Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
PHCA:scaffold_95260815263172374742e-118
PHCA:scaffold_661068281070642374546e-113
PHCA:scaffold_139521079523432374546e-113
PHCA:scaffold_439515953642063626e-88
PHCA:scaffold_228147416581851851e-39
PHCA:scaffold_887169218821911824e-39
PHCA:scaffold_12118809189901821746e-37
PHCA:scaffold_6140661114068041941661e-34
PHCA:scaffold_14543900440871881463e-29
PHCA:scaffold_187840547842381851355e-26
PHCA:scaffold_6084566391841282e-24
PHCA:scaffold_224148404150231841282e-24
PHCA:scaffold_315187795189451671242e-23
PHCA:scaffold_175186619781131164e-21
PHIF:NW_003303681.14387744388951221046e-18
PHIF:NW_003303668.169392695071161022e-17
PHIF:NW_003303753.130263773026492116921e-14
PHIF:NW_003303737.1737728737843116921e-14
PHIF:NW_003303735.112378091237924116921e-14
PHIF:NW_003303758.131416893141798110904e-14
PHCA:scaffold_2375318975326274881e-13
PHCA:scaffold_55091498774787e-11
PHCA:scaffold_106650466511974787e-11
PHCA:scaffold_19793164793279116773e-10
PHCA:scaffold_121033937103399256773e-10
PHCA:scaffold_42194579194701123763e-10
PHCA:scaffold_5018553018560374733e-09
PHCA:scaffold_766831366838674733e-09
PHPA:scaffold_75389573903478711e-08
PHCA:scaffold_3204040411677694e-08
PHCA:scaffold_1444166844174174684e-08
PHCA:scaffold_532897432904774684e-08
PHCA:scaffold_227468827476174684e-08
PHPA:scaffold_3091216129378661e-07
PHCA:scaffold_5418221718229377645e-07
PHRA:scaffold_1351249774632e-06
PHRA:scaffold_1663648372174632e-06
PHCA:scaffold_867015967022971622e-06
PHPA:scaffold_1991523515341107592e-05
PHIF:NW_003303723.130012630020277592e-05
PHIF:NW_003303713.11037194103727077592e-05
PHIF:NW_003303643.112626812634477592e-05
PHIF:NW_003303752.11100758110083174582e-05
PHCA:scaffold_28376251376364114582e-05
PHPA:scaffold_5031238231243756577e-05
PHCA:scaffold_18826812793113567e-05
PYAP:scaffold_14642813286755552e-04
PHCA:scaffold_3064975504975552e-04
PHCA:scaffold_1727996807075552e-04
PHIF:NW_003303757.13601394360147184542e-04
PHSO:scaffold_1166007166014474538e-04
PHPA:scaffold_4618033918039759538e-04
PHIF:NW_003303705.165032465039774538e-04
PHCA:scaffold_83581365820065500.003
PHIF:NW_003303729.11384694138477184490.010
PHPA:scaffold_244712744719266470.036
PHRA:scaffold_417773117779975460.036
PHCA:scaffold_4014796814802558460.036
PHCA:scaffold_2158709058714758460.036
HYAP:scaffold_33557085576558460.036
PHPA:scaffold_594064494067835450.13
PHIF:NW_003303604.111145511148935450.13
PHIF:NW_003303546.110577110580535450.13
PHCA:scaffold_1020020520026965450.13
HYAP:scaffold_676321776327155450.13
PHIF:NW_003303693.11750180354430.44
PHIF:NW_003303634.1344263447954430.44
PHIF:NW_003303418.1296902974354430.44
PLHA:NW_020187031.127998628000621420.44
PHSO:scaffold_2110628951106294046420.44
PHRA:scaffold_3115712715720579420.44
PHPA:scaffold_138431054313026420.44
PHPA:scaffold_2121853521856026420.44
PHIF:NW_003303756.15126435512647541420.44
PHIF:NW_003303657.123272223276746420.44
PHCA:scaffold_853004307573420.44
HYAP:scaffold_4322552622559166420.44
SAPA:scaffold_24115681159023411.5
PYIW:scaffold_9916693672028411.5
PHPA:scaffold_43341413416828411.5
PHPA:scaffold_31398049139807628411.5
PHIF:NW_003303724.190860190864343411.5
PHCA:scaffold_104312223127958411.5
PHCA:scaffold_75747967485358411.5
PHCA:scaffold_4115318915324658411.5
PHCA:scaffold_3540037740043458411.5
HYAP:scaffold_2676800685758411.5
HYAP:scaffold_265480904814758411.5
HYAP:scaffold_227147651482258411.5
HYAP:scaffold_208538195387658411.5
HYAP:scaffold_18410082710088458411.5
HYAP:scaffold_124959179597458411.5
HYAP:scaffold_115366003665758411.5
HYAP:scaffold_9114647114652858411.5
SAPA:scaffold_18614466147530401.5
PLHA:NW_020187350.11244365124438420401.5
PHSO:scaffold_1122057761220580732401.5
PHRA:scaffold_65847754670401.5
PHRA:scaffold_290135791364870401.5
PHKE:scaffold_36855758559420401.5
PHIF:NW_003303685.113611913614325401.5
PHCA:scaffold_377931277937665401.5
HYAP:scaffold_131326563271359401.5
SADI:scaffold_2526883126885222395.3
PLHA:NW_020189293.11968650196867627395.3
PHIF:NW_003303677.135613035618859395.3
PHCA:scaffold_38208902096677395.3
HYAP:scaffold_2423611723617357395.3
APIN:scaffold_4113845413847522395.3
SAPA:scaffold_954280554282824385.3
SAPA:scaffold_518996818999226385.3
PYVX:scaffold_14725967262429385.3
PYIW:scaffold_30781400143334385.3
PYAR:scaffold_7626860688324385.3
PLHA:NW_020187532.192263392265119385.3
PHRA:scaffold_2752817452820836385.3
HYAP:scaffold_257415454160966385.3
APIN:scaffold_2682184882187124385.3
ALCA:scaffold_13181583319385.3
BLASTN 2.12.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= PHYCA_104740

Length=237
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

PHCA:scaffold_9 PHYCAscaffold_9                                       428     2e-118
PHCA:scaffold_66 PHYCAscaffold_66                                     410     6e-113
PHCA:scaffold_13 PHYCAscaffold_13                                     410     6e-113
PHCA:scaffold_439 PHYCAscaffold_439                                   327     6e-88 
PHCA:scaffold_228 PHYCAscaffold_228                                   168     1e-39 
PHCA:scaffold_887 PHYCAscaffold_887                                   165     4e-39 
PHCA:scaffold_121 PHYCAscaffold_121                                   158     6e-37 
PHCA:scaffold_6 PHYCAscaffold_6                                       150     1e-34 
PHCA:scaffold_145 PHYCAscaffold_145                                   132     3e-29 
PHCA:scaffold_18 PHYCAscaffold_18                                     123     5e-26 
PHCA:scaffold_608 PHYCAscaffold_608                                   116     2e-24 
PHCA:scaffold_22 PHYCAscaffold_22                                     116     2e-24 
PHCA:scaffold_31 PHYCAscaffold_31                                     113     2e-23 
PHCA:scaffold_175 PHYCAscaffold_175                                   105     4e-21 
PHIF:NW_003303681.1 Phytophthora infestans T30-4 supercont1.78 ge...  95.1    6e-18 
PHIF:NW_003303668.1 Phytophthora infestans T30-4 supercont1.91 ge...  93.3    2e-17 
PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 gen...  84.2    1e-14 
PHIF:NW_003303737.1 Phytophthora infestans T30-4 supercont1.22 ge...  84.2    1e-14 
PHIF:NW_003303735.1 Phytophthora infestans T30-4 supercont1.24 ge...  84.2    1e-14 
PHIF:NW_003303758.1 Phytophthora infestans T30-4 supercont1.1 gen...  82.4    4e-14 
PHCA:scaffold_23 PHYCAscaffold_23                                     80.6    1e-13 
PHCA:scaffold_550 PHYCAscaffold_550                                   71.6    7e-11 
PHCA:scaffold_106 PHYCAscaffold_106                                   71.6    7e-11 
PHCA:scaffold_19 PHYCAscaffold_19                                     70.7    3e-10 
PHCA:scaffold_12 PHYCAscaffold_12                                     70.7    3e-10 
PHCA:scaffold_42 PHYCAscaffold_42                                     69.8    3e-10 
PHCA:scaffold_50 PHYCAscaffold_50                                     67.1    3e-09 
PHCA:scaffold_7 PHYCAscaffold_7                                       67.1    3e-09 
PHPA:scaffold_75 NW_008649061.1 Phytophthora parasitica INRA-310 ...  65.3    1e-08 
PHCA:scaffold_320 PHYCAscaffold_320                                   63.5    4e-08 
PHCA:scaffold_14 PHYCAscaffold_14                                     62.6    4e-08 
PHCA:scaffold_5 PHYCAscaffold_5                                       62.6    4e-08 
PHCA:scaffold_2 PHYCAscaffold_2                                       62.6    4e-08 
PHPA:scaffold_309 NW_008649295.1 Phytophthora parasitica INRA-310...  60.8    1e-07 
PHCA:scaffold_54 PHYCAscaffold_54                                     59.0    5e-07 
PHRA:scaffold_1351                                                    58.1    2e-06 
PHRA:scaffold_166                                                     58.1    2e-06 
PHCA:scaffold_8 PHYCAscaffold_8                                       57.2    2e-06 
PHPA:scaffold_199 NW_008649185.1 Phytophthora parasitica INRA-310...  54.5    2e-05 
PHIF:NW_003303723.1 Phytophthora infestans T30-4 supercont1.36 ge...  54.5    2e-05 
PHIF:NW_003303713.1 Phytophthora infestans T30-4 supercont1.46 ge...  54.5    2e-05 
PHIF:NW_003303643.1 Phytophthora infestans T30-4 supercont1.116 g...  54.5    2e-05 
PHIF:NW_003303752.1 Phytophthora infestans T30-4 supercont1.7 gen...  53.6    2e-05 
PHCA:scaffold_28 PHYCAscaffold_28                                     53.6    2e-05 
PHPA:scaffold_50 NW_008649036.1 Phytophthora parasitica INRA-310 ...  52.7    7e-05 
PHCA:scaffold_188 PHYCAscaffold_188                                   51.8    7e-05 
PYAP:scaffold_1464 pag1_scaffold_1464 dna:supercontig supercontig...  50.9    2e-04 
PHCA:scaffold_306 PHYCAscaffold_306                                   50.9    2e-04 
PHCA:scaffold_172 PHYCAscaffold_172                                   50.9    2e-04 
PHIF:NW_003303757.1 Phytophthora infestans T30-4 supercont1.2 gen...  50.0    2e-04 
PHSO:scaffold_11                                                      49.1    8e-04 
PHPA:scaffold_46 NW_008649032.1 Phytophthora parasitica INRA-310 ...  49.1    8e-04 
PHIF:NW_003303705.1 Phytophthora infestans T30-4 supercont1.54 ge...  49.1    8e-04 
PHCA:scaffold_83 PHYCAscaffold_83                                     46.4    0.003 
PHIF:NW_003303729.1 Phytophthora infestans T30-4 supercont1.30 ge...  45.5    0.010 
PHPA:scaffold_2 NW_008648988.1 Phytophthora parasitica INRA-310 u...  43.7    0.036 
PHRA:scaffold_4                                                       42.8    0.036 
PHCA:scaffold_40 PHYCAscaffold_40                                     42.8    0.036 
PHCA:scaffold_21 PHYCAscaffold_21                                     42.8    0.036 
HYAP:scaffold_33 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_3...  42.8    0.036 
PHPA:scaffold_5 NW_008648991.1 Phytophthora parasitica INRA-310 u...  41.9    0.13  
PHIF:NW_003303604.1 Phytophthora infestans T30-4 supercont1.155 g...  41.9    0.13  
PHIF:NW_003303546.1 Phytophthora infestans T30-4 supercont1.213 g...  41.9    0.13  
PHCA:scaffold_10 PHYCAscaffold_10                                     41.9    0.13  
HYAP:scaffold_6 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_6:...  41.9    0.13  
PHIF:NW_003303693.1 Phytophthora infestans T30-4 supercont1.66 ge...  40.1    0.44  
PHIF:NW_003303634.1 Phytophthora infestans T30-4 supercont1.125 g...  40.1    0.44  
PHIF:NW_003303418.1 Phytophthora infestans T30-4 supercont1.341 g...  40.1    0.44  
PLHA:NW_020187031.1 Plasmopara halstedii genome assembly, contig:...  39.2    0.44  
PHSO:scaffold_2                                                       39.2    0.44  
PHRA:scaffold_31                                                      39.2    0.44  
PHPA:scaffold_138 NW_008649124.1 Phytophthora parasitica INRA-310...  39.2    0.44  
PHPA:scaffold_21 NW_008649007.1 Phytophthora parasitica INRA-310 ...  39.2    0.44  
PHIF:NW_003303756.1 Phytophthora infestans T30-4 supercont1.3 gen...  39.2    0.44  
PHIF:NW_003303657.1 Phytophthora infestans T30-4 supercont1.102 g...  39.2    0.44  
PHCA:scaffold_85 PHYCAscaffold_85                                     39.2    0.44  
HYAP:scaffold_43 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_4...  39.2    0.44  
SAPA:scaffold_24 supercont2.24 dna:supercontig supercontig:ASM151...  38.3    1.5   
PYIW:scaffold_991 piw_scaffold_991 dna:supercontig supercontig:pi...  38.3    1.5   
PHPA:scaffold_43 NW_008649029.1 Phytophthora parasitica INRA-310 ...  38.3    1.5   
PHPA:scaffold_3 NW_008648989.1 Phytophthora parasitica INRA-310 u...  38.3    1.5   
PHIF:NW_003303724.1 Phytophthora infestans T30-4 supercont1.35 ge...  38.3    1.5   
PHCA:scaffold_104 PHYCAscaffold_104                                   38.3    1.5   
PHCA:scaffold_75 PHYCAscaffold_75                                     38.3    1.5   
PHCA:scaffold_41 PHYCAscaffold_41                                     38.3    1.5   
PHCA:scaffold_35 PHYCAscaffold_35                                     38.3    1.5   
HYAP:scaffold_267 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  38.3    1.5   
HYAP:scaffold_265 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  38.3    1.5   
HYAP:scaffold_227 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  38.3    1.5   
HYAP:scaffold_208 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  38.3    1.5   
HYAP:scaffold_184 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  38.3    1.5   
HYAP:scaffold_124 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  38.3    1.5   
HYAP:scaffold_115 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  38.3    1.5   
HYAP:scaffold_91 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_9...  38.3    1.5   
SAPA:scaffold_18 supercont2.18 dna:supercontig supercontig:ASM151...  37.4    1.5   
PLHA:NW_020187350.1 Plasmopara halstedii genome assembly, contig:...  37.4    1.5   
PHSO:scaffold_1                                                       37.4    1.5   
PHRA:scaffold_658                                                     37.4    1.5   
PHRA:scaffold_290                                                     37.4    1.5   
PHKE:scaffold_36 scf_22126_36.1 dna:supercontig supercontig:PhyKe...  37.4    1.5   
PHIF:NW_003303685.1 Phytophthora infestans T30-4 supercont1.74 ge...  37.4    1.5   
PHCA:scaffold_3 PHYCAscaffold_3                                       37.4    1.5   
HYAP:scaffold_131 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  37.4    1.5   
SADI:scaffold_25 supercont1.25 dna:supercontig supercontig:Sap_di...  36.5    5.3   
PLHA:NW_020189293.1 Plasmopara halstedii genome assembly, contig:...  36.5    5.3   
PHIF:NW_003303677.1 Phytophthora infestans T30-4 supercont1.82 ge...  36.5    5.3   
PHCA:scaffold_38 PHYCAscaffold_38                                     36.5    5.3   
HYAP:scaffold_24 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_2...  36.5    5.3   
APIN:scaffold_41 supercont1.41 dna:supercontig supercontig:Apha_i...  36.5    5.3   
SAPA:scaffold_9 supercont2.9 dna:supercontig supercontig:ASM15154...  35.6    5.3   
SAPA:scaffold_5 supercont2.5 dna:supercontig supercontig:ASM15154...  35.6    5.3   
PYVX:scaffold_14 pve_scaffold_14 dna:supercontig supercontig:pve_...  35.6    5.3   
PYIW:scaffold_3078 piw_scaffold_3078 dna:supercontig supercontig:...  35.6    5.3   
PYAR:scaffold_762 par_scaffold_762 dna:supercontig supercontig:pa...  35.6    5.3   
PLHA:NW_020187532.1 Plasmopara halstedii genome assembly, contig:...  35.6    5.3   
PHRA:scaffold_27                                                      35.6    5.3   
HYAP:scaffold_257 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  35.6    5.3   
APIN:scaffold_26 supercont1.26 dna:supercontig supercontig:Apha_i...  35.6    5.3   
ALCA:scaffold_131 AcNc2_CONTIG_131_length_62772 dna:supercontig s...  35.6    5.3   

>PHCA:scaffold_9 PHYCAscaffold_9
Length=1114135

 Score = 428 bits (474),  Expect = 2e-118
 Identities = 237/237 (100%), Gaps = 0/237 (0%)
 Strand=Plus/Minus

Query  1       TTGTGCACTTGCCCACGTTCTTGCTCGTTTGCTGGTGCCACTGCGGTCTCCACTGGCGAC  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  526317  TTGTGCACTTGCCCACGTTCTTGCTCGTTTGCTGGTGCCACTGCGGTCTCCACTGGCGAC  526258

Query  61      CCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCCCGAAGTCGTGCC  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  526257  CCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCCCGAAGTCGTGCC  526198

Query  121     CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  526197  CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  526138

Query  181     TCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTGA  237
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  526137  TCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTGA  526081

>PHCA:scaffold_66 PHYCAscaffold_66
Length=294895

 Score = 410 bits (454),  Expect = 6e-113
 Identities = 233/237 (98%), Gaps = 0/237 (0%)
 Strand=Plus/Plus

Query  1       TTGTGCACTTGCCCACGTTCTTGCTCGTTTGCTGGTGCCACTGCGGTCTCCACTGGCGAC  60
               |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct  106828  TTGTGCACTTGCCCACGCCCTTGCTCGTTTGCTGGTGCCACTGCGGTCTCCACTGGCGAC  106887

Query  61      CCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCCCGAAGTCGTGCC  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  106888  CCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCCCGAAGTCGTGCC  106947

Query  121     CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  180
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct  106948  CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGAGCTCGAGATAGCGCA  107007

Query  181     TCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTGA  237
               |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct  107008  TCCGCCACAACATTCGTACTACCGGGTCTATATTGCACGTCAAAGTCGAACTCCTGA  107064

>PHCA:scaffold_13 PHYCAscaffold_13
Length=1060349

 Score = 410 bits (454),  Expect = 6e-113
 Identities = 233/237 (98%), Gaps = 0/237 (0%)
 Strand=Plus/Plus

Query  1       TTGTGCACTTGCCCACGTTCTTGCTCGTTTGCTGGTGCCACTGCGGTCTCCACTGGCGAC  60
               |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct  952107  TTGTGCACTTGCCCACGCCCTTGCTCGTTTGCTGGTGCCACTGCGGTCTCCACTGGCGAC  952166

Query  61      CCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCCCGAAGTCGTGCC  120
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct  952167  CCCGAATCTCGTGCCGCTCGCGCATCGTCGGCCGTCGTTGTCCTCGCCCGAAGTCGTGCC  952226

Query  121     CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  952227  CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  952286

Query  181     TCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTGA  237
               |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct  952287  TCCGCCACAACATTCGTACTACCGGGTCTATATTGCACGTCAAAGTCGAACTCCTGA  952343

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Plus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
               || ||||||||||| ||||| || ||    |  |||||  |||||| ||| || ||||
Sbjct  393235  CGCGATAGCGCATCGGCCACTACGTTTAGCCATCCGGGCTTATACTTCACCTCGAAGT  393292

>PHCA:scaffold_439 PHYCAscaffold_439
Length=7762

 Score = 327 bits (362),  Expect = 6e-88
 Identities = 196/206 (95%), Gaps = 0/206 (0%)
 Strand=Plus/Minus

Query  1     TTGTGCACTTGCCCACGTTCTTGCTCGTTTGCTGGTGCCACTGCGGTCTCCACTGGCGAC  60
             |||||||||||||||||  |||||||| |||||||  ||||||| || ||||| ||||| 
Sbjct  5364  TTGTGCACTTGCCCACGCCCTTGCTCGCTTGCTGGCACCACTGCAGTTTCCACGGGCGAT  5305

Query  61    CCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCCCGAAGTCGTGCC  120
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct  5304  CCCGAATCTCGTGCCGCTCGTGCATCGTCGACCGTCGTTGTCCTCGCCCGAAGTCGTGCC  5245

Query  121   CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  5244  CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  5185

Query  181   TCCGCCACAACATTCGTACTACCGGG  206
             ||||||||||||||||||||||||||
Sbjct  5184  TCCGCCACAACATTCGTACTACCGGG  5159

>PHCA:scaffold_228 PHYCAscaffold_228
Length=10481

 Score = 168 bits (185),  Expect = 1e-39
 Identities = 148/185 (80%), Gaps = 0/185 (0%)
 Strand=Plus/Plus

Query  52    ACTGGCGACCCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCCCGA  111
             || || || |||||||| ||||||||||| || |||||  | | ||||||||  ||||||
Sbjct  1474  ACCGGAGAACCCGAATCCCGTGCCGCTCGTGCGTCGTCTGCAGACGTTGTCCGTGCCCGA  1533

Query  112   AGTCGTGCCCGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGA  171
             ||||| |  || ||||| |  |||||||| ||||| ||||| ||||| || || ||||| 
Sbjct  1534  AGTCGCGATCGTCGTCTCCGGCCAACTGCCGCTAACACCGAGGCCGCTACGGGTGCTCGT  1593

Query  172   GATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAAC  231
             || | ||| ||||| || ||||| ||||| || |||| ||||||||| ||||| ||||||
Sbjct  1594  GACAACGCGTCCGCGACTACATTGGTACTGCCCGGTCGATACTGCACATCAAAATCGAAC  1653

Query  232   TCCTG  236
             |||||
Sbjct  1654  TCCTG  1658

>PHCA:scaffold_887 PHYCAscaffold_887
Length=2466

 Score = 165 bits (182),  Expect = 4e-39
 Identities = 151/191 (79%), Gaps = 0/191 (0%)
 Strand=Plus/Minus

Query  46    GTCTCCACTGGCGACCCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTC  105
             ||| | || || || |||||||||||||||||||| || |||||  |||  |||||||  
Sbjct  1882  GTCCCAACCGGAGAACCCGAATCTCGTGCCGCTCGTGCGTCGTCTGCCGATGTTGTCCGT  1823

Query  106   GCCCGAAGTCGTGCCCGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGC  165
             ||||||||||| || || ||||| |  || ||||| ||||| |||||||| || || || 
Sbjct  1822  GCCCGAAGTCGCGCTCGTCGTCTCCGGCCGACTGCCGCTAACACCGAAGCTGCCACGGGT  1763

Query  166   GCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAG  225
             ||||| || | ||| ||||| || ||||| ||||| || | || |||||| || ||||||
Sbjct  1762  GCTCGTGACAACGCGTCCGCTACTACATTAGTACTGCCCGATCGATACTGTACATCAAAG  1703

Query  226   TCGAACTCCTG  236
             |||||||| ||
Sbjct  1702  TCGAACTCTTG  1692

>PHCA:scaffold_121 PHYCAscaffold_121
Length=70414

 Score = 158 bits (174),  Expect = 6e-37
 Identities = 144/182 (79%), Gaps = 0/182 (0%)
 Strand=Plus/Minus

Query  55     GGCGACCCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCCCGAAGT  114
              || || || || ||||||||||| |||||||||||    ||||| || ||||||||||||
Sbjct  18990  GGTGATCCAGAGTCTCGTGCCGCCCGCGCATCGTCCGATGTCGTCGTTCTCGCCCGAAGT  18931

Query  115    CGTGCCCGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGAT  174
              || || || ||||| |  || || |||||||||||||| ||||| ||||| || || || 
Sbjct  18930  CGCGCTCGTCGTCTCCGTCCTACCGCTGCTAATACCGACGCCGCCACAGGTGCGCGTGAC  18871

Query  175    AGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCC  234
              | ||| || |||||||| |||||||| || |||| |||||| |  || ||||| || |||
Sbjct  18870  AACGCGTCAGCCACAACGTTCGTACTGCCAGGTCGATACTGGATATCGAAGTCAAATTCC  18811

Query  235    TG  236
              ||
Sbjct  18810  TG  18809

 Score = 46.4 bits (50),  Expect = 0.003
 Identities = 43/55 (78%), Gaps = 0/55 (0%)
 Strand=Plus/Minus

Query  35    GTGCCACTGCGGTCTCCACTGGCGACCCCGAATCTCGTGCCGCTCGCGCATCGTC  89
             ||||  || | ||||   |||| || || || ||||||||||| |||||||||||
Sbjct  7391  GTGCTGCTTCTGTCTGTGCTGGTGATCCAGAGTCTCGTGCCGCCCGCGCATCGTC  7337

>PHCA:scaffold_6 PHYCAscaffold_6
Length=1423605

 Score = 150 bits (166),  Expect = 1e-34
 Identities = 150/194 (77%), Gaps = 3/194 (2%)
 Strand=Plus/Minus

Query  46       GTCTCCACTGGCGACCCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTC  105
                || || || || || |||||||| |||||||| || || |||||  | | ||||||||  
Sbjct  1406804  GTTTCAACCGGAGAACCCGAATCCCGTGCCGCCCGTGCGTCGTCTGCAGACGTTGTCCGT  1406745

Query  106      GCCCGAAGTCGTGCCCGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGC  165
                ||||||||||| |  || |||||||  || |||| |||||| ||||||||||| || || 
Sbjct  1406744  GCCCGAAGTCGCGATCGTCGTCTTCAGCCTACTGTTGCTAACACCGAAGCCGCCACGGGT  1406685

Query  166      GCTCGAGATAGCGCATCCGCCACAACATTCG---TACTACCGGGTCTATACTGCACGTCA  222
                ||||| || | ||| || || || ||||| |   |||| || |||| |||||| || |||
Sbjct  1406684  GCTCGTGACAACGCGTCGGCTACTACATTAGTATTACTGCCCGGTCGATACTGTACATCA  1406625

Query  223      AAGTCGAACTCCTG  236
                ||||||||||| ||
Sbjct  1406624  AAGTCGAACTCTTG  1406611

>PHCA:scaffold_145 PHYCAscaffold_145
Length=45111

 Score = 132 bits (146),  Expect = 3e-29
 Identities = 142/188 (76%), Gaps = 0/188 (0%)
 Strand=Plus/Plus

Query  49     TCCACTGGCGACCCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCC  108
              ||| | |||||||| ||||||||||| ||||| || |||||  |||| || |||| ||| 
Sbjct  43900  TCCGCCGGCGACCCTGAATCTCGTGCTGCTCGTGCGTCGTCAGCCGTAGTCGTCCGCGCT  43959

Query  109    CGAAGTCGTGCCCGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCT  168
              ||||| ||||| || || |||||||| ||||| || ||    ||||| || || || || 
Sbjct  43960  CGAAGCCGTGCACGACGCCTTCTCCCGACTGCCGCCAAACATGAAGCTGCTACGGGTGCA  44019

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCG  228
              || || |  || || || || || || |||||||| |||| | | || ||||| || || 
Sbjct  44020  CGCGACAATGCGTCTGCTACCACGTTTGTACTACCAGGTCGAAATTGTACGTCGAAATCA  44079

Query  229    AACTCCTG  236
              ||||||||
Sbjct  44080  AACTCCTG  44087

>PHCA:scaffold_18 PHYCAscaffold_18
Length=984210

 Score = 123 bits (135),  Expect = 5e-26
 Identities = 138/185 (75%), Gaps = 0/185 (0%)
 Strand=Plus/Minus

Query  53      CTGGCGACCCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCCCGAA  112
               |||| || || |  || ||||| |||| ||| |||||  ||||||| ||||| ||||| |
Sbjct  784238  CTGGAGATCCTGCGTCGCGTGCAGCTCTCGCGTCGTCCGCCGTCGTCGTCCTTGCCCGTA  784179

Query  113     GTCGTGCCCGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAG  172
                |||||| || || || |  |||||||| || |  ||||| ||||| | ||| || || |
Sbjct  784178  TTCGTGCTCGTCGCCTCCGTCCAACTGCCGCCATCACCGACGCCGCCAGAGGTGCGCGTG  784119

Query  173     ATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACT  232
               | |  ||||| || || || ||||| || || || |  |||||||| ||||||||||| |
Sbjct  784118  ACAATGCATCTGCTACCACGTTCGTGCTGCCCGGACGGTACTGCACTTCAAAGTCGAATT  784059

Query  233     CCTGA  237
               | |||
Sbjct  784058  CTTGA  784054

 Score = 80.6 bits (88),  Expect = 1e-13
 Identities = 62/74 (84%), Gaps = 0/74 (0%)
 Strand=Plus/Minus

Query  163     GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
               || ||||| || || || || ||||| ||||||||||| ||||| |  ||||||||||| 
Sbjct  634369  GGTGCTCGTGACAGAGCGTCAGCCACTACATTCGTACTCCCGGGCCGGTACTGCACGTCG  634310

Query  223     AAGTCGAACTCCTG  236
               ||||||||||||||
Sbjct  634309  AAGTCGAACTCCTG  634296

>PHCA:scaffold_608 PHYCAscaffold_608
Length=3039

 Score = 116 bits (128),  Expect = 2e-24
 Identities = 136/184 (74%), Gaps = 0/184 (0%)
 Strand=Plus/Minus

Query  53   CTGGCGACCCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCCCGAA  112
            |||||||||| ||||||||||| | ||| || || ||  ||||||| || ||||| || |
Sbjct  639  CTGGCGACCCGGAATCTCGTGCTGTTCGTGCGTCATCCGCCGTCGTAGTTCTCGCTCGTA  580

Query  113  GTCGTGCCCGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAG  172
            | ||||  || |||| || ||| || || | || ||| || || || || || || || |
Sbjct  579  GCCGTGATCGTCGTCGTCGCCCTACCGCCGATAGTACTGATGCTGCCACGGGTGCGCGTG  520

Query  173  ATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACT  232
            | | ||| || ||||| || || ||  | || |||| |||||| || ||||| ||||| |
Sbjct  519  ACAACGCGTCTGCCACCACGTTTGTGTTGCCTGGTCGATACTGTACATCAAAATCGAATT  460

Query  233  CCTG  236
            | ||
Sbjct  459  CTTG  456

>PHCA:scaffold_22 PHYCAscaffold_22
Length=843021

 Score = 116 bits (128),  Expect = 2e-24
 Identities = 136/184 (74%), Gaps = 0/184 (0%)
 Strand=Plus/Plus

Query  54      TGGCGACCCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCCCGAAG  113
               ||| || || |  || ||||| |||| ||| |||||  ||||||| ||||| | ||| | 
Sbjct  414840  TGGAGATCCTGCGTCGCGTGCAGCTCTCGCGTCGTCCGCCGTCGTCGTCCTTGGCCGTAC  414899

Query  114     TCGTGCCCGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGA  173
               |||||| || ||  | |  |||||||| || |  ||||| ||||| | ||| || || ||
Sbjct  414900  TCGTGCTCGTCGCATCCGTCCAACTGCCGCCATCACCGACGCCGCCAGAGGTGCGCGTGA  414959

Query  174     TAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTC  233
                | |||||| || || || ||||| || || || |  |||||||| ||||||||||| ||
Sbjct  414960  CAACGCATCTGCTACCACGTTCGTGCTGCCCGGACGGTACTGCACTTCAAAGTCGAATTC  415019

Query  234     CTGA  237
                |||
Sbjct  415020  TTGA  415023

 Score = 78.8 bits (86),  Expect = 5e-13
 Identities = 86/114 (75%), Gaps = 3/114 (3%)
 Strand=Plus/Minus

Query  124     CGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCATCC  183
               |||||||  || |  || || |||||||   |||| || |||||||  || ||||| |||
Sbjct  464860  CGTCTTCGGCCGATCGCCGCCAATACCG---CCGCCACTGGCGCTCTTGAGAGCGCGTCC  464804

Query  184     GCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTGA  237
               ||||| |||||||| || || ||||  |||   || || || ||||||||||||
Sbjct  464803  GCCACCACATTCGTGCTGCCAGGTCGGTACACTACCTCGAAATCGAACTCCTGA  464750

>PHCA:scaffold_31 PHYCAscaffold_31
Length=686815

 Score = 113 bits (124),  Expect = 2e-23
 Identities = 125/167 (75%), Gaps = 0/167 (0%)
 Strand=Plus/Plus

Query  70      CGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTCGCCCGAAGTCGTGCCCGCCGTCTT  129
               ||||||||||| |  || ||  ||| ||| ||||||||||| | |||||  || |||| |
Sbjct  518779  CGTGCCGCTCGTGAGTCATCCGCCGCCGTCGTCCTCGCCCGTAATCGTGATCGTCGTCGT  518838

Query  130     CTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCATCCGCCACA  189
               | ||| || || |  ||| | || || || ||||| || || || | |||||| || || 
Sbjct  518839  CGCCCTACAGCCGACAATGCTGATGCTGCCACAGGTGCGCGTGACAACGCATCTGCTACC  518898

Query  190     ACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTG  236
               ||||| || || || |||| |||||| ||||| || |||||||| ||
Sbjct  518899  ACATTTGTGCTGCCCGGTCGATACTGTACGTCGAAATCGAACTCTTG  518945

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 55/78 (71%), Gaps = 0/78 (0%)
 Strand=Plus/Plus

Query  160     ACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACG  219
               || || ||||  || || || || ||||||||||| || || || || | |||||  || 
Sbjct  439384  ACTGGAGCTCTCGACAGTGCGTCAGCCACAACATTGGTGCTTCCTGGCCGATACTAAACC  439443

Query  220     TCAAAGTCGAACTCCTGA  237
                 |||  || |||| |||
Sbjct  439444  GTAAAAACGTACTCTTGA  439461

>PHCA:scaffold_175 PHYCAscaffold_175
Length=47467

 Score = 105 bits (116),  Expect = 4e-21
 Identities = 91/113 (81%), Gaps = 0/113 (0%)
 Strand=Plus/Minus

Query  46    GTCTCCACTGGCGACCCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGTTGTCCTC  105
             |||| | |||| || || || ||||||||||| |||||||||||    |||||||| |||
Sbjct  1978  GTCTGCGCTGGTGATCCAGAGTCTCGTGCCGCCCGCGCATCGTCCGATGTCGTTGTTCTC  1919

Query  106   GCCCGAAGTCGTGCCCGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGC  158
             || |||||||| || || ||||| |  || || |||||||||||||| |||||
Sbjct  1918  GCTCGAAGTCGCGCTCGTCGTCTCCGTCCTACCGCTGCTAATACCGACGCCGC  1866

>PHIF:NW_003303681.1 Phytophthora infestans T30-4 supercont1.78 
genomic scaffold, whole genome shotgun sequence
Length=653250

 Score = 95.1 bits (104),  Expect = 6e-18
 Identities = 94/122 (77%), Gaps = 0/122 (0%)
 Strand=Plus/Plus

Query  115     CGTGCCCGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGAT  174
               ||||  || |||||||| || || || |||||||||    | || ||||||||||  || 
Sbjct  438774  CGTGATCGTCGTCTTCTTCCTACGGCCGCTAATACCCTTTCAGCCACAGGCGCTCTCGAA  438833

Query  175     AGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCC  234
               ||||| || ||||| |||||||| || || ||||  ||||| || ||||||||||| || 
Sbjct  438834  AGCGCGTCAGCCACCACATTCGTGCTGCCAGGTCGGTACTGAACTTCAAAGTCGAATTCT  438893

Query  235     TG  236
               ||
Sbjct  438894  TG  438895

>PHIF:NW_003303668.1 Phytophthora infestans T30-4 supercont1.91 
genomic scaffold, whole genome shotgun sequence
Length=525183

 Score = 93.3 bits (102),  Expect = 2e-17
 Identities = 90/116 (78%), Gaps = 0/116 (0%)
 Strand=Plus/Plus

Query  121    CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  180
              || |||||||| || ||  | |||||||||    | || ||||||||||  || ||||||
Sbjct  69392  CGTCGTCTTCTTCCTACGACCGCTAATACCCTTTCAGCCACAGGCGCTCTCGAAAGCGCA  69451

Query  181    TCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTG  236
              || ||||| |||||||| || || ||||  ||||| || ||||||||||| || ||
Sbjct  69452  TCAGCCACCACATTCGTGCTGCCAGGTCGGTACTGAACTTCAAAGTCGAATTCTTG  69507

>PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 
genomic scaffold, whole genome shotgun sequence
Length=4722445

 Score = 84.2 bits (92),  Expect = 1e-14
 Identities = 88/116 (76%), Gaps = 0/116 (0%)
 Strand=Plus/Plus

Query  121      CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  180
                || |||||||| || || || ||||  |||    | || ||||||||||  || ||||| 
Sbjct  3026377  CGTCGTCTTCTTCCTACCGCCGCTAGCACCCTTTCAGCCACAGGCGCTCTCGAAAGCGCG  3026436

Query  181      TCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTG  236
                || ||||| |||||||| || || ||||  ||||| || ||||||||||| || ||
Sbjct  3026437  TCAGCCACCACATTCGTGCTGCCAGGTCGGTACTGAACTTCAAAGTCGAATTCTTG  3026492

>PHIF:NW_003303737.1 Phytophthora infestans T30-4 supercont1.22 
genomic scaffold, whole genome shotgun sequence
Length=2337630

 Score = 84.2 bits (92),  Expect = 1e-14
 Identities = 88/116 (76%), Gaps = 0/116 (0%)
 Strand=Plus/Minus

Query  121     CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  180
               || |||||||| || || || ||||  |||    | || ||||||||||  || ||||| 
Sbjct  737843  CGTCGTCTTCTTCCTACCGCCGCTAGCACCCTTTCAGCCACAGGCGCTCTCGAAAGCGCG  737784

Query  181     TCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTG  236
               || ||||| |||||||| || || ||||  ||||| || ||||||||||| || ||
Sbjct  737783  TCAGCCACCACATTCGTGCTGCCAGGTCGGTACTGAACTTCAAAGTCGAATTCTTG  737728

>PHIF:NW_003303735.1 Phytophthora infestans T30-4 supercont1.24 
genomic scaffold, whole genome shotgun sequence
Length=2281020

 Score = 84.2 bits (92),  Expect = 1e-14
 Identities = 88/116 (76%), Gaps = 0/116 (0%)
 Strand=Plus/Plus

Query  121      CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  180
                || |||||||| || || || ||||  |||    | || ||||||||||  || ||||| 
Sbjct  1237809  CGTCGTCTTCTTCCTACCGCCGCTAGCACCCTTTCAGCCACAGGCGCTCTCGAAAGCGCG  1237868

Query  181      TCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTG  236
                || ||||| |||||||| || || ||||  ||||| || ||||||||||| || ||
Sbjct  1237869  TCAGCCACCACATTCGTGCTGCCAGGTCGGTACTGAACTTCAAAGTCGAATTCTTG  1237924

>PHIF:NW_003303758.1 Phytophthora infestans T30-4 supercont1.1 
genomic scaffold, whole genome shotgun sequence
Length=6928287

 Score = 82.4 bits (90),  Expect = 4e-14
 Identities = 84/110 (76%), Gaps = 0/110 (0%)
 Strand=Plus/Plus

Query  121      CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  180
                || |||||||| || || || ||||| |||    | || ||||| ||||  || ||||| 
Sbjct  3141689  CGTCGTCTTCTTCCTACCGCCGCTAACACCCTTTCAGCCACAGGTGCTCTCGAAAGCGCG  3141748

Query  181      TCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAA  230
                || ||||| |||||||| || || ||||  ||||| || |||||||||||
Sbjct  3141749  TCAGCCACCACATTCGTGCTGCCAGGTCGGTACTGAACTTCAAAGTCGAA  3141798

 Score = 54.5 bits (59),  Expect = 2e-05
 Identities = 58/77 (75%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  160      ACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACG  219
                || || || |||||||||||||| || || || || ||| | || || | ||| | ||| 
Sbjct  3249993  ACCGGAGCGCGAGATAGCGCATCTGCTACCACGTTGGTATTGCCAGGACGATATTCCACC  3249934

Query  220      TCAAAGTCGAACTCCTG  236
                ||||| ||| |||| ||
Sbjct  3249933  TCAAAATCGTACTCTTG  3249917

>PHCA:scaffold_23 PHYCAscaffold_23
Length=821542

 Score = 80.6 bits (88),  Expect = 1e-13
 Identities = 62/74 (84%), Gaps = 0/74 (0%)
 Strand=Plus/Minus

Query  163     GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
               || ||||| || || || || ||||| ||||||||||| ||||| |  ||||||||||| 
Sbjct  753262  GGTGCTCGTGACAGAGCGTCAGCCACTACATTCGTACTCCCGGGCCGGTACTGCACGTCG  753203

Query  223     AAGTCGAACTCCTG  236
               ||||||||||||||
Sbjct  753202  AAGTCGAACTCCTG  753189

 Score = 56.3 bits (61),  Expect = 6e-06
 Identities = 59/78 (76%), Gaps = 0/78 (0%)
 Strand=Plus/Minus

Query  160     ACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACG  219
               || || ||||  || || || |||||||||||||| || || || || | |||||  || 
Sbjct  694118  ACCGGAGCTCTCGACAGTGCGTCCGCCACAACATTGGTGCTTCCTGGCCGATACTCAACC  694059

Query  220     TCAAAGTCGAACTCCTGA  237
                 ||||||| ||||||||
Sbjct  694058  GTAAAGTCGTACTCCTGA  694041

 Score = 49.1 bits (53),  Expect = 8e-04
 Identities = 55/74 (74%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  163    GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
              || || || ||||  ||||||||||| || |||||    || || |||||||  |   ||
Sbjct  19818  GGAGCCCGTGATAAGGCATCCGCCACCACGTTCGTCGATCCAGGCCTATACTCAATTCCA  19877

Query  223    AAGTCGAACTCCTG  236
              |||||| |||||||
Sbjct  19878  AAGTCGTACTCCTG  19891

>PHCA:scaffold_550 PHYCAscaffold_550
Length=4601

 Score = 71.6 bits (78),  Expect = 7e-11
 Identities = 60/74 (81%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  163  GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
            || ||||| || || || ||||||||||| || || || || |||||||||| |||||||
Sbjct  914  GGAGCTCGGGACAGTGCGTCCGCCACAACGTTGGTGCTTCCCGGTCTATACTCCACGTCA  973

Query  223  AAGTCGAACTCCTG  236
            || ||| |||| ||
Sbjct  974  AAATCGTACTCTTG  987

>PHCA:scaffold_106 PHYCAscaffold_106
Length=144267

 Score = 71.6 bits (78),  Expect = 7e-11
 Identities = 60/74 (81%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  163    GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
              || ||||| || || || ||||||||||| || || || || |||||||| | |||||||
Sbjct  65046  GGAGCTCGGGACAGTGCGTCCGCCACAACGTTGGTGCTTCCCGGTCTATATTCCACGTCA  65105

Query  223    AAGTCGAACTCCTG  236
              |||||| |||| ||
Sbjct  65106  AAGTCGTACTCTTG  65119

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Minus

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
              || ||||||||||| ||||| |||||    |  || ||  |||||| ||| || ||||
Sbjct  26800  CGCGATAGCGCATCGGCCACTACATTAAGCCGGCCCGGCTTATACTTCACATCGAAGT  26743

>PHCA:scaffold_19 PHYCAscaffold_19
Length=944885

 Score = 70.7 bits (77),  Expect = 3e-10
 Identities = 85/116 (73%), Gaps = 0/116 (0%)
 Strand=Plus/Minus

Query  121     CGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCA  180
               || ||||| || ||| | ||||||  ||| | |    | |  |||||||  || | ||||
Sbjct  793279  CGTCGTCTCCTTCCAGCCGCTGCTCTTACTGCATGTACTAGTGGCGCTCTCGACAACGCA  793220

Query  181     TCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTG  236
               || || |||||||||||  | || || | ||| | ||||||||||||| |||||||
Sbjct  793219  TCAGCAACAACATTCGTGTTCCCTGGCCGATATTCCACGTCAAAGTCGTACTCCTG  793164

>PHCA:scaffold_12 PHYCAscaffold_12
Length=1145657

 Score = 70.7 bits (77),  Expect = 3e-10
 Identities = 49/56 (88%), Gaps = 0/56 (0%)
 Strand=Plus/Minus

Query  181      TCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTG  236
                || ||||| ||||||||||| ||||| |  ||||||||||| ||||||||||||||
Sbjct  1033992  TCAGCCACTACATTCGTACTCCCGGGCCGGTACTGCACGTCGAAGTCGAACTCCTG  1033937

>PHCA:scaffold_42 PHYCAscaffold_42
Length=526029

 Score = 69.8 bits (76),  Expect = 3e-10
 Identities = 89/123 (72%), Gaps = 0/123 (0%)
 Strand=Plus/Minus

Query  39      CACTGCGGTCTCCACTGGCGACCCCGAATCTCGTGCCGCTCGCGCATCGTCGACCGTCGT  98
               ||| || ||  || |||| || || || |||||||||||||| |  || ||  ||| |||
Sbjct  194701  CACCGCCGTGCCCGCTGGTGATCCTGAGTCTCGTGCCGCTCGTGAGTCATCCGCCGCCGT  194642

Query  99      TGTCCTCGCCCGAAGTCGTGCCCGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGC  158
                ||||||||||| | |||||  || |||| || ||| || || |  ||| | || || ||
Sbjct  194641  CGTCCTCGCCCGTAATCGTGATCGTCGTCGTCGCCCTACAGCCGACAATGCTGATGCTGC  194582

Query  159     AAC  161
                ||
Sbjct  194581  CAC  194579

>PHCA:scaffold_50 PHYCAscaffold_50
Length=475612

 Score = 67.1 bits (73),  Expect = 3e-09
 Identities = 59/74 (80%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  163     GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
               ||||| |  || ||||| || ||||| || ||||||||||| |||| |||   ||| |||
Sbjct  185530  GGCGCCCTCGACAGCGCGTCTGCCACCACGTTCGTACTACCCGGTCGATATACCACCTCA  185589

Query  223     AAGTCGAACTCCTG  236
               ||||| ||||||||
Sbjct  185590  AAGTCAAACTCCTG  185603

>PHCA:scaffold_7 PHYCAscaffold_7
Length=1368812

 Score = 67.1 bits (73),  Expect = 3e-09
 Identities = 59/74 (80%), Gaps = 0/74 (0%)
 Strand=Plus/Minus

Query  163     GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
               |||||||  || | |||||| ||||||||||||||  | || |||| |||||  ||||||
Sbjct  668386  GGCGCTCTCGACAACGCATCAGCCACAACATTCGTGTTCCCCGGTCGATACTCAACGTCA  668327

Query  223     AAGTCGAACTCCTG  236
               || ||  |||||||
Sbjct  668326  AAATCATACTCCTG  668313

>PHPA:scaffold_75 NW_008649061.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.75, whole genome shotgun 
sequence
Length=275807

 Score = 65.3 bits (71),  Expect = 1e-08
 Identities = 61/78 (78%), Gaps = 0/78 (0%)
 Strand=Plus/Minus

Query  160    ACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACG  219
              || || ||||  || || ||||| || || ||||| ||||| || ||||  |||| ||| 
Sbjct  39034  ACCGGTGCTCTTGACAGAGCATCTGCAACCACATTAGTACTGCCCGGTCCGTACTCCACA  38975

Query  220    TCAAAGTCGAACTCCTGA  237
              ||||| ||||||||||||
Sbjct  38974  TCAAACTCGAACTCCTGA  38957

>PHCA:scaffold_320 PHYCAscaffold_320
Length=7343

 Score = 63.5 bits (69),  Expect = 4e-08
 Identities = 60/77 (78%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  160   ACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACG  219
             || |||||||  |||| ||| |||||||| ||||||||||| || |||| |||||  || 
Sbjct  4116  ACCGGCGCTCTCGATAACGCGTCCGCCACGACATTCGTACTTCCCGGTCGATACTCAACT  4057

Query  220   TCAAAGTCGAACTCCTG  236
               ||||||  |||| ||
Sbjct  4056  GTAAAGTCATACTCTTG  4040

>PHCA:scaffold_14 PHYCAscaffold_14
Length=1100894

 Score = 62.6 bits (68),  Expect = 4e-08
 Identities = 58/74 (78%), Gaps = 0/74 (0%)
 Strand=Plus/Minus

Query  163     GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
               || ||||  || || || || || ||||| || || || || |||||||||| |||||||
Sbjct  441741  GGGGCTCTGGACAGTGCGTCTGCAACAACGTTGGTGCTTCCCGGTCTATACTCCACGTCA  441682

Query  223     AAGTCGAACTCCTG  236
               |||||| |||| ||
Sbjct  441681  AAGTCGTACTCTTG  441668

>PHCA:scaffold_5 PHYCAscaffold_5
Length=1593284

 Score = 62.6 bits (68),  Expect = 4e-08
 Identities = 58/74 (78%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  163     GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
               || ||||  || || || || || ||||| || || || || |||||||||| |||||||
Sbjct  328974  GGGGCTCTGGACAGTGCGTCTGCAACAACGTTGGTGCTTCCCGGTCTATACTCCACGTCA  329033

Query  223     AAGTCGAACTCCTG  236
               |||||| |||| ||
Sbjct  329034  AAGTCGTACTCTTG  329047

>PHCA:scaffold_2 PHYCAscaffold_2
Length=1925921

 Score = 62.6 bits (68),  Expect = 4e-08
 Identities = 58/74 (78%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  163     GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
               ||||| |  || | ||| || ||||| || ||||||||||| |||| |||   ||| |||
Sbjct  274688  GGCGCCCTCGACAACGCGTCTGCCACCACGTTCGTACTACCCGGTCGATATACCACCTCA  274747

Query  223     AAGTCGAACTCCTG  236
               ||||| ||||||||
Sbjct  274748  AAGTCAAACTCCTG  274761

>PHPA:scaffold_309 NW_008649295.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.309, whole genome 
shotgun sequence
Length=9020

 Score = 60.8 bits (66),  Expect = 1e-07
 Identities = 60/78 (77%), Gaps = 0/78 (0%)
 Strand=Plus/Plus

Query  160   ACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACG  219
             || || ||||  || || ||||| || || ||||| ||||| || ||||  |||| ||| 
Sbjct  1216  ACCGGTGCTCTTGACAGAGCATCTGCAACCACATTAGTACTGCCCGGTCCGTACTCCACA  1275

Query  220   TCAAAGTCGAACTCCTGA  237
              |||| ||||||||||||
Sbjct  1276  CCAAACTCGAACTCCTGA  1293

>PHCA:scaffold_54 PHYCAscaffold_54
Length=427428

 Score = 59.0 bits (64),  Expect = 5e-07
 Identities = 59/77 (77%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  160     ACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACG  219
               || |||||||  |||| ||| || ||||| ||||||||||| || |||| |||||  || 
Sbjct  182217  ACCGGCGCTCTCGATAACGCGTCTGCCACGACATTCGTACTTCCTGGTCGATACTCAACT  182276

Query  220     TCAAAGTCGAACTCCTG  236
                 ||||||  |||| ||
Sbjct  182277  GTAAAGTCATACTCTTG  182293

>PHRA:scaffold_1351
Length=5447

 Score = 58.1 bits (63),  Expect = 2e-06
 Identities = 57/74 (77%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  163  GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
            ||||| || ||||||||||| ||||| || ||||| || || ||||||||    |  || 
Sbjct  24   GGCGCACGCGATAGCGCATCTGCCACTACGTTCGTTCTGCCTGGTCTATAAACAATTTCG  83

Query  223  AAGTCGAACTCCTG  236
            || ||| |||||||
Sbjct  84   AACTCGTACTCCTG  97

>PHRA:scaffold_166
Length=52707

 Score = 58.1 bits (63),  Expect = 2e-06
 Identities = 57/74 (77%), Gaps = 0/74 (0%)
 Strand=Plus/Minus

Query  163   GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
             ||||| || ||||||||||| ||||| || ||||| || || ||||||||    |  || 
Sbjct  3721  GGCGCACGCGATAGCGCATCTGCCACTACGTTCGTTCTGCCTGGTCTATAAACAATTTCG  3662

Query  223   AAGTCGAACTCCTG  236
             || ||| |||||||
Sbjct  3661  AACTCGTACTCCTG  3648

>PHCA:scaffold_8 PHYCAscaffold_8
Length=1194346

 Score = 57.2 bits (62),  Expect = 2e-06
 Identities = 55/71 (77%), Gaps = 0/71 (0%)
 Strand=Plus/Plus

Query  166     GCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAG  225
               ||||  || | |||||| || |||||||||||  | || || | || ||  |||||||||
Sbjct  670159  GCTCTCGACAACGCATCAGCAACAACATTCGTGTTCCCTGGCCGATGCTCAACGTCAAAG  670218

Query  226     TCGAACTCCTG  236
               ||| |||||||
Sbjct  670219  TCGTACTCCTG  670229

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
               || ||||||||||| ||||| |||||    |  || ||  |||||| ||| || ||||
Sbjct  909809  CGCGATAGCGCATCGGCCACTACATTAAGCCGTCCCGGCTTATACTTCACCTCGAAGT  909752

>PHPA:scaffold_199 NW_008649185.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.199, whole genome 
shotgun sequence
Length=26903

 Score = 54.5 bits (59),  Expect = 2e-05
 Identities = 76/107 (71%), Gaps = 0/107 (0%)
 Strand=Plus/Plus

Query  130    CTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCATCCGCCACA  189
              || |||||||| || ||   || ||   | || ||||| || || ||||| ||| | || 
Sbjct  15235  CTACCAACTGCCGCCAACGTCGTAGATACCACGGGCGCGCGGGAGAGCGCGTCCACTACC  15294

Query  190    ACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTG  236
              ||||| ||  | || || | ||| || || ||||||||||| || ||
Sbjct  15295  ACATTAGTGTTCCCCGGCCGATATTGTACATCAAAGTCGAATTCTTG  15341

>PHIF:NW_003303723.1 Phytophthora infestans T30-4 supercont1.36 
genomic scaffold, whole genome shotgun sequence
Length=1665391

 Score = 54.5 bits (59),  Expect = 2e-05
 Identities = 58/77 (75%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  160     ACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACG  219
               || || || |||||||||||||| || || || || ||| | || || | ||| | ||| 
Sbjct  300202  ACCGGAGCGCGAGATAGCGCATCTGCTACCACGTTGGTATTGCCAGGACGATATTCCACC  300143

Query  220     TCAAAGTCGAACTCCTG  236
               ||||| ||| |||| ||
Sbjct  300142  TCAAAATCGTACTCTTG  300126

>PHIF:NW_003303713.1 Phytophthora infestans T30-4 supercont1.46 
genomic scaffold, whole genome shotgun sequence
Length=1163948

 Score = 54.5 bits (59),  Expect = 2e-05
 Identities = 58/77 (75%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  160      ACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACG  219
                || || || |||||||||||||| || || || || ||| | || || | ||| | ||| 
Sbjct  1037194  ACCGGAGCGCGAGATAGCGCATCTGCTACCACGTTGGTATTGCCAGGACGATATTCCACC  1037253

Query  220      TCAAAGTCGAACTCCTG  236
                ||||| ||| |||| ||
Sbjct  1037254  TCAAAATCGTACTCTTG  1037270

>PHIF:NW_003303643.1 Phytophthora infestans T30-4 supercont1.116 
genomic scaffold, whole genome shotgun sequence
Length=256164

 Score = 54.5 bits (59),  Expect = 2e-05
 Identities = 58/77 (75%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  160     ACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACG  219
               || || || |||||||||||||| || || || || ||| | || || | ||| | ||| 
Sbjct  126268  ACCGGAGCGCGAGATAGCGCATCTGCTACCACGTTGGTATTGCCAGGACGATATTCCACC  126327

Query  220     TCAAAGTCGAACTCCTG  236
               ||||| ||| |||| ||
Sbjct  126328  TCAAAATCGTACTCTTG  126344

>PHIF:NW_003303752.1 Phytophthora infestans T30-4 supercont1.7 
genomic scaffold, whole genome shotgun sequence
Length=4595942

 Score = 53.6 bits (58),  Expect = 2e-05
 Identities = 56/74 (76%), Gaps = 0/74 (0%)
 Strand=Plus/Minus

Query  163      GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
                || || |||||||||||||| || || || || ||| | || || | ||| | ||| |||
Sbjct  1100831  GGAGCGCGAGATAGCGCATCTGCTACCACGTTGGTATTGCCAGGACGATATTCCACCTCA  1100772

Query  223      AAGTCGAACTCCTG  236
                || ||| |||| ||
Sbjct  1100771  AAATCGTACTCTTG  1100758

>PHCA:scaffold_28 PHYCAscaffold_28
Length=757753

 Score = 53.6 bits (58),  Expect = 2e-05
 Identities = 80/114 (70%), Gaps = 0/114 (0%)
 Strand=Plus/Plus

Query  124     CGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCATCC  183
               |||||||  ||||| ||||| ||   |   | | | || || ||||  || || || || 
Sbjct  376251  CGTCTTCGTCCAACGGCTGCCAACGTCCTGGACACCACCGGAGCTCTCGACAGTGCGTCT  376310

Query  184     GCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTGA  237
               ||||||||||| || || || || | |||||  ||   ||||||| |||| |||
Sbjct  376311  GCCACAACATTGGTGCTTCCTGGCCGATACTCAACCGTAAAGTCGTACTCTTGA  376364

>PHPA:scaffold_50 NW_008649036.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.50, whole genome shotgun 
sequence
Length=472422

 Score = 52.7 bits (57),  Expect = 7e-05
 Identities = 45/56 (80%), Gaps = 0/56 (0%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAA  224
               ||||||||||||||||| || || |||||||| || || | ||| |  || |||||
Sbjct  312437  CGAGATAGCGCATCCGCTACCACGTTCGTACTGCCTGGCCGATATTCTACTTCAAA  312382

>PHCA:scaffold_188 PHYCAscaffold_188
Length=15519

 Score = 51.8 bits (56),  Expect = 7e-05
 Identities = 79/113 (70%), Gaps = 0/113 (0%)
 Strand=Plus/Plus

Query  125   GTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCATCCG  184
             ||||||  ||||  ||||||||   |  || | | ||  | ||||  || | ||| || |
Sbjct  2681  GTCTTCGTCCAATGGCTGCTAACGTCCTAGACACTACCAGGGCTCTCGACAACGCGTCTG  2740

Query  185   CCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTGA  237
             |||||||||| || || || |||| |||||  ||  |||| | | |||| |||
Sbjct  2741  CCACAACATTGGTGCTTCCTGGTCGATACTCTACCGCAAACTTGTACTCTTGA  2793

>PYAP:scaffold_1464 pag1_scaffold_1464 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_1464:1:3495:1 
REF
Length=3495

 Score = 50.9 bits (55),  Expect = 2e-04
 Identities = 44/55 (80%), Gaps = 0/55 (0%)
 Strand=Plus/Minus

Query  160   ACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACT  214
             || || |||||||| |||||||| | ||| ||||||    | |||||||||||||
Sbjct  2867  ACCGGGGCTCGAGACAGCGCATCAGGCACCACATTCTCCTTGCCGGGTCTATACT  2813

>PHCA:scaffold_306 PHYCAscaffold_306
Length=5838

 Score = 50.9 bits (55),  Expect = 2e-04
 Identities = 56/75 (75%), Gaps = 0/75 (0%)
 Strand=Plus/Minus

Query  162   AGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTC  221
             |||||| || || || || || || || || ||||| || || || |  || ||||||||
Sbjct  5049  AGGCGCCCGTGAGAGAGCGTCAGCTACGACGTTCGTGCTTCCAGGCCGGTATTGCACGTC  4990

Query  222   AAAGTCGAACTCCTG  236
             ||| || || |||||
Sbjct  4989  AAAATCAAATTCCTG  4975

>PHCA:scaffold_172 PHYCAscaffold_172
Length=15116

 Score = 50.9 bits (55),  Expect = 2e-04
 Identities = 56/75 (75%), Gaps = 0/75 (0%)
 Strand=Plus/Minus

Query  162   AGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTC  221
             |||||| || || || ||||| || || || ||||  || || || |  || ||||||||
Sbjct  8070  AGGCGCCCGCGAGAGAGCATCAGCTACGACGTTCGCGCTTCCAGGCCGGTATTGCACGTC  8011

Query  222   AAAGTCGAACTCCTG  236
             ||| || || |||||
Sbjct  8010  AAAATCAAATTCCTG  7996

>PHIF:NW_003303757.1 Phytophthora infestans T30-4 supercont1.2 
genomic scaffold, whole genome shotgun sequence
Length=5928454

 Score = 50.0 bits (54),  Expect = 2e-04
 Identities = 62/84 (74%), Gaps = 6/84 (7%)
 Strand=Plus/Minus

Query  125      GTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCATCCG  184
                ||| |||||| ||||||||||| ||    ||||   | ||||| || || || || || |
Sbjct  3601471  GTCGTCTCCCTACTGCTGCTAACAC---TGCCG---CTGGCGCCCGCGAGAGAGCGTCGG  3601418

Query  185      CCACAACATTCGTACTACCGGGTC  208
                ||||||| |||||   ||| ||||
Sbjct  3601417  CCACAACGTTCGTGGCACCCGGTC  3601394

 Score = 50.0 bits (54),  Expect = 2e-04
 Identities = 86/124 (69%), Gaps = 6/124 (5%)
 Strand=Plus/Plus

Query  113      GTCGTGCCCGCCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAG  172
                |||||||||| ||||  || ||  | ||||| ||   |  |||    || || || |  |
Sbjct  4471065  GTCGTGCCCGTCGTCGACTTCCCGCCGCTGCCAACGTC--AGC----ACTGGAGCCCTGG  4471118

Query  173      ATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACT  232
                | |  ||||||||||| || |||||||| || | ||||||||  ||    |||||||| |
Sbjct  4471119  ACAAGGCATCCGCCACGACGTTCGTACTGCCCGCTCTATACTCGACCGTGAAGTCGAATT  4471178

Query  233      CCTG  236
                | ||
Sbjct  4471179  CTTG  4471182

>PHSO:scaffold_11
Length=2192408

 Score = 49.1 bits (53),  Expect = 8e-04
 Identities = 55/74 (74%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  163     GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
               || ||||| || | ||| || || || || |||||    || ||||  ||||||||||| 
Sbjct  660071  GGTGCTCGTGACAACGCGTCAGCGACCACGTTCGTCGCCCCCGGTCGGTACTGCACGTCG  660130

Query  223     AAGTCGAACTCCTG  236
               ||||| ||||| ||
Sbjct  660131  AAGTCAAACTCTTG  660144

>PHPA:scaffold_46 NW_008649032.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.46, whole genome shotgun 
sequence
Length=493760

 Score = 49.1 bits (53),  Expect = 8e-04
 Identities = 46/59 (78%), Gaps = 0/59 (0%)
 Strand=Plus/Plus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTC  227
               ||||||||||||||||| || |  |||||||| || || | ||| |  || ||||| ||
Sbjct  180339  CGAGATAGCGCATCCGCTACCATGTTCGTACTGCCTGGACGATATTCTACTTCAAACTC  180397

>PHIF:NW_003303705.1 Phytophthora infestans T30-4 supercont1.54 
genomic scaffold, whole genome shotgun sequence
Length=929857

 Score = 49.1 bits (53),  Expect = 8e-04
 Identities = 55/74 (74%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  163     GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
               || || || ||||||||||| || || ||||| ||| | || || | ||| | ||| || 
Sbjct  650324  GGAGCGCGGGATAGCGCATCTGCTACCACATTGGTATTGCCAGGGCGATATTCCACCTCG  650383

Query  223     AAGTCGAACTCCTG  236
               || ||| |||| ||
Sbjct  650384  AAATCGTACTCTTG  650397

>PHCA:scaffold_83 PHYCAscaffold_83
Length=185922

 Score = 46.4 bits (50),  Expect = 0.003
 Identities = 49/65 (75%), Gaps = 0/65 (0%)
 Strand=Plus/Minus

Query  157    GCAACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGC  216
              || || |||||||  || || ||||| || || |||||  |  | || |||| |||||||
Sbjct  58200  GCCACCGGCGCTCTCGAAAGTGCATCAGCTACCACATTGTTCTTCCCTGGTCGATACTGC  58141

Query  217    ACGTC  221
              |||||
Sbjct  58140  ACGTC  58136

 Score = 37.4 bits (40),  Expect = 1.5
 Identities = 47/65 (72%), Gaps = 0/65 (0%)
 Strand=Plus/Plus

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCG  228
              || ||||||||||| ||||| || ||    |  || ||  |||||| ||| || |||| |
Sbjct  68985  CGCGATAGCGCATCGGCCACTACGTTAAGCCGGCCCGGCTTATACTTCACCTCGAAGTTG  69044

Query  229    AACTC  233
               ||||
Sbjct  69045  TACTC  69049

>PHIF:NW_003303729.1 Phytophthora infestans T30-4 supercont1.30 
genomic scaffold, whole genome shotgun sequence
Length=2025055

 Score = 45.5 bits (49),  Expect = 0.010
 Identities = 61/84 (73%), Gaps = 6/84 (7%)
 Strand=Plus/Minus

Query  125      GTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCATCCG  184
                ||| ||| || ||||||||||||||    ||||   | ||||| || || || || || |
Sbjct  1384771  GTCGTCTTCCTACTGCTGCTAATAC---TGCCG---CTGGCGCACGCGAGAGAGCGTCGG  1384718

Query  185      CCACAACATTCGTACTACCGGGTC  208
                ||||| | |||||   ||| ||||
Sbjct  1384717  CCACAGCGTTCGTGGCACCCGGTC  1384694

>PHPA:scaffold_2 NW_008648988.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.2, whole genome shotgun 
sequence
Length=2916180

 Score = 43.7 bits (47),  Expect = 0.036
 Identities = 49/66 (74%), Gaps = 0/66 (0%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCG  228
               || |||| ||| || ||||||||||||   || |||||| | |||| |||    ||||||
Sbjct  447192  CGCGATAACGCGTCGGCCACAACATTCAACCTTCCGGGTTTGTACTACACCCGGAAGTCG  447133

Query  229     AACTCC  234
                | |||
Sbjct  447132  TATTCC  447127

>PHRA:scaffold_4
Length=963095

 Score = 42.8 bits (46),  Expect = 0.036
 Identities = 54/75 (72%), Gaps = 6/75 (8%)
 Strand=Plus/Plus

Query  123     CCGTCTTCTCCCAACTGCTGCTAATACCGAAGCCGCAACAGGCGCTCGAGATAGCGCATC  182
               ||||||||| || || ||||||| ||| |  || |      | ||||| || || |||||
Sbjct  177731  CCGTCTTCTACCCACCGCTGCTAGTACGGCTGCTG------GGGCTCGTGACAGGGCATC  177784

Query  183     CGCCACAACATTCGT  197
               |||||| || || ||
Sbjct  177785  CGCCACTACGTTAGT  177799

>PHCA:scaffold_40 PHYCAscaffold_40
Length=570383

 Score = 42.8 bits (46),  Expect = 0.036
 Identities = 44/58 (76%), Gaps = 0/58 (0%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
               || ||||||||||| ||||| |||||    | ||| ||  |||||| ||| || ||||
Sbjct  148025  CGCGATAGCGCATCAGCCACTACATTAAGCCGACCCGGCTTATACTTCACCTCGAAGT  147968

>PHCA:scaffold_21 PHYCAscaffold_21
Length=930814

 Score = 42.8 bits (46),  Expect = 0.036
 Identities = 44/58 (76%), Gaps = 0/58 (0%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
               || ||||||||||| ||||| || |||   |  || || ||||||| ||| || ||||
Sbjct  587147  CGCGATAGCGCATCGGCCACTACGTTCAGCCGTCCCGGCCTATACTTCACCTCGAAGT  587090

 Score = 36.5 bits (39),  Expect = 5.3
 Identities = 46/60 (77%), Gaps = 4/60 (7%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTAC--TACCGGGTCTATACTGCACGTCAAAGT  226
               || ||||||||||| ||||| || || | ||  | |||| | |||||| ||| || ||||
Sbjct  806804  CGTGATAGCGCATCGGCCACTACGTT-GAACCGTCCCGGCT-TATACTTCACCTCGAAGT  806747

>HYAP:scaffold_33 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_33:1:475050:1 
REF
Length=475050

 Score = 42.8 bits (46),  Expect = 0.036
 Identities = 44/58 (76%), Gaps = 0/58 (0%)
 Strand=Plus/Plus

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
              || ||||||||||| |||| ||||||   | |||| ||  |||||| |||  | ||||
Sbjct  55708  CGCGATAGCGCATCAGCCAAAACATTTTGATTACCTGGATTATACTTCACTCCGAAGT  55765

>PHPA:scaffold_5 NW_008648991.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.5, whole genome shotgun 
sequence
Length=2147012

 Score = 41.9 bits (45),  Expect = 0.13
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  163     GGCGCTCGAGATAGCGCATCCGCCACAACATTCGT  197
               || ||||| ||||  || |||||||||||||||||
Sbjct  940644  GGAGCTCGCGATAAGGCGTCCGCCACAACATTCGT  940678

>PHIF:NW_003303604.1 Phytophthora infestans T30-4 supercont1.155 
genomic scaffold, whole genome shotgun sequence
Length=183779

 Score = 41.9 bits (45),  Expect = 0.13
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACC  203
               ||||| |||||||| ||||||||||| |  |||||
Sbjct  111489  CGAGAAAGCGCATCTGCCACAACATTGGAGCTACC  111455

>PHIF:NW_003303546.1 Phytophthora infestans T30-4 supercont1.213 
genomic scaffold, whole genome shotgun sequence
Length=161560

 Score = 41.9 bits (45),  Expect = 0.13
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACC  203
               ||||| |||||||| ||||||||||| |  |||||
Sbjct  105805  CGAGAAAGCGCATCTGCCACAACATTTGAGCTACC  105771

>PHCA:scaffold_10 PHYCAscaffold_10
Length=1190366

 Score = 41.9 bits (45),  Expect = 0.13
 Identities = 48/65 (74%), Gaps = 0/65 (0%)
 Strand=Plus/Plus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCG  228
               || ||||||||||| ||||| |||||    |  || ||  |||||| ||| || |||| |
Sbjct  200205  CGCGATAGCGCATCAGCCACTACATTAAGCCGTCCCGGCTTATACTTCACCTCGAAGTTG  200264

Query  229     AACTC  233
                ||||
Sbjct  200265  TACTC  200269

>HYAP:scaffold_6 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_6:1:1098821:1 
REF
Length=1098821

 Score = 41.9 bits (45),  Expect = 0.13
 Identities = 42/55 (76%), Gaps = 0/55 (0%)
 Strand=Plus/Minus

Query  172     GATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
               ||||||||||| |||| | ||||   | | || ||  |||||| ||| |||||||
Sbjct  763271  GATAGCGCATCAGCCAAAGCATTTTGATTTCCTGGCTTATACTTCACTTCAAAGT  763217

>PHIF:NW_003303693.1 Phytophthora infestans T30-4 supercont1.66 
genomic scaffold, whole genome shotgun sequence
Length=708120

 Score = 40.1 bits (43),  Expect = 0.44
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  155   CCGCAACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTC  208
             ||||  | || || ||||| || ||||||||||| || |||||  | || ||||
Sbjct  1803  CCGCCGCTGGAGCCCGAGAGAGGGCATCCGCCACTACGTTCGTCGTGCCAGGTC  1750

>PHIF:NW_003303634.1 Phytophthora infestans T30-4 supercont1.125 
genomic scaffold, whole genome shotgun sequence
Length=238279

 Score = 40.1 bits (43),  Expect = 0.44
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  155    CCGCAACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTC  208
              ||||  | || || ||||| || ||||||||||| || |||||  | || ||||
Sbjct  34479  CCGCCGCTGGAGCCCGAGAGAGGGCATCCGCCACTACGTTCGTCGTGCCAGGTC  34426

>PHIF:NW_003303418.1 Phytophthora infestans T30-4 supercont1.341 
genomic scaffold, whole genome shotgun sequence
Length=44586

 Score = 40.1 bits (43),  Expect = 0.44
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  155    CCGCAACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTC  208
              ||||  | || || ||||| || ||||||||||| || |||||  | || ||||
Sbjct  29743  CCGCCGCTGGAGCCCGAGAGAGGGCATCCGCCACTACGTTCGTCGTGCCAGGTC  29690

>PLHA:NW_020187031.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_110, whole genome shotgun sequence
Length=2288132

 Score = 39.2 bits (42),  Expect = 0.44
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  174     TAGCGCATCCGCCACAACATT  194
               |||||||||||||||||||||
Sbjct  279986  TAGCGCATCCGCCACAACATT  280006

>PHSO:scaffold_2
Length=11587142

 Score = 39.2 bits (42),  Expect = 0.44
 Identities = 36/46 (78%), Gaps = 0/46 (0%)
 Strand=Plus/Minus

Query  169       CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACT  214
                 ||||||||||| || ||||| |||||    || |||||| | ||||
Sbjct  11062940  CGAGATAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACT  11062895

>PHRA:scaffold_31
Length=507260

 Score = 39.2 bits (42),  Expect = 0.44
 Identities = 56/79 (71%), Gaps = 4/79 (5%)
 Strand=Plus/Minus

Query  163     GGCGCTCGAGATAGCGCAT----CCGCCACAACATTCGTACTACCGGGTCTATACTGCAC  218
               ||||  || ||||||||||    | ||||| ||||| || || || |||| |||    | 
Sbjct  157205  GGCGAACGCGATAGCGCATCTGCCTGCCACTACATTTGTTCTGCCTGGTCCATAAACAAT  157146

Query  219     GTCAAAGTCGAACTCCTGA  237
                || || ||| ||||||||
Sbjct  157145  TTCGAACTCGTACTCCTGA  157127

>PHPA:scaffold_138 NW_008649124.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.138, whole genome 
shotgun sequence
Length=64966

 Score = 39.2 bits (42),  Expect = 0.44
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  169    CGAGATAGCGCATCCGCCACAACATT  194
              ||||| ||||| ||||||||||||||
Sbjct  43105  CGAGAAAGCGCGTCCGCCACAACATT  43130

>PHPA:scaffold_21 NW_008649007.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.21, whole genome shotgun 
sequence
Length=1058518

 Score = 39.2 bits (42),  Expect = 0.44
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  169     CGAGATAGCGCATCCGCCACAACATT  194
               ||||| ||||| ||||||||||||||
Sbjct  218535  CGAGAAAGCGCGTCCGCCACAACATT  218560

>PHIF:NW_003303756.1 Phytophthora infestans T30-4 supercont1.3 
genomic scaffold, whole genome shotgun sequence
Length=5458067

 Score = 39.2 bits (42),  Expect = 0.44
 Identities = 33/41 (80%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  196      GTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTG  236
                ||||||||||| |  || || |||||||| ||||| || ||
Sbjct  5126435  GTACTACCGGGCCCGTATTGAACGTCAAATTCGAATTCTTG  5126475

 Score = 39.2 bits (42),  Expect = 0.44
 Identities = 33/41 (80%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  196      GTACTACCGGGTCTATACTGCACGTCAAAGTCGAACTCCTG  236
                ||||||||||| |  || || |||||||| ||||| || ||
Sbjct  5130381  GTACTACCGGGCCCGTATTGAACGTCAAATTCGAATTCTTG  5130421

>PHIF:NW_003303657.1 Phytophthora infestans T30-4 supercont1.102 
genomic scaffold, whole genome shotgun sequence
Length=373391

 Score = 39.2 bits (42),  Expect = 0.44
 Identities = 36/46 (78%), Gaps = 0/46 (0%)
 Strand=Plus/Minus

Query  163     GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTC  208
               || || ||||| || ||||||||||| || |||||  | || ||||
Sbjct  232767  GGAGCCCGAGAGAGGGCATCCGCCACTACGTTCGTCGTGCCAGGTC  232722

>PHCA:scaffold_85 PHYCAscaffold_85
Length=206069

 Score = 39.2 bits (42),  Expect = 0.44
 Identities = 53/73 (73%), Gaps = 1/73 (1%)
 Strand=Plus/Plus

Query  163   GGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCA  222
             || || || ||||  ||||||||||| || |||||    || || |||||||  |   ||
Sbjct  3004  GGAGCCCGCGATAAGGCATCCGCCACCACGTTCGTTGATCCAGG-CTATACTCAATTCCA  3062

Query  223   AAGTCGAACTCCT  235
             || ||| ||||||
Sbjct  3063  AATTCGTACTCCT  3075

>HYAP:scaffold_43 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_43:1:434001:1 
REF
Length=434001

 Score = 39.2 bits (42),  Expect = 0.44
 Identities = 48/66 (73%), Gaps = 0/66 (0%)
 Strand=Plus/Minus

Query  161     CAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGT  220
               |||||  ||| || |||||||| ||||    |||    || |  ||| |||||| |||||
Sbjct  225591  CAGGCAGTCGTGAGAGCGCATCAGCCAACGTATTTTGCCTCCTCGGTTTATACTTCACGT  225532

Query  221     CAAAGT  226
               ||||||
Sbjct  225531  CAAAGT  225526

>SAPA:scaffold_24 supercont2.24 dna:supercontig supercontig:ASM15154v2:supercont2.24:1:471063:1 
REF
Length=471063

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  86     CGTCGACCGTCGTTGTCCTCGCC  108
              |||||||||||| ||||||||||
Sbjct  11568  CGTCGACCGTCGATGTCCTCGCC  11590

>PYIW:scaffold_991 piw_scaffold_991 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_991:1:12026:1 
REF
Length=12026

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  117   TGCCCGCCGTCTTCTCCCAACTGCTGCT  144
             || ||||||||||||| | |||||||||
Sbjct  6693  TGGCCGCCGTCTTCTCACCACTGCTGCT  6720

>PHPA:scaffold_43 NW_008649029.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.43, whole genome shotgun 
sequence
Length=596611

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  168    TCGAGATAGCGCATCCGCCACAACATTC  195
              || ||||||||||||||| || ||||||
Sbjct  34168  TCTAGATAGCGCATCCGCTACCACATTC  34141

>PHPA:scaffold_3 NW_008648989.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.3, whole genome shotgun 
sequence
Length=2979218

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  168      TCGAGATAGCGCATCCGCCACAACATTC  195
                || ||||||||||||||| || ||||||
Sbjct  1398076  TCTAGATAGCGCATCCGCTACCACATTC  1398049

 Score = 35.6 bits (38),  Expect = 5.3
 Identities = 24/26 (92%), Gaps = 1/26 (4%)
 Strand=Plus/Minus

Query  29       TTGCTGGTG-CCACTGCGGTCTCCAC  53
                ||||| ||| ||||||||||||||||
Sbjct  2102322  TTGCTAGTGGCCACTGCGGTCTCCAC  2102297

>PHIF:NW_003303724.1 Phytophthora infestans T30-4 supercont1.35 
genomic scaffold, whole genome shotgun sequence
Length=1599985

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 34/43 (79%), Gaps = 0/43 (0%)
 Strand=Plus/Plus

Query  190     ACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCGAACT  232
               ||||||||||| || || | |||  ||||||| || || ||||
Sbjct  908601  ACATTCGTACTGCCAGGGCGATATAGCACGTCGAACTCAAACT  908643

>PHCA:scaffold_104 PHYCAscaffold_104
Length=135144

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Minus

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
              || ||||||||||| ||||| |||||    |  || ||  |||||| ||| || ||||
Sbjct  31279  CGCGATAGCGCATCGGCCACTACATTAAGCCGGCCCGGCTTATACTTCACCTCGAAGT  31222

>PHCA:scaffold_75 PHYCAscaffold_75
Length=288075

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Plus

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
              || ||||||||||| ||||| |||||    |  || ||  |||||| ||| || ||||
Sbjct  74796  CGCGATAGCGCATCGGCCACTACATTTAGCCGTCCCGGCTTATACTTCACCTCGAAGT  74853

>PHCA:scaffold_41 PHYCAscaffold_41
Length=565801

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Plus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
               || ||||||||||| ||||| |||||    |  || ||  |||||| ||| || ||||
Sbjct  153189  CGCGATAGCGCATCGGCCACTACATTATGCCGGCCCGGCTTATACTTCACCTCGAAGT  153246

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Plus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
               || ||||||||||| ||||| |||||    |  || ||  |||||| ||| || ||||
Sbjct  449186  CGCGATAGCGCATCGGCCACTACATTAAGCCGGCCCGGCTTATACTTCACCTCGAAGT  449243

>PHCA:scaffold_35 PHYCAscaffold_35
Length=603175

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
               || ||||||||||| ||||| |||||    |  || ||  |||||| ||| || ||||
Sbjct  400434  CGCGATAGCGCATCGGCCACTACATTAAGCCGGCCCGGCTTATACTTCACCTCGAAGT  400377

>HYAP:scaffold_267 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_267:1:50347:1 
REF
Length=50347

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Minus

Query  169   CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
             || ||||||||||| |||| | ||||     | || ||  |||||| ||| |||||||
Sbjct  6857  CGCGATAGCGCATCAGCCAAATCATTTTGCTTTCCTGGCTTATACTTCACTTCAAAGT  6800

>HYAP:scaffold_265 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_265:1:52242:1 
REF
Length=52242

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Minus

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
              || ||||||||||| |||| ||||||     | || ||  |||||| ||| || ||||
Sbjct  48147  CGCGATAGCGCATCAGCCAAAACATTTTGCTTTCCTGGCTTATACTTCACTTCGAAGT  48090

>HYAP:scaffold_227 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_227:1:82265:1 
REF
Length=82265

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Plus

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
              || ||||||||||| |||| | ||||     | || ||  |||||| ||| |||||||
Sbjct  14765  CGCGATAGCGCATCAGCCAAAGCATTTTGCTTTCCTGGCTTATACTTCACTTCAAAGT  14822

>HYAP:scaffold_208 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_208:1:99469:1 
REF
Length=99469

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Plus

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
              || ||||||||||| |||| | ||||     | || ||  |||||| |||||| ||||
Sbjct  53819  CGCGATAGCGCATCAGCCAAAGCATTTTGCTTTCCTGGCTTATACTTCACGTCGAAGT  53876

>HYAP:scaffold_184 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_184:1:123007:1 
REF
Length=123007

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
               || ||||||||||| |||| | |||||    | || ||  |||||| ||| || ||||
Sbjct  100884  CGCGATAGCGCATCAGCCAAAGCATTCTGCTTTCCTGGCTTATACTTCACTTCGAAGT  100827

>HYAP:scaffold_124 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_124:1:208173:1 
REF
Length=208173

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Plus

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
              || ||||||||||| |||| | ||||     | || ||  |||||| ||| |||||||
Sbjct  95917  CGCGATAGCGCATCAGCCAAAGCATTTTGCTTTCCTGGCTTATACTTCACCTCAAAGT  95974

>HYAP:scaffold_115 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_115:1:221855:1 
REF
Length=221855

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Plus

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
              || ||||||||||| |||| | ||||     | || ||  |||||| ||| |||||||
Sbjct  36600  CGCGATAGCGCATCAGCCAAATCATTTTGCTTTCCTGGCTTATACTTCACTTCAAAGT  36657

>HYAP:scaffold_91 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_91:1:274680:1 
REF
Length=274680

 Score = 38.3 bits (41),  Expect = 1.5
 Identities = 43/58 (74%), Gaps = 0/58 (0%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
               || ||||||||||| |||| | ||||     | || ||  |||||| ||| |||||||
Sbjct  146528  CGCGATAGCGCATCAGCCAAAGCATTTTGCTTTCCTGGCTTATACTTCACTTCAAAGT  146471

>SAPA:scaffold_18 supercont2.18 dna:supercontig supercontig:ASM15154v2:supercont2.18:1:504189:1 
REF
Length=504189

 Score = 37.4 bits (40),  Expect = 1.5
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  16     CGTTCTTGCTCGTTTGCTGGTGCCACTGCG  45
              || |||||||||||||||| | | ||||||
Sbjct  61475  CGATCTTGCTCGTTTGCTGCTACGACTGCG  61446

>PLHA:NW_020187350.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_430, whole genome shotgun sequence
Length=1405462

 Score = 37.4 bits (40),  Expect = 1.5
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  174      TAGCGCATCCGCCACAACAT  193
                ||||||||||||||||||||
Sbjct  1244384  TAGCGCATCCGCCACAACAT  1244365

>PHSO:scaffold_1
Length=13391543

 Score = 37.4 bits (40),  Expect = 1.5
 Identities = 28/32 (88%), Gaps = 1/32 (3%)
 Strand=Plus/Plus

Query  20        CTTGCTCGTT-TGCTGGTGCCACTGCGGTCTC  50
                 |||||||||  ||| | |||||||||||||||
Sbjct  12205776  CTTGCTCGTGCTGCAGTTGCCACTGCGGTCTC  12205807

>PHRA:scaffold_658
Length=9219

 Score = 37.4 bits (40),  Expect = 1.5
 Identities = 50/70 (71%), Gaps = 0/70 (0%)
 Strand=Plus/Plus

Query  167  CTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
            |||| || |  ||||||||||||   ||    ||||| || || ||||| |  ||||| |
Sbjct  477  CTCGCGACAAGGCATCCGCCACATAGTTTTCTCTACCAGGCCTGTACTGGATATCAAAAT  536

Query  227  CGAACTCCTG  236
            || |||| ||
Sbjct  537  CGTACTCTTG  546

>PHRA:scaffold_290
Length=21303

 Score = 37.4 bits (40),  Expect = 1.5
 Identities = 50/70 (71%), Gaps = 0/70 (0%)
 Strand=Plus/Minus

Query  167    CTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
              |||| || |  ||||||||||||   ||    ||||| || || ||||| |  ||||| |
Sbjct  13648  CTCGCGACAAGGCATCCGCCACATAGTTTTCTCTACCAGGCCTGTACTGGATATCAAAAT  13589

Query  227    CGAACTCCTG  236
              || |||| ||
Sbjct  13588  CGTACTCTTG  13579

>PHKE:scaffold_36 scf_22126_36.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_36.1:1:159174:1 
REF
Length=159174

 Score = 37.4 bits (40),  Expect = 1.5
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  60     CCCCGAATCTCGTGCCGCTC  79
              ||||||||||||||||||||
Sbjct  85594  CCCCGAATCTCGTGCCGCTC  85575

>PHIF:NW_003303685.1 Phytophthora infestans T30-4 supercont1.74 
genomic scaffold, whole genome shotgun sequence
Length=532832

 Score = 37.4 bits (40),  Expect = 1.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  170     GAGATAGCGCATCCGCCACAACATT  194
               |||| |||||||| |||||||||||
Sbjct  136143  GAGAAAGCGCATCTGCCACAACATT  136119

>PHCA:scaffold_3 PHYCAscaffold_3
Length=1611504

 Score = 37.4 bits (40),  Expect = 1.5
 Identities = 47/65 (72%), Gaps = 0/65 (0%)
 Strand=Plus/Plus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCG  228
               || ||||||||||| ||||| || ||    |  || ||  |||||| ||| || |||| |
Sbjct  779312  CGCGATAGCGCATCGGCCACTACGTTAAGCCGGCCCGGCTTATACTTCACCTCGAAGTTG  779371

Query  229     AACTC  233
                ||||
Sbjct  779372  TACTC  779376

 Score = 37.4 bits (40),  Expect = 1.5
 Identities = 47/65 (72%), Gaps = 0/65 (0%)
 Strand=Plus/Plus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCG  228
               || ||||||||||| ||||| || ||    |  || ||  |||||| ||| || |||| |
Sbjct  801215  CGCGATAGCGCATCGGCCACTACGTTAAGCCGGCCCGGCTTATACTTCACCTCGAAGTTG  801274

Query  229     AACTC  233
                ||||
Sbjct  801275  TACTC  801279

>HYAP:scaffold_131 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_131:1:197808:1 
REF
Length=197808

 Score = 37.4 bits (40),  Expect = 1.5
 Identities = 45/59 (76%), Gaps = 2/59 (3%)
 Strand=Plus/Minus

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTAC-TACCGGGTCTATACTGCACGTCAAAGT  226
              ||||||||||| || |||| | ||||  ||| | || ||  |||||| ||| || ||||
Sbjct  32713  CGAGATAGCGCGTCAGCCAAAGCATT-TTACTTTCCTGGCTTATACTTCACTTCGAAGT  32656

>SADI:scaffold_25 supercont1.25 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.25:1:683613:1 
REF
Length=683613

 Score = 36.5 bits (39),  Expect = 5.3
 Identities = 21/22 (95%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  71      GTGCCGCTCGCGCATCGTCGAC  92
               ||||||||||||||||| ||||
Sbjct  268831  GTGCCGCTCGCGCATCGCCGAC  268852

>PLHA:NW_020189293.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2386, whole genome shotgun sequence
Length=2296535

 Score = 36.5 bits (39),  Expect = 5.3
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  169      CGAGATAGCGCATCCGCCACAACATTC  195
                || |||| ||||||||||| |||||||
Sbjct  1968650  CGTGATATCGCATCCGCCAAAACATTC  1968676

>PHIF:NW_003303677.1 Phytophthora infestans T30-4 supercont1.82 
genomic scaffold, whole genome shotgun sequence
Length=575233

 Score = 36.5 bits (39),  Expect = 5.3
 Identities = 44/59 (75%), Gaps = 1/59 (2%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATTCGTACTA-CCGGGTCTATACTGCACGTCAAAGT  226
               || || | |||||| |||||||||||    | | || ||  |||||| ||| |||||||
Sbjct  356188  CGCGAGAACGCATCAGCCACAACATTTAAGCGACCCCGGCTTATACTTCACCTCAAAGT  356130

 Score = 35.6 bits (38),  Expect = 5.3
 Identities = 46/61 (75%), Gaps = 6/61 (10%)
 Strand=Plus/Minus

Query  169     CGAGATAGCGCATCCGCCACAACATT---CGTACTACCGGGTCTATACTGCACGTCAAAG  225
               || || | |||||| |||||||||||   || ||  || ||  |||||| ||| ||||||
Sbjct  342929  CGCGAGAACGCATCAGCCACAACATTAAGCG-AC--CCCGGCTTATACTTCACCTCAAAG  342873

Query  226     T  226
               |
Sbjct  342872  T  342872

>PHCA:scaffold_38 PHYCAscaffold_38
Length=550336

 Score = 36.5 bits (39),  Expect = 5.3
 Identities = 54/77 (70%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  160    ACAGGCGCTCGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACG  219
              || || || || || ||||| || |||||||||||  |  | || ||||  ||    || 
Sbjct  20966  ACCGGAGCACGTGACAGCGCGTCTGCCACAACATTGCTTTTCCCCGGTCGGTAGACAACC  20907

Query  220    TCAAAGTCGAACTCCTG  236
              || |||||  |||||||
Sbjct  20906  TCGAAGTCATACTCCTG  20890

>HYAP:scaffold_24 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_24:1:592158:1 
REF
Length=592158

 Score = 36.5 bits (39),  Expect = 5.3
 Identities = 42/57 (74%), Gaps = 0/57 (0%)
 Strand=Plus/Plus

Query  170     GAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGT  226
               |||| ||||||||||| |  || ||| || | || | | || ||| ||| || ||||
Sbjct  236117  GAGACAGCGCATCCGCTAGCACTTTCTTATTGCCTGATTTACACTTCACCTCGAAGT  236173

>APIN:scaffold_41 supercont1.41 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.41:1:635509:1 
REF
Length=635509

 Score = 36.5 bits (39),  Expect = 5.3
 Identities = 21/22 (95%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  97      GTTGTCCTCGCCCGAAGTCGTG  118
               |||||||||| |||||||||||
Sbjct  138475  GTTGTCCTCGGCCGAAGTCGTG  138454

>SAPA:scaffold_9 supercont2.9 dna:supercontig supercontig:ASM15154v2:supercont2.9:1:812807:1 
REF
Length=812807

 Score = 35.6 bits (38),  Expect = 5.3
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  85      TCGTCGACCGTCGTTGTCCTCGCC  108
               |||||| ||||| |||||||||||
Sbjct  542828  TCGTCGGCCGTCTTTGTCCTCGCC  542805

>SAPA:scaffold_5 supercont2.5 dna:supercontig supercontig:ASM15154v2:supercont2.5:1:1129684:1 
REF
Length=1129684

 Score = 35.6 bits (38),  Expect = 5.3
 Identities = 24/26 (92%), Gaps = 1/26 (4%)
 Strand=Plus/Plus

Query  3       GTGCACTTGCCCACGTTCTTGCTCGT  28
               ||||||||||||||||| ||||| ||
Sbjct  189968  GTGCACTTGCCCACGTT-TTGCTTGT  189992

>PYVX:scaffold_14 pve_scaffold_14 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_14:1:104156:1 
REF
Length=104156

 Score = 35.6 bits (38),  Expect = 5.3
 Identities = 25/29 (86%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  55     GGCGACCCCGAATCTCGTGCCGCTCGCGC  83
              |||| |||||   ||||||||||||||||
Sbjct  72596  GGCGTCCCCGCCGCTCGTGCCGCTCGCGC  72624

>PYIW:scaffold_3078 piw_scaffold_3078 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_3078:1:3696:1 
REF
Length=3696

 Score = 35.6 bits (38),  Expect = 5.3
 Identities = 28/34 (82%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  24    CTCGTTTGCTGGTGCCACTGCGGTCTCCACTGGC  57
             |||| | |||| || |  ||||||||||||||||
Sbjct  1400  CTCGATCGCTGCTGGCTTTGCGGTCTCCACTGGC  1433

>PYAR:scaffold_762 par_scaffold_762 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_762:1:13539:1 
REF
Length=13539

 Score = 35.6 bits (38),  Expect = 5.3
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  2     TGTGCACTTGCCCACGTTCTTGCT  25
             ||||||| ||||||||||||| ||
Sbjct  6860  TGTGCACGTGCCCACGTTCTTTCT  6883

>PLHA:NW_020187532.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_614, whole genome shotgun sequence
Length=3420761

 Score = 35.6 bits (38),  Expect = 5.3
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  175     AGCGCATCCGCCACAACAT  193
               |||||||||||||||||||
Sbjct  922651  AGCGCATCCGCCACAACAT  922633

>PHRA:scaffold_27
Length=538834

 Score = 35.6 bits (38),  Expect = 5.3
 Identities = 30/36 (83%), Gaps = 1/36 (3%)
 Strand=Plus/Plus

Query  92      CCGTCGTTGTCCTCGCCCGAAGTCGTGCCCGCCGTC  127
               ||||||||||  ||| | |  |||||||||||||||
Sbjct  528174  CCGTCGTTGTGGTCGTC-GTCGTCGTGCCCGCCGTC  528208

>HYAP:scaffold_257 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_257:1:58421:1 
REF
Length=58421

 Score = 35.6 bits (38),  Expect = 5.3
 Identities = 48/66 (73%), Gaps = 1/66 (2%)
 Strand=Plus/Minus

Query  169    CGAGATAGCGCATCCGCCACAACATTCGTACTACCGGGTCTATACTGCACGTCAAAGTCG  228
              || || |||||||||||||  |||||| || | ||     |||||| |||  ||||||  
Sbjct  41609  CGGGAGAGCGCATCCGCCAACACATTC-TATTTCCCACCGTATACTTCACACCAAAGTTT  41551

Query  229    AACTCC  234
              || |||
Sbjct  41550  AATTCC  41545

>APIN:scaffold_26 supercont1.26 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.26:1:915853:1 
REF
Length=915853

 Score = 35.6 bits (38),  Expect = 5.3
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  69      TCGTGCCGCTCGCGCATCGTCGAC  92
               ||||||||||||| || |||||||
Sbjct  821871  TCGTGCCGCTCGCACACCGTCGAC  821848

>ALCA:scaffold_131 AcNc2_CONTIG_131_length_62772 dna:supercontig 
supercontig:ASM107853v1:AcNc2_CONTIG_131_length_62772:1:62772:1 
REF
Length=62772

 Score = 35.6 bits (38),  Expect = 5.3
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  16   CGTTCTTGCTCGTTTGCTG  34
            |||||||||||||||||||
Sbjct  833  CGTTCTTGCTCGTTTGCTG  815

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 268195822758

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2