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGC---AGGACCTGCTTCTGCT  1106
             ||  |  |||||| | ||| |  |      |||  | |||    ||||| |||||||| |
Sbjct  5587  GGGCGGTATCCTGGGTGGCGAGCA------GGATGACCTGACGAAGGACGTGCTTCTGAT  5534

Query  1107  GGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGAT  1166
              || |||   || ||||| | |||| | ||||| |  ||||| |||||||| | ||| ||
Sbjct  5533  TGATGTGGTTCCTCTGTCCCAGGGTATTGAGACCGTGGGTGGCGTCATGACCAAGCTCAT  5474

Query  1167  CGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAA  1226
             |   || |||||   | | |||||||||||||||||||| ||||| ||||||   |||||
Sbjct  5473  CAACCGTAACACTGTGATCCCGACCAAGAAGTCGCAGACCTTCTCTACGTACCAGGACAA  5414

Query  1227  CCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAA  1286
             |||||| |  ||||| ||||||||||||||||| |||||  |||||||    ||||||  
Sbjct  5413  CCAGCCGGCTGTGCTGATCCAGGTGTTCGAGGGTGAGCGTGCCATGACCAAGGACAACCG  5354

Query  1287  CCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGAT  1346
              || |||||||||||| | |||   ||  | || ||    || || |||||||| |||||
Sbjct  5353  TCTTCTGGGCAAGTTCGAGCTGACGGGTCTGCCGCCTGCTCCGCGTGGTGTGCCTCAGAT  5294

Query  1347  CGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTC  1406
              || ||||||||||| || ||||| ||||| |||||| | ||||| |||| ||| |||  
Sbjct  5293  TGAGGTGACGTTCGAGATTGACGCCAACGGTATCCTGCAGGTGTCTGCTGAGGACAAGGG  5234

Query  1407  AACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGA  1466
              ||||||||||   | | ||||||||||||   ||| |||||||| || || ||||  ||
Sbjct  5233  CACGGGCAAGGCTGAGACGATCACGATCACTGCCGAGAAGGGCCGTCTGTCCCAGGACGA  5174

Query  1467  CATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCG--GAGGACGAGGCTAACAAG  1524
              || |||||||||||   |||||| |   ||| |  | ||  |||||| ||     ||||
Sbjct  5173  GATCGACCGCATGGTCCAGGAGGCTGCCGAGTTC--GCCGACGAGGACAAGAAGGTCAAG  5116

Query  1525  CAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACA  1579
              | || ||||| | |   ||||| || |||  ||||   |||||  ||  |||||
Sbjct  5115  GACCGTATCGATGGCCGCAACGCTCTCGAGGGCTACCTGTACAGCTTGAAGAACA  5061

 Score = 121 bits (133),  Expect = 1e-24
 Identities = 178/252 (71%), Gaps = 9/252 (4%)
 Strand=Plus/Minus

Query  32    TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
             |||| ||||| || || || || ||||| ||||| ||| | |   || || |    || |
Sbjct  6698  TCGGAATCGATCTGGGTACCACATACTCTTGCGTCGGCATCTACAAGGACCAGAAGGTCG  6639

Query  92    AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
             | |||||||||||||||||||| ||||| | ||| || || ||||| || |     ||||
Sbjct  6638  AGATCATCGCCAACGACCAGGGTAACCGTATCACACCTTCGTACGTGGCTT---GGGACT  6582

Query  152   CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
             ||      || || || ||||| |||| ||||||||| ||||   |||| ||| || | |
Sbjct  6581  CGAACGACGAGCGTCTGATCGGAGACGGCGCCAAGAACCAGGCCACCATCAACCCGGAGA  6522

Query  206   ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGG  265
             | ||  ||||||| | ||| ||||| || || ||||||| | | |||     ||| ||||
Sbjct  6521  AGACACTGTTCGATGTCAAGCGTCTCATTGGTCGCAAGTACACCGACAAGTCCGTGCAGG  6462

Query  266   CCGACATCAAGC  277
             | ||||  ||||
Sbjct  6461  CAGACAAGAAGC  6450

>PHIF:NW_003303738.1 Phytophthora infestans T30-4 supercont1.21 
genomic scaffold, whole genome shotgun sequence
Length=2319577

 Score = 511 bits (566),  Expect = 2e-142
 Identities = 834/1189 (70%), Gaps = 58/1189 (5%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||  |||| ||||||||  ||||   |||||||||||||||||| |||||||
Sbjct  934510  AGGACGCCGGTTCCATCGCCGGCCTGGACGTCAAGCGTATCATCAACGAGCCCACGGCCG  934569

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGC------------GAGCGCAACGTGC  508
               | ||  | |||||||| ||||||| ||| | ||||            | | |||||||||
Sbjct  934570  CTGCACTGGCGTACGGTCTGGACACGAACGCCGGCACGGACGGCAAGGCGTGCAACGTGC  934629

Query  509     TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
               |||||||||||||||| ||||| ||||||||||||||  |||||||||||||| | ||||
Sbjct  934630  TGATCTTCGACCTGGGTGGCGGTACCTTCGATGTGTCGATCCTGTCCATTGAGAACGGCA  934689

Query  569     TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
               |||||||||||||| | || |  |||||||||||| |||||||||||||||| |||||| 
Sbjct  934690  TCTTCGAGGTCAAGTCGACGGGCGGTGACACGCACTTGGGTGGTGAGGACTTTGACAACA  934749

Query  629     GCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAA---GGACATCACGG  685
                | ||||||| ||| |   |  |||||||||||| ||| |||||||   |||   | || 
Sbjct  934750  ACATGGTGGAGCACCTGCTGTCGGAGTTCAAGCGTAAGAACCGCAACCTGGA---CCCGT  934806

Query  686     AGAACCAG---CGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGC  742
                || |  |   |||||  | ||||||||||| ||||| || |||   || ||||||| ||
Sbjct  934807  CGAGCTCGGCCCGTGCGATGCGTCGTCTGCGTACGGCGTGTGAGTCGGCTAAGCGTATGC  934866

Query  743     TGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCA  802
               ||||  |  || |   ||| |   | ||| | ||||| |||||||| ||| |||||||| 
Sbjct  934867  TGTCCACTACGACGTCGGCCTCGGTAGAGGTGGACTCGCTGTTCGAGGGCGTCGACTTCT  934926

Query  803     ACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGA-CTACTTCCGCAAGACG  861
                 || ||  | || |||||    ||||||    ||  ||  || ||  |   ||    ||
Sbjct  934927  CGTCCACTGTGACGCGTGCCAAGTTCGAGTCGCTGAACGAGGAGCTGTTCAAGCGTTGCG  934986

Query  862     ATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAG---GTGCAC  918
               | |||| | |||  ||||||||||   ||||||||| |   ||||  | ||   |||   
Sbjct  934987  A-GGAGACTGTGCTGAAGGTGCTGGAGGACGCCAAGAT---GAAGCCCGAGGACGTGACG  935042

Query  919     GAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGAC  978
               ||| |||||||||| ||||| || ||||||||||| |||||||||    |||||||  ||
Sbjct  935043  GAGCTGGTGCTGGTCGGCGGTTCCACGCGTATCCCCAAGGTGCAGACCATGCTGTC-CAC  935101

Query  979     T-TCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGG  1037
               | | |||  |||||||||||     |||||||||||||||||||||||||||||||||||
Sbjct  935102  TCTGTTCGGCGGCAAGGAGCTGTCGAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGG  935161

Query  1038    TGCGACCGTGCAGGCGGCCATCCTG------AGCGGCAACGACTCGTCGGAGAAGCTGCA  1091
               |||  | || ||||  |||||||||      | | |||||||| || |  |   ||||  
Sbjct  935162  TGCCGCTGTCCAGGGCGCCATCCTGGACGGCATCCGCAACGACGCGACCAACTCGCTG--  935219

Query  1092    GGACCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGT  1151
                   ||||||    |||| || ||||||||||| || ||| | ||||| |  ||    ||
Sbjct  935220  ----CTGCTT---GTGGATGTAACGCCGCTGTCCCTCGGTATTGAGACCGTGGGCAAGGT  935272

Query  1152    CATGACGACGCTGATCGCGCGGAACACGACGGTGCC---GACCAAGAAGTCGCAGACGTT  1208
               |||| ||  |||||||  ||| |||||| |  | ||   |  |||||   | |    || 
Sbjct  935273  CATGTCGGTGCTGATCAAGCGCAACACGGCCATCCCCGTGCGCAAGA---CCCGCGTGTA  935329

Query  1209    CTCGACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTC  1268
               | | ||  | |  ||| ||||| |    |||  | |     | | |||||||||||||  
Sbjct  935330  CACTACCGAGGAGGACTACCAGACGTCTGTGGACGTGTGCATCTACGAGGGCGAGCGC-G  935388

Query  1269    CATGACGCGCGAC-AACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGC  1327
               | ||   || | | ||||||  ||| ||| |||||||| |   |||  ||     | |||
Sbjct  935389  CGTGCGTCGAGTCGAACAACAAGCTCGGCGAGTTCAACATCTCCGG--TCTGGAGCGTGC  935446

Query  1328    C--TCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAA  1385
               |   || || | ||||||| |||| ||||||||||| || ||||||||||| ||||||||
Sbjct  935447  CAAGCGTGGCGAGCCGCAGGTCGAGGTGACGTTCGAGATTGACGCGAACGGAATCCTGAA  935506

Query  1386    CGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAA  1445
               |||||||||    || |||   || |||  | ||  | |||  || ||| ||||| ||  
Sbjct  935507  CGTGTCGGCCCGTGACAAGAAGACCGGCGCGAAGGCCGAGACGACCATCTCGAACAACCG  935566

Query  1446    GGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTC  1505
                || || ||    ||||  ||||| ||||| |||||  | |||||||| |||| ||||  
Sbjct  935567  TGGGCGTCTGAGCCAGGAGGACATCGACCGTATGGTGGCCGAGGCCGACAAGTTCAAGAA  935626

Query  1506    GGAGGACGAGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAG  1554
               ||| ||||  |  |    ||  ||||| ||||||   ||||  ||||||
Sbjct  935627  GGACGACGCCGAGATGCTGCGTCGCATTGAGGCCCGTAACGACCTGGAG  935675

 Score = 201 bits (222),  Expect = 5e-49
 Identities = 259/355 (73%), Gaps = 2/355 (1%)
 Strand=Plus/Plus

Query  34      GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
               || ||||| || || || || |||||||||||||| |||||| || ||| ||  ||||| 
Sbjct  934053  GGTATCGATCTGGGTACGACGTACTCGTGCGTGGGTGTGTGGAAGGACGGCCAGGTGGAG  934112

Query  94      ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
               ||||| ||||||  | | || ||||| || |||||||| |  || |||||||  ||    
Sbjct  934113  ATCATTGCCAACAGCGAAGGTAACCGTACGACCCCGTCGTGGGTGGCCTTCAACGAGAGC  934172

Query  154     GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCAC-AACACGGT  212
               || || |||||||| || || |||||||  ||||  ||    ||||| ||| ||||||||
Sbjct  934173  GAGCGTCTCATCGGAGAGGCGGCCAAGATCCAGGCCGCTGGTAACGC-CACGAACACGGT  934231

Query  213     GTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACAT  272
               |||||||||||| ||| | || || ||||  |||   |||   || ||  ||   |||  
Sbjct  934232  GTTCGACGCCAAGCGTATCATTGGACGCAGCTTCAGCGACGAGGTGGTGAAGAAGGACGC  934291

Query  273     CAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGCA  332
                |||||||  ||||||    | | |  |||||  |  ||||||  || ||||  |||| |
Sbjct  934292  GAAGCACTTCCCGTTCACGATCAAGGAGGGCGATGAGGACAAGGTGCTGATCGAGGTGGA  934351

Query  333     GTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTG  387
               |||||||||||||   ||||  |||   |||||||||||||||||||||||||||
Sbjct  934352  GTTCAAGGGCGAGAAGAAGAGCTTCACGCCCGAGGAGATCTCGTCCATGGTGCTG  934406

 Score = 39.2 bits (42),  Expect = 3.9
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  1315    ATCCCTCCCATGCCTCGCGGTGTGCC  1340
               |||||||||||||||| | |||||||
Sbjct  278284  ATCCCTCCCATGCCTCCCAGTGTGCC  278309

>PYIR:scaffold_176 pir_scaffold_176 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_176:1:45219:1 
REF
Length=45219

 Score = 507 bits (561),  Expect = 1e-140
 Identities = 926/1341 (69%), Gaps = 49/1341 (4%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||| |||||  ||||||||||  | |  |||| |||||||||||| |||||||| || |
Sbjct  42851  AGGATGCCGGTACCATTGCCGGTATGACTGTGCAGCGTATCATCAATGAGCCGACTGCTG  42910

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGG-GC--GGCGAGCGCAACGTGCTGATCTTCG  517
              | || |||||||||||  | |||||||||| ||  ||||||   || |||||| ||||||
Sbjct  42911  CGGCGATCGCGTACGGTATCGACAAGAAGGCGCAGGGCGAGAAGAATGTGCTGGTCTTCG  42970

Query  518    ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
              | || || || || |||||||||||| | |||||  ||||||| |  ||  | || || |
Sbjct  42971  ATCTTGGTGGTGGTACCTTCGATGTGACCCTCCTCGCCATTGACGGTGGTGTGTTTGAAG  43030

Query  578    TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
              |    || ||    |||||||| ||| |||| || |||||||||||| | ||| |  || 
Sbjct  43031  TGCTCGCAACCAACGGTGACACTCACTTGGGCGGCGAGGACTTCGACCAGCGCATCATGC  43090

Query  638    ACCACTTCACGCAGGAGTTCAAGCGCAAGCAC----CGCAAGGACAT---CACGGAGAAC  690
              |   ||| |   |  |||  |||   ||| ||    || | ||||||   |||||| || 
Sbjct  43091  AGTTCTTTATCAAAAAGTGGAAG---AAGGACAAGTCG-ATGGACATTGGCACGGACAAG  43146

Query  691    CAGCGTGCTC-------TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCT  743
              | ||| ||||       | ||||||     || ||||   |||||||  |||||| | ||
Sbjct  43147  C-GCGCGCTCCAGAAGCTCCGTCGT-----GA-GGCC---GAGCGTGTGAAGCGTGCTCT  43196

Query  744    GTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAA  803
              |||| |   ||| ||||||    | |||||||| || ||| |||| |||   ||||||| 
Sbjct  43197  GTCGACCCAGGCACAGGCTCGTCTGGAGATTGAGTCGCTGCTCGATGGCGAGGACTTCAC  43256

Query  804    CTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGAT  863
                 | |  |  | || |||||||||||| |  |    |  ||||  |||   |||||  |
Sbjct  43257  GGAGTCACTGTCGCGCGCTCGTTTCGAGAAGCTCAATGAAGACTTGTTCAAGAAGACCCT  43316

Query  864    GGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGT  923
               |  || || |||||||||||    ||||||    ||  ||||    ||||  | ||| |
Sbjct  43317  CGGCCCAGTCGAGAAGGTGCTCAAGGACGCCGGCTTGAAGAAGTCGGAGGTTGATGAGAT  43376

Query  924    GGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTT  983
               ||||| |||||||| ||||| |||||||| ||||||||||||||| |   ||||| |||
Sbjct  43377  CGTGCTCGTGGGCGGTTCGACCCGTATCCCAAAGGTGCAGCAGCTGATCAAGGACTACTT  43436

Query  984    CAACGGCAAGGAGCCCAACAAGT-CCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGA  1042
              ||||||||||||| ||| |  ||    | ||||| || |||||||| || ||||||||  
Sbjct  43437  CAACGGCAAGGAG-CCATCGCGTGGTGTGAACCCAGATGAGGCTGTTGCCTACGGTGCCG  43495

Query  1043   CCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTG---CAGGACCTGC  1099
              | |||||||  |  |||||  ||||  |  ||     |||  | |||    ||||| |||
Sbjct  43496  CTGTGCAGGGTGGTATCCTCGGCGGTGA--AC----AGGACGACCTGACCAAGGACGTGC  43549

Query  1100   TTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGA  1159
              ||||| | || ||    || ||||| | |||  | ||||| | ||| ||||||||||| |
Sbjct  43550  TTCTGATCGATGTCGTCCCTCTGTCGCAGGGCATTGAGACCGTCGGCGGTGTCATGACCA  43609

Query  1160   CGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACG  1219
               |||||||   || |||||   | | |||||||||||||||||||| |||||||| ||| 
Sbjct  43610  AGCTGATCAACCGCAACACTGTGATCCCGACCAAGAAGTCGCAGACTTTCTCGACCTACC  43669

Query  1220   CCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCG  1279
                ||||||||||| |  ||||| |||||||||||||||||||||||  | |||||    |
Sbjct  43670  AGGACAACCAGCCAGCTGTGCTGATCCAGGTGTTCGAGGGCGAGCGTGCGATGACCAAGG  43729

Query  1280   ACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGC  1339
              |||||   || |||||||||||| |  ||   ||  |||||||    || || |||||||
Sbjct  43730  ACAACCGTCTCCTGGGCAAGTTCGAGTTGACTGGTCTCCCTCCAGCTCCGCGTGGTGTGC  43789

Query  1340   CGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGG  1399
              | ||||| || || || ||||| || || |||||||| ||| || | ||    ||||  |
Sbjct  43790  CACAGATTGAAGTCACCTTCGAAATTGATGCGAACGGTATCTTGCAGGTCGGCGCTGAAG  43849

Query  1400   AGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGC  1459
              | |||   || |||||||   | |||||||| || ||   ||| |||||||| || || |
Sbjct  43850  ACAAGGGCACTGGCAAGGCTGAGAAGATCACCATTACCGCCGAGAAGGGCCGTCTGTCCC  43909

Query  1460   AGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTA  1519
              |||  || || |||||||||||   ||| ||||   || ||     ||||||| ||    
Sbjct  43910  AGGAGGAGATCGACCGCATGGTGCAGGAAGCCGCTGAGAACGCCGAGGAGGACAAGAAGG  43969

Query  1520   ACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACA  1579
                ||| | |||||||| | |   ||||  || |||  ||||   |||||  ||  |||||
Sbjct  43970  TGAAGGACCGCATCGACGGCCGCAACGGTCTCGAGGGCTACCTGTACAGCTTGAAGAACA  44029

Query  1580   GTCTGAATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTG--GA  1637
               | ||   ||||| ||| |   ||| ||||||  ||| |  |||||| |  |||||  ||
Sbjct  44030  CTGTG---GACGACAAGCTTGCGGACAAGATCGAGGAGGACGACAAGGACTCGGTGCTGA  44086

Query  1638   CGACAAGGTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGC  1697
               | |   |||  ||| |  ||  | |||||||| |  ||||||  |   || ||||| | 
Sbjct  44087  AGGC--CGTGCAGGACGCCATGGACTGGCTGGAGGACAACCAGGAAGCCGACAAGGAGGA  44144

Query  1698   GTACGAGTCGAAGCAGAAGGA  1718
               |  ||| |||||||||||||
Sbjct  44145  CTTTGAGGCGAAGCAGAAGGA  44165

 Score = 245 bits (271),  Expect = 5e-62
 Identities = 412/591 (70%), Gaps = 9/591 (2%)
 Strand=Plus/Plus

Query  911    AGGTGCACGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGC  970
              ||||  ||||| | || || ||||| |||||||| |||||||| ||||||||||||||| 
Sbjct  38909  AGGTCGACGAGATCGTACTCGTGGGTGGCTCGACCCGTATCCCAAAGGTGCAGCAGCTGA  38968

Query  971    TGTCGGACTTCTTCAACGGCAAGGAGCCCAACAAGTCCA-TCAACCCGGACGAGGCTGTG  1029
              |   ||||| |||||||||||||||||| | |  ||    | || || ||||| || || 
Sbjct  38969  TCAAGGACTACTTCAACGGCAAGGAGCC-ATCGCGTGGTGTGAATCCTGACGAAGCGGTT  39027

Query  1030   GCGTACGGTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTG  1089
              || || || ||  |||| ||||  |  ||||| ||||||   ||   |   |||  ||||
Sbjct  39028  GCCTATGGCGCTGCCGTACAGGGCGGTATCCTCAGCGGCGCGGA---GCAAGAGGGGCTG  39084

Query  1090   CAGGACCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGT  1149
                 ||| || | ||  | || ||   ||| || || | |||  ||||||| | ||| |||
Sbjct  39085  GGCGACATGGTGCTCATCGATGTCGTGCCCCTCTCACAGGGCATCGAGACTGTCGGGGGT  39144

Query  1150   GTCATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTC  1209
              || ||||| | | ||||      ||||||  || | |||||||||||||| |||   |||
Sbjct  39145  GTGATGACCAAGTTGATTAACAAGAACACAGCGATCCCGACCAAGAAGTCTCAGGTATTC  39204

Query  1210   TCGACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCC  1269
              |||||  |||  ||||||||||| |  ||    ||| |||| | ||| || |||||  | 
Sbjct  39205  TCGACCCACGTGGACAACCAGCCCGCAGTATCGATCAAGGTCTACGAAGGTGAGCGTGCG  39264

Query  1270   ATGACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCT  1329
               ||      |||||| |  |||||||||||||  ||||    |||||||| ||    || 
Sbjct  39265  CTGGTCAAGGACAACCATTTGCTGGGCAAGTTTGACCTCACGGGCATCCCACCGGCACCG  39324

Query  1330   CGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTG  1389
              || || || || |||||| | || || |||||  |||| |||||||||||| || | || 
Sbjct  39325  CGTGGGGTCCCACAGATCCAGGTCACATTCGAAGTCGATGCGAACGGCATCTTGCAGGTT  39384

Query  1390   TCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGC  1449
              || || |  || |||   || || |||| | | ||||| |||||||||  ||| ||||| 
Sbjct  39385  TCTGCGGAAGACAAGGGCACTGGTAAGGCGGAGAAGATTACGATCACGGCCGAAAAGGGA  39444

Query  1450   CGCCTCTCGCAGGCTGACATTGACCGCATGGTATC--GGAGGCCGAGAAGT  1498
              || ||||| ||||  || || || || ||  ||||  ||| || ||| |||
Sbjct  39445  CGTCTCTCCCAGGAGGAGATCGATCGGAT--TATCCGGGAAGCTGAGCAGT  39493

 Score = 166 bits (183),  Expect = 4e-38
 Identities = 262/372 (70%), Gaps = 14/372 (4%)
 Strand=Plus/Plus

Query  32     TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
              |||||||||| |||||||| || ||||||||||| ||| | |   || || |    || |
Sbjct  38294  TCGGCATCGATCTCGGCACCACGTACTCGTGCGTAGGCATCTACAAGGACCAGAAGGTCG  38353

Query  92     AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
              | ||||| || ||||||||||||||||||| ||| ||||| |||||||| |     ||||
Sbjct  38354  AGATCATTGCGAACGACCAGGGCAACCGCATCACGCCGTCGTACGTCGCGT---GGGACT  38410

Query  152    CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
              ||      || || || ||||| |||| ||||||||| |||| | | || ||| || |  
Sbjct  38411  CGAACGACGAGCGTCTGATCGGCGACGGCGCCAAGAACCAGGCGACGATCAACCCGGAGC  38470

Query  206    ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTC-GTCCAG  264
              | ||  ||||||| | ||| |||||||| ||||||  || |   || |  ||| || |||
Sbjct  38471  AGACCTTGTTCGATGTCAAGCGTCTGATTGGCCGCTCGTACAACGA-CAAGTCGGTGCAG  38529

Query  265    GCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATC  324
              |||||||  ||||    ||||| | |   ||    || |   | || |||||||  ||||
Sbjct  38530  GCCGACAAGAAGCTGCTGCCGTACAA---GATTGTGGACAAGGATGGCAAGCCGGCGATC  38586

Query  325    ACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTG  384
                 |||| | |||||||||||   ||   ||||   || |||||||||||  | ||| | 
Sbjct  38587  GAAGTGCCGATCAAGGGCGAGAAGAAACTGTTCTCGCCTGAGGAGATCTCTGCGATGATC  38646

Query  385    CTGATCAAGATG  396
              |||| |||||||
Sbjct  38647  CTGACCAAGATG  38658

 Score = 41.0 bits (44),  Expect = 1.1
 Identities = 46/62 (74%), Gaps = 0/62 (0%)
 Strand=Plus/Plus

Query  335    TCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGATCAAGA  394
              |||||||||||   |||||||||   || || ||  | ||| | ||| | |||| |||||
Sbjct  42695  TCAAGGGCGAGAAGAAGACGTTCTCGCCAGAAGAAGTGTCGGCGATGATCCTGACCAAGA  42754

Query  395    TG  396
              ||
Sbjct  42755  TG  42756

>PYVX:scaffold_271 pve_scaffold_271 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_271:1:32374:1 
REF
Length=32374

 Score = 506 bits (560),  Expect = 1e-140
 Identities = 833/1185 (70%), Gaps = 50/1185 (4%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              ||||||| ||| | || || || ||  ||||   |||||||||||||||||| |||||||
Sbjct  15983  AGGACGCTGGCTCGATCGCGGGTCTTGACGTCAAGCGTATCATCAACGAGCCCACGGCCG  16042

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGC------------GAGCGCAACGTGC  508
              ||||  |||||||||| ||||||| ||| | ||||            | | |||||||||
Sbjct  16043  CCGCTCTCGCGTACGGTCTGGACACGAACGCCGGCTCGGACGGCAAGGCGTGCAACGTGC  16102

Query  509    TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
              | |||||||||||||| ||||| ||||||||||||||  ||||||| || ||| | ||||
Sbjct  16103  TCATCTTCGACCTGGGTGGCGGTACCTTCGATGTGTCGATCCTGTCGATCGAGAACGGCA  16162

Query  569    TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
              |||||||||| |||||||| | ||||||||| ||||| ||||||||||||||||||||| 
Sbjct  16163  TCTTCGAGGTGAAGGCCACGGGTGGTGACACCCACCTTGGTGGTGAGGACTTCGACAACA  16222

Query  629    GCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCA---AGGACATCACGG  685
               | |||| || ||| |   |  |||||||||||||||| ||||||    ||||  | |  
Sbjct  16223  ACATGGTCGAGCACCTGCTGACGGAGTTCAAGCGCAAGAACCGCAGCCTGGACCCCTC-C  16281

Query  686    AGAAC-CAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTG  744
              ||  |    |||||| | || |||||||| |||||||| |||   |||||||| | ||| 
Sbjct  16282  AGCTCGGCTCGTGCTATGCGCCGTCTGCGTACGGCCTGTGAGTCGGCCAAGCGCATGCTT  16341

Query  745    TCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAAC  804
              ||| || || |    || |   ||||| ||||||| || ||||| ||| | ||||||   
Sbjct  16342  TCGACGACGACGAGCGCCTCGGTCGAGGTTGACTCGCTCTTCGAGGGCGTTGACTTCTCT  16401

Query  805    TCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGA-CTACTTCCGCAAGACGAT  863
              |||||  | || |||||    ||||||    ||  ||  || ||  |   ||    ||| 
Sbjct  16402  TCGACGGTGACGCGTGCCAAGTTCGAGTCGCTGAACGAGGAGCTGTTCAAGCGCTGCGA-  16460

Query  864    GGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGT  923
              |||| | ||    |||||||||   ||||||||  ||  |  |    | |||   ||| |
Sbjct  16461  GGAGACTGTCCTCAAGGTGCTGTCGGACGCCAACATGAAGCCGGAGGACGTGACGGAGCT  16520

Query  924    GGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACT-TCT  982
              |||||| || || |||||||||||||||||||||||||||    ||||||| |||| | |
Sbjct  16521  GGTGCTTGTCGGTGGCTCGACGCGTATCCCGAAGGTGCAGACCATGCTGTC-GACTCTGT  16579

Query  983    TCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGA  1042
              ||   |||||||| |    |||||| |||||||| ||||||||||| || ||||||||  
Sbjct  16580  TCGGTGGCAAGGAACTGTCCAAGTCGATCAACCCCGACGAGGCTGTCGCCTACGGTGCTG  16639

Query  1043   CCGTGCAGGCGGCCATCCTG------AGCGGCAACGACTCGTCGGAGAAGCTGCAGGACC  1096
              |||||||||  || || |||      | | |||||||| |    ||  | ||       |
Sbjct  16640  CCGTGCAGGGTGCGATTCTGTCGGGCATCCGCAACGACGC----GACCAACT-----CGC  16690

Query  1097   TGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGA  1156
              |||| ||| |||| ||||| |||||||| || ||| | ||||||| |||    |||||| 
Sbjct  16691  TGCTGCTGGTGGATGTGACCCCGCTGTCGCTCGGTATTGAGACGGTCGGCAAGGTCATGT  16750

Query  1157   CGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGT  1216
              ||  ||| |||  ||| |||||| |  | |||      ||| |||    || | ||||| 
Sbjct  16751  CGGTGCTCATCAAGCGCAACACGGCCATTCCGGTGCGCAAGACGCGTGTGTACACGACGG  16810

Query  1217   ACGCCGACAACCAG-CCTGGGGTG-CTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGAC  1274
              | |  ||| ||||| | | || || |   | ||  | | |||||||||||||  | || |
Sbjct  16811  AGGAGGACTACCAGACGTCGGTTGACGTGTGCA--TCTACGAGGGCGAGCGC-GCGTG-C  16866

Query  1275   GCGCGAC---AACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCC--T  1329
              | | |||   ||||||  ||| ||| |||||||| |    |||||    | |  |||   
Sbjct  16867  GTG-GACTCGAACAACAAGCTCGGCGAGTTCAACATCTCGGGCATTGAGCGC--GCCAAG  16923

Query  1330   CGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTG  1389
              || || | ||||||| |||| ||||||||||| ||||| || ||||| ||||||||||||
Sbjct  16924  CGTGGCGAGCCGCAGGTCGAGGTGACGTTCGAGATCGATGCCAACGGTATCCTGAACGTG  16983

Query  1390   TCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGC  1449
              |||||    || |||   |||||         | |||  |||||| ||||| ||   |||
Sbjct  16984  TCGGCCCGCGACAAGAAGACGGGTGCCCGCGCCGAGACGACGATCTCGAACAACCGCGGC  17043

Query  1450   CGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAG  1509
              || ||  | ||||  |||||||||||||||||   |||||| ||||||| ||||  ||| 
Sbjct  17044  CGTCTGACCCAGGAGGACATTGACCGCATGGTGCAGGAGGCTGAGAAGTTCAAGAAGGAC  17103

Query  1510   GACGAGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAG  1554
              ||||  |  |    ||  ||||||||||||   ||||  ||||||
Sbjct  17104  GACGCCGAGATGCTGCGCCGCATCGAGGCCCGCAACGACCTGGAG  17148

 Score = 238 bits (263),  Expect = 8e-60
 Identities = 268/359 (75%), Gaps = 0/359 (0%)
 Strand=Plus/Plus

Query  32     TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
              ||||||| ||||||||||| || |||||||||||||| || ||| || ||| ||  ||||
Sbjct  15524  TCGGCATTGACCTCGGCACGACGTACTCGTGCGTGGGTGTCTGGAAGGACGGCCAGGTGG  15583

Query  92     AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
              | ||||||||||||  | |||| ||||| || || ||||| |  ||||||||||  ||  
Sbjct  15584  AGATCATCGCCAACAGCGAGGGTAACCGTACGACGCCGTCGTGGGTCGCCTTCAACGAGA  15643

Query  152    CGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGG  211
                || || || |||||||| ||||||||||  ||||  |||  ||||||   ||||||||
Sbjct  15644  GCGAGCGTCTGATCGGTGAGGCCGCCAAGATCCAGGCCGCCTCGAACGCCACCAACACGG  15703

Query  212    TGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACA  271
              ||||||||||||| ||| | ||||||||||| |||   |||   |||||  ||   ||| 
Sbjct  15704  TGTTCGACGCCAAGCGTATCATCGGCCGCAACTTCAGCGACGAGGTCGTGAAGAAGGACG  15763

Query  272    TCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGC  331
               || |||||  |||||| |  |   |  ||| | ||   |||||  || ||||  |||  
Sbjct  15764  CCACGCACTTCCCGTTCAAGATCGTGGAGGGTGACGACAACAAGGTGCTGATCGAGGTTG  15823

Query  332    AGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGATC  390
              |||||||||||||| | |||   |||   || |||||||||||||| ||||||||| ||
Sbjct  15824  AGTTCAAGGGCGAGGCTAAGCGCTTCACGCCGGAGGAGATCTCGTCGATGGTGCTGCTC  15882

>PHRA:scaffold_29
Length=529199

 Score = 496 bits (549),  Expect = 2e-137
 Identities = 830/1186 (70%), Gaps = 52/1186 (4%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||  | || || |||||  ||||   |||||||||||||||||| |||||||
Sbjct  523794  AGGACGCCGGTTCGATCGCTGGCCTGGACGTCAAGCGTATCATCAACGAGCCCACGGCCG  523735

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGC---GA-------GC--GCAACGTGC  508
               | ||| |||||||||||||||||| ||| | ||||   ||       ||  |||||||||
Sbjct  523734  CTGCCCTCGCGTACGGCCTGGACACGAACGCCGGCACGGACGGCACGGCCTGCAACGTGC  523675

Query  509     TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
               | |||||||||||||| ||||| ||||||||||||||  ||||||| || ||| | ||||
Sbjct  523674  TCATCTTCGACCTGGGTGGCGGTACCTTCGATGTGTCGATCCTGTCGATCGAGAACGGCA  523615

Query  569     TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
               |||||||||||||| |||| |  ||||||||||||||||| |||||||||||||||||| 
Sbjct  523614  TCTTCGAGGTCAAGTCCACGGGCGGTGACACGCACCTGGGCGGTGAGGACTTCGACAACA  523555

Query  629     GCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAA---GGA------CA  679
                | ||||||| ||| |   |  |||||||||||||||| |||||||   |||      ||
Sbjct  523554  ACATGGTGGAACACCTGCTGACGGAGTTCAAGCGCAAGAACCGCAACCTGGACCCGTCCA  523495

Query  680     TCACGGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTA  739
                | |||    ||  |||||| | ||||||||||| |||||||| |||   |||||||| |
Sbjct  523494  GCTCGG----CC--CGTGCTATGCGTCGTCTGCGTACGGCCTGTGAGTCGGCCAAGCGCA  523441

Query  740     CGCTGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACT  799
                ||| ||| |  || |    || |   | ||| | ||||| || ||||| ||| ||||||
Sbjct  523440  TGCTTTCGACCACGACGTCCGCGTCGGTGGAGGTGGACTCGCTCTTCGAGGGCGTCGACT  523381

Query  800     TCAACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGA  859
               ||   || ||  | || |||||    ||||||     |  |  |||  |  |   |||| 
Sbjct  523380  TCTCGTCCACGGTGACCCGTGCCAAGTTCGAG---TCGCTCAACGAGGAGCTGTTCAAG-  523325

Query  860     CGAT----GGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTG  915
               || |    |||  |||||  |||||| ||    ||||||||| ||  |  |    | |||
Sbjct  523324  CGTTGTGAGGATACCGTGCTGAAGGTCCTCGAGGACGCCAAGATGAAGCCGGAGGACGTG  523265

Query  916     CACGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCG  975
                  ||| |||||||||| |||||||| ||||||||||| |||||||||    ||||||||
Sbjct  523264  ACGGAGCTGGTGCTGGTCGGCGGCTCCACGCGTATCCCCAAGGTGCAGACCATGCTGTCG  523205

Query  976     GACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTAC  1035
                   | |||  |||||||||||    |||||||||||||||||||||||| || || |||
Sbjct  523204  TCTCTGTTCGGCGGCAAGGAGCTGTCCAAGTCCATCAACCCGGACGAGGCCGTCGCCTAC  523145

Query  1036    GGTGCGACCGTGCAGGCGGCCATCCTGAGCGGCA-ACGACTCGTCGGAGAAGCTGCAGGA  1094
               || ||  |||||||||  |||||||||  |||||  ||   || ||    | |  |  | 
Sbjct  523144  GGCGCCGCCGTGCAGGGCGCCATCCTGGACGGCATCCGCAACGACG--CCACCAACTCG-  523088

Query  1095    CCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCAT  1154
                ||||| ||| |||| ||||| || ||||| || ||| |||||||||  ||    |||||
Sbjct  523087  -CTGCTGCTGGTGGATGTGACCCCTCTGTCGCTCGGTATCGAGACGGTGGGCAAGGTCAT  523029

Query  1155    GACGACGCTGATCGCGCGGAACACGACGGTGCC---GACCAAGAAGTCGCAGACGTTCTC  1211
               | ||  ||| |||  ||| |||||| |  | ||   |  |||||   | |    || | |
Sbjct  523028  GTCGGTGCTCATCAAGCGCAACACGGCTATCCCCGTGCGCAAGA---CCCGCGTGTACAC  522972

Query  1212    GACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCAT  1271
                ||| | |  ||  ||||| |    |||  | |     | | |||||||||||| | | |
Sbjct  522971  CACGGAGGAGGATTACCAGACGTCCGTGGACGTGTGCATCTACGAGGGCGAGCG-TGCCT  522913

Query  1272    GACGCGCG-ACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCC--  1328
               |   || |  |||||||  ||||||| |||||||| |   |||| |    | |  |||  
Sbjct  522912  GCGTCGAGTCCAACAACAAGCTGGGCGAGTTCAACATCTCCGGCCTGGAGCGC--GCCAA  522855

Query  1329    TCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGT  1388
                || || | ||||||| | || || |||||||| || ||||||||||| |||||||||||
Sbjct  522854  GCGTGGCGAGCCGCAGGTGGAGGTCACGTTCGAGATTGACGCGAACGGAATCCTGAACGT  522795

Query  1389    GTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGG  1448
               ||| ||    || |||   || |||    ||  | ||| ||| ||| ||||| ||   ||
Sbjct  522794  GTCTGCCCGCGACAAGAAGACTGGCGCCAAGGCCGAGACCACCATCTCGAACAACCGCGG  522735

Query  1449    CCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGA  1508
               ||| ||    ||||  ||||| |||||||||||  | |||||||| |||| ||||  |||
Sbjct  522734  CCGTCTGAGTCAGGAGGACATCGACCGCATGGTTGCCGAGGCCGACAAGTTCAAGAAGGA  522675

Query  1509    GGACGAGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAG  1554
                ||||  |  |    ||  ||||| ||||||   ||||  ||||||
Sbjct  522674  CGACGCCGAGATGCTGCGCCGCATTGAGGCCCGTAACGACCTGGAG  522629

 Score = 242 bits (267),  Expect = 6e-61
 Identities = 267/356 (75%), Gaps = 0/356 (0%)
 Strand=Plus/Minus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               ||||||| ||||| ||||| || ||||||||||||||||||||| || ||| ||  ||||
Sbjct  524253  TCGGCATTGACCTGGGCACGACGTACTCGTGCGTGGGCGTGTGGAAGGACGGCCAGGTGG  524194

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               | ||||||||||||  | ||||||||||||| ||||| || |  ||||| ||||  ||  
Sbjct  524193  AGATCATCGCCAACAGCGAGGGCAACCGCACGACCCCCTCGTGGGTCGCTTTCAACGAGA  524134

Query  152     CGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGG  211
                 || || ||||||||||| ||||||||||  ||||  |||   |||||   ||||||||
Sbjct  524133  GCGAGCGTCTCATCGGTGAGGCCGCCAAGATCCAGGCCGCCGGTAACGCCACCAACACGG  524074

Query  212     TGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACA  271
               ||||||||||||| ||| | ||||||||||  |||   |||   || ||  ||   ||| 
Sbjct  524073  TGTTCGACGCCAAGCGTATCATCGGCCGCAGCTTCAGCGACGAGGTGGTGAAGAAGGACG  524014

Query  272     TCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGC  331
                ||||||||  || |||    | | |  ||| | ||  ||||||   | ||||  |||| 
Sbjct  524013  CCAAGCACTTCCCCTTCACGATCAAGGAGGGTGACGACGACAAGGTCCTGATCGAGGTGG  523954

Query  332     AGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTG  387
               |||||||||| ||    ||||  |||   |||||||||||||||||||||||||||
Sbjct  523953  AGTTCAAGGGTGACAAGAAGAGCTTCACCCCCGAGGAGATCTCGTCCATGGTGCTG  523898

 Score = 73.4 bits (80),  Expect = 2e-10
 Identities = 63/77 (82%), Gaps = 1/77 (1%)
 Strand=Plus/Plus

Query  316     CCGCAGATCACGGTGCAGTTCAAGG-GCGAGTCCAAGACGTTCCAACCCGAGGAGATCTC  374
               ||||| |||||||||||||  ||||   ||| ||||| |||||||  ||||||| || ||
Sbjct  439170  CCGCAAATCACGGTGCAGTGTAAGGATGGAGACCAAGTCGTTCCATACCGAGGAAATATC  439229

Query  375     GTCCATGGTGCTGATCA  391
               || ||||||| ||||||
Sbjct  439230  GTTCATGGTGTTGATCA  439246

 Score = 49.1 bits (53),  Expect = 0.008
 Identities = 40/49 (82%), Gaps = 0/49 (0%)
 Strand=Plus/Plus

Query  429     CGTGCTGCGTATCATCAACGAGCCGACGGCCGCCGCCATCGCGTACGGC  477
               ||| ||||||| | ||||||||||| ||||||||   |||| ||| |||
Sbjct  439320  CGTACTGCGTACCTTCAACGAGCCGGCGGCCGCCATAATCGTGTATGGC  439368

 Score = 43.7 bits (47),  Expect = 0.32
 Identities = 31/36 (86%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  253     CCCGTCGTCCAGGCCGACATCAAGCACTGGCCGTTC  288
               ||||| || |||||||||||| ||||||| || |||
Sbjct  439132  CCCGTGGTGCAGGCCGACATCGAGCACTGTCCATTC  439167

>PHIF:NW_003303690.1 Phytophthora infestans T30-4 supercont1.69 
genomic scaffold, whole genome shotgun sequence
Length=660613

 Score = 489 bits (541),  Expect = 3e-135
 Identities = 428/533 (80%), Gaps = 0/533 (0%)
 Strand=Plus/Plus

Query  415     ATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCCGCCATCGCGTAC  474
               ||||| ||  | |||||||||||||||||  | ||||||||||| || || ||||| || 
Sbjct  305972  ATTGCTGGTTTGAACGTGCTGCGTATCATTGATGAGCCGACGGCTGCTGCGATCGCCTAT  306031

Query  475     GGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTGGGCGGCGGCACC  534
               || || |||||||| |  ||||||| |||||||||||||||||| || || |||||||| 
Sbjct  306032  GGGCTCGACAAGAAAGTAGGCGAGCACAACGTGCTGATCTTCGATCTCGGAGGCGGCACG  306091

Query  535     TTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAGGCCACTGCTGGT  594
               ||||| || || || ||  | ||||| || || ||||||||||||||||| || || |||
Sbjct  306092  TTCGACGTCTCACTGCTAACTATTGAAGACGGGATCTTCGAGGTCAAGGCGACGGCGGGT  306151

Query  595     GACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCACTTCACGCAGGAG  654
               |||||| || |||| |||||||||||||||||||| ||||| ||   ||||  |   |||
Sbjct  306152  GACACGAACTTGGGCGGTGAGGACTTCGACAACCGTCTGGTCGAGTTCTTCGTGACCGAG  306211

Query  655     TTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTTCGTCGTCTGCGG  714
                |||| || |||||||||||||| || |||  || |||||| ||||| |||||||| || 
Sbjct  306212  CTCAAACGTAAGCACCGCAAGGATATGACGTCGAGCCAGCGAGCTCTGCGTCGTCTTCGT  306271

Query  715     ACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCTTACATCGAGATT  774
               ||||| ||||| || |||||||| ||||||||  | ||||| ||||| ||||||||||| 
Sbjct  306272  ACGGCGTGCGAACGCGCCAAGCGGACGCTGTCCACTTCGGCGCAGGCGTACATCGAGATC  306331

Query  775     GACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTGCTCGTTTCGAGGAC  834
               ||||| ||||| |||||| | |||||||||||||||||||| || || || ||||| |||
Sbjct  306332  GACTCGCTGTTTGACGGCGTGGACTTCAACTCGACCATCACGCGCGCGCGGTTCGAAGAC  306391

Query  835     ATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCC  894
                ||||| |||| || ||||||||||| ||||| || || | | ||||  | || ||| | 
Sbjct  306392  TTGTGCAGCGATTATTTCCGCAAGACCATGGATCCTGTTGCGCAGGTTTTACGAGACTCT  306451

Query  895     AAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCTCGACGCG  947
               || ||||| |||| |||||||  |||| | || ||||| || |||||||||||
Sbjct  306452  AAACTGTCCAAGAACCAGGTGAGCGAGATCGTCCTGGTCGGAGGCTCGACGCG  306504

>PYAR:scaffold_1129 par_scaffold_1129 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1129:1:10213:1 
REF
Length=10213

 Score = 483 bits (535),  Expect = 1e-133
 Identities = 831/1190 (70%), Gaps = 60/1190 (5%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||||||||| ||||||||||| ||| ||||   |||||||||||||||||| |||||||
Sbjct  8995   AGGACGCCGGTGCCATTGCCGGTCTCGACGTCAAGCGTATCATCAACGAGCCCACGGCCG  9054

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGG-----CGAGCGC-------AACGTGC  508
              | ||| |||||||||| || |||| ||| | |||     || ||||       |||||||
Sbjct  9055   CTGCCCTCGCGTACGGTCTCGACACGAACGCCGGTCAGTCGGGCGCTGGTGTCAACGTGC  9114

Query  509    TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
              | || |||||| ||||||| || ||||||||||||||  ||||   ||||||| | ||||
Sbjct  9115   TCATTTTCGACTTGGGCGGTGGTACCTTCGATGTGTCGATCCTCAGCATTGAGAACGGCA  9174

Query  569    TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
              |||| ||||||||| | || |  |||||||||||| |||||||||| |||||||||    
Sbjct  9175   TCTTTGAGGTCAAGTCGACGGGCGGTGACACGCACTTGGGTGGTGAAGACTTCGACTCGA  9234

Query  629    GCCTGGTGGAC---CACTTCACGCAGGAGTTCAAGCGCAAGCACC---GCAAGGACATCA  682
               ||| || |||   | | |||||   ||||||||||||||| ||    ||   |||  ||
Sbjct  9235   ACCTCGTCGACTTCCTCGTCACG---GAGTTCAAGCGCAAGAACAAGGGCCTCGACCCCA  9291

Query  683    CGGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGC  742
              |||        |||||  | || ||||| || |||||||| |||   |||||||| | ||
Sbjct  9292   CGGGCTCGGCCCGTGCCATGCGCCGTCTCCGCACGGCCTGTGAGTCGGCCAAGCGCATGC  9351

Query  743    TGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCA  802
              ||||| |  || |   |||   | ||||  | ||||| || || || ||  |||||||| 
Sbjct  9352   TGTCGACCACGACGTCGGCGGCCGTCGAAGTCGACTCGCTCTTTGAAGGTGTCGACTTCT  9411

Query  803    ACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCC-GCAAGACG  861
                |||||  |||| |||||     |||||    |   ||  |||  ||||  ||    ||
Sbjct  9412   CGTCGACGCTCACGCGTGCCAAGCTCGAGTCGCTCAACGAAGACCTCTTCAAGCGTTGCG  9471

Query  862    ATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTG----CA  917
              | |||| | ||  ||||||||||    || |||||| ||      |||| | ||    ||
Sbjct  9472   A-GGAGACGGTCCAGAAGGTGCTTGCTGATGCCAAGATGA-----AGCCCGATGATATCA  9525

Query  918    C-GAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGG  976
              | || || ||||| || || || ||||| |||||||| ||||| |||  ||| |||||||
Sbjct  9526   CCGAAGTTGTGCTTGTCGGTGGTTCGACCCGTATCCCCAAGGTTCAGTCGCTTCTGTCGG  9585

Query  977    ACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACG  1036
                 |||||  ||||||||| |    |||||| |||||||| || ||||| || |||||||
Sbjct  9586   CGCTCTTCGGCGGCAAGGAACTGTCCAAGTCGATCAACCCCGATGAGGCCGTCGCGTACG  9645

Query  1037   GTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACC  1096
              ||||| |||||||||  |||||||| ||||||| |    |||    || ||  || || |
Sbjct  9646   GTGCGGCCGTGCAGGGCGCCATCCTCAGCGGCATC----CGT-AACGACGC--CACGAAC  9698

Query  1097   T-GCTTCTGC---TGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTC  1152
              | ||| ||||   | || || ||||||||||| || ||| ||||||||| |||    |||
Sbjct  9699   TCGCTGCTGCTCGTTGATGTCACGCCGCTGTCGCTCGGTATCGAGACGGTCGGCAAGGTC  9758

Query  1153   ATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCG  1212
              ||| ||  |||||||  ||| |||||| |  | |||  |   ||| |||    || | ||
Sbjct  9759   ATGTCGGTGCTGATCAAGCGCAACACGGCTATCCCGGTCCGCAAGACGCGTGTGTACACG  9818

Query  1213   ACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTC-CAT  1271
              ||| | |  ||| ||||| |   |||   | ||    | | ||||||||||||  | || 
Sbjct  9819   ACGGAGGAGGACTACCAGACGTCGGTCGACGTCTGCATCTACGAGGGCGAGCGTGCTCAC  9878

Query  1272   GACG-CGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCAT---CCCTCCCATGC  1327
              | || | ||  ||||||  ||| ||| |||||||| |    |||||    | | | | | 
Sbjct  9879   GTCGACTCG--AACAACAAGCTCGGCGAGTTCAACATTTCGGGCATTGAGCGTGCTAAG-  9935

Query  1328   CTCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACG  1387
                || || | ||||||| |||| || |||||||| || || || ||||| ||||| ||||
Sbjct  9936   --CGTGGCGAGCCGCAGGTCGAAGTCACGTTCGAGATTGATGCCAACGGTATCCTCAACG  9993

Query  1388   TGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGG  1447
              |||||||    || |||   |||||   |     | ||| ||| ||| ||||| ||   |
Sbjct  9994   TGTCGGCCCGCGACAAGAAGACGGGTGCGCGTGCCGAGACCACCATCTCGAACAACCGTG  10053

Query  1448   GCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGG  1507
              |||| ||| | ||||  ||||||||||||||||| ||||| |||||||||| |||   | 
Sbjct  10054  GCCGTCTCACCCAGGAAGACATTGACCGCATGGTGTCGGATGCCGAGAAGTTCAA---GA  10110

Query  1508   AGGACGAGGCTAACAAGCAACGC---ATCGAGGCCAAGAACGCGCTGGAG  1554
              ||||||| ||| |   ||  |||   || ||||||   |||| ||| |||
Sbjct  10111  AGGACGATGCTGAGCTGCTCCGCAAGATTGAGGCCCGCAACGAGCTCGAG  10160

 Score = 129 bits (142),  Expect = 3e-27
 Identities = 143/191 (75%), Gaps = 0/191 (0%)
 Strand=Plus/Plus

Query  34    GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
             || ||||| ||||| || || |||||||| || || || ||| || ||| ||  || || 
Sbjct  8541  GGTATCGATCTCGGTACGACGTACTCGTGTGTCGGTGTCTGGAAGGACGGCCAGGTCGAG  8600

Query  94    ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
             ||||| ||||||  | | || |||||||| || ||||| |  || || ||||  |||  |
Sbjct  8601  ATCATTGCCAACAGCGAAGGTAACCGCACGACGCCGTCGTGGGTTGCGTTCAACGACCAG  8660

Query  154   GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGGTG  213
             || || ||||||||||| ||||||||||  ||||  ||    ||| ||  ||||||||| 
Sbjct  8661  GAGCGTCTCATCGGTGAGGCCGCCAAGATCCAGGCCGCGTCCAACCCGACCAACACGGTC  8720

Query  214   TTCGACGCCAA  224
             |||||||||||
Sbjct  8721  TTCGACGCCAA  8731

>PHKE:scaffold_155 scf_22126_155.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_155.1:1:75875:1 
REF
Length=75875

 Score = 482 bits (534),  Expect = 1e-133
 Identities = 795/1133 (70%), Gaps = 28/1133 (2%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              ||||||||||  |||||||||| ||  |||||  |||||||||||||||||| || || |
Sbjct  74287  AGGACGCCGGTTCCATTGCCGGTCTGGACGTGAAGCGTATCATCAACGAGCCCACCGCTG  74346

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAA---------GGGCGGCGAGC---GCAACGTGC  508
              ||||  | || || |||||||||| |||         || |||| ||    |||||||||
Sbjct  74347  CCGCTCTGGCTTATGGCCTGGACACGAACGCTGGCACGGACGGCAAGGCTTGCAACGTGC  74406

Query  509    TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
              |||||||||||||||| ||||| ||||||||||||||  ||||||| || ||| | ||||
Sbjct  74407  TGATCTTCGACCTGGGTGGCGGTACCTTCGATGTGTCGATCCTGTCGATCGAGAACGGCA  74466

Query  569    TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
              |||||||||||||| |||| | |||||||||||||||||||||||||||||| |||||| 
Sbjct  74467  TCTTCGAGGTCAAGTCCACGGGTGGTGACACGCACCTGGGTGGTGAGGACTTTGACAACA  74526

Query  629    GCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAA---GGACATCACGG  685
               | ||||||| ||| |   |  |||||||||||||||| |||||||   ||||  |    
Sbjct  74527  ACATGGTGGAGCACCTGCTGACGGAGTTCAAGCGCAAGAACCGCAACCTGGAC-CCGTCC  74585

Query  686    AGAAC-CAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTG  744
              ||  | |  |||||  | ||||||||||| |||||||| |||   |||||||||| ||| 
Sbjct  74586  AGCTCGCCCCGTGCCATGCGTCGTCTGCGTACGGCCTGTGAGTCGGCCAAGCGTATGCTA  74645

Query  745    TCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAAC  804
              ||  |  || ||   ||||   | ||| ||||||| |||||||| ||| | ||||||   
Sbjct  74646  TCAACCACGACTTCCGCTTCGGTGGAGGTTGACTCCCTGTTCGAGGGCGTGGACTTCTCG  74705

Query  805    TCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGA-CTACTTCCGCAAGACGAT  863
               | ||| | || |||||    ||||||    |   ||  || ||  |   ||    ||| 
Sbjct  74706  GCCACCGTGACCCGTGCCAAGTTCGAGTCGCTCAACGAGGAGCTGTTCAAGCGTTGCGA-  74764

Query  864    GGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCG-AAGAGCCAGGTGCACGAGG  922
              |||| |||||   ||||| ||    ||||| ||| ||  |   |||  | |||   ||| 
Sbjct  74765  GGAGACCGTGACCAAGGTCCTCGAGGACGCTAAGATGAAGCCTGAG-GATGTGACGGAGC  74823

Query  923    TGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCT  982
              |||||||||| ||||| || || |||||||| |||||||||    |||| |||    | |
Sbjct  74824  TGGTGCTGGTCGGCGGTTCCACACGTATCCCTAAGGTGCAGACCATGCTCTCGTCGCTGT  74883

Query  983    TCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGA  1042
              ||  |||||||||||    ||||||||| |||||||| |||||||| || ||||||||  
Sbjct  74884  TCGGCGGCAAGGAGCTGTCCAAGTCCATTAACCCGGATGAGGCTGTTGCCTACGGTGCTG  74943

Query  1043   CCGTGCAGGCGGCCATCCTGAGCGGCA-ACGACTCGTCGGAGAAGCTGCAGGACCTGCTT  1101
              |||||||||  || |||||   |||||  ||   || ||    | |  |  |  ||||| 
Sbjct  74944  CCGTGCAGGGTGCTATCCTTGACGGCATCCGTAACGACG--CCACCAACTCG--CTGCTG  74999

Query  1102   CTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACG  1161
              ||| |||| ||||| || |||||||||||| | ||||||| |||    || ||| ||  |
Sbjct  75000  CTGGTGGATGTGACCCCTCTGTCTCTGGGTATTGAGACGGTCGGCAAGGTTATGTCGGTG  75059

Query  1162   CTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCC  1221
              || |||  ||| |||||| |  | |||  |   ||| |||    || | | ||| | |  
Sbjct  75060  CTCATCAAGCGTAACACGGCCATCCCGGTCCGCAAGACGCGCGTGTACACCACGGAGGAG  75119

Query  1222   GACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGAC  1281
              ||| ||||| |    |||  | |     | | |||||||||||| | | ||   || | |
Sbjct  75120  GACTACCAGACGTCCGTGGACGTGTGCATCTACGAGGGCGAGCG-TGCCTGTGTCGAGTC  75178

Query  1282   -AACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCC  1340
               ||||||  | ||||  |||||||| |   |||| |    | |      || || | |||
Sbjct  75179  TAACAACAAGTTGGGAGAGTTCAACATCTCCGGCCTGGAGCGCGCTAAGCGTGGAGAGCC  75238

Query  1341   GCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGA  1400
              |||| | || ||||||||||| ||||| || || || ||||||||||| |||||    ||
Sbjct  75239  GCAGGTGGAGGTGACGTTCGAAATCGATGCCAATGGTATCCTGAACGTTTCGGCCCGCGA  75298

Query  1401   GAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCA  1460
               |||   || |||    ||  | ||| ||| ||| ||||| ||   ||||| ||    ||
Sbjct  75299  CAAGAAGACTGGCGCTAAGGCCGAGACCACCATCTCGAACAACCGTGGCCGTCTGAGTCA  75358

Query  1461   GGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACG  1513
              ||  |||||||||||||||||  | ||||| || |||| ||||  ||| ||||
Sbjct  75359  GGAGGACATTGACCGCATGGTTGCTGAGGCGGACAAGTTCAAGAAGGACGACG  75411

 Score = 198 bits (219),  Expect = 7e-48
 Identities = 258/357 (72%), Gaps = 0/357 (0%)
 Strand=Plus/Plus

Query  34     GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
              || || || || || || || ||||||||||||||||||||| || ||| ||  ||||| 
Sbjct  73830  GGTATTGATCTGGGTACGACGTACTCGTGCGTGGGCGTGTGGAAGGACGGCCAGGTGGAG  73889

Query  94     ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
              ||||| ||||||    | || ||||| ||||| ||||| |  || |||||||  |||   
Sbjct  73890  ATCATTGCCAACAGTGAAGGTAACCGTACCACTCCGTCGTGGGTTGCCTTCAACGACAGC  73949

Query  154    GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGGTG  213
              || || ||||| ||||| || |||||||  ||||  |||   |||||   ||||||||||
Sbjct  73950  GAGCGTCTCATTGGTGAGGCTGCCAAGATCCAGGCTGCCGGTAACGCCACCAACACGGTG  74009

Query  214    TTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACATC  273
              ||||||||||| ||| | || |||||||  |||||||||    | ||| ||   ||   |
Sbjct  74010  TTCGACGCCAAGCGTATCATTGGCCGCAGCTTCTCGGACGAGATGGTCAAGAAGGATGCC  74069

Query  274    AAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGCAG  333
              |||||||  || |||    | | |  |||||  | |||||||   | |||   |||  ||
Sbjct  74070  AAGCACTTCCCCTTCACGATTAAGGAGGGCGATGATGACAAGGTCCTGATTGAGGTCGAG  74129

Query  334    TTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGATC  390
              || |||  ||||   ||||  |||   ||||||||||||||||||||||||||| ||
Sbjct  74130  TTTAAGAACGAGAAGAAGAGCTTCACCCCCGAGGAGATCTCGTCCATGGTGCTGCTC  74186

>PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.22, whole genome shotgun 
sequence
Length=998868

 Score = 480 bits (531),  Expect = 1e-132
 Identities = 495/643 (77%), Gaps = 5/643 (1%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||| |  ||||| |  |||| |||||||||||||| ||||||| | ||||||| ||| 
Sbjct  905853  AGGACACTAGCGCCTTCACCGGGCTCAACGTGCTGCGAATCATCAGCAAGCCGACAGCCT  905794

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               || ||||||| | ||||||| |||||| ||||| |||||| |||| ||||||||||||| 
Sbjct  905793  CCACCATCGCATTCGGCCTGAACAAGATGGGCGACGAGCGGAACGAGCTGATCTTCGAC-  905735

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               |||||||||||| || |||  | ||  | |||  ||  |||||||||||||||  ||| |
Sbjct  905734  TGGGCGGCGGCATCTCCGACATTTCGATGCTGAACACCGAGGAGGGCATCTTCTTGGTAA  905675

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               |||| || || ||  |||| ||||| ||||| |||||||  || |||||||||||| |  
Sbjct  905674  AGGCGACGGCGGGCAACACACACCTAGGTGGAGAGGACTCTGATAACCGCCTGGTGAAGT  905615

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               ||||   |||||||||||||| | | |||| |||| || | ||| || ||||||| || |
Sbjct  905614  ACTTTGAGCAGGAGTTCAAGCCCCACCACCCCAAGAACCTGACGCAGTACCAGCGCGCGC  905555

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
               | || || | |   ||||  ||| | || |||||||| |  |||| |||||| || ||| 
Sbjct  905554  TGCGCCGACCGAACACGGTATGCTAACGCGCCAAGCGGAACCTGTTGTCGTCAGCGCAGA  905495

Query  761     CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
               | |||||| |||| ||||| |||||||||  |||||| |||||||||| || ||| |  |
Sbjct  905494  CGTACATCAAGATCGACTCGCTGTTCGACACCATCGAGTTCAACTCGATCAGCACGCACG  905435

Query  821     CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
               | || ||||||  | ||||| ||||| ||||||||| |||||  || ||||||| |||||
Sbjct  905434  CGCGCTTCGAGAGCCTGTGCAGCGACGACTTCCGCACGACGAATGACCCCGTGGGGAAGG  905375

Query  881     TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                 ||||| | |||  ||| | | ||||||||| |||||||||||||||||| ||||  ||
Sbjct  905374  ATCTGCGTGCCGCATAGCCGCCCAAGAGCCAGTTGCACGAGGTGGTGCTGGCGGGCACCT  905315

Query  941     CGA-CGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCC  999
               ||| | || ||||  ||  ||| ||||| |||| ||||  |||| ||||   || |||| 
Sbjct  905314  CGACCACGAATCCTCAA--TGCTGCAGCCGCTGACGGAGCTCTT-AACGCAGAGAAGCCG  905258

Query  1000    AACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGA  1042
                || | || | ||| || ||| |||||||||||| ||| ||||
Sbjct  905257  TACCACTCGAGCAATCCAGACTAGGCTGTGGCGTTCGGCGCGA  905215

 Score = 41.9 bits (45),  Expect = 1.1
 Identities = 39/50 (78%), Gaps = 0/50 (0%)
 Strand=Plus/Minus

Query  348     CAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGATCAAGATGC  397
               ||||||  || | || | | ||| ||||||||||   |||||||||||||
Sbjct  905991  CAAGACTCTCGAGCCTGTGAAGAACTCGTCCATGAGACTGATCAAGATGC  905942

>PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.4, whole genome shotgun 
sequence
Length=2787191

 Score = 478 bits (529),  Expect = 5e-132
 Identities = 544/728 (75%), Gaps = 23/728 (3%)
 Strand=Plus/Plus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                ||||| |  ||||| |  |||| |||||| ||||||| ||||||| | ||||||| ||| 
Sbjct  1986361  AGGACACTAGCGCCTTCACCGGGCTCAACATGCTGCGAATCATCAGCAAGCCGACAGCCT  1986420

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                || ||||||||| ||||||| |||||| ||||         |||| ||||||||||||| 
Sbjct  1986421  CCACCATCGCGTTCGGCCTGAACAAGATGGGC---------AACGAGCTGATCTTCGAC-  1986470

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                ||||| |||||| || |||  |||  || |||  ||  |||||||||||||||  ||| |
Sbjct  1986471  TGGGCAGCGGCATCTCCGACATGTTGCTGCTGAACAACGAGGAGGGCATCTTCTTGGTGA  1986530

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                |||| || || || |||| |||||| ||||| |||||||  || ||||||||||||||  
Sbjct  1986531  AGGCGACGGCGGGCGACAAGCACCTAGGTGGCGAGGACTCTGATAACCGCCTGGTGGAGT  1986590

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
                ||||   |||||||||||||| | | |||||||||||| | ||| || || |||| || |
Sbjct  1986591  ACTTTGAGCAGGAGTTCAAGCCCCACCACCGCAAGGACCTGACGTAGTACTAGCGCGCGC  1986650

Query  701      TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
                | || || | |   ||||  ||| | ||  ||||||| |  |||| |||||| || ||| 
Sbjct  1986651  TGCGCCGACCGAACACGGTATGCTAACGCACCAAGCGGAACCTGTTGTCGTCAGCGCAGA  1986710

Query  761      CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
                | |||||| |||| ||||| |||||||||| | ||||||||||||||| || ||| |  |
Sbjct  1986711  CGTACATCAAGATCGACTCGCTGTTCGACGCCGTCGACTTCAACTCGATCAGCACGCACG  1986770

Query  821      CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
                | || |||| | || ||||| ||||| ||||||||| ||||| | | ||||||| |||||
Sbjct  1986771  CGCGCTTCGGGAACCTGTGCAGCGACGACTTCCGCACGACGAAGAAACCCGTGGGGAAGG  1986830

Query  881      TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                  ||||| | | |  ||| ||| ||||||| | |||||||||||||||||| ||||  ||
Sbjct  1986831  ATCTGCGTGCCTCATAGCCGTCCAAGAGCC-GTTGCACGAGGTGGTGCTGGCGGGCACCT  1986889

Query  941      CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
                |||| || ||||  ||  ||| |||||||||| ||||  |||| |||| | || ||||  
Sbjct  1986890  CGACACGAATCCTCAA--TGCTGCAGCTGCTGACGGATCTCTT-AACGTCGAGAAGCCGT  1986946

Query  1001     ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATCC  1060
                |  | || | ||| || |||||||||||||| | ||| || |    |||||||  ||  |
Sbjct  1986947  ATCACTCGAGCAATCCAGACGAGGCTGTGGCATTCGGCGCAAAGAAGCAGGCGAGCACTC  1987006

Query  1061     TGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCGC  1120
                | |||| || | ||         || || | |||||||||| | ||| |||| |||  | 
Sbjct  1987007  TTAGCGACAGCAAC---------AACCTTCCGGACCTGCTTGTTCTGAACGTAACGATGT  1987057

Query  1121     TGTCTCTG  1128
                |||| |||
Sbjct  1987058  TGTCACTG  1987065

 Score = 472 bits (523),  Expect = 2e-130
 Identities = 830/1187 (70%), Gaps = 54/1187 (5%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||  |||| || |||||  ||||   |||||||||||||||||| |||||||
Sbjct  447160  AGGACGCCGGTTCCATCGCTGGCCTGGACGTCAAGCGTATCATCAACGAGCCCACGGCCG  447219

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGC---GA-------GC--GCAACGTGC  508
               | ||  | || ||||| ||||||| ||| | ||||   ||       ||  |||||||||
Sbjct  447220  CTGCTCTGGCCTACGGTCTGGACACGAACGCCGGCACGGATGGCAAGGCCTGCAACGTGC  447279

Query  509     TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
               |||||||||||||||| || || ||||||||||||||  ||||||| |||||| | ||||
Sbjct  447280  TGATCTTCGACCTGGGTGGAGGTACCTTCGATGTGTCGATCCTGTCTATTGAGAACGGCA  447339

Query  569     TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
               |||||||||||||| | || |  |||||||| ||| ||||||||||||||||||||||| 
Sbjct  447340  TCTTCGAGGTCAAGTCGACGGGCGGTGACACTCACTTGGGTGGTGAGGACTTCGACAACA  447399

Query  629     GCCTGGTGGACCA-CTTCACGCAGGAGTTCAAGCGCAAGCACCGCAA---GGACATCACG  684
                | ||||||| || || | | | |||||||||||| ||| |||||||   ||||    ||
Sbjct  447400  ACATGGTGGAGCACCTGCTCAC-GGAGTTCAAGCGTAAGAACCGCAACCTGGACCCGTCG  447458

Query  685     GAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTG  744
               |        |||||  | ||||||||||| |||||||| |||   |||||||||| ||||
Sbjct  447459  GGTTCGGCCCGTGCCATGCGTCGTCTGCGTACGGCCTGTGAGTCGGCCAAGCGTATGCTG  447518

Query  745     TCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAAC  804
               ||| |  |  |   ||| |   | ||| | ||||| ||||| || ||| ||||||||   
Sbjct  447519  TCGACCACCACGTCGGCATCGGTGGAGGTGGACTCGCTGTTTGAGGGCGTCGACTTCTCG  447578

Query  805     TCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGA-CTACTTCCGCAAGACGAT  863
               || ||  | || |||||    ||||||    |   ||  || ||  |   ||    ||| 
Sbjct  447579  TCCACTGTGACGCGTGCCAAGTTCGAGTCGCTCAACGAGGAGCTGTTCAAGCGTTGCGA-  447637

Query  864     GGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAG---GTGCACGA  920
               |||| | |||   ||||||||    ||||||||| |   ||||  | ||   |||   ||
Sbjct  447638  GGAGACTGTGCTCAAGGTGCTCGAGGACGCCAAGAT---GAAGCCCGAGGACGTGACGGA  447694

Query  921     GGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACT-  979
               | |||||||||| ||||| || ||||||||||| |||||||||    |||||||  ||| 
Sbjct  447695  GCTGGTGCTGGTCGGCGGTTCCACGCGTATCCCCAAGGTGCAGACCATGCTGTC-CACTC  447753

Query  980     TCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTG  1039
               | |||  ||| |||||||    ||||||||| |||||||||||||| || || |||||||
Sbjct  447754  TGTTCGGCGGTAAGGAGCTGTCCAAGTCCATTAACCCGGACGAGGCCGTTGCCTACGGTG  447813

Query  1040    CGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCT-G  1098
               |  | |||||||  || ||||||  ||| | |    |||    || ||  ||  | || |
Sbjct  447814  CCGCTGTGCAGGGCGCTATCCTGGACGGTATC----CGT-AACGACGC--CACCAACTCG  447866

Query  1099    CTTCTGCTG---GACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATG  1155
               || ||||||   ||||| || ||||||||||| ||| |||||||||  ||    ||||||
Sbjct  447867  CTGCTGCTGGTTGACGTCACCCCGCTGTCTCTCGGTATCGAGACGGTGGGCAAGGTCATG  447926

Query  1156    ACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACG  1215
                ||  |||||||  ||| |||||| |  | |||      ||| | |    || | | || 
Sbjct  447927  TCGGTGCTGATCAAGCGCAACACGGCCATCCCGGTGCGCAAGACCCGTGTGTACACTACC  447986

Query  1216    TACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACG  1275
                | |  ||| ||||| |    |||  | |     | | ||||||||||||| || ||   
Sbjct  447987  GAGGAGGACTACCAGACGTCCGTGGACGTGTGCATCTACGAGGGCGAGCGCGCC-TGCGT  448045

Query  1276    CGCGAC-AACAACCTGCTGGGCAAGTTCAAC----CTGGACGGCATCCCTCCCATGCCTC  1330
               || | | ||||||  ||| ||| ||||||||    |||| | | |  | | ||| |   |
Sbjct  448046  CGAGTCGAACAACAAGCTCGGCGAGTTCAACATCTCTGGTCTGGA-GCGTGCCAAG---C  448101

Query  1331    GCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGT  1390
               | || | ||| ||| | || ||||||||||| ||||| || ||||| |||||||||||||
Sbjct  448102  GTGGCGAGCCCCAGGTGGAGGTGACGTTCGAGATCGATGCTAACGGTATCCTGAACGTGT  448161

Query  1391    CGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCC  1450
               ||||    || |||   || |||    ||  | |||  || ||| ||||| ||   ||||
Sbjct  448162  CGGCCCGTGACAAGAAGACCGGCGCCAAGGCCGAGACGACCATCTCGAACAACCGTGGCC  448221

Query  1451    GCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGG  1510
               | ||    ||||  ||||| |||||||||||  | |||||||| |||| |||   | |||
Sbjct  448222  GTCTGAGCCAGGAGGACATCGACCGCATGGTGGCCGAGGCCGACAAGTTCAA---GAAGG  448278

Query  1511    ACGAGGCTAACA---AGCAACGCATCGAGGCCAAGAACGCGCTGGAG  1554
               |||| ||| | |    ||  ||||| ||||||   ||||  ||||||
Sbjct  448279  ACGACGCTGAGATGCTGCGTCGCATTGAGGCCCGCAACGACCTGGAG  448325

 Score = 222 bits (245),  Expect = 6e-55
 Identities = 262/355 (74%), Gaps = 0/355 (0%)
 Strand=Plus/Plus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               |||| ||||| || || || || ||||||||||||||||||||| || ||| ||  ||||
Sbjct  446701  TCGGTATCGATCTGGGTACGACGTACTCGTGCGTGGGCGTGTGGAAGGACGGCCAGGTGG  446760

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               | || || ||||||  | | || ||||| ||||| ||||| |  || |||||||  ||  
Sbjct  446761  AGATTATTGCCAACAGCGAAGGTAACCGTACCACTCCGTCGTGGGTTGCCTTCAACGAGA  446820

Query  152     CGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGG  211
                 || || || |||||||| || |||||||  ||||  |||   |||||   ||||||||
Sbjct  446821  GCGAGCGTCTGATCGGTGAGGCTGCCAAGATCCAGGCCGCCGGTAACGCCACCAACACGG  446880

Query  212     TGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACA  271
               ||||||||||||| ||| | || |||||||  |||   |||   || ||| ||   ||| 
Sbjct  446881  TGTTCGACGCCAAGCGTATCATTGGCCGCAGCTTCAGCGACGAGGTGGTCAAGAAGGACG  446940

Query  272     TCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGC  331
                || |||||  || ||| |  | | |  |||||  |  ||||||  || ||||  |||| 
Sbjct  446941  CCACGCACTTCCCCTTCAAGATCAAGGAGGGCGATGACGACAAGGTGCTGATCGAGGTGG  447000

Query  332     AGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
               ||||||||||||||  |||||  |||   ||||||||||||||||||||||||||
Sbjct  447001  AGTTCAAGGGCGAGAACAAGAGCTTCACGCCCGAGGAGATCTCGTCCATGGTGCT  447055

>APAS:scaffold_91 supercont1.91 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.91:1:302683:1 
REF
Length=302683

 Score = 475 bits (526),  Expect = 2e-131
 Identities = 567/771 (74%), Gaps = 54/771 (7%)
 Strand=Plus/Plus

Query  1002    CAAGTCCATCAACCCG--GACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGGCCATC  1059
               ||||||  |||||||   ||||| |||||||||| ||| ||||||||||| || || |||
Sbjct  300733  CAAGTCGGTCAACCCCCCGACGAAGCTGTGGCGTTCGGCGCGACCGTGCAAGCCGCGATC  300792

Query  1060    CTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACGTGACGCCG  1119
                ||   |||||||||   ||||| |   |||| ||| || |  | ||| |||||||||||
Sbjct  300793  TTGTCGGGCAACGACAGCTCGGACAGATTGCAAGACTTGTTGTTTCTGCACGTGACGCCG  300852

Query  1120    CTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGCGGAACACG  1179
                |||| || ||  | || || ||||| ||||| ||||         ||  ||| ||||||
Sbjct  300853  TTGTCGCTCGGGTT-GAAACAGCCGGCGGTGTGATGA---------TCCAGCGCAACACG  300902

Query  1180    ACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTG  1239
               |||||       ||||||||||||||||| ||||||      ||||||||||| || | |
Sbjct  300903  ACGGT-------AAGAAGTCGCAGACGTTTTCGACG------GACAACCAGCCGGGTGCG  300949

Query  1240    CTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGCTGGGCAAG  1299
                | ||||| || || || ||||||||||| |||||||||||||||||| || ||||||||
Sbjct  300950  TTGATCCAAGTATTTGAAGGCGAGCGCTCGATGACGCGCGACAACAACTTGTTGGGCAAG  301009

Query  1300    TTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTC  1359
               ||   | | ||||| ||||| |||||||  ||||| ||||||||| | ||||||||||||
Sbjct  301010  TTTTCCTTTGACGGGATCCCGCCCATGCACCGCGGCGTGCCGCAGGTGGACGTGACGTTC  301069

Query  1360    GACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAG  1419
               ||||| ||||||||||| ||| ||||||||||  |  | || ||||| ||||||||||  
Sbjct  301070  GACATTGACGCGAACGGGATCTTGAACGTGTCTACGATCGAAAAGTCGACGGGCAAGG--  301127

Query  1420    AACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGAC---ATTGACCGC  1476
                   |||| |||||||| |||| |||||| ||| |     |||  |||   ||||| |||
Sbjct  301128  ----AGATTACGATCACTAACGCCAAGGGTCGCTTGAGCAAGGACGACATTATTGAGCGC  301183

Query  1477    ATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAG--GCTAACAAGCAACGCATCG  1534
               |||||      |   ||  || | ||||||||||| |||  || ||||||   ||| |||
Sbjct  301184  ATGGT------GCAAGAAGAGGAAAAGTCGGAGGAAGAGAAGCCAACAAGTTGCGCGTCG  301237

Query  1535    AGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAGA  1594
               | || ||||||| |||||| |||||||| ||||  ||||| ||||  || || | |||||
Sbjct  301238  AAGCGAAGAACGGGCTGGAAAACTACGCGTACAACCTGCGCAACACGCTCAACGTCGAGA  301297

Query  1595    AGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAAG  1654
               || |  |||  ||| |    ||||| ||||||||||   |||| ||||||||||||||  
Sbjct  301298  AGCTCCAGGGCAAGTTGGACGAAGCGGACAAGAAGGTCATGGAGGACAAGGTGACGGAGA  301357

Query  1655    TGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAGA  1714
                |||| |||||||||||||||             |||||| | ||||||  | ||||| |
Sbjct  301358  CGATCAAGTGGCTGGACGCAA------------CGAAGGAGGAGTACGAAGCCAAGCAAA  301405

Query  1715    AGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTGCTG  1765
               ||||  | || ||||||||||||||  |  |||| ||| ||||||| ||||
Sbjct  301406  AGGAGCTCGAAGGCGTGGCCAACCCGATCATGCAAAAGCTGTACGCGGCTG  301456

>PHPA:scaffold_21 NW_008649007.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.21, whole genome shotgun 
sequence
Length=1058518

 Score = 472 bits (523),  Expect = 2e-130
 Identities = 491/642 (76%), Gaps = 14/642 (2%)
 Strand=Plus/Minus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              ||||| |  ||||| |  |||| |||||||||||||| ||||||| | ||||||| ||| 
Sbjct  11700  AGGACACTAGCGCCTTCACCGGGCTCAACGTGCTGCGAATCATCAGCAAGCCGACAGCCT  11641

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              || ||||||| | ||||||| |||||| ||||| ||||||||||| ||||||||||||| 
Sbjct  11640  CCACCATCGCATTCGGCCTGAACAAGATGGGCGACGAGCGCAACGAGCTGATCTTCGAC-  11582

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              |||||||||||| || |||| ||||  | |||  || |||| |||||||||||  ||| |
Sbjct  11581  TGGGCGGCGGCATCTCCGATATGTCGATGCTGAACACTGAGAAGGGCATCTTCTTGGTGA  11522

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
              |||| || || || ||||||||||| ||||| |||||||  || ||||||||||||||  
Sbjct  11521  AGGCGACGGCGGGGGACACGCACCTAGGTGGCGAGGACTCTGATAACCGCCTGGTGGAGT  11462

Query  641    ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
              |  |   |||||||||||||| | | ||||||||| || | ||| || ||||||| || |
Sbjct  11461  AAGTTGAGCAGGAGTTCAAGCCCCACCACCGCAAGAACCTGACGCAGTACCAGCGCGCGC  11402

Query  701    TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGG  760
              | || || | |   ||||  ||| | || |||||||  |  | || |||||| || ||| 
Sbjct  11401  TGCGCCGACCGAACACGGTATGCTAACGCGCCAAGCAGAACCGGTTGTCGTCAGCGCAGA  11342

Query  761    CTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCACTCGTG  820
              | |||||| |||| ||||| |||||||||  |||||| |||||||||| ||  || |  |
Sbjct  11341  CGTACATCAAGATCGACTCGCTGTTCGACACCATCGAGTTCAACTCGATCAGTACGCACG  11282

Query  821    CTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGGAGAAGG  880
                || |||||| || ||||| ||||| ||||||||| |||||  || ||||||| |||||
Sbjct  11281  TGCGCTTCGAGAACCTGTGCAGCGACGACTTCCGCACGACGAATGACCCCGTGGGGAAGG  11222

Query  881    TGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGGGCGGCT  940
                ||||| | | |  ||| | | ||||||||| |||||||||||||||          ||
Sbjct  11221  ATCTGCGTGCCTCATAGCCGCCCAAGAGCCAGTTGCACGAGGTGGTGC----------CT  11172

Query  941    CGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGGAGCCCA  1000
              |||| || ||||| ||  ||| ||||| |||| ||||  |||| |||| | || ||||  
Sbjct  11171  CGACACGAATCCCCAA--TGCTGCAGCCGCTGACGGAGCTCTT-AACGCCGAGAAGCCGT  11115

Query  1001   ACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGA  1042
              || | || | ||| || ||| |||||||||||| ||| ||||
Sbjct  11114  ACCACTCGAGCAATCCAGACTAGGCTGTGGCGTTCGGCGCGA  11073

 Score = 46.4 bits (50),  Expect = 0.026
 Identities = 28/30 (93%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  368    AGATCTCGTCCATGGTGCTGATCAAGATGC  397
              |||||||||||||| | |||||||||||||
Sbjct  11818  AGATCTCGTCCATGATACTGATCAAGATGC  11789

>APAS:scaffold_108 supercont1.108 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.108:1:129163:1 
REF
Length=129163

 Score = 472 bits (523),  Expect = 2e-130
 Identities = 919/1352 (68%), Gaps = 29/1352 (2%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||| |||||  ||||||| ||  | | |||||  |||||||||||||| || ||||| |
Sbjct  57888  AGGATGCCGGTACCATTGCTGGTTTGACCGTGCAACGTATCATCAACGAACCCACGGCTG  57947

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGC---GGCGAGCGCAACGTGCTGATCTTCG  517
              ||||||| ||||||||| | ||||| |||| |   |||||    |||||| || | ||||
Sbjct  57948  CCGCCATTGCGTACGGCATTGACAAAAAGGCCAAGGGCGAAAAGAACGTGTTGGTGTTCG  58007

Query  518    ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
              |  |||||||||| ||||| |||||| |  |  || |||| || |  ||  | || ||||
Sbjct  58008  ATTTGGGCGGCGGTACCTTTGATGTGACGTTGTTGACCATCGACGGTGGTGTGTTTGAGG  58067

Query  578    TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
              |   | | ||    |||||||||||| |||| ||||| || |||||  | ||| |  || 
Sbjct  58068  TGTTGTCGACCAACGGTGACACGCACTTGGGCGGTGAAGATTTCGATCAACGCATCATGC  58127

Query  638    ACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAG---GACATCACGGAGAACCAGC  694
              |   |||||   || |||    ||  |||||    |||   |||||  |     || |||
Sbjct  58128  AATTCTTCATCAAGAAGTG---GCAAAAGCAAAAGAAGATTGACATTTCCAGCGACAAGC  58184

Query  695    GTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGG  754
              | ||  | |     || ||    |    ||| |||| ||||||  || ||||| |   | 
Sbjct  58185  GCGCGTTGCAGAAGCTCCGCCGTGAAGCCGAACGTGTCAAGCGCGCGTTGTCGACCCAGC  58244

Query  755    CTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCA  814
              | || ||   | | || || || || || || ||||||   |||||| ||  |||  | |
Sbjct  58245  CCCAAGCGCGCCTTGAAATCGAATCGCTCTTGGACGGCGAAGACTTCGACGAGACGTTGA  58304

Query  815    CTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGG  874
              | ||||| |||||||| ||  ||  |  |||||  |||   |||||| ||   |||||||
Sbjct  58305  CCCGTGCGCGTTTCGAAGAATTGAACAACGACTTGTTCAAGAAGACGTTGAGCCCCGTGG  58364

Query  875    AGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGG  934
              | |||||| ||   || ||     ||  ||||| | | ||| ||||| | ||||| || |
Sbjct  58365  AAAAGGTGATGAAGGATGCTGGCTTGAAGAAGAACGAAGTGGACGAGATTGTGCTTGTCG  58424

Query  935    GCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGG  994
              |||| || ||||||||||| ||| | |||||  || |   ||||||||||||||||||||
Sbjct  58425  GCGGGTCCACGCGTATCCCCAAGATCCAGCAATTGATCAAGGACTTCTTCAACGGCAAGG  58484

Query  995    AGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCGG  1054
              | ||   |     ||||||||| ||||| ||||| |||||||||||| | || || |  |
Sbjct  58485  AACCTTCCCGCGGCATCAACCCCGACGAAGCTGTCGCGTACGGTGCGGCTGTCCAAGGTG  58544

Query  1055   CCATCCTGAGCGGC---AACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGGACG  1111
                ||  || ||||    |||||| |  ||  |      || ||| |  |  || ||||||
Sbjct  58545  GTATTTTGGGCGGTGAAAACGACGCCACGACG------CAAGACATTTTGTTGTTGGACG  58598

Query  1112   TGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCGC  1171
              || | ||| ||||  ||||  | || || | ||| ||||||||||| | | | |||   |
Sbjct  58599  TGGCCCCGTTGTCGTTGGGAATTGAAACCGTCGGCGGTGTCATGACCAAGATCATCAACC  58658

Query  1172   GGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAGC  1231
              | ||||||   || || || ||||||||||| |||||||||||||||   |||||||| |
Sbjct  58659  GCAACACGGTCGTCCCCACGAAGAAGTCGCAAACGTTCTCGACGTACCAAGACAACCAAC  58718

Query  1232   CTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTGC  1291
              | |  |||   ||||| |||| ||| ||||| ||| | |||||    |||||| || | |
Sbjct  58719  CGGCCGTGTCGATCCAAGTGTACGAAGGCGAACGCACGATGACCAAGGACAACCACATTC  58778

Query  1292   TGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGACG  1351
              | ||||||||| |  ||  ||| ||||| ||    |||||||| ||||| |||||||| |
Sbjct  58779  TCGGCAAGTTCGAATTGACCGGGATCCCGCCGGCTCCTCGCGGCGTGCCCCAGATCGAAG  58838

Query  1352   TGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACGG  1411
              ||||||| ||  | || || ||||| ||| || | |||||||| |  || |||   ||||
Sbjct  58839  TGACGTTTGAAGTGGATGCCAACGGTATCTTGCAAGTGTCGGCGGAAGACAAGGGCACGG  58898

Query  1412   GCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATTG  1471
              ||||||   | |||||||||||||||  ||| ||||||||| | || ||||  || ||||
Sbjct  58899  GCAAGGCCGAGAAGATCACGATCACGGCCGAAAAGGGCCGCTTGTCCCAGGAAGAGATTG  58958

Query  1472   ACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAGCAACGCA  1531
              ||||||||||    ||||||||| |  ||  |   || ||| ||   | |||| | ||||
Sbjct  58959  ACCGCATGGTGCAAGAGGCCGAGGAAAACGCGGAAGAAGACAAGAAGATCAAGGACCGCA  59018

Query  1532   TCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACA--GTCTGAATGA  1589
              |||| |     ||| |||||||    |||   ||||   ||  |||||  |||     ||
Sbjct  59019  TCGACGGACGCAACTCGCTGGAAGGGTACTTATACAACTTGAAGAACAACGTC-----GA  59073

Query  1590   CGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAG--AAGGCGGTGGACGACAAGGTG  1647
               || ||| ||  ||| |||||    ||||  ||||||   | || || || | |  ||||
Sbjct  59074  AGACAAGTTGGCGGACAAGATTGAAGAAGGCGACAAGGACACGCTGTTGAAGGC--GGTG  59131

Query  1648   ACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCG  1707
                 ||||  ||  | ||| |||||| |||||||     ||| ||||| |  | |||  ||
Sbjct  59132  CAAGAAGCCATGGACTGGTTGGACGAAAACCAGGAGGCGGACAAGGAGGACTTCGACGCG  59191

Query  1708   AAGCAGAAGGAATTGGAGGGCGTGGCCAACCC  1739
               |||| ||||   | |||   |||||||||||
Sbjct  59192  CAGCAAAAGGCCGTCGAGAAGGTGGCCAACCC  59223

 Score = 131 bits (144),  Expect = 8e-28
 Identities = 158/215 (73%), Gaps = 9/215 (4%)
 Strand=Plus/Plus

Query  32     TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
              |||| ||||| ||||| || ||||||||||||||||||   |    |  || |   ||||
Sbjct  57429  TCGGTATCGATCTCGGTACCACCTACTCGTGCGTGGGCCACTACTCGGGCGGCAAGGTGG  57488

Query  92     AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
              ||||||| ||||||||||| || ||||||| ||||||||| ||||| || |     ||||
Sbjct  57489  AAATCATTGCCAACGACCAAGGTAACCGCATCACCCCGTCGTACGTGGCGT---GGGACT  57545

Query  152    CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
              ||      || ||| | ||||||||||  |||||||| || |   | || ||| |  | |
Sbjct  57546  CGAACGACGAGCGCTTGATCGGTGACGGTGCCAAGAACCAAGCCACGATCAACCCCGAAA  57605

Query  206    ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
              ||||| |||||||||  || ||| ||||||| |||
Sbjct  57606  ACACGTTGTTCGACGTGAAGCGTTTGATCGGTCGC  57640

>HYAP:scaffold_5 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_5:1:1104709:1 
REF
Length=1104709

 Score = 464 bits (514),  Expect = 3e-128
 Identities = 913/1339 (68%), Gaps = 31/1339 (2%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||  ||||||| ||| | |  || | ||| ||||| || ||||| || || |
Sbjct  274487  AGGACGCCGGTACCATTGCTGGCTTGACAGTCCAGCGCATCATTAATGAGCCTACTGCGG  274546

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGG-GC--GGCGAGCGCAACGTGCTGATCTTCG  517
               |||| || || |||||| | |||||||||| ||  ||||||   ||||||||| | || |
Sbjct  274547  CCGCTATTGCCTACGGCATTGACAAGAAGGCGCAGGGCGAGAAGAACGTGCTGGTGTTTG  274606

Query  518     ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
               || |||||||||| ||||| || ||  | || ||| ||||||| |  ||| | || || |
Sbjct  274607  ACTTGGGCGGCGGGACCTTTGACGTAACGCTGCTGGCCATTGACGGTGGCGTGTTTGAAG  274666

Query  578     TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
               |   ||| ||   ||| ||||||||| |||| || |||||||| ||| | ||| |  || 
Sbjct  274667  TGCTGGCGACCAATGGCGACACGCACTTGGGCGGCGAGGACTTTGACCAGCGCATTATGC  274726

Query  638     ACCACTTCACGCAGGAGTTCAAGCG---CAAGCACCGCAAGGACATCACGGAGAACCAGC  694
               |  |||| |   || |||  |||     |||| ||   |  ||| |  ||  | || |||
Sbjct  274727  AGTACTTTATTAAGAAGTGGAAGAAGGACAAGAAC---ATTGACGTGGCGTCGGACAAGC  274783

Query  695     GTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGG  754
               | ||  | |     ||||||   |    ||||||||  || ||  |||||||| ||   |
Sbjct  274784  GCGCGTTGCAGAAGCTGCGGCGCGAAGCCGAGCGTGTGAAACGCGCGCTGTCGGCGCAAG  274843

Query  755     CTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATCA  814
               | || |||    | |||||||| ||  |  | || |||   ||||| | |  | |  | |
Sbjct  274844  CGCAAGCTAGACTGGAGATTGAATCGTTACTGGAAGGCGAGGACTTTACCGAGTCGTTGA  274903

Query  815     CTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTGG  874
                |||||| || || ||| |  ||   |  || |  |||   |||||  |||  |||||||
Sbjct  274904  GTCGTGCACGCTTTGAGAAGCTGAATGATGATTTGTTCAAGAAGACACTGGGACCCGTGG  274963

Query  875     AGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTGG  934
               |||||||| ||   || ||     ||  ||||    ||||| | ||| | ||||| ||||
Sbjct  274964  AGAAGGTGATGAAAGATGCTGGTTTGAAGAAGTCGGAGGTGGATGAGATTGTGCTCGTGG  275023

Query  935     GCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAGG  994
               | || |||||||||||||| ||||||||||||||| |   ||||| ||| ||||||||||
Sbjct  275024  GTGGATCGACGCGTATCCCCAAGGTGCAGCAGCTGATCAAGGACTACTTTAACGGCAAGG  275083

Query  995     AGCCCAACAAGTCCA-TCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGCG  1053
               | ||   |  ||  | | || ||||| || ||||||||||| || ||| | |||||||  
Sbjct  275084  AACCGT-CGCGTGGAGTGAATCCGGATGAAGCTGTGGCGTATGGCGCGGCTGTGCAGGGC  275142

Query  1054    GCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGC---AGGACCTGCTTCTGCTGGAC  1110
               |  |||||| | ||| |  |      |||  |  ||    ||||  | || ||| | || 
Sbjct  275143  GGTATCCTGGGTGGCGAGCA------GGACGACTTGACCAAGGATGTACTGCTGATTGAT  275196

Query  1111    GTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCGCG  1170
               ||   ||||||||||| |||| | |||||||  ||||| |||||||||| ||| ||    
Sbjct  275197  GTCGTGCCGCTGTCTCAGGGTATTGAGACGGTGGGTGGCGTCATGACGAAGCTTATTAAC  275256

Query  1171    CGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACCAG  1230
               || ||||||  | | |||||||||||||||||||| ||||||||||||   ||||| |||
Sbjct  275257  CGCAACACGGTGATCCCGACCAAGAAGTCGCAGACCTTCTCGACGTACCAGGACAATCAG  275316

Query  1231    CCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACCTG  1290
               || |  ||||| ||||||||||| |||||||| ||  | |||||    ||||||   |||
Sbjct  275317  CCAGCCGTGCTGATCCAGGTGTTTGAGGGCGAACGTGCGATGACCAAAGACAACCGTCTG  275376

Query  1291    CTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCGAC  1350
               || || |||||  | |||   ||  | || ||    || || |||||||| ||||| || 
Sbjct  275377  CTTGGTAAGTTTGAGCTGACTGGTCTGCCGCCTGCTCCCCGTGGTGTGCCTCAGATTGAG  275436

Query  1351    GTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAACG  1410
               ||||||||||| || || || || || ||| || | ||||| || | ||| |||   || 
Sbjct  275437  GTGACGTTCGAGATTGATGCCAATGGTATCTTGCAAGTGTCTGCGGAGGACAAGGGTACC  275496

Query  1411    GGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACATT  1470
               |||||||   | | ||||||||||||   ||| |||||||| || |||||||  || |||
Sbjct  275497  GGCAAGGCCGAGACGATCACGATCACTGCCGAGAAGGGCCGTCTGTCGCAGGAAGAGATT  275556

Query  1471    GACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCG--GAGGACGAGGCTAACAAGCAAC  1528
               |||||||||||   ||||||   | |||    | ||  |||||| ||  |   ||| | |
Sbjct  275557  GACCGCATGGTCCAGGAGGCGTCGGAGT--TTGCCGACGAGGACAAGCGTGTGAAGGACC  275614

Query  1529    GCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATG  1588
               | ||||| | |   ||| ||||||||  ||||   ||||   ||  |||||   ||   |
Sbjct  275615  GTATCGATGGCCGCAACTCGCTGGAGGGCTACTTGTACAACTTGAAGAACAACGTG---G  275671

Query  1589    ACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGG--TGGACGACAAGGT  1646
               | |  ||| |  | || ||||||  ||| |  |||||| |  |||  | |||  |   ||
Sbjct  275672  AGGGCAAGCTTGACGACAAGATCGAGGAGGACGACAAGGACACGGTCTTGACTGC--TGT  275729

Query  1647    GACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTC  1706
                  ||| | |||  | |||||||| |  ||||||    |||| || || |  || ||| |
Sbjct  275730  TCAGGACGCGATGGACTGGCTGGAGGATAACCAGGAGGTGGACAAAGAGGACTATGAGGC  275789

Query  1707    GAAGCAGAAGGAATTGGAG  1725
                |||||||||||  |||||
Sbjct  275790  CAAGCAGAAGGAGGTGGAG  275808

 Score = 139 bits (153),  Expect = 5e-30
 Identities = 167/227 (74%), Gaps = 9/227 (4%)
 Strand=Plus/Plus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               ||||||| ||||| || || || ||||||||||||||| | |   || || |    ||||
Sbjct  274028  TCGGCATTGACCTGGGGACGACGTACTCGTGCGTGGGCATTTACAAGGACCAGAAGGTGG  274087

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               | ||||| |||||||||||||||||||||| ||| ||||| ||||| || |     ||||
Sbjct  274088  AGATCATTGCCAACGACCAGGGCAACCGCATCACGCCGTCGTACGTGGCGT---GGGACT  274144

Query  152     CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
               ||      || || || || || |||| ||||||||| || | | | || ||| || | |
Sbjct  274145  CGAACGACGAGCGTCTGATTGGCGACGGCGCCAAGAACCAAGCGACGATCAACCCGGAGA  274204

Query  206     ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGAC  252
               | ||| ||||||| | ||| ||||| || ||||| || | | |||||
Sbjct  274205  AGACGCTGTTCGATGTCAAGCGTCTCATTGGCCGAAAATACACGGAC  274251

 Score = 39.2 bits (42),  Expect = 3.9
 Identities = 33/41 (80%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  408     CGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACG  448
               |||||||||||  || |||||||  ||||| |||  |||||
Sbjct  606585  CGGCGCCATTGGGGGGCTCAACGACCTGCGAATCTGCAACG  606545

>PYAP:scaffold_4 pag1_scaffold_4 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_4:1:159791:1 
REF
Length=159791

 Score = 462 bits (511),  Expect = 4e-127
 Identities = 948/1396 (68%), Gaps = 39/1396 (3%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||| |||||  ||||| | ||  | |  |||| |||||||||||||||||| ||||| |
Sbjct  95471  AGGATGCCGGTACCATTTCGGGTATGACTGTGCAGCGTATCATCAACGAGCCAACGGCTG  95530

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGC---GGCGAGCGCAACGTGCTGATCTTCG  517
              ||||||| || |||||  | |||||||||| |   ||||||   ||||||||  ||||||
Sbjct  95531  CCGCCATTGCCTACGGTATCGACAAGAAGGCCCAGGGCGAGAAGAACGTGCTTGTCTTCG  95590

Query  518    ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
              |||| ||||| || |||||||||||| | |||||  ||||||| |  ||  |||||||||
Sbjct  95591  ACCTTGGCGGTGGTACCTTCGATGTGACGCTCCTCGCCATTGATGGTGGTGTCTTCGAGG  95650

Query  578    TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
              |    || ||    |||||||| ||||| || ||||||||||||||| | ||  |  || 
Sbjct  95651  TGCTTGCTACCAACGGTGACACTCACCTTGGCGGTGAGGACTTCGACCAGCGTATCATGC  95710

Query  638    ACCACTTCACGCAGGAGTTCAAGCGCAAGCACC---GCAAGGACATCACGGAGAACCAGC  694
              |  ||||||   || |||  |||   ||| ||    |||  ||||||    || || |||
Sbjct  95711  AGTACTTCATCAAGAAGTGGAAG---AAGGACAAGAGCATTGACATCGGCAAGGACAAGC  95767

Query  695    GTGCTCTTCGTCGTCTGCGGACGGCCTGC-GAGCGTGCCAAGCGTACGCTGTCGTCGTCG  753
              |||| || |     || ||  ||    || |||||||  |||||| | |||||| |   |
Sbjct  95768  GTGCCCTGCAGAAGCTCCGT-CGTGAGGCTGAGCGTGTGAAGCGTGCTCTGTCGACCCAG  95826

Query  754    GCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCATC  813
              |||||||||    | |||||||| || ||  |||| ||    |||||||    | || | 
Sbjct  95827  GCTCAGGCTCGTCTTGAGATTGAGTCGCTCCTCGATGGTGAGGACTTCACTGAGGCCCTT  95886

Query  814    ACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCCGTG  873
               | ||||||||||||||| |  ||  ||  |||  ||||   |||||  | |  || || 
Sbjct  95887  TCGCGTGCTCGTTTCGAGAAGCTGAACGAGGACCTCTTCAAGAAGACCCTCGGCCCAGTC  95946

Query  874    GAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTGGTG  933
              |||||||| ||    || |     ||   ||||    ||||  ||||| | ||||| || 
Sbjct  95947  GAGAAGGTCCTCAAGGATGGTGGCCTCAAGAAGTCGGAGGTCGACGAGATCGTGCTTGTT  96006

Query  934    GGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGCAAG  993
              || || ||||| ||||| || ||||| ||||||||  |   ||||| |||||||||||||
Sbjct  96007  GGTGGTTCGACTCGTATTCCTAAGGTCCAGCAGCTCATCAAGGACTACTTCAACGGCAAG  96066

Query  994    GAGCCCAACAAGTCCA-TCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCAGGC  1052
              ||||| | |  ||    | |||||||| |||||||| || ||||||||  ||||||||| 
Sbjct  96067  GAGCC-ATCGCGTGGTGTGAACCCGGATGAGGCTGTTGCCTACGGTGCTGCCGTGCAGGG  96125

Query  1053   GGCCATCCTGAGCGG----CA--ACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCT  1106
               |  |||||  | ||    ||  ||||   |||  | ||     ||||| | || ||  |
Sbjct  96126  TGGTATCCTCGGTGGTGAGCAGGACGAT--GTC--ACAA-----AGGACATTCTCCTTAT  96176

Query  1107   GGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGAT  1166
               || ||   ||| || || || ||| | ||||| | ||| ||||| ||||| | ||| ||
Sbjct  96177  TGATGTCGTGCCTCTCTCGCTTGGTATTGAGACTGTCGGCGGTGTGATGACCAAGCTCAT  96236

Query  1167   CGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAA  1226
              |   || ||||||    | || || |||||||||||||| |||||||| |||   |||||
Sbjct  96237  CAACCGTAACACGGTCATCCCAACGAAGAAGTCGCAGACATTCTCGACCTACCAGGACAA  96296

Query  1227   CCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAA  1286
              |||||| |  ||||| ||||||||||||||||| |||||  |||||||    ||||||  
Sbjct  96297  CCAGCCAGCTGTGCTGATCCAGGTGTTCGAGGGTGAGCGTACCATGACCAAGGACAACCG  96356

Query  1287   CCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGAT  1346
               || || ||||||||| | ||    ||  | || ||    ||||| ||||| || |||||
Sbjct  96357  TCTTCTCGGCAAGTTCGAGCTCACGGGTCTGCCACCAGCTCCTCGTGGTGTTCCTCAGAT  96416

Query  1347   CGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTC  1406
               || || |  || ||  | ||||| ||||| || ||  | ||    || | ||| |||  
Sbjct  96417  TGAGGTCAGCTTTGAGCTTGACGCTAACGGAATTCTCCAGGTCGGTGCCGAGGATAAGGG  96476

Query  1407   AACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGA  1466
               || || ||||   | |||||||||||||||  ||| |||||||| ||||||||||  ||
Sbjct  96477  CACTGGTAAGGCCGAGAAGATCACGATCACGGCCGAGAAGGGCCGTCTCTCGCAGGAGGA  96536

Query  1467   CATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCG--GAGGACGAGGCTAACAAG  1524
               || || ||||||||   |||||| ||| ||| |  | ||  |||||| ||      |||
Sbjct  96537  GATCGAGCGCATGGTCAAGGAGGCTGAGGAGTTC--GCCGACGAGGACAAGAAGGTGAAG  96594

Query  1525   CAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACA--GTC  1582
               | || || || | |   ||||  || |||   |||   ||||| ||   |||||  |||
Sbjct  96595  GACCGTATTGACGGCCGCAACGGTCTTGAGGGTTACCTGTACAGCCTCAAGAACAACGTC  96654

Query  1583   TGAATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACA  1642
                   || || ||| |    || ||||||   || |  |||||| || | |||  | |  
Sbjct  96655  -----GAGGACAAGCTCGCTGACAAGATCGACGAGGACGACAAGGAGACTGTGCTCAAGG  96709

Query  1643   AGGTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACG  1702
                |||  ||| |  ||  | ||||| || |  ||||||   | ||| ||||| |  | ||
Sbjct  96710  CTGTGCAGGACGCCATGGACTGGCTCGAGGACAACCAGGACTCGGACAAGGAGGACTTCG  96769

Query  1703   AGTCGAAGCAGAAGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATGTACGCTG  1762
              || | |||||||||||  | |||   ||||  |||||| |  ||   ||| |||||   |
Sbjct  96770  AGGCCAAGCAGAAGGAGGTCGAGAAGGTGGTGAACCCAATCATGGCCAAGGTGTACCAGG  96829

Query  1763   CTGCTGGCGGTTCCCC  1778
              ||| ||||| | ||||
Sbjct  96830  CTGGTGGCGCTGCCCC  96845

 Score = 129 bits (142),  Expect = 3e-27
 Identities = 255/373 (68%), Gaps = 16/373 (4%)
 Strand=Plus/Plus

Query  32     TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
              |||| ||||| || || || || |||||||| || || ||||   || || |    ||||
Sbjct  95012  TCGGTATCGATCTTGGTACCACGTACTCGTGTGTCGGTGTGTACAAGGACCAGAAGGTGG  95071

Query  92     AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
              | ||||| |||||||||||||| ||||| | ||| || || |||||||| |     ||||
Sbjct  95072  AGATCATTGCCAACGACCAGGGTAACCGTATCACGCCTTCGTACGTCGCTT---GGGACT  95128

Query  152    CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
              ||      || ||  | |||||||| | ||||||||| ||||   | || ||| |  | |
Sbjct  95129  CGAACGACGAGCGTTTGATCGGTGATGGCGCCAAGAACCAGGCCACGATCAACCCAGAGA  95188

Query  206    ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTC-GTCCAG  264
              | ||| | |||||||  || ||||| || || |||  || |   || |  ||| ||||||
Sbjct  95189  AGACGCTCTTCGACGTGAAGCGTCTCATTGGTCGCTCGTACAACGA-CAAGTCGGTCCAG  95247

Query  265    GCCGACATCAAGCACTGGCCGTTCCA-AGTGACGTCGGGCGCCGGTGACAAGCCGCAGAT  323
              |||||||  |||| |  ||||| | | | || |  |  |    | || |||||||   ||
Sbjct  95248  GCCGACAAGAAGCTCCTGCCGTACGAGATTGTCAACAAG----GATGGCAAGCCGTTCAT  95303

Query  324    CACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGT  383
              |  |||   | ||||||| |||  ||||   |||   || |||||  | ||| |||||||
Sbjct  95304  CCAGGTCACGATCAAGGGTGAGAACAAGCTCTTCGCCCCAGAGGAAGTGTCGGCCATGGT  95363

Query  384    GCTGATCAAGATG  396
              ||| | |||||||
Sbjct  95364  GCTCACCAAGATG  95376

>PYIW:scaffold_1597 piw_scaffold_1597 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1597:1:8004:1 
REF
Length=8004

 Score = 461 bits (510),  Expect = 4e-127
 Identities = 829/1203 (69%), Gaps = 74/1203 (6%)
 Strand=Plus/Minus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             |||||||||| ||||| || |||||  ||||   ||||||||| ||||||||||| || |
Sbjct  1946  AGGACGCCGGTGCCATCGCTGGCCTTGACGTCAAGCGTATCATTAACGAGCCGACTGCGG  1887

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGA-----GCG-------CAACGTGC  508
             | ||| ||||||||||||| ||||  || | ||||       |||       ||||||||
Sbjct  1886  CTGCCCTCGCGTACGGCCTCGACACCAACGCCGGCTCCAACGGCGAGAAGACCAACGTGC  1827

Query  509   TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
             | ||||||||||| ||||| || ||||||||||||||  |||| || || ||| | ||||
Sbjct  1826  TCATCTTCGACCTTGGCGGTGGTACCTTCGATGTGTCGATCCTCTCGATCGAGAACGGCA  1767

Query  569   TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
             ||||||||||||||||||| |  |||||||||||||| || |||||||||||||||||| 
Sbjct  1766  TCTTCGAGGTCAAGGCCACGGGCGGTGACACGCACCTCGGCGGTGAGGACTTCGACAACA  1707

Query  629   GCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAA---GGACATCACGG  685
              | |||| ||  || |   |  |||||||||||||||| |||||||    |||  ||  |
Sbjct  1706  ACATGGTCGAGTACCTGCTGACGGAGTTCAAGCGCAAGAACCGCAACCTCGAC-CCATCG  1648

Query  686   AGAAC-CAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTG  744
             ||  | |  |||||  | || ||||| |  |||||||| |||   |||||||| | ||| 
Sbjct  1647  AGCTCGCCACGTGCCATGCGCCGTCTCCACACGGCCTGTGAGTCGGCCAAGCGCATGCTA  1588

Query  745   TCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAAC  804
             ||| |  || |    ||||   | ||| ||||||| || ||||| ||  | ||||||| |
Sbjct  1587  TCGACCACGACGTCTGCTTCGGTGGAGGTTGACTCGCTCTTCGAGGGTGTGGACTTCAGC  1528

Query  805   TCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAG----AC  860
              ||||  | || || ||    ||||||     |  ||||||  |  ||  ||||     |
Sbjct  1527  GCGACGGTGACGCGCGCCAAGTTCGAG---TCGCTCGGCGAGGAGCTCTTCAAGCGTTGC  1471

Query  861   GATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTG----C  916
             || |||| | |||   |||||||| |  ||||||||  ||      |||| ||||    |
Sbjct  1470  GA-GGAGACTGTGCTCAAGGTGCTCCAGGACGCCAACATG-----AAGCCTGGTGAGATC  1417

Query  917   AC-GAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCG  975
             || ||| ||||||| || || ||||| |||||||||||||||||||||    |||| |||
Sbjct  1416  ACGGAGCTGGTGCTCGTTGGTGGCTCCACGCGTATCCCGAAGGTGCAGACCATGCTCTCG  1357

Query  976   GACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTAC  1035
             | | | |||||||||||||||| |  |||||| |||||||| |||||||| || || |||
Sbjct  1356  GGCCTGTTCAACGGCAAGGAGCTCTCCAAGTCGATCAACCCTGACGAGGCCGTTGCCTAC  1297

Query  1036  GGTGCGACCGTGCAGGCGGCCATCCT------GAGCGGCAACGACTCGTCGGAGAAGCTG  1089
             || ||  |||||||||  || || ||       | | |||||||| |    ||  | || 
Sbjct  1296  GGCGCTGCCGTGCAGGGCGCTATTCTTTCGGGCATCCGCAACGACGC----GACCAACT-  1242

Query  1090  CAGGACCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGT  1149
                   ||||| ||  | ||||||||||||||||| || ||  | ||||| | |||    
Sbjct  1241  ----CGCTGCTGCTCGTTGACGTGACGCCGCTGTCGCTCGGCATTGAGACCGTCGGCAAG  1186

Query  1150  GTCATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTC  1209
             |||||| ||  ||| |||  ||| |||||| |  | |||      ||| |||    ||  
Sbjct  1185  GTCATGTCGGTGCTCATCAAGCGTAACACGGCCATCCCGGTGCGCAAGACGCGCGTGTAT  1126

Query  1210  TCGACGTACGCCGACAACCAGCC------TGGGGTGCTCATCCAGGTGTTCGAGGGCGAG  1263
              ||||| | |  ||| ||||| |      ||  |||  ||||      | ||||||||||
Sbjct  1125  ACGACGGAGGAGGACTACCAGACGTCCGTTGACGTGTGCATC------TACGAGGGCGAG  1072

Query  1264  CGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATC---CCT  1320
             ||  |    |||  ||  ||||||  ||| ||| |||||||| |    ||| ||   | |
Sbjct  1071  CGTGCGTCCACGGCCGTGAACAACAAGCTCGGCGAGTTCAACATCTCTGGCCTCGAGCGT  1012

Query  1321  CCCATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATC  1380
              ||| |   || || | ||||||| | || ||||||||||| || ||||| |||||||||
Sbjct  1011  GCCAAG---CGTGGCGAGCCGCAGGTGGAGGTGACGTTCGAGATTGACGCCAACGGCATC  955

Query  1381  CTGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAAC  1440
             ||||||||||||||    || |||   || ||   |     | |||  || ||| |||||
Sbjct  954   CTGAACGTGTCGGCCCGCGACAAGAAGACCGGTGCGCGTGCCGAGACGACCATCTCGAAC  895

Query  1441  GACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTAC  1500
              ||   ||||| ||    ||| | ||||| |||||||||||  | || || || |||| |
Sbjct  894   AACGCCGGCCGTCTGAGCCAGTCCGACATCGACCGCATGGTTGCCGACGCTGAAAAGTTC  835

Query  1501  AAGTCGGAGGACGAGGCTAA---CAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAAC  1557
             ||   | ||||||| ||| |      ||  |||||||||||    ||||| |||||| | 
Sbjct  834   AA---GAAGGACGACGCTGAGCTGCTGCGCCGCATCGAGGCTCGTAACGCTCTGGAGCAG  778

Query  1558  TAC  1560
             |||
Sbjct  777   TAC  775

 Score = 271 bits (300),  Expect = 4e-70
 Identities = 273/355 (77%), Gaps = 0/355 (0%)
 Strand=Plus/Minus

Query  32    TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
             ||||||||||||||||||| |||||||||||||||||||||||| |  ||| ||  ||||
Sbjct  2405  TCGGCATCGACCTCGGCACGACCTACTCGTGCGTGGGCGTGTGGAAAGACGGCCAGGTGG  2346

Query  92    AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
             | ||||||||||||  | |||| |||||||| || ||||| |  || || ||||  || |
Sbjct  2345  AGATCATCGCCAACAGCGAGGGTAACCGCACGACTCCGTCGTGGGTGGCTTTCAACGAGT  2286

Query  152   CGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGG  211
             |||| || || ||||| || ||||||||||  ||||  ||   |||||||  ||||||||
Sbjct  2285  CGGAGCGTCTGATCGGCGAGGCCGCCAAGATCCAGGCCGCGTCGAACGCGACCAACACGG  2226

Query  212   TGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACA  271
             ||||||||||||| ||| | ||||||||||| |||   |||  | ||||  ||   ||| 
Sbjct  2225  TGTTCGACGCCAAGCGTATCATCGGCCGCAACTTCAACGACGACATCGTGAAGAAGGACG  2166

Query  272   TCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGC  331
              ||||||||  |||||| |  |   |  ||||| |    |||||   | ||||  |||| 
Sbjct  2165  CCAAGCACTTCCCGTTCAAGATCGTGGAGGGCGACTCGAACAAGGTTCTGATCGAGGTGG  2106

Query  332   AGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
             ||||||||||||||||||||   |||   || |||||||||||||||||||||||
Sbjct  2105  AGTTCAAGGGCGAGTCCAAGCGCTTCACGCCGGAGGAGATCTCGTCCATGGTGCT  2051

>APAS:scaffold_253 supercont1.253 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.253:1:11029:1 
REF
Length=11029

 Score = 459 bits (508),  Expect = 1e-126
 Identities = 798/1142 (70%), Gaps = 49/1142 (4%)
 Strand=Plus/Minus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             |||||||||||||||| || |||||| |||||  ||| |||||||||||||| || ||||
Sbjct  9993  AGGACGCCGGCGCCATCGCTGGCCTCGACGTGAAGCGCATCATCAACGAGCCCACCGCCG  9934

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGC---GCAA------CGTGCTGA  511
             ||||| ||||||||||  |||||| ||| | ||||| |    ||||      | |  |||
Sbjct  9933  CCGCCCTCGCGTACGGGTTGGACACGAACGCCGGCGCGGAAGGCAAGTCGAACATTTTGA  9874

Query  512   TCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCT  571
             |||||||| ||||||| ||||| || ||||||||  || |||| |||||| | |||||||
Sbjct  9873  TCTTCGACTTGGGCGGAGGCACGTTTGATGTGTCCATCTTGTCGATTGAGAACGGCATCT  9814

Query  572   TCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCC  631
             |||| |||||| |||| |  |||||||||||| ||||||| || ||||| |||     | 
Sbjct  9813  TCGAAGTCAAGTCCACGGGCGGTGACACGCACTTGGGTGGCGAAGACTTTGACTCGAACA  9754

Query  632   TGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAA---GGACATCACGGAGA  688
             |||| ||| |||| |     ||||||||||||||| ||   ||   ||||   |||  | 
Sbjct  9753  TGGTCGACTACTTGATCACCGAGTTCAAGCGCAAGAACAAGAACTTGGACCCGACGACG-  9695

Query  689   ACCAGCGTGCTC--TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTC  746
               | ||  | ||  | || || ||||| ||||| ||||||  ||||||||| | ||| ||
Sbjct  9694  -TCGGCCCGGTCCATGCGCCGCCTGCGCACGGCGTGCGAGTCTGCCAAGCGCATGCTTTC  9636

Query  747   GTCGTCGGCTCAG-GCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACT  805
               || |  | ||| ||    |||||  | ||||| || ||||| ||| ||||||| | ||
Sbjct  9635  CACGACCAC-CAGCGCCACGATCGAAGTGGACTCGCTCTTCGAAGGCGTCGACTTTAGCT  9577

Query  806   CGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTC---CGCAAGACGA  862
             ||||||| || || ||    || |||    |   || ||| | ||||   |||   ||| 
Sbjct  9576  CGACCATGACGCGCGCCAAGTTTGAGTCGCTCAACGACGAGTGCTTCAAGCGC---ACGG  9520

Query  863   TGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGG  922
               ||  |||||  ||||||| |||  ||||||||  ||  |     |||  |    ||  
Sbjct  9519  AAGAAACCGTGTTGAAGGTGTTGCAAGACGCCAACATGAAGCCCGACCAAATCTCGGAAC  9460

Query  923   TGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCT  982
             ||||||| |||||||| || ||||||||||| ||||||||  |  |||||||||   | |
Sbjct  9459  TGGTGCTCGTGGGCGGGTCCACGCGTATCCCCAAGGTGCAAAACATGCTGTCGGGTCTGT  9400

Query  983   TCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGA  1042
             |   |||||||||||  | ||||||||||||||| || || || ||||||||||||||| 
Sbjct  9399  TTGGCGGCAAGGAGCTGAGCAAGTCCATCAACCCCGATGAAGCCGTGGCGTACGGTGCGG  9340

Query  1043  CCGTGCAGGCGGCCATCCTGAGCGGCA-ACGACTCGTCG-GAGAAGCTGCAGGACCTGCT  1100
             ||||||| |  || |||||||||||||  ||   || || ||  | ||        || |
Sbjct  9339  CCGTGCAAGGCGCGATCCTGAGCGGCATCCGCAACGACGCGACCAACT-----CGTTGTT  9285

Query  1101  TCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGAC  1160
               || |||||||||||||  ||||||||||  | || || |  ||    |||||| ||  
Sbjct  9284  GTTGGTGGACGTGACGCCCTTGTCTCTGGGCATTGAAACCGTGGGCAAGGTCATGTCGGT  9225

Query  1161  GCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGC  1220
             |||||||  ||| |||||| || | |||  ||||||| |||    || | ||||  | ||
Sbjct  9224  GCTGATCAAGCGCAACACGGCGATCCCGGTCAAGAAGACGCGCGTGTACACGACCGAAGC  9165

Query  1221  CGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCG--C  1278
             |||| ||||  |    |||  | |     | | ||| |||||||||  | || || |  |
Sbjct  9164  CGACTACCAAACCCAAGTGAACGTGGTCATCTACGAAGGCGAGCGC-GCGTG-CGTGGAC  9107

Query  1279  GACAACAACCTGCTGGGCAAGTTCA--ACCTGGACGGCATCCCTCCCATGCC--TCGCGG  1334
              ||||||||  ||||||| ||||||  | || |  |||||    | |  |||   |||||
Sbjct  9106  CACAACAACAAGCTGGGCGAGTTCACGATCTCG--GGCATTGAACGC--GCCAAGCGCGG  9051

Query  1335  TGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGC  1394
              | ||| ||  | || ||||||||||| |||||||| ||||||||| ||||||||   ||
Sbjct  9050  CGAGCCCCAAGTGGAAGTGACGTTCGAGATCGACGCCAACGGCATCTTGAACGTGAGCGC  8991

Query  1395  TGTGG---AGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCG  1451
                ||   ||||| |    | |||||    | ||| ||||||||  | | ||   |||||
Sbjct  8990  CAAGGACAAGAAGACCCACGCCAAGG---CCGAGACCACGATCAGCAGCAACGGCGGCCG  8934

Query  1452  CCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGA  1511
             | |    ||||  |||||||||||||||||  |||| || || |||||||||  ||| ||
Sbjct  8933  CTTGAGCCAGGAAGACATTGACCGCATGGTGGCGGACGCGGAAAAGTACAAGAAGGACGA  8874

Query  1512  CG  1513
             ||
Sbjct  8873  CG  8872

 Score = 230 bits (254),  Expect = 1e-57
 Identities = 265/357 (74%), Gaps = 0/357 (0%)
 Strand=Plus/Minus

Query  32     TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
              |||| ||||| ||||| || ||||||||||||||||| |||||| || | | ||  ||||
Sbjct  10452  TCGGGATCGATCTCGGTACCACCTACTCGTGCGTGGGTGTGTGGAAGGATGGCCAAGTGG  10393

Query  92     AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
              ||||||||||||||  | | ||||||||||| ||||| || |  || || ||||  ||  
Sbjct  10392  AAATCATCGCCAACAGCGAAGGCAACCGCACGACCCCTTCGTGGGTGGCGTTCAACGAAA  10333

Query  152    CGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGG  211
              | || ||| | |||||||| ||||||||||  || |  ||    |||||   ||||||||
Sbjct  10332  CCGAGCGCTTGATCGGTGAAGCCGCCAAGATCCAAGCCGCGTCCAACGCCACCAACACGG  10273

Query  212    TGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACA  271
              ||||||||||||| ||| | || |||||||| |||   |||||  ||||  ||   ||| 
Sbjct  10272  TGTTCGACGCCAAGCGTATCATTGGCCGCAACTTCAGCGACCCGATCGTGAAGAAGGACG  10213

Query  272    TCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGC  331
               |  |||||  |||||| |  | ||  | || | ||  |||||||||  ||||   ||| 
Sbjct  10212  CCGCGCACTTCCCGTTCAAGATTACCGCCGGGGACGACGACAAGCCGTTGATCGAAGTGA  10153

Query  332    AGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGA  388
               ||||||||||||  ||||||  |||   ||||| || |||||||| ||||||||||
Sbjct  10152  CGTTCAAGGGCGAAGCCAAGAGCTTCACCCCCGAAGAAATCTCGTCGATGGTGCTGA  10096

>SAPA:scaffold_62 supercont2.62 dna:supercontig supercontig:ASM15154v2:supercont2.62:1:212711:1 
REF
Length=212711

 Score = 456 bits (505),  Expect = 2e-125
 Identities = 843/1212 (70%), Gaps = 81/1212 (7%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||| ||||| ||||||||||||||| ||||   |||||||||||||||||| |||||||
Sbjct  10915  AGGATGCCGGTGCCATTGCCGGCCTCGACGTCAAGCGTATCATCAACGAGCCCACGGCCG  10974

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAG--CG----------CAACGTGC  508
              ||||| ||||||||||| |||||| ||| | ||||  |  ||          |||| | |
Sbjct  10975  CCGCCCTCGCGTACGGCTTGGACACGAACGCCGGCTCGGACGGCAACAAGGCCAACATCC  11034

Query  509    TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
              | |||||||| || || || || ||||||||||||||  |||| || || ||| | ||||
Sbjct  11035  TCATCTTCGATCTCGGTGGTGGTACCTTCGATGTGTCGATCCTCTCGATCGAGAACGGCA  11094

Query  569    TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
              ||||||| ||||||||||| |  ||||||||||| || |||||||| || ||||||    
Sbjct  11095  TCTTCGAAGTCAAGGCCACGGGCGGTGACACGCATCTCGGTGGTGAAGATTTCGACTCGA  11154

Query  629    GCCTGGTGGA---CCACTTCACGCAGGAGTTCAAGCGCAAG--CACCGCAAGGACATCAC  683
               | |||| ||   || | ||||   ||||||||||||||||   |  ||   |||  |||
Sbjct  11155  ACATGGTCGACTTCCTCGTCAC---GGAGTTCAAGCGCAAGACAAGGGCCTTGACCCCAC  11211

Query  684    GGAGAACCAGCGTGCTC--TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACG  741
              |  |   | ||  ||||  | || ||||| || ||||||||||||   |||||||| | |
Sbjct  11212  GTCG--TCGGCTCGCTCGATGCGCCGTCTCCGCACGGCCTGCGAGTCGGCCAAGCGCATG  11269

Query  742    CTGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTC  801
              || ||| || || |   ||||   || ||  | ||||| || ||||| ||| | ||||||
Sbjct  11270  CTTTCGACGACGACGTCGGCTGCTATTGAAGTCGACTCGCTCTTCGAGGGCGTTGACTTC  11329

Query  802    AACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTC---CGCAAG  858
                 ||||| || || |||||    ||||||    |   ||  || | ||||   |||   
Sbjct  11330  TCGTCGACGATGACGCGTGCCAAGTTCGAGTCGCTCAACGAAGAGTGCTTCAAGCGC---  11386

Query  859    ACGATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGG--TGC  916
              |||  |||| | ||    ||||||||   |||||| ||| |   ||||    |||    |
Sbjct  11387  ACGGAGGAGACTGTCCTCAAGGTGCTTGCCGACGCTAAGAT---GAAGCCGGAGGAAATC  11443

Query  917    AC-GAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCG  975
              || ||| | || || || ||||| || ||||||||||| ||||||||| |  |||| |||
Sbjct  11444  ACGGAGCTCGTCCTTGTCGGCGGTTCCACGCGTATCCCCAAGGTGCAGAACATGCTCTCG  11503

Query  976    GACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTAC  1035
              |   |||||  ||||||||||| |   ||||| ||||||||||| ||||| || ||||||
Sbjct  11504  GCTGTCTTCGGCGGCAAGGAGCTCTCGAAGTCGATCAACCCGGATGAGGCCGTCGCGTAC  11563

Query  1036   GGTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGAC  1095
              |||||  |||| ||||  ||||||||    ||||     ||  |   || ||  || || 
Sbjct  11564  GGTGCCGCCGTCCAGGGTGCCATCCTCTCGGGCA-----TCCGCAACGACGC--CACGAA  11616

Query  1096   CT-GCTTCTGC---TGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGT  1151
              || ||| || |   | || ||||||||||| || || ||| | ||||||| |||  | ||
Sbjct  11617  CTCGCTCCTCCTCGTCGATGTGACGCCGCTCTCGCTCGGTATTGAGACGGTCGGCCGCGT  11676

Query  1152   CATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTC  1211
              |||| |   ||| |||  ||| |||||| |  | |||  ||||||| |||     | | |
Sbjct  11677  CATGTCAGTGCTCATCAAGCGCAACACGGCCATCCCGGTCAAGAAGACGCGCGTCTACAC  11736

Query  1212   GACGTACGCCGACAACCAGCCTGGGGT-GCT-CATCCAGGTGTTCGAGGGCGAGCGCTCC  1269
              |||  | |  ||| ||||| |   ||| | |   | ||  | | ||| |||||||| | |
Sbjct  11737  GACCGAGGAAGACTACCAGACGCAGGTCGATGTGTGCA--TCTACGAAGGCGAGCG-TGC  11793

Query  1270   ATGACGCG--CGACAACAACCTGCTGGGCAAGTTCA--ACCTGGACGGCATCCCTCCCAT  1325
               || || |  | ||||||||  ||| ||| ||||||  | || |  |||||    | |  
Sbjct  11794  CTG-CGTGGACCACAACAACAAGCTCGGCGAGTTCACGATCTCG--GGCATTGAGCGC--  11848

Query  1326   GCC--TCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTG  1383
              |||   ||||||| ||||||| || | ||||| ||||| || ||||| ||||| ||||| 
Sbjct  11849  GCCAAGCGCGGTGAGCCGCAGGTCCAGGTGACCTTCGAGATTGACGCCAACGGTATCCTC  11908

Query  1384   AACGTGTCGGCTGTGG---AGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAAC  1440
              |||||||||||  | |   ||||| | |  | |||||    | |||  || ||||  |||
Sbjct  11909  AACGTGTCGGCGCTCGACAAGAAGACGAACGCCAAGG---CCGAGACGACCATCAACAAC  11965

Query  1441   GACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTAC  1500
               |||| || |||||| ||||||  |||||||||||||||||  | || |||||||||| |
Sbjct  11966  AACAACGGTCGCCTCACGCAGGAGGACATTGACCGCATGGTCGCTGACGCCGAGAAGTTC  12025

Query  1501   AAGTCGGAGGACGAGGCTAA------CAAGCAACGCATCGAGGCCAAGAACGCGCTGGAG  1554
              ||   | ||||||| ||| |      |||| |    |||||||||   ||| |||| |||
Sbjct  12026  AA---GAAGGACGATGCTGAGGTGCTCAAGAA---GATCGAGGCCCGCAACTCGCTCGAG  12079

Query  1555   AACTACGCCTAC  1566
              | || |  ||||
Sbjct  12080  AGCTTCATCTAC  12091

 Score = 456 bits (505),  Expect = 2e-125
 Identities = 829/1201 (69%), Gaps = 58/1201 (5%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| ||||| ||||||||||||||| ||||   ||| |||||||||||||| |||||||
Sbjct  106586  AGGATGCCGGTGCCATTGCCGGCCTCGACGTCAAGCGCATCATCAACGAGCCCACGGCCG  106527

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCG------------AGCGCAACGTGC  508
               ||||| ||||||||||| |||||| ||| | ||| |            ||  |||| | |
Sbjct  106526  CCGCCCTCGCGTACGGCTTGGACACGAACGCCGGTGCCGATGGCTCTAAGACCAACATCC  106467

Query  509     TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
               | |||||||| || || || || ||||||||||||||  |||| || || ||| | ||||
Sbjct  106466  TCATCTTCGATCTCGGTGGTGGTACCTTCGATGTGTCGATCCTCTCTATCGAGAACGGCA  106407

Query  569     TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
               ||||||| |||||| | || |  || |||||||| || |||||||| || ||||||    
Sbjct  106406  TCTTCGAAGTCAAGTCGACGGGCGGCGACACGCATCTCGGTGGTGAAGATTTCGACTCGA  106347

Query  629     GCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCAC---CGCAAGGACATCACGG  685
                | |||| ||| || |||    |||||||||||||||| ||    ||   |||  |||| 
Sbjct  106346  ACATGGTCGACTACCTCATCACGGAGTTCAAGCGCAAGAACAAGGGCCTTGACCCCACGT  106287

Query  686     AGAACCAGCGTGCTC--TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCT  743
                |   | ||  ||||  | || ||||| || ||||||||||||   |||||||| | |||
Sbjct  106286  CG--TCGGCTCGCTCGATGCGCCGTCTCCGCACGGCCTGCGAGTCGGCCAAGCGCATGCT  106229

Query  744     GTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAA  803
                ||| || || |   ||| |  |||||| ||||||| || ||||| ||| | ||||||  
Sbjct  106228  CTCGACGACGACGTCGGCCTCGATCGAGGTTGACTCGCTCTTCGAGGGCGTTGACTTCTC  106169

Query  804     CTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTC---CGCAAGAC  860
                ||||| || || || ||    ||||||    |   ||  || | ||||   |||   ||
Sbjct  106168  GTCGACGATGACGCGCGCCAAGTTCGAGTCGCTCAACGAAGAGTGCTTCAAGCGC---AC  106112

Query  861     GATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTG----C  916
               |   ||| ||||    ||||||||   |||||||||  ||      |||| ||||    |
Sbjct  106111  GGAAGAGACCGTCCTCAAGGTGCTTGCCGACGCCAACATG-----CAGCCGGGTGACATC  106057

Query  917     AC-GAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCG  975
               || ||| | || || || ||||| || ||||||||||| ||||||||| |  |||| |||
Sbjct  106056  ACGGAGCTCGTCCTTGTCGGCGGTTCCACGCGTATCCCCAAGGTGCAGAACATGCTCTCG  105997

Query  976     GACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTAC  1035
               |   |||||  ||||||||||| |   ||||| ||||||||||| ||||| || ||||||
Sbjct  105996  GCTGTCTTCGGCGGCAAGGAGCTCTCGAAGTCGATCAACCCGGATGAGGCCGTCGCGTAC  105937

Query  1036    GGTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGAC  1095
               |||||  |||| ||||  ||||||||    ||||     ||  |   || ||  || || 
Sbjct  105936  GGTGCCGCCGTCCAGGGTGCCATCCTCTCGGGCA-----TCCGCAACGACGC--CACGAA  105884

Query  1096    CT-GCTTCTGC---TGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGT  1151
               || ||| || |   | || ||||||||||| || || ||| | |||   | |||    ||
Sbjct  105883  CTCGCTCCTCCTCGTCGATGTGACGCCGCTCTCGCTCGGTATTGAGCTTGTCGGCAAGGT  105824

Query  1152    CATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTC  1211
               |||| ||  ||| |||  ||| |||||| || | ||   ||||||| |||  |  | | |
Sbjct  105823  CATGTCGGTGCTCATCAAGCGCAACACGGCGATTCCTGTCAAGAAGACGCGCATCTACAC  105764

Query  1212    GACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCAT  1271
               |||  | |  |||   ||| |   || |    ||    | ||||| |||||||| | | |
Sbjct  105763  GACCGAAGAGGACTGGCAGACGACGGAGAAGGTCGTCATCTTCGAAGGCGAGCG-TGCTT  105705

Query  1272    GACGCG-CGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCC--  1328
               |   || ||||||||||  ||| ||| ||||| |  |    |||||    | |  |||  
Sbjct  105704  GTGTCGTCGACAACAACAAGCTCGGCGAGTTCGAGATCTCGGGCATTGAGCGC--GCCAA  105647

Query  1329    TCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGT  1388
                ||||| | |||||||||||| ||||||||||| ||||| || |||||||||||  ||||
Sbjct  105646  GCGCGGCGAGCCGCAGATCGAAGTGACGTTCGAGATCGATGCCAACGGCATCCTCCACGT  105587

Query  1389    GTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGG  1448
                |||||    || |||   ||||||    |||||  ||  |||||| | ||| ||   ||
Sbjct  105586  CTCGGCCCGCGACAAGAAGACGGGCGCCAAGAACGCGACGACGATCTCCAACAACCGCGG  105527

Query  1449    CCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGA  1508
                |||||| | |||   |||||||||||||||||    ||||||||||||| |||   | |
Sbjct  105526  TCGCCTCACCCAGCAGGACATTGACCGCATGGTCGAAGAGGCCGAGAAGTTCAA---GAA  105470

Query  1509    GGACGAGGCTAACAAGC---AACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTA  1565
               |||||| ||  | | ||   | |||||||| |||   ||||  || |||  ||||  |||
Sbjct  105469  GGACGACGCGCAGATGCTCAAGCGCATCGACGCCCGCAACGACCTCGAGGGCTACCTCTA  105410

Query  1566    C  1566
               |
Sbjct  105409  C  105409

 Score = 243 bits (269),  Expect = 2e-61
 Identities = 454/652 (70%), Gaps = 35/652 (5%)
 Strand=Plus/Minus

Query  919   GAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGAC  978
             ||| | || || || ||||| || ||||||||||| ||||||||| |  |||| ||||  
Sbjct  6775  GAGCTCGTCCTCGTCGGCGGTTCCACGCGTATCCCCAAGGTGCAGAACATGCTCTCGGCT  6716

Query  979   TTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGT  1038
              |||||  ||||||||||| |   ||||| ||||||||||| ||||| || |||||||||
Sbjct  6715  GTCTTCGGCGGCAAGGAGCTCTCGAAGTCGATCAACCCGGATGAGGCCGTCGCGTACGGT  6656

Query  1039  GCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCT-  1097
             ||  |||| ||||  ||||||||    |||| |    || |   || ||  || || || 
Sbjct  6655  GCCGCCGTCCAGGGTGCCATCCTCTCGGGCATC----CG-CAACGACGC--CACGAACTC  6603

Query  1098  GCTTCTGCTGGACG---TGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCAT  1154
             ||| || || | ||   |||||||||| || || ||| | ||||||| |||  | |||||
Sbjct  6602  GCTCCTCCTCGTCGATGTGACGCCGCTCTCGCTCGGTATTGAGACGGTCGGCCGCGTCAT  6543

Query  1155  GACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGAC  1214
             | ||  ||| |||  ||| |||||| |  | |||  ||||||| |||     | | | ||
Sbjct  6542  GTCGGTGCTCATCAAGCGCAACACGGCCATCCCGGTCAAGAAGACGCGCGTCTACACCAC  6483

Query  1215  GTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGAC  1274
             | |  | ||| ||||| |   ||||  | |     | | ||| ||||||||  || || |
Sbjct  6482  GGAGTCGGACTACCAGACGCAGGTGAACGTTGTCATCTACGAAGGCGAGCGTGCC-TG-C  6425

Query  1275  GCG--CGACAACAACCTGCTGGGCAAGTTCA--ACCTGGACGGCATCCCTCCCATGCCT-  1329
             | |  | ||||||||  ||| ||| ||||||  | || |  |||||    | |  |||  
Sbjct  6424  GTGGACCACAACAACAAGCTCGGCGAGTTCACGATCTCG--GGCATTGAGCGC--GCCAA  6369

Query  1330  -CGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGT  1388
              ||||| | ||| ||| |||| || |||||||| || || || ||||| ||||| |||||
Sbjct  6368  GCGCGGCGAGCCCCAGGTCGAGGTCACGTTCGAGATTGATGCCAACGGTATCCTCAACGT  6309

Query  1389  GTCGGCTGTGGAGAAGTCAACG---GGCAAGGAGAACAAGATCACGATCACGAACGACAA  1445
             ||||||    || |||   |||   | |||||    | |||  |||||| ||||| || |
Sbjct  6308  GTCGGCCCGCGACAAGAAGACGAACGCCAAGGC---CGAGACTACGATCTCGAACAACCA  6252

Query  1446  GGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTC  1505
              ||||||||    |||||||| ||||||||||||||    ||||||||||||| ||||  
Sbjct  6251  CGGCCGCCTGAGCCAGGCTGATATTGACCGCATGGTCGAAGAGGCCGAGAAGTTCAAGAA  6192

Query  1506  GGAGGA---CGAGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAG  1554
             ||||||   ||||||   |||| |    |||||||||   ||| |||| |||
Sbjct  6191  GGAGGATGCCGAGGCGCTCAAGAA---GATCGAGGCCCGCAACTCGCTTGAG  6143

 Score = 230 bits (254),  Expect = 1e-57
 Identities = 266/356 (75%), Gaps = 2/356 (1%)
 Strand=Plus/Plus

Query  32     TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
              |||| ||||| ||||| || || ||||||||||| || || ||| || ||| ||  || |
Sbjct  10456  TCGGTATCGATCTCGGTACGACGTACTCGTGCGTCGGTGTCTGGAAGGACGGCCAGGTCG  10515

Query  92     AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
              | ||||| ||||||  | | || |||||||| || ||||| |  ||||||||||  || |
Sbjct  10516  AGATCATTGCCAACAGCGAAGGTAACCGCACGACGCCGTCGTGGGTCGCCTTCAACGAGT  10575

Query  152    CGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGG  211
              |||| ||||||||||||||||||||||||   ||||  |||  ||||||   ||||||||
Sbjct  10576  CGGAGCGCCTCATCGGTGACGCCGCCAAGCTCCAGGCTGCCTCGAACGCCACCAACACGG  10635

Query  212    TGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACA  271
              | ||||| ||||| ||| | ||||| |||   |||||||||||  ||||| ||   ||| 
Sbjct  10636  TCTTCGATGCCAAGCGTATCATCGGTCGCGCTTTCTCGGACCCGATCGTCAAGAAGGACG  10695

Query  272    TCAAGCACTGGCCGTTCCA-AGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTG  330
                   ||||  |||||| | | || ||  ||| |  | |||||||||||  |||  ||| 
Sbjct  10696  CTGCTCACTTCCCGTTCAAGATTGTCG-AGGGTGATGATGACAAGCCGCTCATCCAGGTC  10754

Query  331    CAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
                |||||||||||||  ||||   |||   ||||||||||||||||| ||||| ||
Sbjct  10755  TCGTTCAAGGGCGAGGACAAGCGCTTCACGCCCGAGGAGATCTCGTCGATGGTCCT  10810

 Score = 194 bits (214),  Expect = 8e-47
 Identities = 258/356 (72%), Gaps = 2/356 (1%)
 Strand=Plus/Minus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               |||| ||||| ||||| || || ||||||||||| || || ||| || ||| ||  || |
Sbjct  107045  TCGGTATCGATCTCGGTACGACGTACTCGTGCGTCGGTGTCTGGAAGGACGGCCAGGTCG  106986

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               | ||||| ||||||  | | || |||||||| || ||||| |  ||||||||||  ||  
Sbjct  106985  AGATCATTGCCAACAGCGAAGGTAACCGCACGACGCCGTCGTGGGTCGCCTTCAACGAAG  106926

Query  152     CGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGG  211
               | |||||| | || |||||||||||||||   ||||  |||  ||||||   ||||||||
Sbjct  106925  CCGAACGCTTGATTGGTGACGCCGCCAAGCTCCAGGCTGCCTCGAACGCCACCAACACGG  106866

Query  212     TGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACA  271
               | ||||| ||||| ||| | || || |||   |||||||||||  ||||| ||   ||| 
Sbjct  106865  TCTTCGATGCCAAGCGTATCATTGGTCGCGCTTTCTCGGACCCGATCGTCAAGAAGGACG  106806

Query  272     TCAAGCACTGGCCGTTCCA-AGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTG  330
                    ||||  |||||| | | || ||   ||||  || ||||||||||  |||  ||| 
Sbjct  106805  CTGCTCACTTCCCGTTCAAGATTGTCG-AAGGCGAAGGCGACAAGCCGCTCATCCAGGTC  106747

Query  331     CAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
                 |||||||||||||   ||||  ||    || || ||||||||||| ||||| ||
Sbjct  106746  ACGTTCAAGGGCGAGGAGAAGAACTTTTCGCCGGAAGAGATCTCGTCGATGGTCCT  106691

>PHPA:scaffold_18 NW_008649004.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.18, whole genome shotgun 
sequence
Length=1085237

 Score = 450 bits (498),  Expect = 7e-124
 Identities = 484/636 (76%), Gaps = 36/636 (6%)
 Strand=Plus/Plus

Query  682     ACGGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACG  741
               |||||||| |||  |||||||| | || ||||| | ||||||||||||        ||||
Sbjct  776801  ACGGAGAATCAGTATGCTCTTCATTGTTTGCGGGCTGCCTGCGAGCGTAT------TACG  776854

Query  742     CTGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTC  801
                 |||||||||||| |||| || |||||||||  |||||||||||||| |||  | ||||
Sbjct  776855  GCGTCGTCGTCGGC-CAGG-TTGCATCGAGATCTACTCTCTGTTCGACAGCACGGGCTTC  776912

Query  802     AACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACG  861
               ||||| |||| ||| | || |||||| ||||||||||||||| |||||||||  |||  |
Sbjct  776913  AACTCAACCACCACGCTTGATCGTTTTGAGGACATGTGCGGCAACTACTTCCA-AAGGTG  776971

Query  862     ATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAG  921
               ||||| ||| |||| ||| || | ||||||||||||||||| |||||| ||||||||| |
Sbjct  776972  ATGGACCCCTTGGAAAAGTTGTTCCGCGACGCCAAGCTGTCCAAGAGCGAGGTGCACGGG  777031

Query  922     GTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTC  981
               || || |||||||||||||| || |||| ||| |||||||||| |||||||||| |||||
Sbjct  777032  GTTGTCCTGGTGGGCGGCTCCACCCGTA-CCCCAAGGTGCAGCCGCTGCTGTCGTACTTC  777090

Query  982     TTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCG  1041
                |||||| || |||||||| |||||||||||||    ||| |||||||   ||||||   
Sbjct  777091  GTCAACGACATGGAGCCCATCAAGTCCATCAACAGCTACGCGGCTGTGATCTACGGT---  777147

Query  1042    ACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTT  1101
                      ||   ||| | || ||||||||| ||||||| |||||||||||||  ||||| 
Sbjct  777148  -------AGTTTGCCGTTCTAAGCGGCAACAACTCGTCAGAGAAGCTGCAGGTACTGCTA  777200

Query  1102    CTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACG  1161
               ||||   | | ||||||||| |  ||  || | ||||| | || | | |||| | | | |
Sbjct  777201  CTGC-AAATGCGACGCCGCTAT-GCTAAGTATGGAGACAGTCGATTGAGTCACGTCAAAG  777258

Query  1162    CTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCC  1221
               ||||||||| | |||| | |||||||| ||||||| | ||||||||||||||  || || 
Sbjct  777259  CTGATCGCGTGTAACATGTCGGTGCCGGCCAAGAACTTGCAGACGTTCTCGATATAAGCG  777318

Query  1222    GACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGAC  1281
               ||||||||| ||||  |  | ||       |||       |||| || ||| ||||  ||
Sbjct  777319  GACAACCAGTCTGGATTATTTAT-------TTC-------AGCGTTCGATGGCGCGATAC  777364

Query  1282    AACAACCTGCTGGGCAAGTTCAACCTGGACGGCATC  1317
               |||||||||||| |  || |||| || |||||| ||
Sbjct  777365  AACAACCTGCTGAGTGAGCTCAATCTCGACGGCGTC  777400

 Score = 90.6 bits (99),  Expect = 2e-15
 Identities = 66/77 (86%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  311     ACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGA  370
               |||||||   ||||||  ||||| |||||||||||  |||||||||| | ||||||||||
Sbjct  776596  ACAAGCCATTGATCACAATGCAGGTCAAGGGCGAGAGCAAGACGTTCAACCCCGAGGAGA  776655

Query  371     TCTCGTCCATGGTGCTG  387
               |||||||||||| ||||
Sbjct  776656  TCTCGTCCATGGAGCTG  776672

 Score = 63.5 bits (69),  Expect = 3e-07
 Identities = 48/57 (84%), Gaps = 0/57 (0%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGG  457
               |||| ||||||||||| || ||||| || || || | |||||||||||||| |||||
Sbjct  776748  AGGATGCCGGCGCCATCGCTGGCCTAAAAGTTCTACATATCATCAACGAGCTGACGG  776804

>APAS:scaffold_1 supercont1.1 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.1:1:2615878:1 
REF
Length=2615878

 Score = 449 bits (497),  Expect = 2e-123
 Identities = 797/1148 (69%), Gaps = 61/1148 (5%)
 Strand=Plus/Minus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||||||||||||||| || |||||| |||||  ||| |||||||||||||| || ||||
Sbjct  16248  AGGACGCCGGCGCCATCGCTGGCCTCGACGTGAAGCGCATCATCAACGAGCCCACCGCCG  16189

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGC---GCAA------CGTGCTGA  511
              ||||| ||||||||||| |||||| ||| | ||||| |    ||||      | |  |||
Sbjct  16188  CCGCCCTCGCGTACGGCTTGGACACGAACGCCGGCGCGGAAGGCAAGTCGAACATTTTGA  16129

Query  512    TCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCT  571
              |||||||| ||||||| ||||| || ||||||||  || |||| |||||| | |||||||
Sbjct  16128  TCTTCGACTTGGGCGGAGGCACGTTTGATGTGTCCATCTTGTCGATTGAGAACGGCATCT  16069

Query  572    TCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCC  631
              |||| |||||| |||| |  |||||||||||| ||||||| || ||||| |||     | 
Sbjct  16068  TCGAAGTCAAGTCCACGGGCGGTGACACGCACTTGGGTGGCGAAGACTTTGACTCGAACA  16009

Query  632    TGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAA---GGACATCACGGAGA  688
              |||| ||| |||| |     ||||||||||||||| ||   ||   ||||   |||  | 
Sbjct  16008  TGGTCGACTACTTGATCACCGAGTTCAAGCGCAAGAACAAGAACTTGGACCCGACGACG-  15950

Query  689    ACCAGCGTGCTC--TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTC  746
                | ||  | ||  | || || ||||| ||||| ||||||  ||||||||| | ||| ||
Sbjct  15949  -TCGGCCCGGTCCATGCGCCGCCTGCGCACGGCGTGCGAGTCTGCCAAGCGCATGCTTTC  15891

Query  747    GTCGTCGGCTCAG-GCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACT  805
                || |  | ||| ||   ||||||  | ||||| || ||||| ||  | ||||| | ||
Sbjct  15890  CACGACCAC-CAGCGCCACCATCGAAGTGGACTCGCTCTTCGAAGGTGTGGACTTTAGCT  15832

Query  806    CGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTC---CGCAAGACGA  862
              ||||||| || || ||    || |||    |   || ||| | ||||   |||   ||| 
Sbjct  15831  CGACCATGACGCGCGCCAAGTTTGAGTCGCTCAACGACGAGTGCTTCAAGCGC---ACGG  15775

Query  863    TGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCA-----  917
                ||  |||||  ||||||| |||  ||||||||  ||     ||||| |||  |     
Sbjct  15774  AAGAAACCGTGTTGAAGGTGTTGCAAGACGCCAACATG-----GAGCCCGGTCAAATCAC  15720

Query  918    CGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGA  977
              |||  ||||||| |||||||| || ||||||||||| ||||||||  |  ||||||||| 
Sbjct  15719  CGAACTGGTGCTCGTGGGCGGGTCCACGCGTATCCCCAAGGTGCAAAACATGCTGTCGGG  15660

Query  978    CTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGG  1037
                | ||   |||||||||||  | ||||||||||||||| || || || |||||||||||
Sbjct  15659  TCTGTTTGGCGGCAAGGAGCTGAGCAAGTCCATCAACCCCGATGAAGCCGTGGCGTACGG  15600

Query  1038   TGCGACCGTGCAGGCGGCCATCCTGAGCGGCA-ACGACTCGTCG-GAGAAGCTGCAGGAC  1095
               ||| ||||||| |  || |||||||||||||  ||   || || ||  | ||       
Sbjct  15599  CGCGGCCGTGCAAGGCGCGATCCTGAGCGGCATCCGCAACGACGCGACCAACT-----CG  15545

Query  1096   CTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATG  1155
               || | ||| |||||||||||||  ||||||||||  | |||  ||  ||    ||||||
Sbjct  15544  TTGTTGCTGGTGGACGTGACGCCCTTGTCTCTGGGCATTGAGTTGGTGGGCAAGGTCATG  15485

Query  1156   ACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACG  1215
               ||  |||||||  ||| |||||| || | |||  ||||||| |||  |  | | |||| 
Sbjct  15484  TCGGTGCTGATCAAGCGCAACACGGCGATCCCGGTCAAGAAGACGCGCATCTACACGACC  15425

Query  1216   TACGCCGACAACCAG-CCTGG-----GGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCC  1269
               | |  |||  |||| ||  |     |||  |||||      | ||| ||||||||| | 
Sbjct  15424  GAAGAAGACTTCCAGACCACGGAAAAGGTCGTCATC------TACGAAGGCGAGCGCGCG  15371

Query  1270   ATGACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCC-  1328
                |  |   |||||||||  ||| ||  ||||  |  |    ||||||   | |  ||| 
Sbjct  15370  TCGGTGGTGGACAACAACAAGCTCGGTGAGTTTGAAATCACGGGCATCGAGCGC--GCCA  15313

Query  1329   -TCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACG  1387
                ||||| | |||  |  | || |||||||| || |||||||| ||||||||| || |||
Sbjct  15312  AGCGCGGCGAGCCCAAATTGGAAGTGACGTTTGAGATCGACGCCAACGGCATCTTGCACG  15253

Query  1388   TGTCGGCTG--TGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAA  1445
              ||   ||||   ||| |||   || |||    ||||| ||| ||||||||  ||| ||  
Sbjct  15252  TG--AGCTGCAAGGACAAGAAGACCGGCGCCAAGAACCAGACCACGATCAGCAACAACCG  15195

Query  1446   GGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTC  1505
               |||||  |    ||||  |||||||||||||||||    ||||| ||||||||||||  
Sbjct  15194  CGGCCGGTTGAGCCAGGAAGACATTGACCGCATGGTCGACGAGGCGGAGAAGTACAAGAA  15135

Query  1506   GGAGGACG  1513
              || |||||
Sbjct  15134  GGCGGACG  15127

 Score = 198 bits (219),  Expect = 7e-48
 Identities = 258/357 (72%), Gaps = 0/357 (0%)
 Strand=Plus/Minus

Query  32     TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
              |||| ||||| ||||| || ||||||||||||||||| |||||| || ||| ||  ||||
Sbjct  16707  TCGGGATCGATCTCGGTACCACCTACTCGTGCGTGGGTGTGTGGAAGGACGGCCAAGTGG  16648

Query  92     AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
              ||||||| ||||| | | | ||||||||||| ||||| || |  || || ||||  ||  
Sbjct  16647  AAATCATTGCCAATGCCGAAGGCAACCGCACGACCCCTTCGTGGGTGGCGTTCAACGAAA  16588

Query  152    CGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGG  211
              | || ||| | |||||||| || || ||   |||||  ||    |||||   ||||||||
Sbjct  16587  CCGAGCGCTTGATCGGTGAAGCTGCTAAACTTCAGGCCGCGTCCAACGCCACCAACACGG  16528

Query  212    TGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACA  271
              ||||||||||||| ||| | || |||||||| ||    |||||| ||||  ||   ||| 
Sbjct  16527  TGTTCGACGCCAAGCGTATCATTGGCCGCAACTTTAGCGACCCCATCGTGAAGAAGGACG  16468

Query  272    TCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGC  331
               |  |||||  || ||  |  | ||   ||| |  ||||||||||||  ||||   ||| 
Sbjct  16467  CCGCGCACTTCCCCTTTAAGATTACCAAGGGAGAAGGTGACAAGCCGTTGATCGAAGTGT  16408

Query  332    AGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGA  388
                |||   |||||  ||||||  |||   ||||| || |||||||| ||||||||||
Sbjct  16407  CTTTCCGCGGCGAAGCCAAGAGCTTCACCCCCGAAGAAATCTCGTCGATGGTGCTGA  16351

>PHPA:scaffold_75 NW_008649061.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.75, whole genome shotgun 
sequence
Length=275807

 Score = 447 bits (495),  Expect = 8e-123
 Identities = 476/638 (75%), Gaps = 59/638 (9%)
 Strand=Plus/Plus

Query  504    CGTGCTGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGA  563
              ||||||||| ||||| ||||    |||||       ||||| |   ||| || |||||||
Sbjct  41297  CGTGCTGATTTTCGATCTGG----CGGCAG------TGTGTGTGCTCTGCCCGTTGAGGA  41346

Query  564    GGGCATCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGA  623
              || ||||||| |||   ||| |||| || |||||||||||| |||||  |||||| ||||
Sbjct  41347  GGACATCTTCAAGGCACAGGACACTACTAGTGACACGCACCAGGGTGACGAGGACCTCGA  41406

Query  624    CAACCGCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCAC  683
              |||| |||| | || ||||||||||||||||||||||  |||||  | |  ||| || | 
Sbjct  41407  CAACTGCCTTGGGGTCCACTTCACGCAGGAGTTCAAGAACAAGC--CTCCTGGAGATTA-  41463

Query  684    GGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCT  743
                 ||||||||||||| || |||||||||||| |  |||||| | ||| || ||| ||||
Sbjct  41464  ---GAACCAGCGTGCTTTTTGTCGTCTGCGGATGAGCTGCGAACATGCGAACCGTGCGCT  41520

Query  744    GTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAA  803
              |||                                           || ||| |||||||
Sbjct  41521  GTCT------------------------------------------GGTATCCACTTCAA  41538

Query  804    CTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGAT  863
              |||||||   |||| |||||| |||||||| | |||||||||| || |||||||||||| 
Sbjct  41539  CTCGACCGCTACTCATGCTCGCTTCGAGGATAAGTGCGGCGACAACATCCGCAAGACGAC  41598

Query  864    GGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGT  923
              |||||||||| ||| |||||||||||||||||||||| |||||| |||||||||| ||||
Sbjct  41599  GGAGCCCGTGAAGACGGTGCTGCGCGACGCCAAGCTGCCGAAGAACCAGGTGCACAAGGT  41658

Query  924    GGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTT  983
              || |||||  |||| ||||  |||  |||  || ||||||||||| |||||| |||||||
Sbjct  41659  GGAGCTGGCCGGCGACTCGGAGCGATTCCATAACGTGCAGCAGCTTCTGTCGTACTTCTT  41718

Query  984    CAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGAC  1043
              |||||||| |||||||| |||||  |||||||||| ||||  | ||||||||||||| ||
Sbjct  41719  CAACGGCACGGAGCCCACCAAGTTGATCAACCCGGTCGAGTGTATGGCGTACGGTGCAAC  41778

Query  1044   CGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCT  1103
              ||||  || | |||| | |||||||||||||||||| ||||| ||||||| ||   || |
Sbjct  41779  CGTGGTGGAGACCATGCCGAGCGGCAACGACTCGTCTGAGAATCTGCAGGTCCAATTTTT  41838

Query  1104   GCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGG  1141
              | ||||||||  || ||| || |||| ||| ||| |||
Sbjct  41839  G-TGGACGTGGTGCTGCTTTCACTGGATCTGGAGGCGG  41875

 Score = 118 bits (130),  Expect = 5e-24
 Identities = 160/222 (72%), Gaps = 11/222 (5%)
 Strand=Plus/Plus

Query  1534   GAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTGAATGACGAG  1593
              ||||| ||||    |||||||| ||||||||||||| || |    ||  ||||  |||||
Sbjct  41893  GAGGCGAAGACTTGGCTGGAGAGCTACGCCTACAGTGTGTG----AGCTTGAAA-ACGAG  41947

Query  1594   AAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTGGACGACAAGGTGACGGAA  1653
              ||| ||||||||||||| | |||||| |||   || | || |||| || |  | ||||||
Sbjct  41948  AAGCTGAAGGAGAAGATTCAGGAAGCCGACGGAAACGTGGCGGACAACGACATAACGGAA  42007

Query  1654   GTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACGAGTCGAAGCAG  1713
               ||||||||| | |||||   ||  | || ||||||||||      | || | ||| |  
Sbjct  42008  ATGATCCAGTTGTTGGACAAGAATTATTCGTTGGAGAAGG------AGGAATAGAAACTT  42061

Query  1714   AAGGAATTGGAGGGCGTGGCCAACCCAGTGTTGCAGAAGATG  1755
              |||||| | || |||||| | || ||| || ||||||| |||
Sbjct  42062  AAGGAAATCGAAGGCGTGTCTAAACCACTGATGCAGAAAATG  42103

>SADI:scaffold_15 supercont1.15 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.15:1:848687:1 
REF
Length=848687

 Score = 445 bits (493),  Expect = 3e-122
 Identities = 836/1208 (69%), Gaps = 72/1208 (6%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| ||||| |||||||| |||||| ||||   |||||||||||| ||||| |||||||
Sbjct  626850  AGGATGCCGGTGCCATTGCTGGCCTCGACGTCAAGCGTATCATCAATGAGCCCACGGCCG  626791

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAG--CG----------CAACGTGC  508
               ||||| ||||||||||| |||||| ||| | ||||  |  ||          |||| | |
Sbjct  626790  CCGCCCTCGCGTACGGCTTGGACACGAACGCCGGCTCGGACGGCAACAAGGCCAACATCC  626731

Query  509     TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
               | |||||||| || || || || ||||||||||||||  |||| || || ||| | ||||
Sbjct  626730  TCATCTTCGATCTCGGTGGTGGTACCTTCGATGTGTCGATCCTCTCGATCGAGAACGGCA  626671

Query  569     TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
               ||||||| |||||| | || |  ||||||||||| || |||||||| || ||||||    
Sbjct  626670  TCTTCGAAGTCAAGTCGACGGGCGGTGACACGCATCTCGGTGGTGAAGATTTCGACTCGA  626611

Query  629     GCCTGGTGGA---CCACTTCACGCAGGAGTTCAAGCGCAAGCAC---CGCAAGGACATCA  682
                | |||| ||   || | ||||   |||||||||||||||| ||    ||   |||   |
Sbjct  626610  ACATGGTCGACTTCCTCGTCAC---GGAGTTCAAGCGCAAGAACAAGGGCCTTGACCCTA  626554

Query  683     CGGAGAACCAGCGTGCTC--TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTAC  740
               ||  |   | ||  ||||  | || ||||| || ||||||||||||   |||||||| | 
Sbjct  626553  CGTCG--TCGGCTCGCTCGATGCGCCGTCTTCGCACGGCCTGCGAGTCGGCCAAGCGCAT  626496

Query  741     GCTGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTT  800
               ||| ||  || || |   ||||  ||| ||  | ||||| || ||||| ||  | |||||
Sbjct  626495  GCTTTCCACGACGACGTCGGCTGCCATTGAAGTCGACTCGCTCTTCGAGGGTGTTGACTT  626436

Query  801     CAACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTC---CGCAA  857
               |   ||||| || || || ||    ||||||    |   ||  || | ||||   |||  
Sbjct  626435  CTCGTCGACGATGACGCGCGCCAAGTTCGAGTCGCTCAACGAAGAGTGCTTCAAGCGC--  626378

Query  858     GACGATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTG--  915
                |||  |||| ||||    ||||||||   |||||||||| |   ||||    ||| |  
Sbjct  626377  -ACGGAGGAGACCGTCCTCAAGGTGCTTGCCGACGCCAAGAT---GAAGCCGGAGGAGAT  626322

Query  916     CAC-GAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTC  974
                || ||| | || || || || || || ||||||||||| ||||||||| |  |||| ||
Sbjct  626321  TACGGAGCTCGTCCTTGTCGGTGGTTCCACGCGTATCCCCAAGGTGCAGAACATGCTCTC  626262

Query  975     GGACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTA  1034
               ||   ||||   ||||||||||| |   ||||| ||||||||||| ||||| || |||||
Sbjct  626261  GGCTGTCTTTGGCGGCAAGGAGCTCTCGAAGTCGATCAACCCGGATGAGGCCGTCGCGTA  626202

Query  1035    CGGTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGA  1094
               ||||||  |||| ||||  ||||||||    |||    | ||| |   || ||  || ||
Sbjct  626201  CGGTGCTGCCGTCCAGGGTGCCATCCTCTCGGGC----ATTCG-CAACGACGC--CACGA  626149

Query  1095    CCT-GCTTCTGC---TGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTG  1150
                || ||| || |   | || ||||||||||| || || ||| | ||||||| |||  | |
Sbjct  626148  ACTCGCTCCTCCTCGTCGATGTGACGCCGCTCTCGCTCGGTATTGAGACGGTCGGCCGCG  626089

Query  1151    TCATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCT  1210
               ||||| ||  ||| |||  ||| |||||| |  | |||| ||||||| |||     | | 
Sbjct  626088  TCATGTCGGTGCTCATCAAGCGCAACACGGCCATCCCGATCAAGAAGACGCGTGTCTACA  626029

Query  1211    CGACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCA  1270
               | ||| |  | ||| ||||| |   ||||  | |     | | ||| ||||||||| || 
Sbjct  626028  CCACGGAGTCGGACTACCAGACCCAGGTGAACGTTGTCATCTACGAAGGCGAGCGCGCC-  625970

Query  1271    TGACGCG--CGACAACAACCTGCTGGGCAAGTTCA--ACCT--GGACGGCATCCCTCCCA  1324
               || || |  | ||||||||  ||| ||| ||||||  | ||  || |   | | | || |
Sbjct  625969  TG-CGTGGACCACAACAACAAGCTCGGCGAGTTCACGATCTCGGGCCTTGAGCGCGCCAA  625911

Query  1325    TGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGA  1384
                    ||||| | ||||||| |||| || |||||||| ||||| || ||||| ||||| |
Sbjct  625910  ----GCGCGGCGAGCCGCAGGTCGAAGTCACGTTCGAGATCGATGCCAACGGTATCCTCA  625855

Query  1385    ACGTGTCGGC---TGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACG  1441
               ||||||||||    |   ||||| | |  | |||||    | |||  |||||| ||||| 
Sbjct  625854  ACGTGTCGGCCCGCGACAAGAAGACGAACGCCAAGG---CCGAGACGACGATCTCGAACA  625798

Query  1442    ACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACA  1501
               || | ||||||||    ||||||||||| |||||||||||    ||||||||||||| ||
Sbjct  625797  ACCACGGCCGCCTGAGCCAGGCTGACATCGACCGCATGGTCGAAGAGGCCGAGAAGTTCA  625738

Query  1502    AGTCGGAGGA---CGAGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACT  1558
               ||  ||| ||   ||||||   |||| |    |||||||||   ||| |||| |||| ||
Sbjct  625737  AGAAGGAAGATGCCGAGGCCCTCAAGAA---GATCGAGGCCCGCAACTCGCTCGAGAGCT  625681

Query  1559    ACGCCTAC  1566
                |  ||||
Sbjct  625680  TCATCTAC  625673

 Score = 434 bits (480),  Expect = 5e-119
 Identities = 828/1206 (69%), Gaps = 68/1206 (6%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| ||||| ||||||||||||||| ||||   ||| |||||||||||||| |||||||
Sbjct  727793  AGGATGCCGGTGCCATTGCCGGCCTCGACGTCAAGCGCATCATCAACGAGCCCACGGCCG  727852

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCG------------AGCGCAACGTGC  508
               ||||| ||||||||||| |||||| ||| | ||| |            ||  |||| | |
Sbjct  727853  CCGCCCTCGCGTACGGCTTGGACACGAACGCCGGTGCCGATGGCTCGAAGACCAACATCC  727912

Query  509     TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
               | |||||||| || || || || ||||||||||||||  |||| || || ||| | ||||
Sbjct  727913  TCATCTTCGATCTCGGTGGTGGTACCTTCGATGTGTCGATCCTCTCGATCGAGAACGGCA  727972

Query  569     TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
               ||||||| |||||| | || |  ||||||||||| || |||||||| || ||||||    
Sbjct  727973  TCTTCGAAGTCAAGTCGACGGGCGGTGACACGCATCTCGGTGGTGAAGATTTCGACTCGA  728032

Query  629     GCCTGGTGGAC---CACTTCACGCAGGAGTTCAAGCGCAAGCACC---GCAAGGACATCA  682
                | |||| |||   | | |||||   ||||||||||||||| ||    ||   |||  ||
Sbjct  728033  ACATGGTCGACTTCCTCGTCACG---GAGTTCAAGCGCAAGAACAAGGGCCTTGACCCCA  728089

Query  683     CGGAGAACCAGCGTGCTC--TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTAC  740
               ||  |   | ||  ||||  | || ||||| || ||||||||||||   |||||||| | 
Sbjct  728090  CGTCGT--CGGCTCGCTCGATGCGCCGTCTCCGCACGGCCTGCGAGTCGGCCAAGCGCAT  728147

Query  741     GCTGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTT  800
               ||| ||  || || |   |||||  |||||| |||| || || ||||| ||| | |||||
Sbjct  728148  GCTTTCCACGACGACGTCGGCTTCGATCGAGGTTGATTCGCTCTTCGAGGGCGTTGACTT  728207

Query  801     CAACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAG--  858
               |   ||||| || || || ||    ||||||    |   ||  || | ||||   |||  
Sbjct  728208  CTCGTCGACGATGACGCGCGCCAAGTTCGAGTCGCTCAACGAAGAGTGCTTC---AAGCG  728264

Query  859     -ACGATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTG--  915
                |||  |||| ||||    ||||||||   |||||||||  ||      |||| ||||  
Sbjct  728265  CACGGAGGAGACCGTCCTCAAGGTGCTCGCCGACGCCAACATGC-----AGCCCGGTGAC  728319

Query  916     --CACG-AGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTG  972
                 |||| || | || || || ||||| || ||||||||||| ||||||||| |  |||| 
Sbjct  728320  ATCACGGAGCTCGTCCTTGTCGGCGGTTCCACGCGTATCCCCAAGGTGCAGAACATGCTC  728379

Query  973     TCGGACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCG  1032
               ||||   |||||  ||||||||||| |   ||||| ||||||||||| ||||| || |||
Sbjct  728380  TCGGCTGTCTTCGGCGGCAAGGAGCTCTCGAAGTCGATCAACCCGGATGAGGCCGTCGCG  728439

Query  1033    TACGGTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAG  1092
               ||||||||  |||| ||||  ||||||||    ||||     ||  |   || ||  || 
Sbjct  728440  TACGGTGCTGCCGTCCAGGGCGCCATCCTCTCGGGCA-----TCCGCAACGACGC--CAC  728492

Query  1093    GACCT-GCTTCTGC---TGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGG  1148
               || || ||| || |   | || ||||||||||| || || ||| | |||   |  ||   
Sbjct  728493  GAACTCGCTCCTCCTCGTCGATGTGACGCCGCTCTCGCTCGGTATTGAGCTTGTTGGCAA  728552

Query  1149    TGTCATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTT  1208
                |||||| ||  ||| |||  ||| |||||| || | ||   ||||||| |||  |  | 
Sbjct  728553  GGTCATGTCGGTGCTCATCAAGCGCAACACGGCGATTCCCGTCAAGAAGACGCGCATCTA  728612

Query  1209    CTCGACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTC  1268
               | ||||  | |  |||   ||| |   || |    ||    | ||||| |||||||| | 
Sbjct  728613  CACGACCGAAGAGGACTGGCAGACGACGGAGAAGGTCGTTATCTTCGAAGGCGAGCG-TG  728671

Query  1269    CATGACGCG-CGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGC  1327
               | ||   || ||||||||||   || ||| ||||| |  |    |||||    | |  ||
Sbjct  728672  CCTGCGTCGTCGACAACAACAAACTCGGCGAGTTCGAGATCTCGGGCATTGAGCGC--GC  728729

Query  1328    C--TCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAA  1385
               |   ||||| | |||||||||||| || |||||||| ||||| || ||||| |||||  |
Sbjct  728730  CAAGCGCGGCGAGCCGCAGATCGAAGTCACGTTCGAGATCGATGCCAACGGTATCCTCCA  728789

Query  1386    CGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAA  1445
               ||| |||||    || |||   |||||     |||||  ||  |||||| | ||| ||  
Sbjct  728790  CGTCTCGGCCCGCGACAAGAAGACGGGTGCCAAGAACGCGACGACGATCTCCAACAACCG  728849

Query  1446    GGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTC  1505
                ||||||||| | |||   |||||||||||||||||    ||||||||||||| ||||  
Sbjct  728850  CGGCCGCCTCACCCAGCAGGACATTGACCGCATGGTCGAAGAGGCCGAGAAGTTCAAGAA  728909

Query  1506    GGAGGAC-----GAGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACTAC  1560
               ||| |||     || |||  ||||   |||||||| |||   ||||  || |||  ||||
Sbjct  728910  GGATGACGCGCAGATGCT--CAAG---CGCATCGACGCCCGCAACGACCTCGAGGGCTAC  728964

Query  1561    GCCTAC  1566
                 ||||
Sbjct  728965  CTCTAC  728970

 Score = 220 bits (243),  Expect = 2e-54
 Identities = 266/357 (75%), Gaps = 4/357 (1%)
 Strand=Plus/Minus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               |||| ||||| ||||| || || ||||||||||| || || ||| || ||| ||  || |
Sbjct  627309  TCGGTATCGATCTCGGTACGACGTACTCGTGCGTCGGTGTCTGGAAGGACGGCCAGGTCG  627250

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               | ||||| ||||||  | | || |||||||| || ||||| |  ||||| ||||  || |
Sbjct  627249  AGATCATTGCCAACAGCGAAGGTAACCGCACGACGCCGTCGTGGGTCGCTTTCAACGAGT  627190

Query  152     CGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCAC-AACACG  210
               |||| ||||||||||||||||||||||||   ||||  |||  |||||| ||| ||||||
Sbjct  627189  CGGAGCGCCTCATCGGTGACGCCGCCAAGCTCCAGGCTGCCTCGAACGC-CACGAACACG  627131

Query  211     GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
               || ||||||||||| ||| | || || |||   |||||||||||  ||||| ||   |||
Sbjct  627130  GTCTTCGACGCCAAGCGTATCATTGGTCGCGCTTTCTCGGACCCGATCGTCAAGAAGGAC  627071

Query  271     ATCAAGCACTGGCCGTTCCA-AGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGT  329
                     ||||  |||||| | | || ||  ||| |  |  ||||||||||  |||  |||
Sbjct  627070  GCTGCTCACTTCCCGTTCAAGATTGTCG-AGGGTGATGAGGACAAGCCGCTCATCCAGGT  627012

Query  330     GCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
                  |||||||||||||  ||||   |||   ||||||||||||||||| ||||| ||
Sbjct  627011  CTCGTTCAAGGGCGAGGACAAGCGCTTCACGCCCGAGGAGATCTCGTCGATGGTCCT  626955

 Score = 210 bits (232),  Expect = 1e-51
 Identities = 265/358 (74%), Gaps = 6/358 (2%)
 Strand=Plus/Plus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               |||| ||||| ||||| || || ||||||||||| || || ||| || ||| ||  || |
Sbjct  630839  TCGGTATCGATCTCGGTACGACGTACTCGTGCGTCGGTGTCTGGAAGGACGGCCAGGTCG  630898

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               | ||||| ||||||  | | || |||||||| || ||||| |  ||||| ||||  ||  
Sbjct  630899  AGATCATTGCCAACAGCGAAGGTAACCGCACGACGCCGTCGTGGGTCGCTTTCAACGAAG  630958

Query  152     CGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCAC-AACACG  210
               | |||||||||||||| ||||||||||||   ||||  |||  |||||| ||| ||||||
Sbjct  630959  CCGAACGCCTCATCGGCGACGCCGCCAAGCTCCAGGCTGCCTCGAACGC-CACGAACACG  631017

Query  211     GTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGAC  270
               || ||||||||||| ||| | || || |||   |||||||||||  ||||| ||   |||
Sbjct  631018  GTCTTCGACGCCAAGCGTATCATTGGTCGCGCTTTCTCGGACCCGATCGTCAAGAAGGAC  631077

Query  271     ATCAAGCACTGGCCGTTCCAAGTGACGTC--GGGCGCCGGTGACAAGCCGCAGATCACGG  328
                     ||||  ||||| ||||   ||||  ||| |  |  ||||||||||  |||  ||
Sbjct  631078  GCTGCTCACTTCCCGTT-CAAG-ATCGTCGAGGGTGATGAGGACAAGCCGCTCATCCAGG  631135

Query  329     TGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
               |   |||||||||||||  ||||   |||   ||||||||||||||||| ||||| ||
Sbjct  631136  TCTCGTTCAAGGGCGAGGACAAGCGCTTCACGCCCGAGGAGATCTCGTCGATGGTCCT  631193

 Score = 200 bits (221),  Expect = 2e-48
 Identities = 215/284 (76%), Gaps = 18/284 (6%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||| ||||| |||||||| |||||| ||||   ||| |||||||||||||| |||||||
Sbjct  631298  AGGATGCCGGTGCCATTGCTGGCCTCGACGTCAAGCGCATCATCAACGAGCCCACGGCCG  631357

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAG--CG----------CAACGTGC  508
               ||||| ||||||||||| |||||| ||| | ||||  |  ||          |||| | |
Sbjct  631358  CCGCCCTCGCGTACGGCTTGGACACGAACGCCGGCTCGGACGGCAACAAGGCCAACATCC  631417

Query  509     TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
               | |||||||| || || || || ||||||||||||||  |||| || || ||| | ||||
Sbjct  631418  TCATCTTCGATCTCGGTGGTGGTACCTTCGATGTGTCGATCCTCTCGATCGAGAACGGCA  631477

Query  569     TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
               ||||||| |||||| | || |  ||||||||||| || |||||||| || ||||||    
Sbjct  631478  TCTTCGAAGTCAAGTCGACGGGCGGTGACACGCATCTCGGTGGTGAAGATTTCGACTCGA  631537

Query  629     GCCTGGTGGA---CCACTTCACGCAGGAGTTCAAGCGCAAGCAC  669
                | |||| ||   || | ||||   |||||||||||||||| ||
Sbjct  631538  ACATGGTCGACTTCCTCGTCAC---GGAGTTCAAGCGCAAGAAC  631578

 Score = 171 bits (189),  Expect = 9e-40
 Identities = 330/473 (70%), Gaps = 28/473 (6%)
 Strand=Plus/Plus

Query  1108    GACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATC  1167
               || ||||||||||| || || ||| | ||||||| |||  | |||||| ||  ||| |||
Sbjct  632006  GATGTGACGCCGCTCTCGCTCGGTATTGAGACGGTCGGCCGCGTCATGTCGGTGCTCATC  632065

Query  1168    GCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAAC  1227
                 ||| |||||| |  | |||| ||||||| |||     | | ||||  | |  ||| ||
Sbjct  632066  AAGCGCAACACGGCCATCCCGATCAAGAAGACGCGCGTCTACACGACTGAGGAAGACTAC  632125

Query  1228    CAGCCTGGGGT-GCTCA-TCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCG--CGACAA  1283
               ||| |   ||| | |   | ||  | | ||| ||||||||| || || || |  | ||||
Sbjct  632126  CAGACGCAGGTCGATGTGTGCA--TCTACGAAGGCGAGCGCGCC-TG-CGTGGACCACAA  632181

Query  1284    CAACCTGCTGGGCAAGTTCA--ACCTGGACGGCATCCCTCCCATGCCT--CGCGGTGTGC  1339
               ||||  ||| ||| ||||||  | || |  ||||||   | |  |||   ||||| | ||
Sbjct  632182  CAACAAGCTCGGCGAGTTCACGATCTCG--GGCATCGAGCGC--GCCAAGCGCGGCGAGC  632237

Query  1340    CGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGG  1399
               ||||| || | ||||| ||||| |||||||| ||||| ||||| ||||| |||||  | |
Sbjct  632238  CGCAGGTCCAGGTGACCTTCGAGATCGACGCCAACGGTATCCTCAACGTTTCGGCGCTCG  632297

Query  1400    AGAAGTCAACG---GGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCT  1456
               | |||   |||   | |||||    | |||  |||||||  ||| |||| || |||||| 
Sbjct  632298  ACAAGAAGACGAACGCCAAGGC---CGAGACGACGATCAACAACAACAACGGTCGCCTCA  632354

Query  1457    CGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGA---CG  1513
               ||||||  |||||||||||||||||  | || |||||||||| ||||  ||| ||   ||
Sbjct  632355  CGCAGGAGGACATTGACCGCATGGTTGCTGACGCCGAGAAGTTCAAGAAGGACGACGCCG  632414

Query  1514    AGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTAC  1566
               |||    |||| |    |||||||||   ||| |||| |||| || |  ||||
Sbjct  632415  AGGTGCTCAAGAA---GATCGAGGCCCGCAACTCGCTCGAGAGCTTCATCTAC  632464

 Score = 49.1 bits (53),  Expect = 0.008
 Identities = 43/54 (80%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACC  85
               |||| ||||| ||||| || || ||||||||||| || || ||| || ||| ||
Sbjct  739820  TCGGTATCGATCTCGGTACGACGTACTCGTGCGTCGGTGTCTGGAAGGACGGCC  739767

 Score = 39.2 bits (42),  Expect = 3.9
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  361     CCCGAGGAGATCTCGTCCATGGTGCT  386
               ||||||||||||||||| ||||| ||
Sbjct  727663  CCCGAGGAGATCTCGTCGATGGTCCT  727688

>PHPA:scaffold_11 NW_008648997.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.11, whole genome shotgun 
sequence
Length=1562868

 Score = 445 bits (493),  Expect = 3e-122
 Identities = 483/636 (76%), Gaps = 36/636 (6%)
 Strand=Plus/Plus

Query  682      ACGGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACG  741
                |||||||| |||  |||||||| | || ||||| | ||||||||||||        ||||
Sbjct  1386384  ACGGAGAATCAGTATGCTCTTCATTGTTTGCGGGCTGCCTGCGAGCGTAT------TACG  1386437

Query  742      CTGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTC  801
                  |||||||||||| |||| || |||||||||  |||||||||||||| |||  | ||||
Sbjct  1386438  GCGTCGTCGTCGGC-CAGG-TTGCATCGAGATCTACTCTCTGTTCGACAGCACGGGCTTC  1386495

Query  802      AACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACG  861
                ||||| |||| ||| | || |||||| ||||||||||||||| |||||||||  |||  |
Sbjct  1386496  AACTCAACCACCACGCTTGATCGTTTTGAGGACATGTGCGGCAACTACTTCC-AAAGGTG  1386554

Query  862      ATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAG  921
                ||||| ||| |||| ||| || | |||||||||||| |||| |||||| ||||||||| |
Sbjct  1386555  ATGGACCCCTTGGAAAAGTTGTTCCGCGACGCCAAGGTGTCCAAGAGCGAGGTGCACGGG  1386614

Query  922      GTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTC  981
                || || |||||||||||||| || |||| ||| |||||||||| |||||||||| |||||
Sbjct  1386615  GTTGTCCTGGTGGGCGGCTCCACCCGTA-CCCCAAGGTGCAGCCGCTGCTGTCGTACTTC  1386673

Query  982      TTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCG  1041
                 | |||| || |||||||| |||||||||||||    ||| |||||||   ||||||   
Sbjct  1386674  GTTAACGACATGGAGCCCATCAAGTCCATCAACAGCTACGCGGCTGTGATCTACGGT---  1386730

Query  1042     ACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTT  1101
                       ||   ||| | || ||||||||| ||||||| |||||||||||||  ||||| 
Sbjct  1386731  -------AGTTTGCCGTTCTAAGCGGCAACAACTCGTCAGAGAAGCTGCAGGTACTGCTA  1386783

Query  1102     CTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACG  1161
                ||||   | | ||||||||| |  ||  || | ||||| | || | | |||| | ||| |
Sbjct  1386784  CTGC-AAATGCGACGCCGCTAT-GCTAAGTATGGAGACAGTCGATTGAGTCACGTCGAAG  1386841

Query  1162     CTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCC  1221
                ||||||||| | |||| | |||||||| ||||||| | ||||||||||||||  || || 
Sbjct  1386842  CTGATCGCGTGTAACATGTCGGTGCCGGCCAAGAACTTGCAGACGTTCTCGATATAAGCG  1386901

Query  1222     GACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGAC  1281
                ||||||||| ||||  |  | ||       |||       |||| || ||| ||||  ||
Sbjct  1386902  GACAACCAGTCTGGATTATTTAT-------TTC-------AGCGTTCGATGGCGCGATAC  1386947

Query  1282     AACAACCTGCTGGGCAAGTTCAACCTGGACGGCATC  1317
                |||||||||||| |  || |||| || |||||| ||
Sbjct  1386948  AACAACCTGCTGAGTGAGCTCAATCTCGACGGCGTC  1386983

 Score = 81.5 bits (89),  Expect = 1e-12
 Identities = 64/77 (83%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  311      ACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGA  370
                |||||||   ||||||  ||||| ||||||| |||  |||||||||| | | ||||||||
Sbjct  1386179  ACAAGCCATTGATCACAATGCAGGTCAAGGGTGAGAGCAAGACGTTCAACCTCGAGGAGA  1386238

Query  371      TCTCGTCCATGGTGCTG  387
                |||||||||||| ||||
Sbjct  1386239  TCTCGTCCATGGAGCTG  1386255

 Score = 63.5 bits (69),  Expect = 3e-07
 Identities = 48/57 (84%), Gaps = 0/57 (0%)
 Strand=Plus/Plus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGG  457
                |||| ||||||||||| || ||||| || || || | |||||||||||||| |||||
Sbjct  1386331  AGGATGCCGGCGCCATCGCTGGCCTAAAAGTTCTACATATCATCAACGAGCTGACGG  1386387

>PHPA:scaffold_7 NW_008648993.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.7, whole genome shotgun 
sequence
Length=2078921

 Score = 445 bits (493),  Expect = 3e-122
 Identities = 483/636 (76%), Gaps = 36/636 (6%)
 Strand=Plus/Minus

Query  682      ACGGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACG  741
                |||||||| |||  |||||||| | || ||||| | ||||||||||||        ||||
Sbjct  1546593  ACGGAGAATCAGTATGCTCTTCATTGTTTGCGGGCTGCCTGCGAGCGTAT------TACG  1546540

Query  742      CTGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTC  801
                  |||||||||||| |||| || |||||||||  |||||||||||||| |||  | ||||
Sbjct  1546539  GCGTCGTCGTCGGC-CAGG-TTGCATCGAGATCTACTCTCTGTTCGACAGCACGGGCTTC  1546482

Query  802      AACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACG  861
                ||||| |||| ||| | || |||||| ||||||||||||||  |||||||||  |||  |
Sbjct  1546481  AACTCAACCACCACGCTTGATCGTTTTGAGGACATGTGCGGTAACTACTTCCA-AAGGTG  1546423

Query  862      ATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAG  921
                ||||| ||| |||| ||| || | ||||||||||||||||| |||||| ||||||||| |
Sbjct  1546422  ATGGACCCCTTGGAAAAGTTGTTCCGCGACGCCAAGCTGTCCAAGAGCGAGGTGCACGGG  1546363

Query  922      GTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTC  981
                || || |||||||||||||| || |||| ||| |||||||||| |||||||||| |||| 
Sbjct  1546362  GTTGTCCTGGTGGGCGGCTCCACCCGTA-CCCCAAGGTGCAGCCGCTGCTGTCGTACTTT  1546304

Query  982      TTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCG  1041
                |||||||  | |||||||| |||||||||||||    ||| |||||||   ||||||   
Sbjct  1546303  TTCAACGATATGGAGCCCATCAAGTCCATCAACAGCTACGCGGCTGTGATCTACGGT---  1546247

Query  1042     ACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTT  1101
                       ||   ||| | || ||||||||| ||||||| |||||||||||||  ||||| 
Sbjct  1546246  -------AGTTTGCCGTTCTAAGCGGCAACAACTCGTCAGAGAAGCTGCAGGTACTGCTA  1546194

Query  1102     CTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACG  1161
                ||||   | | ||||||||| |  ||  || | ||||| | || | | |||| | ||| |
Sbjct  1546193  CTGC-AAATGCGACGCCGCTAT-GCTAAGTATGGAGACAGTCGATTGAGTCACGTCGAAG  1546136

Query  1162     CTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCC  1221
                ||||||||| | |||| | |||||||| ||||||| | ||||||||||||||  || || 
Sbjct  1546135  CTGATCGCGTGTAACATGTCGGTGCCGGCCAAGAACTTGCAGACGTTCTCGATATAAGCG  1546076

Query  1222     GACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGAC  1281
                ||||||||| ||||  |  | ||       |||       |||| || ||| ||||  ||
Sbjct  1546075  GACAACCAGTCTGGATTATTTAT-------TTC-------AGCGTTCGATGGCGCGATAC  1546030

Query  1282     AACAACCTGCTGGGCAAGTTCAACCTGGACGGCATC  1317
                |||||||||||| |  || |||| || |||||| ||
Sbjct  1546029  AACAACCTGCTGAGTGAGCTCAATCTCGACGGCGTC  1545994

 Score = 81.5 bits (89),  Expect = 1e-12
 Identities = 64/77 (83%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  311      ACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGA  370
                |||||||   ||||||  ||||| ||||||| |||  |||||||||| | | ||||||||
Sbjct  1546798  ACAAGCCATTGATCACAATGCAGGTCAAGGGTGAGAGCAAGACGTTCAACCTCGAGGAGA  1546739

Query  371      TCTCGTCCATGGTGCTG  387
                |||||||||||| ||||
Sbjct  1546738  TCTCGTCCATGGAGCTG  1546722

 Score = 63.5 bits (69),  Expect = 3e-07
 Identities = 48/57 (84%), Gaps = 0/57 (0%)
 Strand=Plus/Minus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGG  457
                |||| ||||||||||| || ||||| || || || | |||||||||||||| |||||
Sbjct  1546646  AGGATGCCGGCGCCATCGCTGGCCTAAAAGTTCTACATATCATCAACGAGCTGACGG  1546590

>PHPA:scaffold_28 NW_008649014.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.28, whole genome shotgun 
sequence
Length=808817

 Score = 435 bits (482),  Expect = 1e-119
 Identities = 483/637 (76%), Gaps = 38/637 (6%)
 Strand=Plus/Minus

Query  682     ACGGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACG  741
               |||||||| |||  |||||||| | || ||||| |  ||||||||||||       ||| 
Sbjct  612088  ACGGAGAATCAGTATGCTCTTCATTGTTTGCGGGCTACCTGCGAGCGTGT------TACT  612035

Query  742     CTGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTC  801
                 |||| ||||||| |||| || ||||| |||  |||||||||||||  |||  | ||||
Sbjct  612034  GCGTCGCCGTCGGC-CAGG-TTGCATCGGGATCTACTCTCTGTTCGATAGCACGGGCTTC  611977

Query  802     AACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACG  861
               ||||| |||| ||| | || |||||| ||||||||||||||| |||||||||  |||  |
Sbjct  611976  AACTCAACCACCACGCTTGATCGTTTTGAGGACATGTGCGGCAACTACTTCCA-AAGGTG  611918

Query  862     ATGGAGCCCGTGGAGAAGGT-GCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGA  920
               ||||| ||| | |  ||||| | | ||||||||||||||||| |||||| ||||||||| 
Sbjct  611917  ATGGACCCCTTTGGAAAGGTTGTTCCGCGACGCCAAGCTGTCCAAGAGCGAGGTGCACGG  611858

Query  921     GGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTT  980
               ||| || |||||||||||||| || |||| ||| |||| ||||| |||||||||||||||
Sbjct  611857  GGTTGTCCTGGTGGGCGGCTCCACCCGTACCCC-AAGGAGCAGCCGCTGCTGTCGGACTT  611799

Query  981     CTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGC  1040
               |||||||  ||||||| ||| |||||||||||||    ||| ||||||||  ||||||  
Sbjct  611798  CTTCAACAACAAGGAGACCATCAAGTCCATCAACAGCTACGCGGCTGTGGTCTACGGT--  611741

Query  1041    GACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCT  1100
                        |   ||| | || || |||||| ||||||| |||||||||||||  | |||
Sbjct  611740  --------TGTTTGCCGTTCTAAGGGGCAACAACTCGTCAGAGAAGCTGCAGGTACAGCT  611689

Query  1101    TCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGAC  1160
                ||||   | | ||||||||| |  ||  || | ||||| | || | | |||| ||||| 
Sbjct  611688  ACTGC-AAATGCGACGCCGCTAT-GCTAAGTATGGAGACAGTCGATTGAGTCACGACGAA  611631

Query  1161    GCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGC  1220
               |||||||||| | |||||| |||||||||||||||||| ||||||||||||||  || ||
Sbjct  611630  GCTGATCGCGTGTAACACGTCGGTGCCGACCAAGAAGTTGCAGACGTTCTCGATATAAGC  611571

Query  1221    CGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGA  1280
                ||||||||| ||||  |  | ||       |||       |||| || ||||||||  |
Sbjct  611570  GGACAACCAGTCTGGATTATTTAT-------TTC-------AGCGTTCGATGACGCGATA  611525

Query  1281    CAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATC  1317
               ||||||||||||| |  | ||||| || |||||| ||
Sbjct  611524  CAACAACCTGCTGAGTGA-TTCAATCTCGACGGCGTC  611489

 Score = 82.4 bits (90),  Expect = 4e-13
 Identities = 63/75 (84%), Gaps = 0/75 (0%)
 Strand=Plus/Minus

Query  311     ACAAGCCGCAGATCACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGA  370
               |||||||   ||||||  ||||| ||||||  |||  |||||||||||| ||||||||||
Sbjct  612293  ACAAGCCATTGATCACAATGCAGGTCAAGGATGAGAGCAAGACGTTCCACCCCGAGGAGA  612234

Query  371     TCTCGTCCATGGTGC  385
               |||||||||||| ||
Sbjct  612233  TCTCGTCCATGGAGC  612219

 Score = 63.5 bits (69),  Expect = 3e-07
 Identities = 48/57 (84%), Gaps = 0/57 (0%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGG  457
               |||| ||||||||||  || ||||| || || |||| |||||||||||||| |||||
Sbjct  612141  AGGATGCCGGCGCCACCGCTGGCCTAAAAGTTCTGCATATCATCAACGAGCTGACGG  612085

>PYIR:scaffold_1726 pir_scaffold_1726 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_1726:1:5317:1 
REF
Length=5317

 Score = 432 bits (478),  Expect = 2e-118
 Identities = 828/1208 (69%), Gaps = 72/1208 (6%)
 Strand=Plus/Plus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             |||||||||||||||| || || ||  |||||  |||||||||||||||||| || ||||
Sbjct  2523  AGGACGCCGGCGCCATCGCGGGTCTGGACGTGAAGCGTATCATCAACGAGCCTACCGCCG  2582

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGC--GAGCG----------CAACGTGC  508
             | ||  | |||||||| |||||||  || | ||||  || ||          ||||||||
Sbjct  2583  CTGCACTTGCGTACGGTCTGGACACCAACGCCGGCTCGAACGGCGAGAAGACCAACGTGC  2642

Query  509   TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
             ||||||||||||| || || || ||||||||||||||  ||||||| |||||| | ||||
Sbjct  2643  TGATCTTCGACCTTGGTGGTGGTACCTTCGATGTGTCGATCCTGTCGATTGAGAACGGCA  2702

Query  569   TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
             |||||||||| |||||||| |  |||||||| ||| ||||||| ||||||||||||||| 
Sbjct  2703  TCTTCGAGGTGAAGGCCACCGGCGGTGACACCCACTTGGGTGGCGAGGACTTCGACAACA  2762

Query  629   GCCTGGTGGACCACTTCACGCA-GGAGTTCAAGCGCAAGCACCGCAA---GGACATCACG  684
              | |||| ||  || || | ||  ||||||||||||||| |||||||   ||||  ||  
Sbjct  2763  ACATGGTCGAGTACCTC-CTCACTGAGTTCAAGCGCAAGAACCGCAACTTGGAC-CCATC  2820

Query  685   GAGAAC-CAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCT  743
             |||  | |  |||||  | |||||||| || || || || |||   || ||||| | |||
Sbjct  2821  GAGCTCGCCACGTGCCATGCGTCGTCTCCGCACTGCGTGTGAGTCGGCGAAGCGCATGCT  2880

Query  744   GTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAA  803
             |||| |  || |    ||||   ||||  | ||||| || ||||| ||  | ||||||| 
Sbjct  2881  GTCGACCACGACGTCTGCTTCGGTCGAAGTGGACTCGCTCTTCGAGGGTGTTGACTTCAG  2940

Query  804   CTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAG----A  859
             | | ||| | ||||||||    ||||||     |  ||||||  |  ||  ||||     
Sbjct  2941  CGCCACCGTGACTCGTGCCAAGTTCGAG---TCGCTCGGCGAGGAGCTCTTCAAGCGTTG  2997

Query  860   CGATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAG-GTGCA-  917
             ||| |||| |||||  |||||||||    ||||||||  ||      |||||| |  || 
Sbjct  2998  CGA-GGAGACCGTGCTGAAGGTGCTCTCGGACGCCAACATG-----AAGCCAGAGGACAT  3051

Query  918   ---CGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTC  974
                |||| ||||||| || || || || || |||||||| |||||||||    |||| ||
Sbjct  3052  CACCGAGCTGGTGCTTGTCGGTGGTTCCACCCGTATCCCTAAGGTGCAGACCATGCTCTC  3111

Query  975   GGACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTA  1034
             || | | |||||||||||||||| |   ||||| |||||||| || ||||| || || ||
Sbjct  3112  GGGCCTGTTCAACGGCAAGGAGCTCTCGAAGTCGATCAACCCTGATGAGGCCGTTGCCTA  3171

Query  1035  CGGTGCGACCGTGCAGGCGGCCATCCTG------AGCGGCAACGACTCGTCGGAGAAGCT  1088
             ||||||  |||||||||  || ||||||      | | |||||||| || |  |   |||
Sbjct  3172  CGGTGCCGCCGTGCAGGGTGCGATCCTGTCGGGCATCCGCAACGACGCGACCAACTCGCT  3231

Query  1089  GCAGGACCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGG  1148
                    ||  | ||  |||| ||||| || ||||| || ||| | ||||| |  ||   
Sbjct  3232  -------CT--TGCTCGTGGATGTGACCCCTCTGTCGCTCGGTATTGAGACCGTGGGCAA  3282

Query  1149  TGTCATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAG-----AAGTCGCAG  1203
              |||||| |   ||| |||  ||| |||||     ||||  || ||     ||| | |  
Sbjct  3283  GGTCATGTCCGTGCTCATCAAGCGTAACAC-----TGCCATCCCAGTGCGCAAGACCCGC  3337

Query  1204  ACGTTCTCGACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAG  1263
               || | | ||| | |  ||| ||||| |    ||   | |     | | |||||| |||
Sbjct  3338  GTGTACACCACGGAGGAGGACTACCAGACGTCCGTCGACGTGTGCATCTACGAGGGTGAG  3397

Query  1264  CGCTCCATGACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCC  1323
             ||  |   |||   ||  ||||||  ||| ||| |||||||| |    ||| ||   | |
Sbjct  3398  CGTGCGTCGACCGCCGTGAACAACAAGCTCGGCGAGTTCAACATCTCTGGCCTCGAGCGC  3457

Query  1324  ATGCC--TCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCC  1381
               |||   || || | ||| ||| | || ||||| ||||| ||||| |||||||| ||||
Sbjct  3458  --GCCAAGCGTGGCGAGCCACAGGTGGAGGTGACCTTCGAGATCGATGCGAACGGTATCC  3515

Query  1382  TGAACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACG  1441
             |||||||||||||    || |||   || |||        | |||  |||||| ||||| 
Sbjct  3516  TGAACGTGTCGGCCCGCGACAAGAAGACCGGCGCCCGTGCCGAGACGACGATCTCGAACA  3575

Query  1442  ACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACA  1501
             ||   ||||| ||    ||| | |||||||||||||||||  | || || ||||||| ||
Sbjct  3576  ACGCCGGCCGTCTGAGCCAGTCGGACATTGACCGCATGGTTGCCGACGCTGAGAAGTTCA  3635

Query  1502  AGTCGGAGGACGAGGCTAA---CAAGCAACGCATCGAGGCCAAGAACGCGCTGGAGAACT  1558
             |   | ||||||| ||| |      ||  ||||| ||||||   ||| |||||||| | |
Sbjct  3636  A---GAAGGACGACGCTGAGCTTCTGCGCCGCATTGAGGCCCGTAACTCGCTGGAGCAGT  3692

Query  1559  ACGCCTAC  1566
             ||  ||||
Sbjct  3693  ACATCTAC  3700

 Score = 205 bits (227),  Expect = 4e-50
 Identities = 264/358 (74%), Gaps = 6/358 (2%)
 Strand=Plus/Plus

Query  34    GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
             || ||||| |||||||| || |||||||||||||| || ||| || | | ||  || || 
Sbjct  2066  GGTATCGATCTCGGCACGACGTACTCGTGCGTGGGTGTCTGGAAGGATGGCCAGGTTGAG  2125

Query  94    ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
             ||||| ||||||  | | || |||||||| || || || |  || || ||||  || |||
Sbjct  2126  ATCATTGCCAACAGCGAAGGTAACCGCACGACGCCATCGTGGGTTGCGTTCAACGAGTCG  2185

Query  154   GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGGTG  213
             || || ||||||||||| ||||| ||||  ||||  |||  ||||||   ||||||||||
Sbjct  2186  GAGCGTCTCATCGGTGAGGCCGCGAAGATCCAGGCCGCCTCGAACGCCACCAACACGGTG  2245

Query  214   TTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACATC  273
             ||||||||||| ||| | || || ||||| |||   |||  | ||||  ||   |||  |
Sbjct  2246  TTCGACGCCAAGCGTATCATTGGTCGCAACTTCAACGACGACATCGTGAAGAAGGACGCC  2305

Query  274   AAGCACTGGCCGTTCCAAGTGACGTC--GGGCGCCGGTGACAAGCCGCAGATCACGGTGC  331
             |||||||  || || ||||   ||||  ||| | |    |||||     ||||  |||  
Sbjct  2306  AAGCACTTCCCATT-CAAG-ATCGTCGAGGGTGACTCGAACAAGGTTTTGATCGAGGTCG  2363

Query  332   AGTTCAAGGGCGAGTCCAAGACGTTCCA-ACCCGAGGAGATCTCGTCCATGGTGCTGA  388
             |||||||||||||||| ||| |||| ||  || |||||||||||||| ||||||||||
Sbjct  2364  AGTTCAAGGGCGAGTCGAAG-CGTTTCACGCCTGAGGAGATCTCGTCGATGGTGCTGA  2420

>PYUU:scaffold_1354 scf1117875581354 dna:supercontig supercontig:pug:scf1117875581354:1:1199448:1 
REF
Length=1199448

 Score = 416 bits (460),  Expect = 1e-113
 Identities = 903/1343 (67%), Gaps = 39/1343 (3%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||  ||||||||||  | | ||||| |||||| ||||||||||| ||||| |
Sbjct  675579  AGGACGCCGGTACCATTGCCGGTTTGAGCGTGCAGCGTATTATCAACGAGCCTACGGCTG  675520

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGC---GGCGAGCGCAACGTGCTGATCTTCG  517
               |||| ||||| |||||  | |||||||||| |   ||||||   ||||||||  | ||||
Sbjct  675519  CCGCTATCGCCTACGGTATTGACAAGAAGGCCCAGGGCGAGAAGAACGTGCTCGTGTTCG  675460

Query  518     ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
               | || || || || |||||||||||| | || ||  ||||||| |  ||  | ||||| |
Sbjct  675459  ATCTTGGTGGTGGTACCTTCGATGTGACGCTGCTTGCCATTGATGGTGGTGTGTTCGAAG  675400

Query  578     TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
               |   ||| ||    |||||||| ||| ||||||| || || |||||| | ||| |  || 
Sbjct  675399  TGTTGGCTACGAACGGTGACACTCACTTGGGTGGCGAAGATTTCGACCAGCGCGTCATGC  675340

Query  638     ACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAG------GACATC---ACGGAGA  688
               |    ||||   || |||  |||   ||| ||   |||      ||||||   ||||| |
Sbjct  675339  AGTTTTTCATCAAGAAGTGGAAG---AAGGAC---AAGTCTGTCGACATCGGTACGGACA  675286

Query  689     ACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGT  748
               |   |||||| || |     || ||    |    ||| ||||  |||||  |  ||||| 
Sbjct  675285  A---GCGTGCCCTCCAGAAGCTTCGTCGTGAAGCCGAACGTGTGAAGCGCGCATTGTCGA  675229

Query  749     CGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGA  808
               |    || || |||    | || ||||| || || || |||||    |||||||    | 
Sbjct  675228  CCCAAGCCCAAGCTCGTCTTGAAATTGAATCGCTTTTGGACGGTGAGGACTTCACTGAGT  675169

Query  809     CCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGC  868
               |  |  | ||||||||||||||| |  |   ||  ||||  |||   |||||  | |  |
Sbjct  675168  CGTTGTCGCGTGCTCGTTTCGAGAAGCTCAACGAAGACTTGTTCAAGAAGACCCTCGGCC  675109

Query  869     CCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGC  928
               | || |||||||||||    |||||     ||  ||||    | ||  ||||| | ||||
Sbjct  675108  CAGTCGAGAAGGTGCTCAAGGACGCTGGCTTGAAGAAGTCGGAAGTCGACGAGATCGTGC  675049

Query  929     TGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACG  988
               | || || || ||||| |||||||| |||||||||||  || |   ||||| ||||||||
Sbjct  675048  TTGTCGGTGGTTCGACCCGTATCCCTAAGGTGCAGCAATTGATCAAGGACTACTTCAACG  674989

Query  989     GCAAGGAGCCCAACAAGTCCA-TCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTG  1047
               |||||||||| | |  ||    | ||||| || |||||||| |||||||||||  |||||
Sbjct  674988  GCAAGGAGCC-ATCGCGTGGTGTGAACCCAGATGAGGCTGTTGCGTACGGTGCTGCCGTG  674930

Query  1048    CAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGC---AGGACCTGCTTCTG  1104
               ||||  |  |||||| ||||  |      | ||||  |  ||    ||||  ||||  ||
Sbjct  674929  CAGGGCGGTATCCTGGGCGGTGA------GACGGATGACTTGACCAAGGATGTGCTCTTG  674876

Query  1105    CTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTG  1164
                | || ||    || ||||| |  ||| | ||||| | ||||||||| ||||| | | ||
Sbjct  674875  ATCGATGTCGTCCCTCTGTCGCAAGGTATTGAGACCGTCGGTGGTGTTATGACCAAGTTG  674816

Query  1165    ATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGAC  1224
               |||   || |||||   | | || || |||||||||||||| ||||||||||||   |||
Sbjct  674815  ATCAACCGTAACACTGTGATCCCAACGAAGAAGTCGCAGACTTTCTCGACGTACCAGGAC  674756

Query  1225    AACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAAC  1284
               |||||||| |  ||| | |||||||||||||| || || ||  |||||||    ||||||
Sbjct  674755  AACCAGCCAGCTGTGTTGATCCAGGTGTTCGAAGGTGAACGTGCCATGACCAAGGACAAC  674696

Query  1285    AACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAG  1344
                  ||  |||| |||||| |  ||   ||  |||| ||    || || |||||||| |||
Sbjct  674695  CGTCTTTTGGGTAAGTTCGAATTGACTGGTCTCCCACCAGCTCCACGTGGTGTGCCACAG  674636

Query  1345    ATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAG  1404
               || || ||||||||||| || || |||||||| ||| || | ||    |||| ||| |||
Sbjct  674635  ATTGAAGTGACGTTCGAAATTGATGCGAACGGTATCTTGCAAGTCGGTGCTGAGGACAAG  674576

Query  1405    TCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCT  1464
                  || || ||||   | ||||| || || ||   ||| |||||||| |||||||| |  
Sbjct  674575  GGTACCGGTAAGGCTGAAAAGATTACCATTACCGCCGAAAAGGGCCGTCTCTCGCAAGAA  674516

Query  1465    GACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAGGCTAACAAG  1524
               || ||||| ||||||||    || || |   || ||     ||||||| ||      |||
Sbjct  674515  GAAATTGATCGCATGGTGCAAGAAGCTGCTGAGAACGCCGAGGAGGACAAGAAGGTGAAG  674456

Query  1525    CAACGCATCGAGGCCAAGAACGCGCTGGAGAACTACGCCTACAGTCTGCGGAACAGTCTG  1584
                | || ||||| | |   ||||   ||||   ||||   |||||  ||  |||||    |
Sbjct  674455  GACCGTATCGATGGCCGCAACGGTTTGGAAGGCTACTTGTACAGCTTGAAGAACA---CG  674399

Query  1585    AATGACGAGAAGATGAAGGAGAAGATCCCGGAAGCTGACAAGAAGGCGGTG--GACGACA  1642
                 ||| || ||||||   || ||||||  |||||  |||||| | || |||  || | | 
Sbjct  674398  GTTGAGGACAAGATGGCTGACAAGATCGAGGAAGACGACAAGGACGCCGTGTTGAAGGC-  674340

Query  1643    AGGTGACGGAAGTGATCCAGTGGCTGGACGCAAACCAGTCATTGGAGAAGGATGCGTACG  1702
                 |||  ||| | |||  | ||| |||| |  ||||||  |   || ||||| |  | ||
Sbjct  674339  -TGTGCAGGACGCGATGGACTGGTTGGAAGACAACCAGGAAGCCGACAAGGAGGACTTCG  674281

Query  1703    AGTCGAAGCAGAAGGAATTGGAG  1725
               ||   |||||||||||| | |||
Sbjct  674280  AGGGCAAGCAGAAGGAAGTCGAG  674258

 Score = 289 bits (320),  Expect = 1e-75
 Identities = 729/1093 (67%), Gaps = 24/1093 (2%)
 Strand=Plus/Minus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||  ||||||||||  | | ||||| ||| |||||||||||||| ||||| |
Sbjct  678962  AGGACGCCGGTACCATTGCCGGTTTGAGCGTGCAGCGCATCATCAACGAGCCTACGGCGG  678903

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGC---GGCGAGCGCAACGTGCTGATCTTCG  517
               |||| ||||| |||||  | |||||||||| |   ||||||   ||||||||  | ||||
Sbjct  678902  CCGCTATCGCCTACGGTATTGACAAGAAGGCCCAGGGCGAGAAGAACGTGCTCGTGTTCG  678843

Query  518     ACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGG  577
               | || || || || || || |||||| | || ||  | || ||  | ||| | || || |
Sbjct  678842  ATCTCGGTGGTGGTACGTTTGATGTGACGCTACTCGCAATCGACAATGGCGTGTTTGAAG  678783

Query  578     TCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGG  637
               |   ||||||   ||| || || ||| ||||||| || || |||||| | ||| |  || 
Sbjct  678782  TGCTGGCCACGAATGGGGATACCCACTTGGGTGGCGAAGATTTCGACCAGCGCGTCATGC  678723

Query  638     ACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAG--GACAT---CACGGAGAACCA  692
               |    ||||   || |||  ||||  |||    |  ||  |||||   ||| || ||   
Sbjct  678722  AGTTTTTCATCAAGAAGTGGAAGC--AAGACAAGGGAGTCGACATTGGCACCGACAA---  678668

Query  693     GCGTGCTCTTCGTCGTCTGCGGACGGCCTGC-GAGCGTGCCAAGCGTACGCTGTCGTCGT  751
               ||| || || |     || ||| ||    || |||||||  |||||  |  ||||| |  
Sbjct  678667  GCGCGCACTCCAGAAGCTTCGG-CGCGAGGCTGAGCGTGTGAAGCGCGCATTGTCGACCC  678609

Query  752     CGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACCA  811
                 || || ||     | |||||||| ||  || |  ||||    || ||||     ||  
Sbjct  678608  AAGCCCAAGCGCGGCTTGAGATTGAGTCGTTGCTGAACGGGGAAGATTTCAGTGAAACGC  678549

Query  812     TCACTCGTGCTCGTTTCGAGGACATGTGCGGCGA-CTACTTCCGCAAGACGATGGAGCCC  870
               | || || || || |||||| |  |    |  || ||  ||  | |||||  | |  || 
Sbjct  678548  TGACGCGCGCGCGGTTCGAGAAGCTCAATGAGGATCTGTTTAAG-AAGACCCTCGGTCCA  678490

Query  871     GTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTGCTG  930
               || |||||||||||    || ||    ||   ||||   || ||  | ||  | ||||| 
Sbjct  678489  GTCGAGAAGGTGCTCAAGGATGCGGGTCTAAAGAAGTCGCAAGTCGATGAAATCGTGCTC  678430

Query  931     GTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGGC  990
               ||||| || || ||||| ||||| |||||||||||| || |   ||||| ||| ||||| 
Sbjct  678429  GTGGGTGGATCCACGCGGATCCCCAAGGTGCAGCAGATGATCAAGGACTACTTTAACGGA  678370

Query  991     AAGGAGCCCAACAAGTC-CATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGCA  1049
               || |||||   |  ||  | | ||||| || |||||||||||||| || ||  |  | ||
Sbjct  678369  AAAGAGCCGT-CGCGTGGCGTGAACCCAGATGAGGCTGTGGCGTATGGCGCCGCAATCCA  678311

Query  1050    -GGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTGCTGG  1108
                |||||  |||||| ||||| |  |       || ||||||||||| ||| |  || | |
Sbjct  678310  AGGCGGG-ATCCTGGGCGGCGATCAAGAT---GAAAAGCTGCAGGATCTGGTGTTGATCG  678255

Query  1109    ACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTGATCG  1168
               ||||   |||||| || | |||  | ||||| |  ||||| || ||||| | | ||||| 
Sbjct  678254  ACGTCGTGCCGCTCTCGCAGGGGATTGAGACAGTGGGTGGCGTGATGACAAAGTTGATCA  678195

Query  1169    CGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGACAACC  1228
                 ||||| ||| |  | ||||| |||||||||||   ||| |||||| | |  |||||||
Sbjct  678194  ACCGGAATACGGCAATCCCGACGAAGAAGTCGCAAGTGTTTTCGACGCATGTTGACAACC  678135

Query  1229    AGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAACAACC  1288
               |  |||  |||   ||| | || || || ||||| ||  |  ||  |    |||||    
Sbjct  678134  AAGCTGCCGTGTCGATCAAAGTCTTTGAAGGCGAACGTACGCTGGTGAAGCACAACCGTT  678075

Query  1289    TGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAGATCG  1348
               |||||||||||||  |||| |  ||  | || ||    || ||||| ||||||||||| |
Sbjct  678074  TGCTGGGCAAGTTTGACCTCGCAGGGCTGCCACCAGCTCCGCGCGGCGTGCCGCAGATTG  678015

Query  1349    ACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAGTCAA  1408
               | || || || || || || |||||||| ||| || | || |||||    || ||    |
Sbjct  678014  AAGTCACATTTGAGATTGATGCGAACGGGATCTTGCAGGTATCGGCGCAAGACAAAGGCA  677955

Query  1409    CGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGCTGACA  1468
               |||||||   | | ||||||||||||||    || || ||||| || || ||||  || |
Sbjct  677954  CGGGCAAAACGGAAAAGATCACGATCACAGCGGAGAAAGGCCGTCTTTCACAGGAAGAGA  677895

Query  1469    TTGACCGCATGGT  1481
               |||| ||||||||
Sbjct  677894  TTGAGCGCATGGT  677882

 Score = 134 bits (148),  Expect = 7e-29
 Identities = 256/372 (69%), Gaps = 14/372 (4%)
 Strand=Plus/Minus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               ||||||| || || ||||| || ||||||||||| || || |   || ||| |   ||||
Sbjct  679421  TCGGCATTGATCTTGGCACGACGTACTCGTGCGTCGGGGTCTTCAAGGACGGCAAGGTGG  679362

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               | |||||||| || |||||||| ||||||| ||| || || ||||||||||     ||||
Sbjct  679361  ACATCATCGCGAATGACCAGGGGAACCGCATCACGCCATCGTACGTCGCCT---GGGACT  679305

Query  152     CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
               ||      || || || ||||| |||| ||||||||| || | | | || ||| |  | |
Sbjct  679304  CGAACGACGAGCGTCTGATCGGCGACGGCGCCAAGAACCAAGCGACGATCAACCCAGAGA  679245

Query  206     ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTC-GTCCAG  264
               | ||  | ||||||| ||| ||  |||| || ||||  | |   || |  ||| || |||
Sbjct  679244  AGACCATTTTCGACGTCAAGCGCTTGATTGGTCGCAGCTACAACGA-CAAGTCGGTGCAG  679186

Query  265     GCCGACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATC  324
               || ||||  |||     ||| | | || |  ||| |  |   | || ||||||   ||||
Sbjct  679185  GCGGACAAGAAGTTGCTGCCATACGAAAT--CGT-GAACAAGGATGGCAAGCCAGTGATC  679129

Query  325     ACGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTG  384
                  |||  | |||||||| |  | |||   |||   ||||| ||||||||| ||||||||
Sbjct  679128  CAAGTGACGGTCAAGGGCCAAACGAAGCTCTTCTCGCCCGAAGAGATCTCGGCCATGGTG  679069

Query  385     CTGATCAAGATG  396
               |||  |||||||
Sbjct  679068  CTGGGCAAGATG  679057

 Score = 117 bits (129),  Expect = 2e-23
 Identities = 155/215 (72%), Gaps = 9/215 (4%)
 Strand=Plus/Minus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               |||| ||||| |||||||| || ||||||||||| ||| | |   || || |    ||||
Sbjct  676038  TCGGTATCGATCTCGGCACGACGTACTCGTGCGTCGGCATCTACAAGGACCAGAAGGTGG  675979

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               | |||||||| |||||||| || ||||| | ||| || || ||||||||||     ||||
Sbjct  675978  AGATCATCGCGAACGACCAAGGTAACCGTATCACGCCATCGTACGTCGCCT---GGGACT  675922

Query  152     CG------GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
               ||      || || || ||||| |||| ||||||||| || | | | || ||| |  | |
Sbjct  675921  CGAACGACGAGCGTCTGATCGGCGACGGCGCCAAGAACCAAGCGACGATCAACCCAGAGA  675862

Query  206     ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGC  240
               | ||| |||| || | ||| ||  ||||||| |||
Sbjct  675861  AGACGTTGTTTGATGTCAAGCGCTTGATCGGTCGC  675827

>PYVX:scaffold_67 pve_scaffold_67 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_67:1:65954:1 
REF
Length=65954

 Score = 392 bits (434),  Expect = 2e-106
 Identities = 803/1171 (69%), Gaps = 62/1171 (5%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||||||||||   || || || ||  ||||||||||||||||||||||||||||||| |
Sbjct  51862  AGGACGCCGGCAAGATCGCGGGTCTTGACGTGCTGCGTATCATCAACGAGCCGACGGCGG  51921

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              | ||| |||||||||| |||||||||   | |||| ||   |   ||| | | |||||||
Sbjct  51922  CTGCCCTCGCGTACGGTCTGGACAAGGCTGACGGCAAGGTGAT--TGCCG-TGTTCGACC  51978

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              |||| ||||||||||||||||||||  ||||    ||   ||  ||  | |||||||| |
Sbjct  51979  TGGGTGGCGGCACCTTCGATGTGTCCATCCTCGAGATCTCGGGCGGTGTGTTCGAGGTGA  52038

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
              |||||||    |||||||| |  || |||||||||||||||||| |    ||| ||  | 
Sbjct  52039  AGGCCACGAACGGTGACACCCTGCTCGGTGGTGAGGACTTCGACGAGGAGCTGCTGCGCT  52098

Query  641    ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
              || ||  |  ||||||||||    ||    |||  ||| |  | |   || | |  ||  
Sbjct  52099  ACCTCGTGTCGGAGTTCAAGAAGGAGACGAGCATCGACCTGTCTGGCGACAACCTCGCCA  52158

Query  701    TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGT-CGTCGTC-GGCTCA  758
              | |  ||||||||   ||||   |||   ||||||||   ||||  ||  ||| ||| ||
Sbjct  52159  TGCAGCGTCTGCGTGAGGCCGCTGAGAAGGCCAAGCGCGAGCTGGACG--GTCTGGCGCA  52216

Query  759    GGCTTACATCGAGATTGAC-----TCTCTGTTCGACGGCATCG---------ACTTCAAC  804
              | |  ||||| ||  || |     || | | | |||| ||  |         |||| |||
Sbjct  52217  GACGGACATC-AGTCTGCCGTTCATCACGGCT-GACGCCACTGGCCCGAAGCACTTGAAC  52274

Query  805    TCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGA--CTACTT--CCGCAAGAC  860
                ||  ||||| |||||    |||||| |  | || |||||  ||  ||  |||||   |
Sbjct  52275  ATGAAGATCACGCGTGCCACGTTCGAGAAGCT-TGTGGCGAACCTGATTGACCGCA---C  52330

Query  861    GATGGAGCCCGTGGAGAAGGTGC-TGCGCGACGCCAAGCTGTCGA--AGAGCCAGGTGCA  917
              ||| | | || || |  | |||| ||   |||||   | | ||||  |||   |  |  |
Sbjct  52331  GATTG-GTCCTTGCAAGAAGTGCGTGAAGGACGCT--GGTCTCGACAAGAAGGACATCAA  52387

Query  918    CGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGA  977
              ||||||| | || || |||||   | |||| || |||||||||||||||  | ||  |||
Sbjct  52388  CGAGGTGATCCTTGTCGGCGGTATGTCGCGCATGCCGAAGGTGCAGCAGTCGGTGGAGGA  52447

Query  978    CTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGG  1037
              |||||||   |||||| ||||    |||  | | |||||||| ||||  || || || ||
Sbjct  52448  CTTCTTC---GGCAAGAAGCCGTCGAAGGGCGTGAACCCGGATGAGGTCGTCGC-TATGG  52503

Query  1038   TGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCT  1097
                     |||| |    |||||| | ||||      |||  ||| || | |  ||||| |
Sbjct  52504  -------GTGCTG----CCATCCAGGGCGGTGTG--CTCCGCGGCGACG-TCAAGGACAT  52549

Query  1098   GCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGAC  1157
               || |||||||| |||||||||||||| || ||| | ||||||  ||| |||||  | ||
Sbjct  52550  TCTGCTGCTGGATGTGACGCCGCTGTCGCTCGGTATTGAGACGCTCGGCGGTGTGTTCAC  52609

Query  1158   GACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTA  1217
              || ||||||| |||| ||||||||| | ||||| ||||||||||||  ||||||||||  
Sbjct  52610  GAAGCTGATCCCGCGTAACACGACGATCCCGACGAAGAAGTCGCAGGTGTTCTCGACGGC  52669

Query  1218   CGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCG  1277
               ||||||   ||| |   ||||  |||| ||||| || |||| ||||||   ||| ||  
Sbjct  52670  GGCCGACTCGCAGACGCAGGTGGGCATCAAGGTGCTCCAGGGTGAGCGCGAGATGGCGTC  52729

Query  1278   CGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGT  1337
               |||||||| ||||| ||||| ||| ||||||  |||||||| ||    |||||||| ||
Sbjct  52730  GGACAACAAGCTGCTCGGCAACTTCGACCTGGTTGGCATCCCGCCGGCTCCTCGCGGCGT  52789

Query  1338   GCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGT  1397
               |||||||| || ||| | |||||||| ||||||||||| ||| ||||||||   |||  
Sbjct  52790  CCCGCAGATTGAGGTGGCTTTCGACATTGACGCGAACGGAATCGTGAACGTGAGCGCTCG  52849

Query  1398   GGAGAAGTCAACGGGCAAGGAGAACAAGATCACGA-TCACGAACGACAAG-GGCCGCCTC  1455
               || ||| | |||  ||||||| | |  |||  || |||     | | || ||| | || 
Sbjct  52850  CGACAAGGCGACGAACAAGGAGCAGAGCATCGTGATTCA-----GTCCAGCGGCGGTCTG  52904

Query  1456   TCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGAG  1515
              ||| |  | ||||| || ||||||||   ||||||||||| | ||  |  || |||| ||
Sbjct  52905  TCGGACTCGGACATCGAGCGCATGGTGCAGGAGGCCGAGATGAACGCGGAGGCGGACCAG  52964

Query  1516   GCTAACAAGCAACGCATCGAGGCCAAGAACG  1546
                   |||| | |  |||||| | |||||||
Sbjct  52965  AAGCGCAAGGAGCTGATCGAGTCGAAGAACG  52995

 Score = 65.3 bits (71),  Expect = 1e-07
 Identities = 155/229 (68%), Gaps = 13/229 (6%)
 Strand=Plus/Plus

Query  32     TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGA----CCGT  87
              ||||||| ||||| ||||| ||| |||||||||||| ||||  | ||  | |    ||| 
Sbjct  51409  TCGGCATTGACCTGGGCACGACCAACTCGTGCGTGGCCGTGATGGAGGGCAAGGCCCCGC  51468

Query  88     GTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACA  147
              |||    | ||||  |||    ||||    ||||| || |||||    || ||  ||   
Sbjct  51469  GTG----TGATCGAGAACTCGGAGGGTGCGCGCACGACGCCGTCCGTGGTGGCGATCCTC  51524

Query  148    GACT-CG--GAACGCCTCATCGGTGACGCCGCC-AAGAATCAGGTGGCCATGAACGCGCA  203
              ||   ||  || |||||| | ||  | |||| | |||   ||||  |  | |||| ||||
Sbjct  51525  GAGAACGACGAGCGCCTCGTGGGC-ATGCCGGCGAAGCGCCAGGCCGTGACGAACCCGCA  51583

Query  204    CAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGAC  252
               |||||| | | || || ||| || |||||||||||||||||| |||||
Sbjct  51584  GAACACGTTCTACGCCGTCAAGCGCCTGATCGGCCGCAAGTTCACGGAC  51632

>PHPA:scaffold_60 NW_008649046.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.60, whole genome shotgun 
sequence
Length=386225

 Score = 383 bits (424),  Expect = 8e-104
 Identities = 315/381 (83%), Gaps = 2/381 (1%)
 Strand=Plus/Plus

Query  30      CGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGT  89
               ||| ||||| || || ||||| |||||||||||||| |||||||||||||||||||| ||
Sbjct  301688  CGTTGGCATTGATCTGGGCACGACCTACTCGTGCGTCGGCGTGTGGCAGAACGACCGCGT  301747

Query  90      GGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGA  149
               ||| ||||| ||||||||||||||||||||||| |||||||| ||||| || ||||| ||
Sbjct  301748  GGAGATCATTGCCAACGACCAGGGCAACCGCACGACCCCGTCGTACGTGGCGTTCACCGA  301807

Query  150     CTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACAC  209
               | |||| || || ||||| || || |||||||| |||||||| |||||||| ||||||||
Sbjct  301808  CACGGAGCGTCTTATCGGCGATGCTGCCAAGAACCAGGTGGCTATGAACGCACACAACAC  301867

Query  210     GGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGA  269
               |||||| || | ||| ||  ||||||| ||||||||| | || || |  || ||| | ||
Sbjct  301868  GGTGTTTGATGTCAAGCGGTTGATCGGGCGCAAGTTCACCGATCCAGAAGTGCAGTCGGA  301927

Query  270     CATCAAGCACTGGCCGTTCCAAGTGACGTCG-GGCGCCGGTGACAAGCCGCAGATCACGG  328
               |||||||||||||||||| ||||  |  ||| || || |   |||| || ||  |   ||
Sbjct  301928  CATCAAGCACTGGCCGTT-CAAGGTAGTTCGTGGTGCTGAGAACAAACCTCAACTGGTGG  301986

Query  329     TGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGA  388
               ||||||||||||||||||| |||||||||||||| |||||||| ||||| |||||| |||
Sbjct  301987  TGCAGTTCAAGGGCGAGTCGAAGACGTTCCAACCGGAGGAGATTTCGTCTATGGTGTTGA  302046

Query  389     TCAAGATGCGCGAGGACGCCG  409
               |||||||||| ||||  ||||
Sbjct  302047  TCAAGATGCGAGAGGTGGCCG  302067

 Score = 264 bits (292),  Expect = 5e-68
 Identities = 200/236 (85%), Gaps = 0/236 (0%)
 Strand=Plus/Plus

Query  403     GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
               || || || || ||||| ||  | || |||||||||||||||||||||||||||||||| 
Sbjct  302151  GATGCGGGAGCTATTGCTGGTTTGAATGTGCTGCGTATCATCAACGAGCCGACGGCCGCT  302210

Query  463     GCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTG  522
               || ||||| || || ||||||||||| || || |||| |||||||||||||||||| || 
Sbjct  302211  GCGATCGCCTATGGGCTGGACAAGAAAGGAGGTGAGCACAACGTGCTGATCTTCGATCTC  302270

Query  523     GGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAG  582
               |||||||| || |||||||| ||||| ||  | ||||| || ||||||||||||||||||
Sbjct  302271  GGCGGCGGAACGTTCGATGTCTCTCTGCTCACTATTGAAGAAGGCATCTTCGAGGTCAAG  302330

Query  583     GCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGA  638
               || || || |||||||||||| |||| |||||||||||||||||||| ||||| ||
Sbjct  302331  GCGACAGCGGGTGACACGCACTTGGGAGGTGAGGACTTCGACAACCGTCTGGTCGA  302386

>APIN:scaffold_85 supercont1.85 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.85:1:132271:1 
REF
Length=132271

 Score = 370 bits (409),  Expect = 2e-99
 Identities = 769/1136 (68%), Gaps = 57/1136 (5%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||||||||| ||||||||||||||| |||||  ||| ||||||||||| |||||||| |
Sbjct  123267  AGGACGCCGGTGCCATTGCCGGCCTCGACGTGAAGCGCATCATCAACGAACCGACGGCGG  123326

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCG---------AGCGCAACGTGCTGA  511
               ||||| | || |||||| |||||| ||| | |||||         ||   ||| |  |||
Sbjct  123327  CCGCCCTTGCCTACGGCTTGGACACGAACGCCGGCGCGGAAGGCAAGTCGAACATTTTGA  123386

Query  512     TCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCT  571
               | |||||| |||| || || ||||| ||||||||  || ||  ||||||| | ||||| |
Sbjct  123387  TTTTCGACTTGGGTGGTGGTACCTTTGATGTGTCGATCTTGAGCATTGAGAACGGCATTT  123446

Query  572     TCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCC  631
               |||| |||||||| ||||  || ||||||||| ||||||| || ||||| |||| |  | 
Sbjct  123447  TCGAAGTCAAGGCGACTGGCGGGGACACGCACTTGGGTGGGGAAGACTTTGACAGCAACA  123506

Query  632     TGGTGGACCACT---TCACGCAGGAGTTCAAGCGCAAGCACCGCAA---GGACATCACGG  685
               |||| |||   |   ||||    ||||||||||||||| |||||||   ||||   ||  
Sbjct  123507  TGGTCGACTTTTTGGTCAC---CGAGTTCAAGCGCAAGAACCGCAACTTGGACCCTACTT  123563

Query  686     AGAACCAGCGTGCTC--TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCT  743
                |   | ||| ||||  | || || ||||| ||||| ||||||  ||||||||| | | |
Sbjct  123564  CG--TCGGCGCGCTCCATGCGCCGCCTGCGCACGGCGTGCGAGTCTGCCAAGCGCATGTT  123621

Query  744     GTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAA  803
               |||| || || |    ||   ||| ||  | ||  | || ||||| ||| | ||||| | 
Sbjct  123622  GTCGACGACGACGAGCGCGACCATTGAAGTCGATGCCCTCTTCGAAGGCGTGGACTTTAG  123681

Query  804     CTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTC---CGCAAGAC  860
               ||||||||| || |||||    || ||     |   ||  || | ||||   |||   ||
Sbjct  123682  CTCGACCATGACCCGTGCCAAGTTTGAATCGCTCAACGAAGAGTGCTTCAAGCGC---AC  123738

Query  861     GATGGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGA  920
               |   ||  |||||  |||||||||||  ||||||||  ||  |     |||  |   |||
Sbjct  123739  GGAAGAAACCGTGTTGAAGGTGCTGCAGGACGCCAACATGAAGCCCGACCAAATCTCCGA  123798

Query  921     GGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTT  980
               | ||||  |||| || || ||||| || ||||| ||||||||     || ||||  ||||
Sbjct  123799  GTTGGTCTTGGTCGGTGGTTCGACCCGCATCCCCAAGGTGCAAACCATGTTGTCCAACTT  123858

Query  981     CTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGC  1040
                ||   ||||||||| |  | |||||| |||||||||||||| || ||||||||||||||
Sbjct  123859  GTTTGGCGGCAAGGAACTGAGCAAGTCGATCAACCCGGACGAAGCCGTGGCGTACGGTGC  123918

Query  1041    GACCGTGCAGGCGGCCATCCTGAGCGGCA-ACGACTCGTCG-GAGAAGCTGCAGGACCTG  1098
               | ||||||| |  || ||| |||||||||  ||   || || ||  | ||       |||
Sbjct  123919  GGCCGTGCAAGGCGCGATCTTGAGCGGCATCCGCAACGACGCGACCAACT-----CGCTG  123973

Query  1099    CTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACG  1158
                |  || |||| ||||||||| ||  | ||||  | ||   || |||    |||||| | 
Sbjct  123974  TTGTTGGTGGATGTGACGCCGTTGAGTTTGGGGATTGAACTGGTCGGCAAGGTCATGTCT  124033

Query  1159    ACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTAC  1218
                   |||||  ||| |||||| || | |||   |||||| |||  |  |   ||||  | 
Sbjct  124034  GTTTTGATCAAGCGCAACACGGCGATCCCGGTGAAGAAGACGCGCATTTATACGACTGAG  124093

Query  1219    GCCGACAACCAGCCT------GGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATG  1272
               |  ||   |||| ||        |||| |||      | | ||| ||||||||| |   |
Sbjct  124094  GAAGATTTCCAGACTTCTGAAAAGGTGGTCA------TTTACGAAGGCGAGCGCGCGTCG  124147

Query  1273    ACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATC---CCTCCCATGCCT  1329
                     |||||||||  ||| ||  | ||| |  |   |||||||   | | ||| |   
Sbjct  124148  GTTGTGGACAACAACAAGCTCGGTGAATTCGAAATCACCGGCATCGAACGTGCCAAG---  124204

Query  1330    CGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTG  1389
               ||||| | |||  || | || ||||||||||| ||||| |||||||| ||| || |||||
Sbjct  124205  CGCGGCGAGCCCAAGTTGGAAGTGACGTTCGAGATCGATGCGAACGGGATCTTGCACGTG  124264

Query  1390    TCGGCTG--TGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGG  1447
                  ||||   ||| |||   || |||  | ||||| ||| ||| ||||  ||| ||   |
Sbjct  124265  --AGCTGCAAGGACAAGAAGACCGGCGCGAAGAACCAGACCACAATCAGCAACAACCGCG  124322

Query  1448    GCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAG  1503
               ||||| |    ||||  ||||| |||||||||||    || || ||||| ||||||
Sbjct  124323  GCCGCTTGAGCCAGGAAGACATCGACCGCATGGTCGACGAAGCGGAGAAATACAAG  124378

 Score = 158 bits (174),  Expect = 6e-36
 Identities = 249/357 (70%), Gaps = 0/357 (0%)
 Strand=Plus/Plus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGG  91
               |||| ||||| || || || ||||||||||||||||| |||||| || ||| ||  || |
Sbjct  122808  TCGGTATCGATCTTGGTACGACCTACTCGTGCGTGGGTGTGTGGAAGGACGGCCAAGTCG  122867

Query  92      AAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACT  151
               ||||||| ||||||  | | ||||||||||||||||| || |  ||||| ||||  ||  
Sbjct  122868  AAATCATTGCCAACAGCGAAGGCAACCGCACCACCCCTTCGTGGGTCGCGTTCAACGAAA  122927

Query  152     CGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGG  211
               | |||||  | ||||| || || |||||||  || |  ||    |||||   ||||||||
Sbjct  122928  CCGAACGTTTGATCGGCGAAGCTGCCAAGATCCAAGCTGCGTCCAACGCCACCAACACGG  122987

Query  212     TGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACA  271
               | ||||| ||||| ||| | ||||| ||||| ||    |||||  ||||  ||   ||| 
Sbjct  122988  TCTTCGATGCCAAGCGTATCATCGGTCGCAACTTTAGCGACCCGATCGTGAAGAAGGACG  123047

Query  272     TCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGC  331
                   |||||  || ||| |  |  |   |||||  |||||||||||   ||||   ||  
Sbjct  123048  CGGCGCACTTCCCCTTCAAGATTTCCAAGGGCGAAGGTGACAAGCCATTGATCCAAGTTA  123107

Query  332     AGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGA  388
                 |||   || ||   |||||  |||   || || || |||||||| |||||| |||
Sbjct  123108  CCTTCCGTGGTGAAGACAAGAGCTTCACCCCTGAAGAAATCTCGTCGATGGTGTTGA  123164

>PHSO:scaffold_4
Length=7609242

 Score = 367 bits (406),  Expect = 6e-99
 Identities = 722/1055 (68%), Gaps = 51/1055 (5%)
 Strand=Plus/Minus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||||||||||   || ||||| ||  ||||||||||||||||||||||||| |||||||
Sbjct  7304134  AGGACGCCGGCAAGATCGCCGGTCTGGACGTGCTGCGTATCATCAACGAGCCCACGGCCG  7304075

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                | ||  | || |||||| ||||||||   | |||| ||  ||   ||| | |||||||||
Sbjct  7304074  CTGCTCTGGCCTACGGCATGGACAAGGCCGACGGCAAGGTCAT--TGCCG-TCTTCGACC  7304018

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                |||| ||||||||||||||||||||  ||||    ||   ||  ||| | ||||||||||
Sbjct  7304017  TGGGTGGCGGCACCTTCGATGTGTCGATCCTCGAGATCTCGGGCGGCGTGTTCGAGGTCA  7303958

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                || ||||    || ||||| |  || || ||||||||||||||| |    ||| ||  | 
Sbjct  7303957  AGTCCACCAACGGCGACACCCTGCTCGGCGGTGAGGACTTCGACGAGGAGCTGCTGCGCT  7303898

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
                || ||  | | ||||||| |    ||    |||  ||| |  |||   || | |  ||  
Sbjct  7303897  ACCTCGTGGACGAGTTCAGGAAGGAGACGAGCATCGACCTGTCGGGCGACAACCTCGCCA  7303838

Query  701      TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCT-GTCGTCGTCGGCTCAG  759
                | |  ||||||||   ||||  ||||   |||||||||  ||| | || | | ||| |||
Sbjct  7303837  TGCAGCGTCTGCGTGAGGCCGCCGAGAAGGCCAAGCGTGAGCTCGACGGCCT-GGCCCAG  7303779

Query  760      GCTTACATCGAGATTGAC---TCTCT-GTTCGACGGCATCG---------ACTTCAACTC  806
                 |  ||||| ||  || |   | ||  |  ||||| || ||         |||| |||  
Sbjct  7303778  ACGGACATC-AGCCTGCCCTTTATCACGGCCGACGCCACCGGCCCCAAGCACTTGAACAT  7303720

Query  807      GACCATCACTCGTGCTCGTTTCGAGGACAT-GTGCGGCGACTACTTC---CGCAAGACGA  862
                ||  ||| | |||||    |||||| |  | ||| ||| ||  | ||   ||||   | |
Sbjct  7303719  GAAGATCTCGCGTGCCACCTTCGAGAAGCTCGTG-GGCAACCTCATCGAGCGCA---CCA  7303664

Query  863      TGGAGCCCGTGGAGAAGGTGCTGCGCG-ACGCCAAGCTGTCGAAGAGCCAGGTGCACGAG  921
                ||| ||||||| |  | ||||  |  | ||||    |||  ||||||| |  |  |||||
Sbjct  7303663  TGG-GCCCGTGCAAGAAGTGCGTCAAGGACGCTGGTCTGGAGAAGAGCGACATCAACGAG  7303605

Query  922      GTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCG--GACT  979
                ||  | ||||| |||||   | ||||||| || |||||||||  |   | ||||  || |
Sbjct  7303604  GTCATTCTGGTCGGCGGTATGTCGCGTATGCCCAAGGTGCAGTCGA--CCGTCGAGGAGT  7303547

Query  980      TCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTG  1039
                |||||   |||||| ||||    |||    | ||||| |||||||  |||||    || |
Sbjct  7303546  TCTTC---GGCAAGAAGCCTTCGAAGGGTGTGAACCCCGACGAGGTGGTGGCCATGGGCG  7303490

Query  1040     CGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGC  1099
                |  || | ||||  | | | ||| ||||  ||| |                ||||| | |
Sbjct  7303489  CTGCCATCCAGGGCGGCGTGCTGCGCGGTGACGTCA---------------AGGACATTC  7303445

Query  1100     TTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGA  1159
                | |||||||||||||| || ||||| |||||| | |||||    || |||||  | || |
Sbjct  7303444  TGCTGCTGGACGTGACCCCCCTGTCCCTGGGTATTGAGACCCTGGGCGGTGTGTTCACCA  7303385

Query  1160     CGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACG  1219
                 ||||||| |||| ||||||||| | ||||||||||||||||||  ||||||||||   |
Sbjct  7303384  AGCTGATCCCGCGTAACACGACGATCCCGACCAAGAAGTCGCAGGTGTTCTCGACGGCTG  7303325

Query  1220     CCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCG  1279
                |||||   ||| |   ||||  |||| ||||| |  |||| |||||    ||| |   ||
Sbjct  7303324  CCGACTCGCAGACGCAGGTGGGCATCAAGGTGCTGCAGGGTGAGCGTGAGATGGCTGCCG  7303265

Query  1280     ACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGC  1339
                ||||||| || |||||||| ||| |||| |  |||||||| |||   || || |||||||
Sbjct  7303264  ACAACAAGCTTCTGGGCAACTTCGACCTAGTGGGCATCCCGCCCGCCCCGCGTGGTGTGC  7303205

Query  1340     CGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGG  1399
                |||||||||| ||||  |||||||| ||||| ||||| ||| ||||||||   |||   |
Sbjct  7303204  CGCAGATCGAGGTGAGCTTCGACATTGACGCCAACGGAATCGTGAACGTGGGCGCTCGTG  7303145

Query  1400     AGAAGTCAACGGGCAAGGAGAACAAGATCACGATC  1434
                | ||| | |||||||||||| | || |||  ||||
Sbjct  7303144  ACAAGGCCACGGGCAAGGAGCAGAACATCGTGATC  7303110

 Score = 66.2 bits (72),  Expect = 3e-08
 Identities = 150/220 (68%), Gaps = 7/220 (3%)
 Strand=Plus/Minus

Query  32       TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGT-GTGG-CAGAACGACCGTGT  89
                ||||||| ||||| ||||| ||| |||||||||||| |||  |||   | | ||||  | 
Sbjct  7304587  TCGGCATTGACCTGGGCACGACCAACTCGTGCGTGGCCGTCATGGAGGGCAAGACCCCGC  7304528

Query  90       GGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGA  149
                |    | ||||  |||    |||||   ||||| ||||||||   ||| ||| ||   ||
Sbjct  7304527  G--CGTGATCGAGAACTCGGAGGGCGCGCGCACGACCCCGTCGGTCGTAGCCATCCTGGA  7304470

Query  150      C-TCG--GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAA  206
                |  ||  || |||||| | ||     ||||||||   ||||  |  |  ||| || | ||
Sbjct  7304469  CAACGACGAGCGCCTCGTGGGCATGCCCGCCAAGCGCCAGGCCGTGACCAACCCGGAGAA  7304410

Query  207      CACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTC  246
                |||| | | || || ||| || || |||||||||||||||
Sbjct  7304409  CACGTTCTACGCCGTCAAGCGCCTCATCGGCCGCAAGTTC  7304370

 Score = 63.5 bits (69),  Expect = 3e-07
 Identities = 57/72 (79%), Gaps = 0/72 (0%)
 Strand=Plus/Minus

Query  415     ATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCCGCCATCGCGTAC  474
               || ||||||||||||   |||||  ||||||||||||  ||||||  |||| |||| |||
Sbjct  979046  ATCGCCGGCCTCAACTGCCTGCGCCTCATCAACGAGCACACGGCCATCGCCCTCGCCTAC  978987

Query  475     GGCCTGGACAAG  486
               ||| |  |||||
Sbjct  978986  GGCATCTACAAG  978975

 Score = 45.5 bits (49),  Expect = 0.092
 Identities = 71/100 (71%), Gaps = 4/100 (4%)
 Strand=Plus/Minus

Query  157     CGCCTCATCGGTGACGCCGCCA--AGAATCAGGTGGCCATGAACGCGCACAACACGGTGT  214
               ||| ||||||| || || ||||  || ||  || |  |||| ||    | |||||||   
Sbjct  979397  CGCTTCATCGGCGAGGCGGCCATCAGCAT--GGCGCGCATGCACTACAAGAACACGGCCA  979340

Query  215     TCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCC  254
                 |||  ||| |||||||||||||||||||||  | ||||
Sbjct  979339  CAGACATCAAGCGTCTGATCGGCCGCAAGTTCAAGCACCC  979300

 Score = 39.2 bits (42),  Expect = 3.9
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  433      CTGCGTATCATCAACGAGCCGACGGCCGCCGCCATC  468
                ||||| || || ||||||||||| || ||| |||||
Sbjct  4592336  CTGCGCATTATGAACGAGCCGACCGCAGCCCCCATC  4592301

>PYUU:scaffold_2029 scf1117875582029 dna:supercontig supercontig:pug:scf1117875582029:1:1550222:1 
REF
Length=1550222

 Score = 359 bits (397),  Expect = 3e-96
 Identities = 779/1150 (68%), Gaps = 62/1150 (5%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||| || |||||||| |||||| ||||   |||||| || |||||||| || ||||
Sbjct  419593  AGGACGCTGGTGCCATTGCTGGCCTCGACGTCAAGCGTATTATTAACGAGCCAACCGCCG  419652

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAG--CG----------CAACGTGC  508
               | ||  |||||||||| ||||||| ||| | |||| |   ||          ||||||| 
Sbjct  419653  CTGCTCTCGCGTACGGTCTGGACACGAACGCCGGCAACAACGGCCAGAAGACCAACGTGT  419712

Query  509     TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
               ||||||||||||| || ||||| ||||| ||||||||  |  |||| || ||  | || |
Sbjct  419713  TGATCTTCGACCTTGGTGGCGGTACCTTTGATGTGTCGATTTTGTCGATCGAAAACGGTA  419772

Query  569     TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
               | |||||||||||| | || |  |||||||| ||| |||| ||||||||||| |||||| 
Sbjct  419773  TTTTCGAGGTCAAGTCGACGGGCGGTGACACACACTTGGGCGGTGAGGACTTTGACAACA  419832

Query  629     GCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAA---GGA--CATC-A  682
                | |||| ||  || ||  |   ||||||||||||||| |||||||   |||  |||| |
Sbjct  419833  ACATGGTTGAGTACCTCTTGACTGAGTTCAAGCGCAAGAACCGCAACTTGGACCCATCGA  419892

Query  683     CGGAGAACCAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGC  742
               ||  |     ||||||  | || ||| |||| ||||| || |||   |||||||| | | 
Sbjct  419893  CGTCG---GCGCGTGCCATGCGCCGTTTGCGCACGGCTTGTGAGTCGGCCAAGCGCATGT  419949

Query  743     TGTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCA  802
               ||||| |  || |   |||||   ||||  | ||||| || || || ||| | |||||||
Sbjct  419950  TGTCGACCACGACGTCGGCTTCGGTCGAAGTGGACTCGCTCTTTGAGGGCGTGGACTTCA  420009

Query  803     ACTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGA  862
                | | ||  | || |||||    || |||     |  ||| ||  |  |   |||| || 
Sbjct  420010  GCGCTACTGTGACCCGTGCCAAGTTTGAG---TCGCTCGGTGAGGAACTTTTCAAG-CGT  420065

Query  863     T----GGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTG---  915
               |    |||| |||||  ||||||| ||  |||||||||  ||      ||||||  |   
Sbjct  420066  TGTGAGGAGACCGTGCTGAAGGTGTTGGCCGACGCCAACATG-----AAGCCAGAGGATA  420120

Query  916     -CA-CGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGT  973
                || |||| ||||||| || || || || ||||||||||| |||||||||    ||||||
Sbjct  420121  TCACCGAGTTGGTGCTTGTTGGTGGTTCCACGCGTATCCCTAAGGTGCAGACCATGCTGT  420180

Query  974     CGGACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGT  1033
               ||  | | |||||||||||||||| |   ||||| |||||||| || ||||| |||||||
Sbjct  420181  CGAGCCTGTTCAACGGCAAGGAGCTCTCGAAGTCGATCAACCCTGATGAGGCCGTGGCGT  420240

Query  1034    ACGGTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGG  1093
               |||||||  |||||||||  |||||| ||   |||    | ||| |   || || |    
Sbjct  420241  ACGGTGCCGCCGTGCAGGGCGCCATCTTGTCGGGC----ATTCG-CAACGACGC-GACCA  420294

Query  1094    ACCTGCTTCTGC---TGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTG  1150
               ||  |||| |||   | || ||||| || || || || ||| | ||||| | |||    |
Sbjct  420295  ACTCGCTTTTGCTCGTTGATGTGACCCCACTTTCGCTCGGTATTGAGACTGTCGGCAAGG  420354

Query  1151    TCATGACGACGCTGATCGCGCGGAACACGACGGTGCC---GACCAAGAAGTCGCAGACGT  1207
               ||||| ||  ||| ||   ||| |||||  |  | ||   |  |||||   | |    ||
Sbjct  420355  TCATGTCGGTGCTCATTAAGCGTAACACTGCCATCCCTGTGCGCAAGA---CCCGTGTGT  420411

Query  1208    TCTCGACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCT  1267
                | ||||  | |  ||| ||||  |    ||   | |     | | ||| || |||||  
Sbjct  420412  ACACGACCGAGGAGGACTACCAAACGTCCGTCGACGTGTGCATCTACGAAGGTGAGCGTG  420471

Query  1268    CCATGACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGC  1327
               |   |||   || |||||||    ||||| |||||||| |   |||     |||  | ||
Sbjct  420472  CGTCGACCGCCGTCAACAACAAATTGGGCGAGTTCAACAT-CTCGG---GTCTCGAACGC  420527

Query  1328    -CT---CGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTG  1383
                ||   ||||||| ||| ||| |||| ||||| || || ||||| || ||||| ||| ||
Sbjct  420528  GCTAAGCGCGGTGAGCCACAGGTCGAAGTGACCTTTGAGATCGATGCCAACGGTATCTTG  420587

Query  1384    AACGTGTCGGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGAC  1443
               ||||||||||||   || |||   || |||          ||| ||||||| || |  ||
Sbjct  420588  AACGTGTCGGCTCGCGACAAGAAGACCGGCGCCCGCGCTGAGACCACGATCTCGCAGAAC  420647

Query  1444    AAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAG  1503
                  ||||| ||    ||||  |||||||||||||||||  | ||||||||||||| ||||
Sbjct  420648  GCCGGCCGTCTGAGCCAGGACGACATTGACCGCATGGTTGCCGAGGCCGAGAAGTTCAAG  420707

Query  1504    TCGGAGGACG  1513
                 ||| ||||
Sbjct  420708  AAGGACGACG  420717

 Score = 176 bits (194),  Expect = 2e-41
 Identities = 254/356 (71%), Gaps = 2/356 (1%)
 Strand=Plus/Plus

Query  34      GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
               || ||||| ||||| || || |||||||| ||||| |||||| || | | ||  ||||||
Sbjct  419136  GGTATCGATCTCGGTACGACGTACTCGTGTGTGGGTGTGTGGAAGGATGGCCAAGTGGAA  419195

Query  94      ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
               ||||| ||||||    |||| |||||||| || || || |  || || || |  ||  ||
Sbjct  419196  ATCATTGCCAACTCGGAGGGTAACCGCACGACGCCATCGTGGGTGGCATTTAACGAGACG  419255

Query  154     GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGGTG  213
               || || || |||||||| ||||||||||  || |  |||  ||||||||||||||| |||
Sbjct  419256  GAGCGTCTGATCGGTGAGGCCGCCAAGATCCAAGCCGCCTCGAACGCGCACAACACCGTG  419315

Query  214     TTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACATC  273
               ||||||||||| ||| | || || ||||| |||   |||    ||||  ||   |||   
Sbjct  419316  TTCGACGCCAAGCGTATCATTGGTCGCAACTTCAACGACGAGATCGTGAAGAAGGACGCG  419375

Query  274     AAGCACTGGCCGTTCCA-AGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGCA  332
               |||||||  || ||| | | || ||  |||||  |   |||||  ||  ||   |||| |
Sbjct  419376  AAGCACTTCCCATTCAAGATTGTCG-AGGGCGATGACAACAAGGTGCTCATTGAGGTGGA  419434

Query  333     GTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCTGA  388
               |||||||||||||   |||   |||   || || ||||| || || |||||| |||
Sbjct  419435  GTTCAAGGGCGAGCAGAAGCGCTTCACGCCAGAAGAGATTTCATCGATGGTGTTGA  419490

>PYAP:scaffold_555 pag1_scaffold_555 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_555:1:21666:1 
REF
Length=21666

 Score = 356 bits (394),  Expect = 1e-95
 Identities = 782/1153 (68%), Gaps = 68/1153 (6%)
 Strand=Plus/Minus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             ||||||||||  | ||||| |||||  ||||   |||||||||||||||||| |||||||
Sbjct  3991  AGGACGCCGGTTCGATTGCTGGCCTTGACGTCAAGCGTATCATCAACGAGCCAACGGCCG  3932

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGC---GCAA---------CGTGC  508
             ||||  | || ||||| || ||||  || | |||| ||    ||||         |||||
Sbjct  3931  CCGCTCTTGCTTACGGTCTTGACACCAACGCCGGCCAGTCGGGCAAGGGTGTGAACGTGC  3872

Query  509   TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
             | |||||||| || || ||||| ||||||||||||||  ||||   ||||||| | ||||
Sbjct  3871  TCATCTTCGATCTTGGTGGCGGTACCTTCGATGTGTCGATCCTCAGCATTGAGAACGGCA  3812

Query  569   TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
             | |||||||||||| | || | ||||||||| ||||| ||||||||||||||||||||| 
Sbjct  3811  TTTTCGAGGTCAAGTCGACCGGTGGTGACACCCACCTTGGTGGTGAGGACTTCGACAACA  3752

Query  629   GCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGA--  686
              | |||| ||| || ||  |  |||||||||||||||| ||||   || |   ||  |  
Sbjct  3751  ACATGGTCGACTACCTCCTGTCGGAGTTCAAGCGCAAGAACCG--TGGCCTCGACCCATC  3694

Query  687   GAACCAG---CGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCT  743
             || |  |   |||||  | || ||||| || || ||||| |||   || ||||||| |||
Sbjct  3693  GACCTCGGCCCGTGCCATGCGCCGTCTCCGCACTGCCTGTGAGTCGGCTAAGCGTATGCT  3634

Query  744   GTCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAA  803
              ||| |  |  |   ||| |   | ||| | ||||| || ||||| ||  | ||||||| 
Sbjct  3633  CTCGACCACCACCTCGGCCTCGGTTGAGGTCGACTCGCTCTTCGAGGGTGTTGACTTCAG  3574

Query  804   CTCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGAT  863
             | | || ||||| |||||    ||||||     |  |  |||  |  ||  |||| || |
Sbjct  3573  CACCACGATCACGCGTGCCAAGTTCGAG---TCGCTCAACGAGGAGCTCTTCAAG-CGTT  3518

Query  864   ----GGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTG----  915
                 |||| |||| |  ||||||||    || |||||  ||      ||||||  |    
Sbjct  3517  GTGAGGAGACCGTCGTTAAGGTGCTCTCGGATGCCAACATG-----AAGCCAGAGGACAT  3463

Query  916   CAC-GAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTC  974
             ||| ||||| || || || || || || || |||||||| ||||| |||    |||| ||
Sbjct  3462  CACTGAGGTCGTCCTTGTTGGTGGTTCCACCCGTATCCCTAAGGTCCAGACCATGCTCTC  3403

Query  975   GGACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTA  1034
             || |   |||  ||||||||| | || |||||| |||||||| || ||||| || || ||
Sbjct  3402  GGCCCAGTTCGGCGGCAAGGAACTCAGCAAGTCGATCAACCCTGATGAGGCCGTCGCCTA  3343

Query  1035  CGGTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGA  1094
             ||||||  |||| ||||  |||||||| ||||| | |  | |  ||  | | |  ||  |
Sbjct  3342  CGGTGCCGCCGTCCAGGGTGCCATCCTCAGCGGTATC--CGCAACGACGCAAC--CA--A  3289

Query  1095  CCTGCTTCTGC---TGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGT  1151
             |  |||||| |   | || ||||| || ||||| || ||| | ||||| | ||||   ||
Sbjct  3288  CTCGCTTCTCCTTGTCGATGTGACCCCTCTGTCGCTCGGTATTGAGACCGTCGGTAAGGT  3229

Query  1152  CATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTC  1211
             |||| ||  ||| ||   ||| |||||  |  | ||   |   ||| | |    || | |
Sbjct  3228  CATGTCGGTGCTTATTAAGCGTAACACCGCCATCCCAGTCCGCAAGACCCGTGTGTACAC  3169

Query  1212  GACGTACGCCGACAACCAG-CCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCG---CT  1267
              ||  | |  ||| ||||| ||| || || |  ||    | | |||||| |||||   ||
Sbjct  3168  CACCGAGGAGGACTACCAGACCTCGGTTGAT-GTCTGCATCTACGAGGGTGAGCGTGCCT  3110

Query  1268  -CCATGACGCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCAT---CCCTCCC  1323
              |  ||||||    |||||||  ||| ||  |||||||| |    |||||    | | ||
Sbjct  3109  GCGTTGACGC----CAACAACAAGCTCGGTGAGTTCAACATCTCGGGCATTGAGCGTGCC  3054

Query  1324  ATGCCTCGCGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTG  1383
             | |   || || | ||| ||| | || || || ||||| ||||| || ||||| ||||| 
Sbjct  3053  AAG---CGTGGCGAGCCACAGGTTGAGGTCACCTTCGAGATCGATGCCAACGGTATCCTT  2997

Query  1384  AACGTGTCGGC---TGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAAC  1440
             |||||||||||   ||   |||||  | |||     | |    ||| ||| ||| |||||
Sbjct  2996  AACGTGTCGGCCCGTGACAAGAAG--ACCGGTGCCCGCG-CTGAGACCACCATCTCGAAC  2940

Query  1441  GACAAGGGCCGCCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTAC  1500
              ||   || || ||  | ||||  |||||||||||||||||  | ||||| |||||||||
Sbjct  2939  AACCGTGGTCGTCTGACCCAGGAGGACATTGACCGCATGGTTGCTGAGGCTGAGAAGTAC  2880

Query  1501  AAGTCGGAGGACG  1513
             |||  ||| ||||
Sbjct  2879  AAGAAGGACGACG  2867

 Score = 173 bits (191),  Expect = 3e-40
 Identities = 250/353 (71%), Gaps = 0/353 (0%)
 Strand=Plus/Minus

Query  34    GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
             || ||||| || || || ||||||||||| || || || ||| || | | ||  || || 
Sbjct  4448  GGTATCGATCTTGGTACCACCTACTCGTGTGTCGGTGTCTGGAAGGATGGCCAGGTCGAG  4389

Query  94    ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
             ||||| ||||||  | |||| ||||| ||||| || || |  || |||||||  ||||||
Sbjct  4388  ATCATTGCCAACAGCGAGGGTAACCGTACCACGCCATCGTGGGTTGCCTTCAACGACTCG  4329

Query  154   GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGGTG  213
             || || ||||||||||| ||||| ||||  ||||  |||  |||| |    |||||||| 
Sbjct  4328  GAGCGTCTCATCGGTGAGGCCGCTAAGATCCAGGCCGCCTCGAACCCATCGAACACGGTC  4269

Query  214   TTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACATC  273
             ||||||||||| ||| | || || || || |||   |||    | ||  ||   |||  |
Sbjct  4268  TTCGACGCCAAGCGTATCATTGGTCGTAACTTCAGCGACGAGATTGTGAAGAAGGACGCC  4209

Query  274   AAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGCAG  333
             | |||||  || ||| |  | |||  ||| |  |   |||||   |  |||  |||  ||
Sbjct  4208  ACGCACTTCCCATTCAAGATCACGGAGGGTGATGACAACAAGGTCCTCATCCAGGTCGAG  4149

Query  334   TTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
             |||||||| ||| ||||||  |||   || |||||||||||||| ||||||||
Sbjct  4148  TTCAAGGGTGAGACCAAGAGCTTCACCCCTGAGGAGATCTCGTCGATGGTGCT  4096

>PHIF:NW_003303754.1 Phytophthora infestans T30-4 supercont1.5 
genomic scaffold, whole genome shotgun sequence
Length=4768765

 Score = 354 bits (392),  Expect = 4e-95
 Identities = 295/361 (82%), Gaps = 0/361 (0%)
 Strand=Plus/Plus

Query  412      GCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCCGCCATCGCG  471
                || ||||| ||  | ||||||||||||||||| || ||||||||||| || || ||||| 
Sbjct  3143632  GCTATTGCTGGTTTGAACGTGCTGCGTATCATTAATGAGCCGACGGCTGCTGCGATCGCC  3143691

Query  472      TACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTGGGCGGCGGC  531
                ||  | || |||||||| || ||||||| |||||||||||||||||| || || ||||||
Sbjct  3143692  TATAGGCTCGACAAGAAAGGAGGCGAGCACAACGTGCTGATCTTCGATCTCGGAGGCGGC  3143751

Query  532      ACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAGGCCACTGCT  591
                || ||||| || || || ||  | ||||| || || ||||||||||||||||| || || 
Sbjct  3143752  ACGTTCGACGTCTCACTGCTAACTATTGAAGACGGGATCTTCGAGGTCAAGGCGACGGCG  3143811

Query  592      GGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCACTTCACGCAG  651
                |||||||||||| |||| |||||||||||||||||||| ||||| ||   ||||  |   
Sbjct  3143812  GGTGACACGCACTTGGGCGGTGAGGACTTCGACAACCGTCTGGTCGAGTTCTTCGTGACC  3143871

Query  652      GAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTTCGTCGTCTG  711
                ||||||||||| |||||||||||||| || |||  ||||||||| ||||| |||||||| 
Sbjct  3143872  GAGTTCAAGCGTAAGCACCGCAAGGATATGACGTCGAACCAGCGAGCTCTGCGTCGTCTT  3143931

Query  712      CGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCTTACATCGAG  771
                || ||||| ||||| || |||||||| ||||||||  | ||||| | ||| |||||||||
Sbjct  3143932  CGTACGGCGTGCGAACGCGCCAAGCGGACGCTGTCCACTTCGGCGCGGGCGTACATCGAG  3143991

Query  772      A  772
                |
Sbjct  3143992  A  3143992

>PHIF:NW_003303744.1 Phytophthora infestans T30-4 supercont1.15 
genomic scaffold, whole genome shotgun sequence
Length=3093265

 Score = 352 bits (389),  Expect = 5e-94
 Identities = 298/367 (81%), Gaps = 0/367 (0%)
 Strand=Plus/Plus

Query  406      GCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCCGCC  465
                || || || ||||| ||  | ||||||||||||||||| || ||||||||||| || || 
Sbjct  2026166  GCTGGAGCTATTGCTGGTTTGAACGTGCTGCGTATCATTAATGAGCCGACGGCTGCTGCG  2026225

Query  466      ATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTGGGC  525
                ||||| || || || |||||||| || ||||||| |||||||||||||||||| || || 
Sbjct  2026226  ATCGCATATGGGCTCGACAAGAAAGGAGGCGAGCACAACGTGCTGATCTTCGATCTCGGA  2026285

Query  526      GGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAGGCC  585
                 ||||||| ||||| || || || ||  | ||||| || || ||||||||||||||||| 
Sbjct  2026286  AGCGGCACGTTCGACGTCTCACTGCTAACTATTGAAGACGGGATCTTCGAGGTCAAGGCG  2026345

Query  586      ACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCACTTC  645
                || || |||||||||||| |||| |||| ||||||||||||||| ||||| ||   ||||
Sbjct  2026346  ACGGCGGGTGACACGCACTTGGGCGGTGTGGACTTCGACAACCGTCTGGTCGAGTTCTTC  2026405

Query  646      ACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTTCGT  705
                  |   ||| ||||||| |||||||||||||| || |||  ||||||||| ||||| |||
Sbjct  2026406  GTGACCGAGCTCAAGCGTAAGCACCGCAAGGATATGACGTCGAACCAGCGAGCTCTGCGT  2026465

Query  706      CGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCTTAC  765
                ||||| || ||||| ||||| || |||||||| ||||||||  | ||||| ||||| |||
Sbjct  2026466  CGTCTTCGTACGGCGTGCGAACGCGCCAAGCGGACGCTGTCCACTTCGGCGCAGGCGTAC  2026525

Query  766      ATCGAGA  772
                |||||||
Sbjct  2026526  ATCGAGA  2026532

 Score = 340 bits (376),  Expect = 9e-91
 Identities = 296/367 (81%), Gaps = 2/367 (1%)
 Strand=Plus/Plus

Query  406      GCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCCGCC  465
                || || || ||||| ||  | ||||||||||||||||| || ||||||||||| || || 
Sbjct  2216090  GCTGGAGCTATTGCTGGTTTGAACGTGCTGCGTATCATTAATGAGCCGACGGCTGCTGCG  2216149

Query  466      ATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACCTGGGC  525
                ||||| || || || |||||||| || ||||||| ||| |||||  ||||||| || || 
Sbjct  2216150  ATCGCCTATGGGCTCGACAAGAAAGGAGGCGAGCACAATGTGCT--TCTTCGATCTCGGA  2216207

Query  526      GGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCAAGGCC  585
                |||||||| ||||| || || || ||  | ||||| || || || |||||||||||||| 
Sbjct  2216208  GGCGGCACGTTCGACGTCTCACTGCTAACTATTGAAGACGGGATTTTCGAGGTCAAGGCG  2216267

Query  586      ACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACCACTTC  645
                || || |||||||||||| |||| |||| ||||||||||||||| ||||| ||   ||||
Sbjct  2216268  ACGGCGGGTGACACGCACTTGGGCGGTGTGGACTTCGACAACCGTCTGGTCGAGTTCTTC  2216327

Query  646      ACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTCTTCGT  705
                  |   ||||||||||| |||||||||||||| || |||  ||||||||| ||||| |||
Sbjct  2216328  GTGACCGAGTTCAAGCGTAAGCACCGCAAGGATATGACGTCGAACCAGCGAGCTCTGCGT  2216387

Query  706      CGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTCGGCTCAGGCTTAC  765
                ||||| || ||||| ||||| || |||||||| ||||||||  | ||||| ||||| |||
Sbjct  2216388  CGTCTTCGTACGGCGTGCGAACGCGCCAAGCGGACGCTGTCCCCTTCGGCGCAGGCGTAC  2216447

Query  766      ATCGAGA  772
                |||||||
Sbjct  2216448  ATCGAGA  2216454

>HYAP:scaffold_212 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_212:1:97642:1 
REF
Length=97642

 Score = 352 bits (389),  Expect = 5e-94
 Identities = 793/1181 (67%), Gaps = 42/1181 (4%)
 Strand=Plus/Minus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||| || ||||||||||| ||| |  |||||  ||||||||| || ||||||||||| |
Sbjct  43177  AGGATGCTGGCGCCATTGCTGGCTTGGACGTGAAGCGTATCATTAATGAGCCGACGGCTG  43118

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGC---GA--GC-------GCAACGTGC  508
              | ||  |||| ||||| || |||| ||| |  |||   ||  ||       |||||||||
Sbjct  43117  CGGCTCTCGCCTACGGTCTCGACACGAATGCTGGCACGGACGGCAAAGTTTGCAACGTGC  43058

Query  509    TGATCTTCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCA  568
              ||||||||||| ||||||| || ||||| || |||||  |||| || |||||| | || |
Sbjct  43057  TGATCTTCGACTTGGGCGGTGGTACCTTTGACGTGTCGATCCTCTCGATTGAGAACGGGA  42998

Query  569    TCTTCGAGGTCAAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACC  628
              |||||||||||||| |||||| |||||||||||| || |||||||||||||| |||||| 
Sbjct  42997  TCTTCGAGGTCAAGTCCACTGGTGGTGACACGCATCTTGGTGGTGAGGACTTTGACAACA  42938

Query  629    GCCTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAA---GGACATCACGG  685
               | |||| ||  || ||  |   ||||||||||||||| |||||||   ||||  |   |
Sbjct  42937  ACATGGTCGAGTACCTCCTGGCAGAGTTCAAGCGCAAGAACCGCAACCTGGAC-CCGTCG  42879

Query  686    AGAAC-CAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTG  744
              ||  |    |||||  | |||||||| || ||||| || |||   ||||| || | ||| 
Sbjct  42878  AGTTCGGCTCGTGCCATGCGTCGTCTTCGAACGGCATGTGAGTCGGCCAAACGCATGCTC  42819

Query  745    TCGTCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAAC  804
              ||| |  |  |    || |   | ||  | |||||  ||||||| ||  | |||||    
Sbjct  42818  TCGACAACCACAAGCGCGTCGGTGGAAGTGGACTCGTTGTTCGAGGGTGTGGACTTTTCG  42759

Query  805    TCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGA-CTACTTCCGCAAGACGAT  863
              || ||  |||| |||||    || |||    ||   |  || ||  |   ||    ||| 
Sbjct  42758  TCCACGGTCACCCGTGCCAAGTTTGAGTCGCTGAATGAAGAGCTGTTCAAGCGCTGCGA-  42700

Query  864    GGAGCCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAG---GTGCACGA  920
              |||| | |||  |||||||||    || |||||| |   ||||  | ||   |||   ||
Sbjct  42699  GGAGACGGTGCTGAAGGTGCTCGAGGATGCCAAGAT---GAAGCCCGAGAACGTGACGGA  42643

Query  921    GGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTT  980
              | | ||||| || || || || ||||||||||| |||||||||  | |||| |||  | |
Sbjct  42642  GCTTGTGCTTGTTGGAGGTTCCACGCGTATCCCCAAGGTGCAGACGATGCTCTCGTCCCT  42583

Query  981    CTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGC  1040
              |||   |||||||||||    |||||| || |||||||||||||| ||||| ||||||||
Sbjct  42582  CTTTGGCGGCAAGGAGCTATCCAAGTCGATTAACCCGGACGAGGCCGTGGCTTACGGTGC  42523

Query  1041   GACCGTGCAGGCGGCCATCCTG------AGCGGCAACGACTCGTCGGAGAAGCTGCAGGA  1094
                | |||||||  || ||  ||      | | |||||||    |  ||  | ||      
Sbjct  42522  CGCTGTGCAGGGTGCGATTTTGGATGGTATCCGCAACGA----TGCGACCAACT-----C  42472

Query  1095   CCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCAT  1154
                |||| ||| ||||||||||||||||||| |||||| | ||||| |  ||    |||||
Sbjct  42471  GTTGCTGCTGGTGGACGTGACGCCGCTGTCGCTGGGTATTGAGACTGTGGGCAAGGTCAT  42412

Query  1155   GACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGAC  1214
              | ||  ||| ||   ||| |||||| |  | ||      |||  | |    || | ||||
Sbjct  42411  GTCGGTGCTCATTAAGCGCAACACGGCCATCCCTGTGCGGAAAACCCGCGTGTACACGAC  42352

Query  1215   GTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGAC  1274
              | | |  ||| ||||| |    |||  | |     | | |||||||||||| | | ||  
Sbjct  42351  GGAAGAGGACTACCAGACGTCCGTGGACGTGTGCATCTACGAGGGCGAGCG-TGCTTGCG  42293

Query  1275   GCGCGAC-AACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCG  1333
                | | | ||||||  ||||||| | |||||| |    ||| |    |    |   || |
Sbjct  42292  TTGAGTCGAACAACAAGCTGGGCGAATTCAACATTTCGGGCTTGGAGCGTGCGAAACGAG  42233

Query  1334   GTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGG  1393
              | | ||||||| | || ||||||||||| || |||||||| || ||| |||||||||| |
Sbjct  42232  GCGAGCCGCAGGTTGAGGTGACGTTCGAGATTGACGCGAATGGTATCTTGAACGTGTCTG  42173

Query  1394   CTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCC  1453
              ||   || |||   |||||   | ||    |||  |||||  | ||  ||   |||||  
Sbjct  42172  CTCGCGACAAGAAGACGGGTGCGAAGGCGGAGACGACGATTTCTAATAACCGCGGCCGTT  42113

Query  1454   TCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACG  1513
              |  | ||||  || || |||||||||||  | |||||||| ||||  |||  ||| ||||
Sbjct  42112  TGACCCAGGAGGATATCGACCGCATGGTTGCCGAGGCCGACAAGTTTAAGAAGGACGACG  42053

Query  1514   AGGCTAACAAGCAACGCATCGAGGCCAAGAACGCGCTGGAG  1554
               ||  |    ||  ||||| ||||||   ||||  ||||||
Sbjct  42052  CGGAGATGTTGCGTCGCATTGAGGCCCGTAACGACCTGGAG  42012

 Score = 154 bits (170),  Expect = 7e-35
 Identities = 248/354 (70%), Gaps = 2/354 (1%)
 Strand=Plus/Minus

Query  34     GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGTGGAA  93
              || || || ||||| || || ||||||||||| || |||||| |  | |  |  ||||| 
Sbjct  43634  GGTATTGATCTCGGTACGACGTACTCGTGCGTCGGTGTGTGGAAAGATGGTCAAGTGGAG  43575

Query  94     ATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAGACTCG  153
              ||||| || |||    | ||||||||||| || ||||| |  ||||| ||||  |||   
Sbjct  43574  ATCATTGCTAACAGTGAAGGCAACCGCACGACGCCGTCGTGGGTCGCGTTCAATGACAGC  43515

Query  154    GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCAC-AACACGGT  212
              ||||| || |||||||| || |||||||  |||| |||    || || ||| ||||||||
Sbjct  43514  GAACGTCTGATCGGTGAAGCGGCCAAGATCCAGGCGGCTGGCAATGC-CACGAACACGGT  43456

Query  213    GTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCCGACAT  272
              ||| ||||| |||||  | || || || |  |||   |||   |||||  ||   |||  
Sbjct  43455  GTTTGACGCGAAACGGATCATTGGTCGGAGTTTCAGTGACGAAGTCGTGAAGAAGGACGC  43396

Query  273    CAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGGTGACAAGCCGCAGATCACGGTGCA  332
              ||||||||  |||||| |  | | |  ||||| || |||||||  |  |||    ||| |
Sbjct  43395  CAAGCACTTCCCGTTCAAGATTAAGGAGGGCGACGATGACAAGGTGTTGATTGAAGTGGA  43336

Query  333    GTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGCT  386
              ||| ||||| |||   ||||  |||   || || ||||| ||||| ||||||||
Sbjct  43335  GTTTAAGGGAGAGAAGAAGAGCTTCACGCCGGAAGAGATTTCGTCTATGGTGCT  43282

>PHRA:scaffold_4
Length=963095

 Score = 324 bits (359),  Expect = 7e-86
 Identities = 706/1046 (67%), Gaps = 47/1046 (4%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               |||||||||||   || ||||| ||  ||||||| ||||||||||| ||||| |||||||
Sbjct  462999  AGGACGCCGGCAAGATCGCCGGTCTGGACGTGCTCCGTATCATCAATGAGCCCACGGCCG  463058

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               | ||| | || |||||| ||||||||   | |||| ||  || ||  | | |||||||||
Sbjct  463059  CTGCCCTGGCCTACGGCATGGACAAGGCCGACGGCAAGGTCATCG--CCG-TCTTCGACC  463115

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               |||| ||||| ||||||||||||||  |||||   ||   ||  ||| | ||||||||||
Sbjct  463116  TGGGTGGCGGTACCTTCGATGTGTCGATCCTGGAGATCTCGGGCGGCGTGTTCGAGGTCA  463175

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               || ||||    || |||||||  || || || |||||||||||| |    ||  ||    
Sbjct  463176  AGTCCACCAACGGCGACACGCTGCTCGGCGGCGAGGACTTCGACGAGGAGCTCCTGCGTT  463235

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               || ||  | | |||||||||    ||  | |||  ||| |  |||   || | |  ||  
Sbjct  463236  ACCTCGTGGACGAGTTCAAGAAGGAGTCCAGCATCGACCTGTCGGGCGACAACCTCGCCA  463295

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCG-TC-GGCTCA  758
               | |  ||||||||   ||||   |||   ||||||||   |||  || || || ||| ||
Sbjct  463296  TGCAGCGTCTGCGTGAGGCCGCGGAGAAGGCCAAGCGCGAGCT--CGACGGTCTGGCCCA  463353

Query  759     GGCTTACATCGAGATTGACTCTCT----GTTCGACGGCATCG---------ACTTCAACT  805
               | || ||||| ||  || |  ||     |  ||||| || ||         |||| ||| 
Sbjct  463354  GACTGACATC-AGCCTGCCCTTCATCACGGCCGACGCCACCGGCCCCAAGCACTTGAACA  463412

Query  806     CGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGA-CTACTTCCGCAAGACGATG  864
                ||  ||||| || ||    |||||| |  ||  |||| | ||  |   ||   || |||
Sbjct  463413  TGAAGATCACGCGCGCCACCTTCGAGCAGCTGGTCGGCAAGCTGATCGAGCGC-ACCATG  463471

Query  865     GAGCCCGTGGAGAAGGTGCTGCGCG-ACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGT  923
               | ||||||| |  | ||||  |  | ||||    |||   |||||  || |  |||||||
Sbjct  463472  G-GCCCGTGCAAGAAGTGCGTCAAGGACGCTGGCCTGGACAAGAGTGAGATCAACGAGGT  463530

Query  924     GGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTT  983
                 | || || |||||   | ||||||| || |||||||||  |    ||  ||| |||||
Sbjct  463531  CATCCTTGTTGGCGGTATGTCGCGTATGCCCAAGGTGCAGACGACCGTGGAGGAGTTCTT  463590

Query  984     CAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGAC  1043
               |   |||||| |||||   |||    ||||||| || ||||  |||||    || ||  |
Sbjct  463591  C---GGCAAGAAGCCCTCGAAGGGTGTCAACCCCGATGAGGTCGTGGCCATGGGCGCTGC  463647

Query  1044    CGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCT  1103
               | | ||||  |   | ||| ||||  |||               || ||||| | || ||
Sbjct  463648  CATCCAGGGTGGTGTGCTGCGCGGTGACG---------------TGAAGGACATTCTGCT  463692

Query  1104    GCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCT  1163
               |||||| ||||| |||||||| |||||| | |||||    || |||||  | || | |||
Sbjct  463693  GCTGGATGTGACCCCGCTGTCCCTGGGTATTGAGACCCTGGGCGGTGTGTTCACCAAGCT  463752

Query  1164    GATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGA  1223
               |||| |||| ||||||||| | || || ||||||||||||  ||||||||||   || ||
Sbjct  463753  GATCCCGCGTAACACGACGATCCCCACGAAGAAGTCGCAGGTGTTCTCGACGGCTGCTGA  463812

Query  1224    CAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAA  1283
               |   ||| |   ||||  |||| ||||| |  ||||||||||    ||| |    |||||
Sbjct  463813  CTCGCAGACGCAGGTGGGCATCAAGGTGCTGCAGGGCGAGCGTGAGATGGCTACTGACAA  463872

Query  1284    CAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGC--GGTGTGCCG  1341
               ||| ||||||||||| ||| ||||||  |||||||| ||  |||| |||  || ||||| 
Sbjct  463873  CAAGCTGCTGGGCAACTTCGACCTGGTGGGCATCCCGCC--TGCCCCGCGTGGCGTGCCT  463930

Query  1342    CAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAG  1401
               ||||| || ||||  |||||||| ||||| ||||| ||| ||||||||   ||    || 
Sbjct  463931  CAGATTGAGGTGAGCTTCGACATTGACGCCAACGGAATCGTGAACGTGGGCGCCCGCGAC  463990

Query  1402    AAGTCAACGGGCAAGGAGAACAAGAT  1427
               ||| | |||||||||||| | || ||
Sbjct  463991  AAGGCCACGGGCAAGGAGCAGAACAT  464016

 Score = 74.3 bits (81),  Expect = 2e-10
 Identities = 157/229 (69%), Gaps = 13/229 (6%)
 Strand=Plus/Plus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAG---AACGAC-CGT  87
               ||||||||||||| ||||| ||| |||||||||||| |||   | ||   || | | || 
Sbjct  462546  TCGGCATCGACCTGGGCACGACCAACTCGTGCGTGGCCGTCATGGAGGGCAAAGCCGCGC  462605

Query  88      GTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCC-TTC--  144
               |||    | ||||  |||    |||||   ||||| || |||||   ||| ||| |||  
Sbjct  462606  GTG----TGATCGAGAACTCAGAGGGCGCGCGCACGACGCCGTCGGTCGTGGCCATTCTG  462661

Query  145     -ACAGACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCA  203
                ||| ||   || |||||| | |||    |||| |||   ||||  |  | |||| || |
Sbjct  462662  GACA-ACGACGAGCGCCTCGTGGGTATGCCCGCTAAGCGCCAGGCCGTGACGAACCCGGA  462720

Query  204     CAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGAC  252
                |||||| | | || || ||| || ||||| ||||||||||||  ||||
Sbjct  462721  GAACACGTTCTACGCCGTCAAGCGCCTGATTGGCCGCAAGTTCGAGGAC  462769

>PHPA:scaffold_82 NW_008649068.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.82, whole genome shotgun 
sequence
Length=225490

 Score = 318 bits (352),  Expect = 3e-84
 Identities = 706/1043 (68%), Gaps = 41/1043 (4%)
 Strand=Plus/Minus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              ||||||||||    |||||||| ||  ||||||| ||||| ||||||||||| ||||| |
Sbjct  61202  AGGACGCCGGTAAGATTGCCGGTCTGGACGTGCTCCGTATTATCAACGAGCCTACGGCTG  61143

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              | ||  | || |||||  ||||||||   | |||  ||  ||   ||||| | |||||||
Sbjct  61142  CTGCTCTGGCCTACGGTATGGACAAGGCCGACGGTAAGGTCAT--TGCTG-TGTTCGACC  61086

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              |||| ||||| ||||||||||||||  |||||   ||   ||  ||  | ||||||||||
Sbjct  61085  TGGGTGGCGGTACCTTCGATGTGTCGATCCTGGAGATCTCGGGCGGTGTGTTCGAGGTCA  61026

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
              || | ||    ||||||||||  || || ||||||||||||||  |    ||| ||    
Sbjct  61025  AGTCGACCAACGGTGACACGCTGCTTGGCGGTGAGGACTTCGATGAGGAGCTGCTGCGTT  60966

Query  641    ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
              || ||  | | |||||||||    ||    |||  ||| |  |||   || | |  ||  
Sbjct  60965  ACCTCGTGGACGAGTTCAAGAAGGAGACGAGCATCGACCTGTCGGGTGACAACCTGGCCA  60906

Query  701    TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTC-GGCTCAG  759
              | |  ||||||||   ||||   |||   |||||||||  ||| |  | ||| ||| |||
Sbjct  60905  TGCAGCGTCTGCGTGAGGCCGCTGAGAAGGCCAAGCGTGAGCT-TGATGGTCTGGCCCAG  60847

Query  760    GCTTACATCGAGATTGACTCTCT----GTTCGACGGCATCG---------ACTTCAACTC  806
               |  ||||| ||  || || ||     |  |||||  | ||         |||| |||  
Sbjct  60846  ACGGACATC-AGTCTGCCTTTCATCACGGCCGACGCTACCGGCCCCAAGCACTTGAACAT  60788

Query  807    GACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGA-CTACTTCCGCAAGACGATGG  865
              ||  ||||| |||||    |||||| |  ||   ||| | ||| ||  ||   || ||||
Sbjct  60787  GAAGATCACGCGTGCCACCTTCGAGAAGCTGGTGGGCAAGCTAATTGAGCGT-ACTATGG  60729

Query  866    AGCCCGTGGAGAAGGTGCTGCGCG-ACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTG  924
               |||| || |  | ||||  |  | ||||    |||   |||||| |  |  ||||||| 
Sbjct  60728  -GCCCCTGCAAGAAGTGCGTCAAGGACGCTGGTCTGGACAAGAGCGAAATCAACGAGGTC  60670

Query  925    GTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTC  984
               | ||||| |||||   | ||||||| || |||||||||  |  | ||  ||| ||||||
Sbjct  60669  ATTCTGGTCGGCGGTATGTCGCGTATGCCCAAGGTGCAGACGACGGTGGAGGAGTTCTTC  60610

Query  985    AACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACC  1044
                 |||||| |||||   |||  | | |||||||| ||||  ||||| || ||       
Sbjct  60609  ---GGCAAGAAGCCCTCAAAGGGCGTGAACCCGGATGAGGTCGTGGC-TATGG-------  60561

Query  1045   GTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCTG  1104
                ||  || || |||| | | |||   |   ||| || || | || ||||| | || |||
Sbjct  60560  --GC--GCTGCTATCCAGGGTGGCGT-GCTGCGT-GGTGACG-TGAAGGACATTCTGCTG  60508

Query  1105   CTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCTG  1164
              ||||| ||||| || |||||||||||| | |||||    || |||||  | || | ||| 
Sbjct  60507  CTGGATGTGACTCCTCTGTCTCTGGGTATTGAGACTTTGGGCGGTGTGTTCACCAAGCTC  60448

Query  1165   ATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGAC  1224
              ||| |||| ||||||||  | ||||||||||||||||||  ||||||||||   || |||
Sbjct  60447  ATCCCGCGTAACACGACCATCCCGACCAAGAAGTCGCAGGTGTTCTCGACGGCTGCTGAC  60388

Query  1225   AACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAAC  1284
                 ||| ||  ||||  |||| ||||| |  |||| |||||    ||| |   |||||||
Sbjct  60387  TCGCAGACTCAGGTGGGCATCAAGGTGCTGCAGGGTGAGCGTGAGATGGCTGCCGACAAC  60328

Query  1285   AACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCAG  1344
              || ||||||||||| ||| || |||  |||||||| ||    ||||| ||||| || |||
Sbjct  60327  AAGCTGCTGGGCAACTTCGACTTGGTGGGCATCCCGCCTGCCCCTCGTGGTGTCCCTCAG  60268

Query  1345   ATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAAG  1404
              || || ||||  |||||||| ||||| ||||| ||| | |||||    |||   || |||
Sbjct  60267  ATTGAGGTGAGCTTCGACATTGACGCCAACGGAATCGTCAACGTCGGTGCTCGTGACAAG  60208

Query  1405   TCAACGGGCAAGGAGAACAAGAT  1427
               | |||||||||||| | || ||
Sbjct  60207  GCCACGGGCAAGGAGCAGAACAT  60185

 Score = 44.6 bits (48),  Expect = 0.092
 Identities = 54/74 (73%), Gaps = 0/74 (0%)
 Strand=Plus/Minus

Query  173    CCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGA  232
              ||||||||   ||||  |  |  ||| || | |||||  | | || || ||| |||||||
Sbjct  61511  CCGCCAAGCGCCAGGCTGTGACTAACCCGGAGAACACTTTCTACGCCGTCAAGCGTCTGA  61452

Query  233    TCGGCCGCAAGTTC  246
              ||||||| ||||||
Sbjct  61451  TCGGCCGTAAGTTC  61438

 Score = 41.9 bits (45),  Expect = 1.1
 Identities = 33/40 (83%), Gaps = 0/40 (0%)
 Strand=Plus/Minus

Query  32     TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGT  71
              |||| || ||||| || || ||| |||||||||||| |||
Sbjct  61655  TCGGTATTGACCTGGGTACGACCAACTCGTGCGTGGCCGT  61616

>PYAR:scaffold_2046 par_scaffold_2046 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_2046:1:6189:1 
REF
Length=6189

 Score = 303 bits (335),  Expect = 2e-79
 Identities = 748/1117 (67%), Gaps = 56/1117 (5%)
 Strand=Plus/Minus

Query  401   AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
             ||||||||||    |||||||| ||| | ||| ||||||||||||||||||| |||||||
Sbjct  2554  AGGACGCCGGTAAGATTGCCGGTCTCGATGTGTTGCGTATCATCAACGAGCCCACGGCCG  2495

Query  461   CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
             | ||  ||||||||||| ||||||||   | |||| ||  || ||  | | |||| ||| 
Sbjct  2494  CTGCGCTCGCGTACGGCATGGACAAGGCCGACGGCAAGGTCATCG--CCG-TCTTTGACT  2438

Query  521   TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
             ||||||| || ||||||||||||||  ||||    ||   ||  ||| |||| |||||||
Sbjct  2437  TGGGCGGTGGTACCTTCGATGTGTCGATCCTTGAGATCTCGGGCGGCGTCTTTGAGGTCA  2378

Query  581   AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
             |||||||    ||||| ||||  || ||||| || ||||||||| |    ||| ||    
Sbjct  2377  AGGCCACGAACGGTGATACGCTGCTCGGTGGCGAAGACTTCGACGAGGAGCTGCTGCGAT  2318

Query  641   ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
             || ||  |   |||||||||    ||  | |||  ||| || | |   || | | |||  
Sbjct  2317  ACCTCGTGACCGAGTTCAAGAAGGAGACCAGCATTGACCTCTCTGGTGACAACCTTGCGA  2258

Query  701   TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCG-TCGTC-GGCTCA  758
             | |  ||||| ||   ||||   |||   |||||||||  |||  || | ||| ||| ||
Sbjct  2257  TGCAGCGTCTCCGTGAGGCCGCTGAGAAGGCCAAGCGTGAGCT--CGATGGTCTGGCGCA  2200

Query  759   GGCTTACATCGAGATTGAC-----TCTCTGTT----CGACGG----CATCGACTTCAACT  805
             | |  ||||| ||  || |     || | |      ||||||    ||   |||| ||| 
Sbjct  2199  GACCGACATC-AGCCTGCCGTTCATCACGGCCGACGCGACGGGCCCCAAGCACTTGAACA  2141

Query  806   CGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTC---CGCAAGACGA  862
              ||  ||||| |||||    |||||| |  |   |||| ||  | |    ||||   | |
Sbjct  2140  TGAAGATCACGCGTGCAACCTTCGAGAAGCTCGTCGGCAACCTCGTGGAGCGCA---CCA  2084

Query  863   TGGAGCCCGTGGA-GAAG-GTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGA  920
             ||| | ||||| | |||| |||    | |||||    ||    ||||   |  |  ||||
Sbjct  2083  TGG-GTCCGTGCAAGAAGTGTGTCAAG-GACGCGGGTCTTGACAAGAAGGACATCAACGA  2026

Query  921   GGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTT  980
              ||| | || || || ||   | |||| || |||||||||||||||  | |   ||| ||
Sbjct  2025  AGTGATTCTTGTTGGTGGTATGTCGCGCATGCCGAAGGTGCAGCAGTCGGTCGAGGAGTT  1966

Query  981   CTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGC  1040
             ||||   |||||| ||||   ||||    | |||||||||||||  |||||    |||||
Sbjct  1965  CTTC---GGCAAGAAGCCGTCCAAGGGTGTGAACCCGGACGAGGTCGTGGCCATGGGTGC  1909

Query  1041  GACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCT  1100
             | || | ||||  |   || || ||||| ||| |                ||||| |  |
Sbjct  1908  GGCCATCCAGGGCGGTGTCTTGCGCGGCGACGTCA---------------AGGACATTTT  1864

Query  1101  TCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGAC  1160
              ||||| || || ||||||||||| || ||  | ||||||   || |||||| | || | 
Sbjct  1863  GCTGCTTGATGTCACGCCGCTGTCGCTCGGCATTGAGACGCTTGGCGGTGTCTTCACCAA  1804

Query  1161  GCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGC  1220
             ||| ||  |||| ||||||||| | ||||||||||||||||||   |||||||||  |||
Sbjct  1803  GCTCATTCCGCGCAACACGACGATCCCGACCAAGAAGTCGCAGGTCTTCTCGACGGCCGC  1744

Query  1221  CGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGA  1280
              ||    ||| |   |||   |||| ||||| || ||||||||||    ||| |    ||
Sbjct  1743  TGATTCGCAGACCCAGGTCGGCATCAAGGTGCTCCAGGGCGAGCGTGAGATGGCTGCTGA  1684

Query  1281  CAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCC  1340
             ||||||   ||| || || ||| || ||| ||| ||||| ||    || || ||||||||
Sbjct  1683  CAACAAGTCGCTCGGTAACTTCGACTTGGTCGGTATCCCGCCGGCCCCGCGTGGTGTGCC  1624

Query  1341  GCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGT--GTCGGCTGTG  1398
             |||||| || || ||||||||||| || || ||||| ||| |||||||  ||  || |||
Sbjct  1623  GCAGATTGAAGTCACGTTCGACATTGATGCCAACGGTATCGTGAACGTCAGTGCGC-GTG  1565

Query  1399  GAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCG  1458
              | ||||| |||||||||||| | |  ||   |||| |   ||  |  ||  | || |||
Sbjct  1564  -ACAAGTCGACGGGCAAGGAGCAGAGCATTGTGATC-CAGTCG--AGCGGTGGTCTGTCG  1509

Query  1459  CAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGA  1495
              | || |||||||| ||||||||   |||||| ||||
Sbjct  1508  GACGCCGACATTGAGCGCATGGTCCAGGAGGCTGAGA  1472

 Score = 57.2 bits (62),  Expect = 1e-05
 Identities = 151/227 (67%), Gaps = 13/227 (6%)
 Strand=Plus/Minus

Query  34    GGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTG-----TGGCAGAACGACCGTG  88
             ||||| || |||||||| ||| |||||||||||| ||||      ||||  ||| ||| |
Sbjct  3005  GGCATTGATCTCGGCACGACCAACTCGTGCGTGGCCGTGATGGAGGGCAAGACG-CCGCG  2947

Query  89    TGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCACAG  148
             ||    | || |  |||| | | ||    ||||| || |||||    |||||  ||   |
Sbjct  2946  TG----TGATTGAAAACGCCGAAGGTGCGCGCACGACGCCGTCCGTGGTCGCGATCCTCG  2891

Query  149   AC-TCG--GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACA  205
             ||  ||  || |||||| | ||     ||||||||   ||||  |  |  ||| || | |
Sbjct  2890  ACAACGAAGAGCGCCTCGTGGGCATGCCCGCCAAGCGCCAGGCCGTGACCAACCCGGAGA  2831

Query  206   ACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGAC  252
             ||||  | | || || ||| ||||| || ||||||||||||  ||||
Sbjct  2830  ACACATTCTACGCCGTCAAGCGTCTCATTGGCCGCAAGTTCCAGGAC  2784

>PHCA:scaffold_6 PHYCAscaffold_6
Length=1423605

 Score = 303 bits (335),  Expect = 2e-79
 Identities = 701/1045 (67%), Gaps = 45/1045 (4%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||||||    |||||||| ||  ||||||| ||||| || |||||||| ||||| |
Sbjct  444905  AGGACGCCGGTAAGATTGCCGGTCTGGACGTGCTTCGTATTATTAACGAGCCCACGGCTG  444964

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
               | ||| | || |||||| ||||||||   | |||| ||  ||   ||||| |||||||||
Sbjct  444965  CTGCCCTTGCCTACGGCATGGACAAGGCTGACGGCAAGGTCAT--TGCTG-TCTTCGACC  445021

Query  521     TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
               |||| ||||| ||||||||||| ||  |||||   ||   ||  ||  | ||||||||||
Sbjct  445022  TGGGTGGCGGTACCTTCGATGTTTCCATCCTGGAGATCTCGGGCGGTGTGTTCGAGGTCA  445081

Query  581     AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
               || ||||    |||||||| |  || |||||||||||||||||| |    ||| ||    
Sbjct  445082  AGTCCACCAACGGTGACACCCTTCTCGGTGGTGAGGACTTCGACGAGGAGCTGCTGCGTT  445141

Query  641     ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
               || ||  | | |||||||||    ||  | |||  ||  |  |||   || | |  ||| 
Sbjct  445142  ACCTCGTGGACGAGTTCAAGAAGGAGACCAGCATTGATCTGTCGGGCGACAACCTGGCTA  445201

Query  701     TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTC-GGCTCAG  759
               | |  ||||| ||   ||||   |||   |||||||||  ||| |  | | | |||||||
Sbjct  445202  TGCAGCGTCTCCGTGAGGCCGCTGAGAAGGCCAAGCGTGAGCT-TGATGGCCTGGCTCAG  445260

Query  760     GCTTACATCGAGATTGACTCTCTGTTCG----ACGGCATCG---------ACTTCAACTC  806
                |  ||||| ||  || || ||    ||    ||| || ||         |||| |||  
Sbjct  445261  ACGGACATC-AGTCTGCCTTTCATCACGGCTGACGCCACCGGCCCCAAGCACTTGAACAT  445319

Query  807     GACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAG---ACGAT  863
               ||  ||||| ||||||   |||||| |  || | ||  |  |  ||  | ||   || ||
Sbjct  445320  GAAGATCACCCGTGCTACCTTCGAGAAGCTG-GTGGGTA--AGCTCATCGAGCGTACCAT  445376

Query  864     GGAGCCCGTGGAGAAGGTGCTGCGCG-ACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGG  922
               || ||||||| |  | ||||  |  | ||||    |||  ||||||| |  |  ||||||
Sbjct  445377  GG-GCCCGTGCAAGAAGTGCGTCAAGGACGCTGGTCTGGAGAAGAGCGACATTAACGAGG  445435

Query  923     TGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCT  982
               |  | || || |||||   | ||||||| || |||||||||  |    ||  ||| ||||
Sbjct  445436  TCATTCTTGTCGGCGGTATGTCGCGTATGCCTAAGGTGCAGACGTCCGTGGAGGAGTTCT  445495

Query  983     TCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGA  1042
               ||   |||||| |||||   |||    ||||||| || ||||  |||||    |||||  
Sbjct  445496  TC---GGCAAGAAGCCCTCGAAGGGTGTCAACCCCGATGAGGTCGTGGCCATGGGTGCTG  445552

Query  1043    CCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTC  1102
               |  | ||||  | | | |||             ||| || || | || ||||| |  | |
Sbjct  445553  CTATCCAGGGTGGCGTGCTG-------------CGT-GGTGATG-TGAAGGACATCTTGC  445597

Query  1103    TGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGC  1162
               |||| || ||||| || ||||| |||||| | |||||    ||||| ||  | || | ||
Sbjct  445598  TGCTAGATGTGACCCCTCTGTCCCTGGGTATTGAGACTCTGGGTGGCGTGTTCACCAAGC  445657

Query  1163    TGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCG  1222
               ||||| |||| ||||| ||| | ||||| ||||||||||||  |||||||||    || |
Sbjct  445658  TGATCCCGCGTAACACTACGATCCCGACGAAGAAGTCGCAGGTGTTCTCGACTGCTGCTG  445717

Query  1223    ACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACA  1282
               ||   ||| ||  ||||  |||| ||||| |  |||| |||||    ||| |   |||||
Sbjct  445718  ACTCGCAGACTCAGGTGGGCATCAAGGTGCTGCAGGGTGAGCGTGAGATGGCTGCCGACA  445777

Query  1283    ACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGC  1342
               |||| ||||| ||||| ||| |||| | ||| ||||| ||    ||||| || ||||| |
Sbjct  445778  ACAAGCTGCTCGGCAACTTCGACCTTGTCGGAATCCCGCCTGCCCCTCGTGGCGTGCCCC  445837

Query  1343    AGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGA  1402
               |||| || ||||  |||||||| ||||| ||||| ||| |||||||    ||    || |
Sbjct  445838  AGATTGAGGTGAGCTTCGACATTGACGCCAACGGAATCGTGAACGTCGGTGCCCGCGACA  445897

Query  1403    AGTCAACGGGCAAGGAGAACAAGAT  1427
               || | |||||||||||| | || ||
Sbjct  445898  AGGCCACGGGCAAGGAGCAGAACAT  445922

 Score = 55.4 bits (60),  Expect = 5e-05
 Identities = 152/230 (66%), Gaps = 15/230 (7%)
 Strand=Plus/Plus

Query  32      TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGT-----GGCAGAAC-GACC  85
               |||| || || || ||||| ||| |||||||||||| ||||      ||||  || | ||
Sbjct  444452  TCGGTATTGATCTGGGCACGACCAACTCGTGCGTGGCCGTGATGGAGGGCAAGACTGCCC  444511

Query  86      GTGTGGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCA  145
               |||||      || |  |||    ||||    ||||| || |||||    || ||| || 
Sbjct  444512  GTGTG------ATTGAGAACTCGGAGGGTGCGCGCACGACGCCGTCGGTTGTGGCCATCC  444565

Query  146     CAGACT-CG--GAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGC  202
                 |||  ||  || |||||  | |||    ||||||||  |||||  |  |  ||| || 
Sbjct  444566  TGGACAACGACGAGCGCCTTGTGGGTATGCCCGCCAAGCGTCAGGCCGTGACCAACCCGG  444625

Query  203     ACAACACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGAC  252
               | |||||| | | || || ||| ||||| || ||||||||||||  ||||
Sbjct  444626  AGAACACGTTCTACGCCGTCAAGCGTCTCATTGGCCGCAAGTTCGAGGAC  444675

>PLHA:NW_020188126.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_1211, whole genome shotgun sequence
Length=1808626

 Score = 275 bits (304),  Expect = 3e-71
 Identities = 726/1098 (66%), Gaps = 38/1098 (3%)
 Strand=Plus/Plus

Query  403     GACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCGCC  462
               ||||| ||  | || || || ||||  || | |||||| || |||||||| || || || 
Sbjct  793590  GACGCTGGTACGATCGCTGGTCTCACGGTTCAGCGTATTATTAACGAGCCTACAGCTGCT  793649

Query  463     GCCATCGCGTACGGCCTGGACAAGAAGG-GC--GGCGAGCGCAACGTGCTGATCTTCGAC  519
               ||||| || |||||  | |||||||||| ||  ||||||   |||||  |  | || || 
Sbjct  793650  GCCATTGCTTACGGTATTGACAAGAAGGCGCAAGGCGAGAAAAACGTTTTAGTGTTTGAT  793709

Query  520     CTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTC  579
                |||| || || || || |||||  |||| ||| | || || |  ||  | || ||||| 
Sbjct  793710  TTGGGTGGTGGTACTTTTGATGTTACTCTTCTGGCAATCGATGGCGGTGTGTTTGAGGTG  793769

Query  580     AAGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGAC  639
                  ||||||   ||||| || ||| |||| ||||| ||||| ||  | ||  |  || | 
Sbjct  793770  CTTGCCACTAACGGTGATACTCACTTGGGCGGTGAAGACTTTGATCAGCGTATAATGCAA  793829

Query  640     CACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGA---------AC  690
                |||| |   || |||  |||   ||| ||   ||| |||||   || |         ||
Sbjct  793830  TACTTTATCAAGAAGTGGAAG---AAGGAC---AAGAACATC---GATATTTCTTCTGAC  793880

Query  691     CAGCGTGCTCTTC-GTCGTCTGCG--GACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCG  747
                ||||||| || | |  || ||||  |   | |||   |||||  |||||| |  |||| 
Sbjct  793881  AAGCGTGCCCTGCAGAAGT-TGCGTCGTGAGGCTGAACGCGTG--AAGCGTGCATTGTCT  793937

Query  748     TCGTCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCG  807
                |    ||||| ||     | |||||||| || ||  |||| |||   ||||| | |   
Sbjct  793938  GCCCAAGCTCAAGCCCGTCTTGAGATTGAGTCGCTTCTCGATGGCGAGGACTTTACCGAA  793997

Query  808     ACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAG  867
                |  | | |||||||||||| ||| |  |    |  || |  ||    |||||  | |  
Sbjct  793998  TCTTTAAGTCGTGCTCGTTTTGAGAAACTCAATGAAGATTTGTTTAAGAAGACTCTTGGA  794057

Query  868     CCCGTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGGTG  927
               || || ||||| ||  ||   |||||  | ||   |||     ||||  ||||| | || 
Sbjct  794058  CCTGTTGAGAAAGTAATGAAGGACGCTGACCTAAAGAAATCGGAGGTTGACGAGATTGTA  794117

Query  928     CTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAAC  987
               || || || || || || ||||||||||||||||||||| || |   ||| | |||||||
Sbjct  794118  CTTGTTGGAGGATCTACTCGTATCCCGAAGGTGCAGCAGTTGATCAAGGATTACTTCAAC  794177

Query  988     GGCAAGGAGCCCAACAAGTCCA-TCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGT  1046
               |||||||| || | |  ||    | ||||| || || || || ||||| || ||  ||||
Sbjct  794178  GGCAAGGAACC-ATCGCGTGGTGTAAACCCCGATGAAGCGGTTGCGTATGGCGCTGCCGT  794236

Query  1047    GCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGC---AGGACCTGCTTCT  1103
                ||||  |  |||||  | ||  |  |      |||  |  ||    ||||| ||||| |
Sbjct  794237  ACAGGGCGGTATCCTTGGGGGTGAACA------GGATGACTTGACTAAGGACGTGCTTTT  794290

Query  1104    GCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCT  1163
               | | || |||  ||| || || | |||| | || || |  |||||||||||||| | |||
Sbjct  794291  GATTGATGTGGTGCCTCTTTCACAGGGTATTGAAACTGTTGGTGGTGTCATGACCAAGCT  794350

Query  1164    GATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGA  1223
               ||||   || |||||     | || ||||| |||||||| ||||| || ||||||   ||
Sbjct  794351  GATCAACCGTAACACTGTCATTCCCACCAAAAAGTCGCAAACGTTTTCAACGTACCAGGA  794410

Query  1224    CAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAA  1283
               ||| || || |  || ||||| |||||||| || || |||||  | |||||    |||||
Sbjct  794411  CAATCAACCCGCTGTACTCATTCAGGTGTTTGAAGGTGAGCGTGCTATGACTAAGGACAA  794470

Query  1284    CAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCA  1343
               |   || |||||||||||| | ||    ||  | || ||    || || ||||| || ||
Sbjct  794471  CCGTCTTCTGGGCAAGTTCGAGCTCACTGGATTGCCACCTGCTCCGCGTGGTGTTCCTCA  794530

Query  1344    GATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAA  1403
               ||| || || |||||||| || || || ||||||||  || | ||||| |||| ||| ||
Sbjct  794531  GATTGAGGTAACGTTCGAGATTGATGCCAACGGCATTTTGCAAGTGTCTGCTGAGGACAA  794590

Query  1404    GTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCTCTCGCAGGC  1463
               |  ||| ||||||| | | | ||| ||||||||   ||| ||||| || ||||| |||| 
Sbjct  794591  GGGAACAGGCAAGGCGGAGACGATTACGATCACTGCCGAGAAGGGACGTCTCTCCCAGGA  794650

Query  1464    TGACATTGACCGCATGGT  1481
                || || || || |||||
Sbjct  794651  GGAGATCGATCGAATGGT  794668

>PYIW:scaffold_414 piw_scaffold_414 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_414:1:19082:1 
REF
Length=19082

 Score = 268 bits (296),  Expect = 4e-69
 Identities = 446/635 (70%), Gaps = 31/635 (5%)
 Strand=Plus/Plus

Query  917   ACGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCG-  975
             |||||||| | ||||| ||||||  | |||| || || ||||| |||  |   | |||| 
Sbjct  545   ACGAGGTGATCCTGGTCGGCGGCATGTCGCGCATGCCAAAGGTACAGACGA--CCGTCGA  602

Query  976   -GACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTA  1034
              |||||||||   |||||| ||||    |||  | | |||||||||||||  |||||  |
Sbjct  603   GGACTTCTTC---GGCAAGAAGCCATCGAAGGGCGTGAACCCGGACGAGGTCGTGGCC-A  658

Query  1035  CGGTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGA  1094
              ||         ||  || ||||||| | ||||  |   ||   |||||| | || ||||
Sbjct  659   TGG---------GC--GCCGCCATCCAGGGCGG--AGTGCTGCGCGGAGACG-TGAAGGA  704

Query  1095  CCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCAT  1154
             | | || ||||| ||||||||||| ||||| || ||  | |||||   ||| || ||  |
Sbjct  705   CATCCTCCTGCTCGACGTGACGCCTCTGTCGCTCGGCATTGAGACCCTCGGCGGCGTGTT  764

Query  1155  GACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGAC  1214
              || | ||||||| |||| ||||||||| | ||||| ||||||||||||  |||||||||
Sbjct  765   CACCAAGCTGATCACGCGCAACACGACGATCCCGACGAAGAAGTCGCAGGTGTTCTCGAC  824

Query  1215  GTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGAC  1274
             |   || |||   ||| |   ||||  |||| ||||| || |||| |||||    ||| |
Sbjct  825   GGCTGCGGACTCGCAGACGCAGGTGGGCATCAAGGTGCTCCAGGGAGAGCGTGAGATGGC  884

Query  1275  GCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGG  1334
             |   ||||||||   ||| ||||| ||| |||| |  |||||||| ||   ||| || ||
Sbjct  885   GGCGGACAACAAGTCGCTCGGCAACTTCGACCTCGTGGGCATCCCGCCTGCGCCGCGTGG  944

Query  1335  TGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGC  1394
              |||||||||||||| ||||  |||||||| ||||||||||||||| |||||||  ||||
Sbjct  945   CGTGCCGCAGATCGAAGTGAGCTTCGACATTGACGCGAACGGCATCGTGAACGTCGCGGC  1004

Query  1395  TGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCGCCT  1454
                 || ||| | || ||||||||| | || |||  |||| |   ||  |  ||| | ||
Sbjct  1005  GCGCGACAAGGCGACCGGCAAGGAGCAGAACATCGTGATC-CAGTCG--AGCGGCGGTCT  1061

Query  1455  CTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGACGA  1514
              ||| |  | || || || ||||||||   ||||||||||| |   ||  | |||| |||
Sbjct  1062  GTCGGACTCGGAGATCGAGCGCATGGTGCAGGAGGCCGAGATG---AACGCCGAGGCCGA  1118

Query  1515  GGCTAA---CAAGCAACGCATCGAGGCCAAGAACG  1546
                 ||   |||| | |  ||||||||||| ||||
Sbjct  1119  CCTGAAGCGCAAGGAGCTGATCGAGGCCAAAAACG  1153

 Score = 173 bits (191),  Expect = 3e-40
 Identities = 173/224 (77%), Gaps = 3/224 (1%)
 Strand=Plus/Plus

Query  401  AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
            |||||||||||   || || || ||| | ||||| |||||||||||||||||||| ||||
Sbjct  20   AGGACGCCGGCAAGATCGCGGGTCTCGATGTGCTCCGTATCATCAACGAGCCGACCGCCG  79

Query  461  CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
            | ||  ||||||||||| ||||||||   | |||| ||  || || | |   ||||||||
Sbjct  80   CGGCGCTCGCGTACGGCATGGACAAGGCTGACGGCAAGGTCATCGCGGT---CTTCGACC  136

Query  521  TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
            | ||||||||||| |||||||||||  || ||   |||  ||  ||  ||||||||||||
Sbjct  137  TCGGCGGCGGCACTTTCGATGTGTCCATCTTGGAGATTTCGGGCGGTGTCTTCGAGGTCA  196

Query  581  AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGAC  624
            || | ||    ||||||||||  || || |||||||||||||||
Sbjct  197  AGTCGACCAACGGTGACACGCTTCTCGGCGGTGAGGACTTCGAC  240

>PHIF:NW_003303719.1 Phytophthora infestans T30-4 supercont1.40 
genomic scaffold, whole genome shotgun sequence
Length=1445775

 Score = 258 bits (285),  Expect = 8e-66
 Identities = 696/1045 (67%), Gaps = 45/1045 (4%)
 Strand=Plus/Plus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                |||| |||||    |||||||| ||  ||||||| ||||| ||||||||||| ||||| |
Sbjct  1337466  AGGATGCCGGTAAGATTGCCGGTCTGGACGTGCTTCGTATTATCAACGAGCCCACGGCTG  1337525

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                | ||  | || |||||  ||||||||   | |||  ||  ||   ||||| |||||||| 
Sbjct  1337526  CTGCTCTGGCTTACGGTATGGACAAGGCCGACGGTAAGGTCAT--TGCTG-TCTTCGACT  1337582

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                |||| ||||| ||||||||||||||  |||||   ||    |  ||  | || |||||||
Sbjct  1337583  TGGGTGGCGGTACCTTCGATGTGTCGATCCTGGAGATCTCTGGCGGTGTGTTTGAGGTCA  1337642

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                || | ||    |||||||| |  || || ||||||||||||||  |    ||| ||  | 
Sbjct  1337643  AGTCGACCAACGGTGACACTCTTCTAGGCGGTGAGGACTTCGATGAGGAGCTGCTGCGCT  1337702

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
                || |   | | |||||||||    ||    |||  ||| |  |||   || | |  ||| 
Sbjct  1337703  ACCTTGTGAACGAGTTCAAGAAGGAGACGAGCATCGACCTGTCGGGAGACAACCTGGCTA  1337762

Query  701      TTCGTCGTCTGCG-GACGGCCTGC-GAGCGTGCCAAGCGTACGCTGTCGTCGTC-GGCTC  757
                | |  ||||| || || |  |||| |||   |||||||||  ||||   | ||| ||| |
Sbjct  1337763  TGCAGCGTCTCCGTGAAG--CTGCTGAGAAGGCCAAGCGTGAGCTGGA-TGGTCTGGCCC  1337819

Query  758      AGGCTTACATCGAGATTGACTCTCT----GTTCGACGGCATCG---------ACTTCAAC  804
                || |  ||||| ||  || || ||     |  |||||  |  |         |||| |||
Sbjct  1337820  AGACGGACATC-AGTCTGCCTTTCATCACGGCCGACGCTACAGGCCCTAAGCACTTAAAC  1337878

Query  805      TCGACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATG  864
                  ||  ||||| |||||    |||||| |  ||   ||| |   | ||      || |||
Sbjct  1337879  ATGAAGATCACACGTGCCACATTCGAGAAGCTGGTGGGCAAGCTCATCGAGCGTACTATG  1337938

Query  865      GAGCCCGTGGAGAAGGTGCTGCGCG-ACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGT  923
                | | || || |  | ||||  |  | ||||    |||   |||||| |  |  |||||||
Sbjct  1337939  G-GTCCTTGCAAGAAGTGCGTCAAGGACGCTGGTCTGGACAAGAGCGAAATCAACGAGGT  1337997

Query  924      GGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTT  983
                  | ||||| |||||   | ||||||| || |||||||||  |  | ||  ||| |||||
Sbjct  1337998  CATTCTGGTCGGCGGTATGTCGCGTATGCCCAAGGTGCAGACGACGGTGGAGGAGTTCTT  1338057

Query  984      CAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGAC  1043
                |   || ||| |||||   |||    | |||||||| || |  ||||| || ||      
Sbjct  1338058  C---GGTAAGAAGCCCTCGAAGGGTGTGAACCCGGATGAAGTCGTGGC-TATGG------  1338107

Query  1044     CGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCT  1103
                   ||  || || |||| | | ||    |   ||| || || | |  ||||| |  | ||
Sbjct  1338108  ---GC--GCTGCTATCCAGGGTGGTGT-GTTGCGT-GGTGACG-TCAAGGACATTTTGCT  1338159

Query  1104     GCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCT  1163
                |||||| ||||| || |||||||||||| | |||||    ||||||||  | |||| |||
Sbjct  1338160  GCTGGATGTGACTCCTCTGTCTCTGGGTATTGAGACTCTGGGTGGTGTGTTCACGAAGCT  1338219

Query  1164     GATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGA  1223
                |||  |||| ||||||||  | ||||||||||||||||||  |||||||||    || ||
Sbjct  1338220  GATTCCGCGTAACACGACCATCCCGACCAAGAAGTCGCAGGTGTTCTCGACTGCGGCGGA  1338279

Query  1224     CAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGAC-GCGCGACA  1282
                |   ||| ||  ||||  |||| ||||| |  ||||||| ||    ||| | ||| ||||
Sbjct  1338280  CTCGCAGACTCAGGTGGGCATCAAGGTGCTGCAGGGCGAACGTGAGATGGCTGCG-GACA  1338338

Query  1283     ACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGC  1342
                |||| ||||| || || ||| | ||||  || ||||| ||    ||||| |||||||| |
Sbjct  1338339  ACAAGCTGCTCGGTAACTTCGATCTGGTGGGTATCCCGCCTGCCCCTCGTGGTGTGCCTC  1338398

Query  1343     AGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGA  1402
                ||||||| ||||  |||||||| ||||| ||||| ||| |||||||    |||   || |
Sbjct  1338399  AGATCGAGGTGAGCTTCGACATTGACGCCAACGGAATCGTGAACGTCGGTGCTCGTGACA  1338458

Query  1403     AGTCAACGGGCAAGGAGAACAAGAT  1427
                || | |||||||||||| | || ||
Sbjct  1338459  AGGCCACGGGCAAGGAGCAGAACAT  1338483

 Score = 39.2 bits (42),  Expect = 3.9
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  32       TCGGCATCGACCTCGGCACAACCTACTCGTGCGTGG  67
                |||| || ||||| || || ||| ||||||||||||
Sbjct  1337013  TCGGTATTGACCTGGGTACGACCAACTCGTGCGTGG  1337048

>PHKE:scaffold_179 scf_22126_179.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_179.1:1:67923:1 
REF
Length=67923

 Score = 254 bits (281),  Expect = 1e-64
 Identities = 694/1044 (66%), Gaps = 43/1044 (4%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              |||||||||||   |||||||| ||  ||||||| ||||| ||||||||||||||||| |
Sbjct  42945  AGGACGCCGGCAAGATTGCCGGTCTGGACGTGCTCCGTATTATCAACGAGCCGACGGCTG  43004

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              | ||  | || |||||| ||||||||  || |||| ||  ||   ||||| | || ||||
Sbjct  43005  CTGCTCTGGCCTACGGCATGGACAAGGCGGACGGCAAGGTCAT--TGCTG-TGTTTGACC  43061

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              |||| || || ||||||||||||||  | ||    ||    |  ||  | ||||||||||
Sbjct  43062  TGGGTGGAGGTACCTTCGATGTGTCGATTCTAGAGATCTCCGGTGGTGTGTTCGAGGTCA  43121

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
              || ||||    ||||||||||  || |||||||||||||||||| |    ||| ||    
Sbjct  43122  AGTCCACCAACGGTGACACGCTGCTCGGTGGTGAGGACTTCGACGAGGAGCTGCTGCGTT  43181

Query  641    ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAACCAGCGTGCTC  700
              || ||  | | |||||||||    ||    |||  ||| |  | |   || | |  ||| 
Sbjct  43182  ACCTCGTGGATGAGTTCAAGAAGGAGTCGAGCATTGACCTGTCAGGCGACAACCTCGCTA  43241

Query  701    TTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCGTC-GGCTCAG  759
              | |  ||||||||   ||||  ||||   |||||||||  ||| |  | | | |||||||
Sbjct  43242  TGCAGCGTCTGCGTGAGGCCGCCGAGAAGGCCAAGCGTGAGCT-TGATGGCCTGGCTCAG  43300

Query  760    GCTTACATCGAGATTGACTCTCT----GTTCGACGGCATCG---------ACTTCAACTC  806
               |  ||||| ||  || |  ||     |  ||||| ||  |         |||| |||  
Sbjct  43301  ACGGACATC-AGTCTGCCGTTCATCACGGCCGACGCCACTGGCCCCAAGCACTTGAACAT  43359

Query  807    GACCATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGA-CTACTTCCGCAAGACGATGG  865
              ||  ||||| |||||   ||| ||| |  |    ||| | ||  ||  ||   || ||||
Sbjct  43360  GAAGATCACGCGTGCCACTTTTGAGAAGCTCGTTGGCAAGCTCATTGAGCGC-ACCATGG  43418

Query  866    AGCCCGTGGA-GAAG-GTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGT  923
               |||| || | |||| |||    | |||||    |||   |||||| || |  |||||||
Sbjct  43419  -GCCCATGCAAGAAGTGTGTCAAG-GACGCTGGTCTGGACAAGAGCGAGATCAACGAGGT  43476

Query  924    GGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTT  983
                | ||||| || ||   | ||||||| || ||||| |||  |    ||  ||| |||||
Sbjct  43477  CATTCTGGTCGGTGGTATGTCGCGTATGCCCAAGGTTCAGACGACCGTGGAGGATTTCTT  43536

Query  984    CAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGGTGCGAC  1043
              |   |||||| |||||  ||||    | ||||| || || |  || ||  | ||      
Sbjct  43537  C---GGCAAGAAGCCCTCCAAGGGTGTGAACCCCGATGAAGTCGTTGCC-ATGG------  43586

Query  1044   CGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCTGCTTCT  1103
                 ||  || ||||||| | ||||    |   ||| || || | || ||||| | || ||
Sbjct  43587  ---GC--GCTGCCATCCAGGGCGGTGT-GCTGCGT-GGTGACG-TGAAGGACATCCTGCT  43638

Query  1104   GCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGACGACGCT  1163
              |||||| || || |||||||| || ||  | |||||    || |||||  | |||| |||
Sbjct  43639  GCTGGATGTAACACCGCTGTCGCTCGGCATTGAGACCCTTGGCGGTGTGTTCACGAAGCT  43698

Query  1164   GATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTACGCCGA  1223
              |||| |||| ||||| ||  | ||||| ||||||||||||   ||||||||    || ||
Sbjct  43699  GATCCCGCGTAACACAACAATCCCGACGAAGAAGTCGCAGGTATTCTCGACTGCTGCTGA  43758

Query  1224   CAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCGCGACAA  1283
              |   ||| |   ||||  |||  ||||  |  |||| |||||    ||| |    |||||
Sbjct  43759  CTCGCAGACACAGGTGGGCATTAAGGTACTTCAGGGAGAGCGTGAGATGGCTACTGACAA  43818

Query  1284   CAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCGCGGTGTGCCGCA  1343
               ||  |||||||||| ||| ||||||  |||||||| |||   || || || ||||| ||
Sbjct  43819  TAAGTTGCTGGGCAACTTCGACCTGGTGGGCATCCCGCCCGCCCCGCGTGGCGTGCCCCA  43878

Query  1344   GATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTCGGCTGTGGAGAA  1403
              ||| || ||||  |||||||| ||||| ||||| ||  ||||||||   |||   || ||
Sbjct  43879  GATTGAGGTGAGCTTCGACATTGACGCCAACGGAATTGTGAACGTGGGCGCTCGCGACAA  43938

Query  1404   GTCAACGGGCAAGGAGAACAAGAT  1427
              | | || ||||||||| | || ||
Sbjct  43939  GGCCACTGGCAAGGAGCAGAACAT  43962

 Score = 50.9 bits (55),  Expect = 0.002
 Identities = 59/80 (74%), Gaps = 0/80 (0%)
 Strand=Plus/Plus

Query  173    CCGCCAAGAATCAGGTGGCCATGAACGCGCACAACACGGTGTTCGACGCCAAACGTCTGA  232
              ||||||||  |||||  |  |  ||| || | |||||  | | || ||  || |||||||
Sbjct  42636  CCGCCAAGCGTCAGGCTGTGACCAACCCGGAGAACACTTTCTACGCCGTTAAGCGTCTGA  42695

Query  233    TCGGCCGCAAGTTCTCGGAC  252
              | ||||| ||||||||||||
Sbjct  42696  TTGGCCGTAAGTTCTCGGAC  42715

>PYIR:scaffold_465 pir_scaffold_465 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_465:1:24264:1 
REF
Length=24264

 Score = 241 bits (266),  Expect = 6e-61
 Identities = 442/635 (70%), Gaps = 31/635 (5%)
 Strand=Plus/Plus

Query  917    ACGAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCG-  975
              |||| ||| |  |||| |||||   | |||| || || ||||||||  | || | || | 
Sbjct  21669  ACGAAGTGATCTTGGTCGGCGGTATGTCGCGCATGCCAAAGGTGCA--AACTACGGTTGA  21726

Query  976    -GACTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTA  1034
               || ||||||   |||||| | ||    |||  | | |||||||| ||||  || ||  |
Sbjct  21727  AGAATTCTTC---GGCAAGAAACCATCGAAGGGCGTGAACCCGGATGAGGTGGTTGCC-A  21782

Query  1035   CGGTGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACT--CGTCGGAGAAGCTGCAG  1092
               ||       ||||||    |||||| | ||||    | ||  ||| || || | || ||
Sbjct  21783  TGG-------GTGCAG----CCATCCAGGGCGGT---GTCTTGCGT-GGTGACG-TGAAG  21826

Query  1093   GACCTGCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTC  1152
              ||| | || ||| ||||||||||||| ||||| || ||| |||||||   ||| ||||| 
Sbjct  21827  GACATCCTGCTGTTGGACGTGACGCCTCTGTCGCTCGGTATCGAGACCCTCGGCGGTGTG  21886

Query  1153   ATGACGACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCG  1212
               | |||| ||||||| | || ||||||||| | || || ||||||||||||  |||||||
Sbjct  21887  TTTACGAAGCTGATCCCACGTAACACGACGATCCCAACGAAGAAGTCGCAGGTGTTCTCG  21946

Query  1213   ACGTACGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATG  1272
              ||    || |||   ||| ||  ||||  |||| ||||| || ||||||||||    |||
Sbjct  21947  ACCGCGGCGGACTCGCAGACTCAGGTGGGCATCAAGGTGCTCCAGGGCGAGCGTGAGATG  22006

Query  1273   AC-GCGCGACAACAACCTGCTGGGCAAGTTCAACCTGGACGGCATCCCTCCCATGCCTCG  1331
               | ||| ||||||||   ||| ||||| ||| ||||||  |||||||| ||    || ||
Sbjct  22007  GCTGCG-GACAACAAGTCGCTCGGCAACTTCGACCTGGTGGGCATCCCGCCAGCCCCACG  22065

Query  1332   CGGTGTGCCGCAGATCGACGTGACGTTCGACATCGACGCGAACGGCATCCTGAACGTGTC  1391
               || ||||| |||||||| ||||  |||||||| |||||||| |||||| |||||||  |
Sbjct  22066  TGGCGTGCCTCAGATCGAGGTGAGCTTCGACATTGACGCGAATGGCATCGTGAACGTCGC  22125

Query  1392   GGCTGTGGAGAAGTCAACGGGCAAGGAGAACAAGATCACGATCACGAACGACAAGGGCCG  1451
              |||    || ||| | || || |||||| | || |||  |||| |   ||  |  ||| |
Sbjct  22126  GGCGCGCGACAAGGCGACCGGTAAGGAGCAAAACATCGTGATC-CAGTCG--AGCGGCGG  22182

Query  1452   CCTCTCGCAGGCTGACATTGACCGCATGGTATCGGAGGCCGAGAAGTACAAGTCGGAGGA  1511
               || ||| |  | || || || ||||||||   ||||||||||| | ||     || |||
Sbjct  22183  TCTGTCGGACTCGGAGATCGAGCGCATGGTGCAGGAGGCCGAGATGAACGCCGAGGCGGA  22242

Query  1512   CGAGGCTAACAAGCAACGCATCGAGGCCAAGAACG  1546
              | ||     |||| | |  |||||| |||||||||
Sbjct  22243  CCAGAAGCGCAAGGAGCTGATCGAGACCAAGAACG  22277

 Score = 159 bits (176),  Expect = 2e-36
 Identities = 171/224 (76%), Gaps = 3/224 (1%)
 Strand=Plus/Plus

Query  401    AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
              ||||||||||    || || |||||| ||||||| |||||||| ||||||||||| || |
Sbjct  21144  AGGACGCCGGTAAGATCGCGGGCCTCGACGTGCTCCGTATCATTAACGAGCCGACTGCTG  21203

Query  461    CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
              | ||  |||| |||||| ||||||||  || |||| ||  || |  |||| | |||||||
Sbjct  21204  CTGCGCTCGCCTACGGCATGGACAAGGCGGACGGCAAGGTCATC--GCTG-TGTTCGACC  21260

Query  521    TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
              | || ||||| ||||||||||||||  || ||   |||  ||  ||  |||||||||| |
Sbjct  21261  TCGGTGGCGGTACCTTCGATGTGTCCATCTTGGAGATTTCGGGCGGTGTCTTCGAGGTGA  21320

Query  581    AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGAC  624
              || | ||    |||||||| |   ||||||||||||||||||||
Sbjct  21321  AGTCGACCAACGGTGACACCCTTTTGGGTGGTGAGGACTTCGAC  21364

>PHRA:scaffold_114
Length=137664

 Score = 220 bits (243),  Expect = 2e-54
 Identities = 458/675 (68%), Gaps = 18/675 (3%)
 Strand=Plus/Plus

Query  401     AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
               ||||||| || |  ||||| || ||||||||| ||||  |  |||||    |||| ||||
Sbjct  109978  AGGACGCGGGAGAAATTGCTGGGCTCAACGTGTTGCGCTTTGTCAACCCTGCGACTGCCG  110037

Query  461     CCGCCATCGCGTACGGCCTGGACAAGAAGGG------CGGCGAGCGCAACGTGCTGATCT  514
               || | ||||| |||||  | |||||| |  |      |||||||| | | |||||  | |
Sbjct  110038  CCTCTATCGCCTACGGATTCGACAAGGACTGGACAGACGGCGAGCACGATGTGCTAGTGT  110097

Query  515     TCGACCTGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCG  574
               |||||||||| ||||| |  || ||||||||  |  || |||||||| ||||||||| ||
Sbjct  110098  TCGACCTGGGAGGCGGGATGTTAGATGTGTCCGTGGTGACCATTGAGCAGGGCATCTACG  110157

Query  575     AGGTCAAGGCCACTGCTGGTGAC--ACGCA--CCTGGGTGGTGAGGACTTCGACAACCGC  630
               | || |||||| |    ||||||  |||||  |||||||||  ||| ||| |||||||||
Sbjct  110158  AAGTTAAGGCCGC----GGTGACAGACGCACGCCTGGGTGGGCAGGTCTTGGACAACCGC  110213

Query  631     CTGGTGGACCACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCACGGAGAAC  690
               || || || || | |  |   || ||  || |    ||   |||| |  |   || ||| 
Sbjct  110214  CTTGTCGAGCATTGCGTGACCGACTTTGAGAGAGTTCATGACAAGAATCTACGGGTGAAT  110273

Query  691     CAGCGTGCTCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCG  750
                 ||||||  |   ||| |||||   ||| || ||||  || |||||  |  ||||||| 
Sbjct  110274  TTGCGTGCAATCACTCGCCTGCGCTTGGCTTGTGAGCAGGCTAAGCGAGCCTTGTCGTCT  110333

Query  751     TCGGCTCAGGCTTACATCGAGATTGACTCTCTGTTCGACGGCATCGACTTCAACTCGACC  810
               ||  |  || | ||||| ||| | ||| | |||  |||||| ||||||| | || |||| 
Sbjct  110334  TCAACGGAGACGTACATTGAGCTGGACGCGCTGCACGACGGGATCGACTACTACGCGACG  110393

Query  811     ATCACTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAGACGATGGAGCCC  870
               ||||| || |||    | ||  || |  |||  ||   |||   |||| |  || | |  
Sbjct  110394  ATCACACGCGCTGAGATGGAAAACTTAAGCGCTGATCTCTTTGACAAGGCCTTGCAACTT  110453

Query  871     GTGGAGAAGGTGCTGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCACGAGGTGG-TGCT  929
               ||| | ||||||||| | || ||||   || | |||   |  || |  ||||||| || |
Sbjct  110454  GTGCAAAAGGTGCTGAGAGATGCCAGAGTGGCAAAGGATCGAGTTCGTGAGGTGGTTGTT  110513

Query  930     GGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGCTGTCGGACTTCTTCAACGG  989
               ||| || || ||  ||||||  |||||| ||  ||||||||||  ||||||||||| || 
Sbjct  110514  GGT-GGTGGTTCCGCGCGTAGTCCGAAGATGTTGCAGCTGCTGAAGGACTTCTTCAGCGA  110572

Query  990     CAAGGAGCCCAACAAGTCC-ATCAACCCGGACGAGGCTGTGGCGTACGGTGCGACCGTGC  1048
               |||||   |   | || || ||    || || |||| ||  |||| |||||  || ||||
Sbjct  110573  CAAGG-CACTTTCGAGCCCAATTCGTCCTGATGAGGGTGCAGCGTTCGGTGTCACTGTGC  110631

Query  1049    AGGCGGCCATCCTGA  1063
               | || ||||||||||
Sbjct  110632  AAGCTGCCATCCTGA  110646

 Score = 129 bits (142),  Expect = 3e-27
 Identities = 248/362 (69%), Gaps = 8/362 (2%)
 Strand=Plus/Plus

Query  30      CGTCGGCATCGACCTCGGCACAACCTACTCGTGCGTGGGCGTGTGGCAGAACGACCGTGT  89
               ||| ||||||||| | ||||| || | | || |||| || |||||||||||| |||| ||
Sbjct  109517  CGTGGGCATCGACTTGGGCACGACGTTCGCGCGCGTAGGTGTGTGGCAGAACAACCGCGT  109576

Query  90      GGAAATCATCGCCAACGACCAGGGCAACCGCACCACCCCGTCATACGTCGCCTTCAC--A  147
               ||| ||| || | | |  | | ||   |    | || ||||| ||||| || || ||  |
Sbjct  109577  GGAGATCGTCCCGAGCTGCGATGGGTCCTATTCGACGCCGTCCTACGTGGCATTTACGGA  109636

Query  148     GACTCGGAACGCCTCATCGGTGACGCCGCCAAGAATCAGGTGGCCATGAACGCGCACAAC  207
               ||||  |  || || |||||  ||||||||||| ||||  || | | ||| || | ||||
Sbjct  109637  GACTTCG--CGGCTGATCGGCCACGCCGCCAAGTATCAACTGACAAGGAATGCTCGCAAC  109694

Query  208     ACGGTGTTCGACGCCAAACGTCTGATCGGCCGCAAGTTCTCGGACCCCGTCGTCCAGGCC  267
               || ||||| |     || |  ||  |||| |||||||| || ||||| |  || |||   
Sbjct  109695  ACCGTGTTTGGGATGAACCAACTCGTCGGACGCAAGTTTTCCGACCCAGAAGTGCAGAGA  109754

Query  268     GACATCAAGCACTGGCCGTTCCAAGTGACGTCGGGCGCCGG--TGACAAGCCGCAGATCA  325
                 ||| || || ||||| ||| ||||||  || |  | | |   || || ||  || |  
Sbjct  109755  AGCATGAAACATTGGCCATTCAAAGTGA--TCTGTGGACAGAACGATAACCCCGAGGTGG  109812

Query  326     CGGTGCAGTTCAAGGGCGAGTCCAAGACGTTCCAACCCGAGGAGATCTCGTCCATGGTGC  385
                |||||| |||   || ||| ||||||||||||| || |  ||||||  | ||||| |||
Sbjct  109813  AGGTGCAATTCCGAGGTGAGACCAAGACGTTCCAGCCTGTAGAGATCCTGGCCATGCTGC  109872

Query  386     TG  387
               ||
Sbjct  109873  TG  109874

>APAS:scaffold_2 supercont1.2 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.2:1:2059303:1 
REF
Length=2059303

 Score = 215 bits (238),  Expect = 2e-53
 Identities = 763/1172 (65%), Gaps = 64/1172 (5%)
 Strand=Plus/Plus

Query  401      AGGACGCCGGCGCCATTGCCGGCCTCAACGTGCTGCGTATCATCAACGAGCCGACGGCCG  460
                ||||||| ||    ||||||||  |  | ||| ||||||||||||||||||| || ||||
Sbjct  1140860  AGGACGCTGGTAAAATTGCCGGGTTGGATGTGTTGCGTATCATCAACGAGCCCACCGCCG  1140919

Query  461      CCGCCATCGCGTACGGCCTGGACAAGAAGGGCGGCGAGCGCAACGTGCTGATCTTCGACC  520
                ||||  | ||||||||  ||||||||   | |||| ||   |   ||| | | |||||  
Sbjct  1140920  CCGCGTTGGCGTACGGGTTGGACAAGGCCGACGGCAAGGTGAT--TGCCG-TGTTCGATT  1140976

Query  521      TGGGCGGCGGCACCTTCGATGTGTCTCTCCTGTCCATTGAGGAGGGCATCTTCGAGGTCA  580
                |||||||||| ||||| ||||||||  || ||   |||   |  ||| | ||||||||||
Sbjct  1140977  TGGGCGGCGGGACCTTTGATGTGTCGATCTTGGAAATTTCCGGAGGCGTGTTCGAGGTCA  1141036

Query  581      AGGCCACTGCTGGTGACACGCACCTGGGTGGTGAGGACTTCGACAACCGCCTGGTGGACC  640
                || | ||    |||||||||   || || || || ||||| ||| |     || ||  ||
Sbjct  1141037  AGTCGACCAACGGTGACACGTTGCTCGGCGGCGAAGACTTTGACGAAGAGTTGCTGCGCC  1141096

Query  641      ACTTCACGCAGGAGTTCAAGCGCAAGCACCGCAAGGACATCA-CGGAGAACCAGCGT-GC  698
                ||||      ||| ||||||||| ||    |||  ||| ||| ||| ||  | || | ||
Sbjct  1141097  ACTTGGTCTCGGAATTCAAGCGCGAGTCGGGCATCGACCTCAGCGGCGA--CGGCCTCGC  1141154

Query  699      TCTTCGTCGTCTGCGGACGGCCTGCGAGCGTGCCAAGCGTACGCTGTCGTCG--TCGGCT  756
                  | |  || |||||    |||  ||||   ||||||||  ||   | | ||  | ||| 
Sbjct  1141155  CATGCAACGCCTGCGCGAAGCCGCCGAGAAGGCCAAGCG--CGAATTGGACGGGTTGGCG  1141212

Query  757      CAGGCTTACATCGAGATTGAC-----TCTCTGTTCGACGGCATCGACTTCAA---CTCGA  808
                ||  |  || | ||| ||| |     || | | | |||| ||  | |  |||   || ||
Sbjct  1141213  CAAACCGACGT-GAGTTTGCCGTTCATCACGGCT-GACGCCACTGGCCCCAAGCACTTGA  1141270

Query  809      CCATCA------CTCGTGCTCGTTTCGAGGACATGTGCGGCGACTACTTCCGCAAG---A  859
                 |||||      | || || |  || ||  |  ||   |   || ||||   | ||   |
Sbjct  1141271  ACATCAAGATTACGCGCGCACAATTTGAAAAGCTG---GTGAACCACTTGATCGAGCGCA  1141327

Query  860      CGATGGAGCCCGTGGAGAAGGTGC-TGCGCGACGCCAAGCTGTCGAAGAGCCAGGTGCAC  918
                || || | |||||| |  | |||| ||   || |||    || | |||  | || |  ||
Sbjct  1141328  CGCTGAA-CCCGTGCAAGAAGTGCGTGAAGGATGCCGGCGTGACCAAGGACGAGATCAAC  1141386

Query  919      GAGGTGGTGCTGGTGGGCGGCTCGACGCGTATCCCGAAGGTGCAGCAGCTGC-TGTCGGA  977
                || ||| |  |||||||||||  | | || || || ||||||||| | | || ||   ||
Sbjct  1141387  GAAGTGATTTTGGTGGGCGGCATGTCCCGCATGCCCAAGGTGCAG-ACCAGCGTGGAAGA  1141445

Query  978      CTTCTTCAACGGCAAGGAGCCCAACAAGTCCATCAACCCGGACGAGGCTGTGGCGTACGG  1037
                 |||||    ||||||   || | ||||  | ||||||| ||||| |  ||||||   ||
Sbjct  1141446  GTTCTTT---GGCAAGCGCCCGAGCAAGGGCGTCAACCCCGACGAAGTCGTGGCGATGGG  1141502

Query  1038     TGCGACCGTGCAGGCGGCCATCCTGAGCGGCAACGACTCGTCGGAGAAGCTGCAGGACCT  1097
                |||  || | ||||  | | | ||  ||||| ||| |                ||||| |
Sbjct  1141503  TGCCGCCATCCAGGGCGGCGTGCTCCGCGGCGACGTCA---------------AGGACAT  1141547

Query  1098     GCTTCTGCTGGACGTGACGCCGCTGTCTCTGGGTCTCGAGACGGCCGGTGGTGTCATGAC  1157
                  | ||||||||||||||||| |||  | ||||  | || |||   || || ||  | ||
Sbjct  1141548  TTTGCTGCTGGACGTGACGCCCCTGAGTTTGGGCATTGAAACGTTGGGCGGCGTATTCAC  1141607

Query  1158     GACGCTGATCGCGCGGAACACGACGGTGCCGACCAAGAAGTCGCAGACGTTCTCGACGTA  1217
                 | | ||||  | || ||||||||  | ||||||||||||||||||  ||||||||||  
Sbjct  1141608  CAAGTTGATTCCCCGCAACACGACCATCCCGACCAAGAAGTCGCAGGTGTTCTCGACGGC  1141667

Query  1218     CGCCGACAACCAGCCTGGGGTGCTCATCCAGGTGTTCGAGGGCGAGCGCTCCATGACGCG  1277
                  | ||||||||| |    |||   ||| ||||| |  | |||||||||   ||| |   
Sb