Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
APAS:scaffold_127066967071654705382e-135
APIN:scaffold_204011704012981291481e-29
SAPA:scaffold_2439369839378993696e-08
SADI:scaffold_420546020552263619e-06
PYUU:scaffold_20371306968130704477593e-05
PYIW:scaffold_963103381039255500.005
PYIR:scaffold_810273610279560500.005
PHSO:scaffold_42976833297686433420.72
PHRA:scaffold_5615168315170826420.72
SAPA:scaffold_1022251222254030412.5
SADI:scaffold_2958993658996430412.5
PYVX:scaffold_268245842460623412.5
PYUU:scaffold_203024924324928139412.5
PYAR:scaffold_8146618665033412.5
PHIF:NW_003303749.180190780192923412.5
PHCA:scaffold_51404860140489738412.5
PYVX:scaffold_319277502776920402.5
PYAP:scaffold_5731766179025402.5
PHSO:scaffold_12799163279924584402.5
PHRA:scaffold_21029511925402.5
PHRA:scaffold_20692876931125402.5
PHKE:scaffold_113456524567625402.5
SAPA:scaffold_64312323125827398.8
PYVX:scaffold_15313113133829398.8
PYIW:scaffold_18831221124222398.8
PYIW:scaffold_15542621266141398.8
PYAR:scaffold_28002914294634398.8
PHSO:scaffold_32817663281769029398.8
PHRA:scaffold_8117966517969229398.8
PHCA:scaffold_35997839980927398.8
SAPA:scaffold_67316593167719388.8
SAPA:scaffold_6441894421224388.8
SADI:scaffold_82145361455924388.8
SADI:scaffold_7021446221448019388.8
SADI:scaffold_1812150312152119388.8
PYVX:scaffold_201131161313924388.8
PYIW:scaffold_25212649266719388.8
PYIW:scaffold_20534830485829388.8
PYIW:scaffold_5917746777126388.8
PYIR:scaffold_7836040606324388.8
PYAR:scaffold_11063102312726388.8
PHRA:scaffold_73219723238388.8
BLASTN 2.12.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= H257_06293

Length=372
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

APAS:scaffold_12 supercont1.12 dna:supercontig supercontig:Apha_a...  486     2e-135
APIN:scaffold_20 supercont1.20 dna:supercontig supercontig:Apha_i...  134     1e-29 
SAPA:scaffold_24 supercont2.24 dna:supercontig supercontig:ASM151...  63.5    6e-08 
SADI:scaffold_4 supercont1.4 dna:supercontig supercontig:Sap_dicl...  56.3    9e-06 
PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:p...  54.5    3e-05 
PYIW:scaffold_963 piw_scaffold_963 dna:supercontig supercontig:pi...  46.4    0.005 
PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_sc...  46.4    0.005 
PHSO:scaffold_4                                                       39.2    0.72  
PHRA:scaffold_56                                                      39.2    0.72  
SAPA:scaffold_10 supercont2.10 dna:supercontig supercontig:ASM151...  38.3    2.5   
SADI:scaffold_29 supercont1.29 dna:supercontig supercontig:Sap_di...  38.3    2.5   
PYVX:scaffold_268 pve_scaffold_268 dna:supercontig supercontig:pv...  38.3    2.5   
PYUU:scaffold_2030 scf1117875582030 dna:supercontig supercontig:p...  38.3    2.5   
PYAR:scaffold_814 par_scaffold_814 dna:supercontig supercontig:pa...  38.3    2.5   
PHIF:NW_003303749.1 Phytophthora infestans T30-4 supercont1.10 ge...  38.3    2.5   
PHCA:scaffold_5 PHYCAscaffold_5                                       38.3    2.5   
PYVX:scaffold_319 pve_scaffold_319 dna:supercontig supercontig:pv...  37.4    2.5   
PYAP:scaffold_573 pag1_scaffold_573 dna:supercontig supercontig:p...  37.4    2.5   
PHSO:scaffold_1                                                       37.4    2.5   
PHRA:scaffold_2102                                                    37.4    2.5   
PHRA:scaffold_20                                                      37.4    2.5   
PHKE:scaffold_113 scf_22126_113.1_contig_1 dna:supercontig superc...  37.4    2.5   
SAPA:scaffold_64 supercont2.64 dna:supercontig supercontig:ASM151...  36.5    8.8   
PYVX:scaffold_15 pve_scaffold_15 dna:supercontig supercontig:pve_...  36.5    8.8   
PYIW:scaffold_1883 piw_scaffold_1883 dna:supercontig supercontig:...  36.5    8.8   
PYIW:scaffold_1554 piw_scaffold_1554 dna:supercontig supercontig:...  36.5    8.8   
PYAR:scaffold_2800 par_scaffold_2800 dna:supercontig supercontig:...  36.5    8.8   
PHSO:scaffold_3                                                       36.5    8.8   
PHRA:scaffold_81                                                      36.5    8.8   
PHCA:scaffold_35 PHYCAscaffold_35                                     36.5    8.8   
SAPA:scaffold_67 supercont2.67 dna:supercontig supercontig:ASM151...  35.6    8.8   
SAPA:scaffold_6 supercont2.6 dna:supercontig supercontig:ASM15154...  35.6    8.8   
SADI:scaffold_82 supercont1.82 dna:supercontig supercontig:Sap_di...  35.6    8.8   
SADI:scaffold_70 supercont1.70 dna:supercontig supercontig:Sap_di...  35.6    8.8   
SADI:scaffold_18 supercont1.18 dna:supercontig supercontig:Sap_di...  35.6    8.8   
PYVX:scaffold_201 pve_scaffold_201 dna:supercontig supercontig:pv...  35.6    8.8   
PYIW:scaffold_2521 piw_scaffold_2521 dna:supercontig supercontig:...  35.6    8.8   
PYIW:scaffold_2053 piw_scaffold_2053 dna:supercontig supercontig:...  35.6    8.8   
PYIW:scaffold_591 piw_scaffold_591 dna:supercontig supercontig:pi...  35.6    8.8   
PYIR:scaffold_783 pir_scaffold_783 dna:supercontig supercontig:pi...  35.6    8.8   
PYAR:scaffold_1106 par_scaffold_1106 dna:supercontig supercontig:...  35.6    8.8   
PHRA:scaffold_732                                                     35.6    8.8   

>APAS:scaffold_12 supercont1.12 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.12:1:1206637:1 
REF
Length=1206637

 Score = 486 bits (538),  Expect = 2e-135
 Identities = 372/470 (79%), Gaps = 98/470 (21%)
 Strand=Plus/Plus

Query  1       ATGGAAAAGTCGGTCCGCACAGCATACAAGAAGCTCATCAAGCTGGCGCAGAGCCTTCCC  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  706696  ATGGAAAAGTCGGTCCGCACAGCATACAAGAAGCTCATCAAGCTGGCGCAGAGCCTTCCC  706755

Query  61      GCCGACCAAAAACCAACAGCGCTGGACAAGATTCGCCACGACTTTCGATCCCGTGGAGTC  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  706756  GCCGACCAAAAACCAACAGCGCTGGACAAGATTCGCCACGACTTTCGATCCCGTGGAGTC  706815

Query  121     ATCTCAACCGCAGAGGAG------------------------------------------  138
               ||||||||||||||||||                                          
Sbjct  706816  ATCTCAACCGCAGAGGAGTAAGTGACATATGGAATCCATCCCACGCGAGGTACACGAATC  706875

Query  139     -------CTGGACAAGCTTGTGATGAAGGCACAGTCAAAGATTAGCTACTTGAAGATTGT  191
                      |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  706876  CTGTAGGCTGGACAAGCTTGTGATGAAGGCACAGTCAAAGATTAGCTACTTGAAGATTGT  706935

Query  192     GACGCCCAAGCGCACGCCAC----------------------------------------  211
               ||||||||||||||||||||                                        
Sbjct  706936  GACGCCCAAGCGCACGCCACGTACGTGGTTCTTGCCTTGTGCATCCATGGTGTTCACGTG  706995

Query  212     ---------AATCTGGTCCCCAGCGCTTCATTTACAAGGACGGCAAACGCCTGGACTCGC  262
                        |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  706996  GATCTATAGAATCTGGTCCCCAGCGCTTCATTTACAAGGACGGCAAACGCCTGGACTCGC  707055

Query  263     AAAGCCTCGACGACGGTGGAAACCGCACGATCAAGACGACCGATGTCAACGCAATGATGG  322
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  707056  AAAGCCTCGACGACGGTGGAAACCGCACGATCAAGACGACCGATGTCAACGCAATGATGG  707115

Query  323     AGCGACACGTCAAGTTGATTCGCCGACAGCACTTTATGGACCGAAAGTAG  372
               ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  707116  AGCGACACGTCAAGTTGATTCGCCGACAGCACTTTATGGACCGAAAGTAG  707165

>APIN:scaffold_20 supercont1.20 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.20:1:1003253:1 
REF
Length=1003253

 Score = 134 bits (148),  Expect = 1e-29
 Identities = 107/129 (83%), Gaps = 0/129 (0%)
 Strand=Plus/Minus

Query  1       ATGGAAAAGTCGGTCCGCACAGCATACAAGAAGCTCATCAAGCTGGCGCAGAGCCTTCCC  60
               |||||||| |||||||| || ||||||||||||||||||||||| |||||||||||||| 
Sbjct  401298  ATGGAAAAATCGGTCCGTACGGCATACAAGAAGCTCATCAAGCTTGCGCAGAGCCTTCCT  401239

Query  61      GCCGACCAAAAACCAACAGCGCTGGACAAGATTCGCCACGACTTTCGATCCCGTGGAGTC  120
               ||||| ||||| ||    |||||||| ||| ||||||| || || || |||| ||| || 
Sbjct  401238  GCCGAGCAAAAGCCCGTGGCGCTGGATAAGGTTCGCCATGAGTTCCGGTCCCATGGCGTT  401179

Query  121     ATCTCAACC  129
               ||| || ||
Sbjct  401178  ATCACATCC  401170

 Score = 100 bits (110),  Expect = 3e-19
 Identities = 115/155 (74%), Gaps = 0/155 (0%)
 Strand=Plus/Minus

Query  218     GTCCCCAGCGCTTCATTTACAAGGACGGCAAACGCCTGGACTCGCAAAGCCTCGACGACG  277
               |||| || || | ||| ||||| ||||| |||||  ||||| |     || ||||  |  
Sbjct  400986  GTCCACAACGATACATCTACAAAGACGGGAAACGATTGGACCCAGGCTGCATCGATCAGA  400927

Query  278     GTGGAAACCGCACGATCAAGACGACCGATGTCAACGCAATGATGGAGCGACACGTCAAGT  337
               ||   |||   || |||||||||  |||  |||| || ||||||||||| || |||||||
Sbjct  400926  GTACCAACGCAACCATCAAGACGGTCGACTTCAATGCCATGATGGAGCGTCATGTCAAGT  400867

Query  338     TGATTCGCCGACAGCACTTTATGGACCGAAAGTAG  372
               || | || |||||||| |||||||| |||||||||
Sbjct  400866  TGGTCCGTCGACAGCATTTTATGGATCGAAAGTAG  400832

>SAPA:scaffold_24 supercont2.24 dna:supercontig supercontig:ASM15154v2:supercont2.24:1:471063:1 
REF
Length=471063

 Score = 63.5 bits (69),  Expect = 6e-08
 Identities = 72/93 (77%), Gaps = 3/93 (3%)
 Strand=Plus/Plus

Query  280     GGAAACCGC-ACGATCAAGACGACCGATGTCAACGCAATGATGGAGCGA-CACGTCAAGT  337
               ||| | ||| |||||||||||| ||||   ||| || ||||| || | | |||||  || 
Sbjct  393698  GGACAGCGCGACGATCAAGACGGCCGACTACAATGCGATGAT-GACCAAGCACGTGCAGC  393756

Query  338     TGATTCGCCGACAGCACTTTATGGACCGAAAGT  370
               |  | || |||||||||||||||||||| ||||
Sbjct  393757  TCGTGCGGCGACAGCACTTTATGGACCGCAAGT  393789

 Score = 55.4 bits (60),  Expect = 9e-06
 Identities = 39/45 (87%), Gaps = 0/45 (0%)
 Strand=Plus/Plus

Query  157     AAGGCACAGTCAAAGATTAGCTACTTGAAGATTGTGACGCCCAAG  201
               ||||| ||||| |||||||||||| | ||||| |||||||| |||
Sbjct  393530  AAGGCGCAGTCCAAGATTAGCTACCTCAAGATCGTGACGCCTAAG  393574

 Score = 45.5 bits (49),  Expect = 0.017
 Identities = 38/47 (81%), Gaps = 0/47 (0%)
 Strand=Plus/Plus

Query  1       ATGGAAAAGTCGGTCCGCACAGCATACAAGAAGCTCATCAAGCTGGC  47
               ||||| | | || ||||| | || |||||||||||| | ||||||||
Sbjct  393327  ATGGACACGACGATCCGCGCTGCCTACAAGAAGCTCCTAAAGCTGGC  393373

>SADI:scaffold_4 supercont1.4 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.4:1:1391842:1 
REF
Length=1391842

 Score = 56.3 bits (61),  Expect = 9e-06
 Identities = 50/63 (79%), Gaps = 0/63 (0%)
 Strand=Plus/Minus

Query  139     CTGGACAAGCTTGTGATGAAGGCACAGTCAAAGATTAGCTACTTGAAGATTGTGACGCCC  198
               |||||| ||||  |    ||||| ||||| ||||| |||||| | ||||| |||||||||
Sbjct  205522  CTGGACCAGCTCCTCCGCAAGGCGCAGTCCAAGATCAGCTACCTCAAGATCGTGACGCCC  205463

Query  199     AAG  201
               |||
Sbjct  205462  AAG  205460

 Score = 55.4 bits (60),  Expect = 9e-06
 Identities = 64/84 (76%), Gaps = 2/84 (2%)
 Strand=Plus/Minus

Query  289     ACGATCAAGACGACCGATGTCAACGCAATGATGGAGCGA-CACGTCAAGTTGATTCGCCG  347
               || |||||||||  |||   ||| || |||||| | | | |||||  || |  | || ||
Sbjct  205327  ACCATCAAGACGCACGACTACAATGCGATGATG-ACCAAGCACGTGCAGCTCGTGCGGCG  205269

Query  348     ACAGCACTTTATGGACCGAAAGTA  371
               |||||||||||||||||| |||||
Sbjct  205268  ACAGCACTTTATGGACCGCAAGTA  205245

 Score = 45.5 bits (49),  Expect = 0.017
 Identities = 32/37 (86%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  11      CGGTCCGCACAGCATACAAGAAGCTCATCAAGCTGGC  47
               || ||||| | || |||||||||||| ||||||||||
Sbjct  205692  CGATCCGCGCTGCCTACAAGAAGCTCCTCAAGCTGGC  205656

>PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:pug:scf1117875582037:1:1414051:1 
REF
Length=1414051

 Score = 54.5 bits (59),  Expect = 3e-05
 Identities = 58/77 (75%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  294      CAAGACGACCGATGTCAACGCAATGATGGAGCGACACGTCAAGTTGATTCGCCGACAGCA  353
                ||| ||| ||||   ||| ||   |||| |||| |||||  ||||| | || || |||||
Sbjct  1306968  CAAAACGGCCGACTACAATGCGCAGATGCAGCGCCACGTGCAGTTGCTGCGTCGTCAGCA  1307027

Query  354      CTTTATGGACCGAAAGT  370
                ||||||||| || ||||
Sbjct  1307028  CTTTATGGATCGTAAGT  1307044

 Score = 36.5 bits (39),  Expect = 8.8
 Identities = 33/42 (79%), Gaps = 0/42 (0%)
 Strand=Plus/Plus

Query  25       TACAAGAAGCTCATCAAGCTGGCGCAGAGCCTTCCCGCCGAC  66
                |||||||||||  ||||||| || ||||  || || || |||
Sbjct  1306515  TACAAGAAGCTGCTCAAGCTCGCTCAGACGCTGCCGGCGGAC  1306556

>PYIW:scaffold_963 piw_scaffold_963 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_963:1:12226:1 
REF
Length=12226

 Score = 46.4 bits (50),  Expect = 0.005
 Identities = 43/55 (78%), Gaps = 0/55 (0%)
 Strand=Plus/Plus

Query  318    GATGGAGCGACACGTCAAGTTGATTCGCCGACAGCACTTTATGGACCGAAAGTAG  372
              ||||  ||| |||   ||| || | || || ||||||||||||||||| ||||||
Sbjct  10338  GATGCTGCGCCACCAGAAGCTGCTGCGTCGCCAGCACTTTATGGACCGCAAGTAG  10392

 Score = 42.8 bits (46),  Expect = 0.059
 Identities = 32/38 (84%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  160    GCACAGTCAAAGATTAGCTACTTGAAGATTGTGACGCC  197
              || |||||   ||| |||||||||||||| ||||||||
Sbjct  10089  GCGCAGTCGTCGATCAGCTACTTGAAGATCGTGACGCC  10126

>PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_8:1:111390:1 
REF
Length=111390

 Score = 46.4 bits (50),  Expect = 0.005
 Identities = 46/60 (77%), Gaps = 0/60 (0%)
 Strand=Plus/Minus

Query  309     CAACGCAATGATGGAGCGACACGTCAAGTTGATTCGCCGACAGCACTTTATGGACCGAAA  368
               ||||||   |||| |||| |||   ||| || | || || ||||||||||||||||| ||
Sbjct  102795  CAACGCGCAGATGCAGCGCCACCAGAAGCTGCTGCGTCGCCAGCACTTTATGGACCGCAA  102736

 Score = 42.8 bits (46),  Expect = 0.059
 Identities = 32/38 (84%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  160     GCACAGTCAAAGATTAGCTACTTGAAGATTGTGACGCC  197
               ||||||||   |||| ||||||||||||| || |||||
Sbjct  103036  GCACAGTCGTCGATTGGCTACTTGAAGATCGTCACGCC  102999

>PHSO:scaffold_4
Length=7609242

 Score = 39.2 bits (42),  Expect = 0.72
 Identities = 29/33 (88%), Gaps = 1/33 (3%)
 Strand=Plus/Minus

Query  27       CAAGAAGCTCATCAAGCTGGCGCAGAGCCTTCC  59
                ||||||| ||||||||||||  ||||| |||||
Sbjct  2976864  CAAGAAGATCATCAAGCTGGGCCAGAG-CTTCC  2976833

>PHRA:scaffold_56
Length=334739

 Score = 39.2 bits (42),  Expect = 0.72
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  173     TTAGCTACTTGAAGATTGTGACGCCC  198
               || ||||||||||||| |||||||||
Sbjct  151708  TTGGCTACTTGAAGATCGTGACGCCC  151683

>SAPA:scaffold_10 supercont2.10 dna:supercontig supercontig:ASM15154v2:supercont2.10:1:790954:1 
REF
Length=790954

 Score = 38.3 bits (41),  Expect = 2.5
 Identities = 27/30 (90%), Gaps = 1/30 (3%)
 Strand=Plus/Minus

Query  58      CCCGCCGACCAAAAACCAACAGCGCTGGAC  87
               ||||||||||||| ||||||| || |||||
Sbjct  222540  CCCGCCGACCAAATACCAACA-CGGTGGAC  222512

>SADI:scaffold_29 supercont1.29 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.29:1:692626:1 
REF
Length=692626

 Score = 38.3 bits (41),  Expect = 2.5
 Identities = 27/30 (90%), Gaps = 1/30 (3%)
 Strand=Plus/Minus

Query  58      CCCGCCGACCAAAAACCAACAGCGCTGGAC  87
               ||||||||||||| ||||||| || |||||
Sbjct  589964  CCCGCCGACCAAATACCAACA-CGGTGGAC  589936

>PYVX:scaffold_268 pve_scaffold_268 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_268:1:32537:1 
REF
Length=32537

 Score = 38.3 bits (41),  Expect = 2.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  27     CAAGAAGCTCATCAAGCTGGCGC  49
              |||||||||| ||||||||||||
Sbjct  24606  CAAGAAGCTCGTCAAGCTGGCGC  24584

>PYUU:scaffold_2030 scf1117875582030 dna:supercontig supercontig:pug:scf1117875582030:1:300584:1 
REF
Length=300584

 Score = 38.3 bits (41),  Expect = 2.5
 Identities = 32/39 (82%), Gaps = 3/39 (8%)
 Strand=Plus/Plus

Query  286     CGCACGATCAAGACGACCGAT---GTCAACGCAATGATG  321
               ||| | |||||||||||||||   ||||||||  |||||
Sbjct  249243  CGCTCAATCAAGACGACCGATGGCGTCAACGCCTTGATG  249281

>PYAR:scaffold_814 par_scaffold_814 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_814:1:12963:1 
REF
Length=12963

 Score = 38.3 bits (41),  Expect = 2.5
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  39    CAAGCTGGCGCAGAGCCTTCCCGCCGACCAAAA  71
             ||| ||||| |||  |||| |||||||||||||
Sbjct  6650  CAACCTGGCTCAGGTCCTTGCCGCCGACCAAAA  6618

>PHIF:NW_003303749.1 Phytophthora infestans T30-4 supercont1.10 
genomic scaffold, whole genome shotgun sequence
Length=3761764

 Score = 38.3 bits (41),  Expect = 2.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  314     CAATGATGGAGCGACACGTCAAG  336
               |||||||||||||||||| ||||
Sbjct  801907  CAATGATGGAGCGACACGACAAG  801929

>PHCA:scaffold_5 PHYCAscaffold_5
Length=1593284

 Score = 38.3 bits (41),  Expect = 2.5
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  303      CGATGTCAACGCAATGATGGAGCGACACGTCAAGTTGA  340
                ||||||||||| | | |||  ||  |||||||||||||
Sbjct  1404860  CGATGTCAACGGAGTCATGTTGCACCACGTCAAGTTGA  1404897

>PYVX:scaffold_319 pve_scaffold_319 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_319:1:30123:1 
REF
Length=30123

 Score = 37.4 bits (40),  Expect = 2.5
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  26     ACAAGAAGCTCATCAAGCTG  45
              ||||||||||||||||||||
Sbjct  27750  ACAAGAAGCTCATCAAGCTG  27769

>PYAP:scaffold_573 pag1_scaffold_573 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_573:1:21082:1 
REF
Length=21082

 Score = 37.4 bits (40),  Expect = 2.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  239   AGGACGGCAAACGCCTGGACTCGCA  263
             ||||| ||| |||||||||||||||
Sbjct  1766  AGGACTGCAGACGCCTGGACTCGCA  1790

>PHSO:scaffold_1
Length=13391543

 Score = 37.4 bits (40),  Expect = 2.5
 Identities = 60/84 (71%), Gaps = 2/84 (2%)
 Strand=Plus/Plus

Query  25       TACAAGAAGCTCATCAAGCTGGCGCAGAGCCTTCCCGCCGACCAAAAACCAACAG-CGCT  83
                |||||||||||  |    ||||||||||||| | |||  | ||||     | ||| ||||
Sbjct  2799163  TACAAGAAGCTGCTGCGCCTGGCGCAGAGCC-TGCCGGAGCCCAAGCGGGAGCAGTCGCT  2799221

Query  84       GGACAAGATTCGCCACGACTTTCG  107
                |||| |||| || | ||| || ||
Sbjct  2799222  GGACCAGATCCGGCGCGAGTTCCG  2799245

 Score = 36.5 bits (39),  Expect = 8.8
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  133       GAGGAGCTGGACAAGCTTGTGATGAAG  159
                 |||||||||||| |||| |||||| ||
Sbjct  12137084  GAGGAGCTGGACGAGCTGGTGATGGAG  12137058

>PHRA:scaffold_2102
Length=3523

 Score = 37.4 bits (40),  Expect = 2.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  135  GGAGCTGGACAAGCTTGTGATGAAG  159
            ||||||||| |||||||||||| ||
Sbjct  95   GGAGCTGGAGAAGCTTGTGATGGAG  119

>PHRA:scaffold_20
Length=586225

 Score = 37.4 bits (40),  Expect = 2.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  135    GGAGCTGGACAAGCTTGTGATGAAG  159
              ||||||||| |||||||||||| ||
Sbjct  69311  GGAGCTGGAGAAGCTTGTGATGGAG  69287

>PHKE:scaffold_113 scf_22126_113.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_113.1_contig_1:1:95012:1 
REF
Length=95012

 Score = 37.4 bits (40),  Expect = 2.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  289    ACGATCAAGACGACCGATGTCAACG  313
              ||||||||||||||||| || ||||
Sbjct  45652  ACGATCAAGACGACCGAGGTGAACG  45676

>SAPA:scaffold_64 supercont2.64 dna:supercontig supercontig:ASM15154v2:supercont2.64:1:208489:1 
REF
Length=208489

 Score = 36.5 bits (39),  Expect = 8.8
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  184    AAGATTGTGACGCCCAAGCGCACGCCA  210
              ||| |||||| ||||||||||||| ||
Sbjct  31232  AAGCTTGTGAAGCCCAAGCGCACGACA  31258

>PYVX:scaffold_15 pve_scaffold_15 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_15:1:101917:1 
REF
Length=101917

 Score = 36.5 bits (39),  Expect = 8.8
 Identities = 26/29 (90%), Gaps = 1/29 (3%)
 Strand=Plus/Minus

Query  11     CGGTCCGCACAGCATACAAGAAGCTCATC  39
              |||||||| |||||  |||||||||||||
Sbjct  31338  CGGTCCGC-CAGCAGGCAAGAAGCTCATC  31311

>PYIW:scaffold_1883 piw_scaffold_1883 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1883:1:6802:1 
REF
Length=6802

 Score = 36.5 bits (39),  Expect = 8.8
 Identities = 21/22 (95%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  256   GACTCGCAAAGCCTCGACGACG  277
             |||||| |||||||||||||||
Sbjct  1221  GACTCGAAAAGCCTCGACGACG  1242

>PYIW:scaffold_1554 piw_scaffold_1554 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1554:1:8257:1 
REF
Length=8257

 Score = 36.5 bits (39),  Expect = 8.8
 Identities = 33/41 (80%), Gaps = 2/41 (5%)
 Strand=Plus/Minus

Query  26    ACAAGAAGCTCATCAAGCTGGCGCAGAGCCT--TCCCGCCG  64
             |||| |||||||||||||||  |||  ||||   |||||||
Sbjct  2661  ACAACAAGCTCATCAAGCTGCTGCACCGCCTCGGCCCGCCG  2621

>PYAR:scaffold_2800 par_scaffold_2800 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_2800:1:4300:1 
REF
Length=4300

 Score = 36.5 bits (39),  Expect = 8.8
 Identities = 29/34 (85%), Gaps = 1/34 (3%)
 Strand=Plus/Plus

Query  71    AACCAACAGCGCTGGACAAGATTCGCCACGACTT  104
             ||||  |||| | ||| |||||||||||||||||
Sbjct  2914  AACCCCCAGC-CAGGAAAAGATTCGCCACGACTT  2946

>PHSO:scaffold_3
Length=10773376

 Score = 36.5 bits (39),  Expect = 8.8
 Identities = 26/29 (90%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  126      AACCGCAGAGGAGCTGGACAAGCTTGTGA  154
                ||| ||| |||||||||||||||| ||||
Sbjct  2817663  AACTGCA-AGGAGCTGGACAAGCTGGTGA  2817690

>PHRA:scaffold_81
Length=216085

 Score = 36.5 bits (39),  Expect = 8.8
 Identities = 26/29 (90%), Gaps = 1/29 (3%)
 Strand=Plus/Minus

Query  126     AACCGCAGAGGAGCTGGACAAGCTTGTGA  154
               ||| ||| |||||||||||||||| ||||
Sbjct  179692  AACTGCA-AGGAGCTGGACAAGCTGGTGA  179665

>PHCA:scaffold_35 PHYCAscaffold_35
Length=603175

 Score = 36.5 bits (39),  Expect = 8.8
 Identities = 24/27 (89%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  38     TCAAGCTGGCGCAGAGCCTTCCCGCCG  64
              ||||| |||||||||||||||  ||||
Sbjct  99809  TCAAGGTGGCGCAGAGCCTTCTTGCCG  99783

>SAPA:scaffold_67 supercont2.67 dna:supercontig supercontig:ASM15154v2:supercont2.67:1:182362:1 
REF
Length=182362

 Score = 35.6 bits (38),  Expect = 8.8
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  190    GTGACGCCCAAGCGCACGC  208
              |||||||||||||||||||
Sbjct  31677  GTGACGCCCAAGCGCACGC  31659

>SAPA:scaffold_6 supercont2.6 dna:supercontig supercontig:ASM15154v2:supercont2.6:1:961754:1 
REF
Length=961754

 Score = 35.6 bits (38),  Expect = 8.8
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  33     GCTCATCAAGCTGGCGCAGAGCCT  56
              |||||||||||| |||||| ||||
Sbjct  44189  GCTCATCAAGCTCGCGCAGCGCCT  44212

>SADI:scaffold_82 supercont1.82 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.82:1:225599:1 
REF
Length=225599

 Score = 35.6 bits (38),  Expect = 8.8
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  33     GCTCATCAAGCTGGCGCAGAGCCT  56
              |||||||||||| |||||| ||||
Sbjct  14559  GCTCATCAAGCTTGCGCAGCGCCT  14536

>SADI:scaffold_70 supercont1.70 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.70:1:294663:1 
REF
Length=294663

 Score = 35.6 bits (38),  Expect = 8.8
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  26      ACAAGAAGCTCATCAAGCT  44
               |||||||||||||||||||
Sbjct  214462  ACAAGAAGCTCATCAAGCT  214480

>SADI:scaffold_18 supercont1.18 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.18:1:789572:1 
REF
Length=789572

 Score = 35.6 bits (38),  Expect = 8.8
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Plus

Query  190     GTGACGCCCAAGCGCACGC  208
               |||||||||||||||||||
Sbjct  121503  GTGACGCCCAAGCGCACGC  121521

>PYVX:scaffold_201 pve_scaffold_201 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_201:1:39033:1 
REF
Length=39033

 Score = 35.6 bits (38),  Expect = 8.8
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  134    AGGAGCTGGACAAGCTTGTGATGA  157
              |||||||||||||||| |||| ||
Sbjct  13116  AGGAGCTGGACAAGCTCGTGACGA  13139

>PYIW:scaffold_2521 piw_scaffold_2521 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_2521:1:4790:1 
REF
Length=4790

 Score = 35.6 bits (38),  Expect = 8.8
 Identities = 19/19 (100%), Gaps = 0/19 (0%)
 Strand=Plus/Minus

Query  19    ACAGCATACAAGAAGCTCA  37
             |||||||||||||||||||
Sbjct  2667  ACAGCATACAAGAAGCTCA  2649

>PYIW:scaffold_2053 piw_scaffold_2053 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_2053:1:6202:1 
REF
Length=6202

 Score = 35.6 bits (38),  Expect = 8.8
 Identities = 25/29 (86%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  27    CAAGAAGCTCATCAAGCTGGCGCAGAGCC  55
             |||| ||||||||||||  ||| ||||||
Sbjct  4830  CAAGGAGCTCATCAAGCGCGCGAAGAGCC  4858

>PYIW:scaffold_591 piw_scaffold_591 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_591:1:16376:1 
REF
Length=16376

 Score = 35.6 bits (38),  Expect = 8.8
 Identities = 24/26 (92%), Gaps = 1/26 (4%)
 Strand=Plus/Plus

Query  154   ATGAAGGC-ACAGTCAAAGATTAGCT  178
             |||||||| ||| |||||||||||||
Sbjct  7746  ATGAAGGCGACACTCAAAGATTAGCT  7771

>PYIR:scaffold_783 pir_scaffold_783 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_783:1:15785:1 
REF
Length=15785

 Score = 35.6 bits (38),  Expect = 8.8
 Identities = 22/24 (92%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  26    ACAAGAAGCTCATCAAGCTGGCGC  49
             |||||||||||||||| |||| ||
Sbjct  6063  ACAAGAAGCTCATCAACCTGGAGC  6040

>PYAR:scaffold_1106 par_scaffold_1106 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1106:1:10350:1 
REF
Length=10350

 Score = 35.6 bits (38),  Expect = 8.8
 Identities = 24/26 (92%), Gaps = 1/26 (4%)
 Strand=Plus/Minus

Query  20    CAGCA-TACAAGAAGCTCATCAAGCT  44
             ||||| ||||| ||||||||||||||
Sbjct  3127  CAGCAGTACAATAAGCTCATCAAGCT  3102

>PHRA:scaffold_732
Length=8797

 Score = 35.6 bits (38),  Expect = 8.8
 Identities = 32/38 (84%), Gaps = 2/38 (5%)
 Strand=Plus/Minus

Query  77   CAGCGCTGGACAAGATTCGCCACGACTTTCGATCCCGT  114
            |||||| ||||| | |||| ||||||||||||  ||||
Sbjct  232  CAGCGC-GGACA-GCTTCGACACGACTTTCGACGCCGT  197

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 441788603773

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2