Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
SAPA:scaffold_24426711429764305444310.0
SADI:scaffold_4173268176290302731430.0
APIN:scaffold_203783593788274694185e-102
APAS:scaffold_127300707305384693936e-95
PYIR:scaffold_8986669980411522581e-58
PYIW:scaffold_711132841442211662141e-46
PYUU:scaffold_2037131042013110396261644e-33
PYAR:scaffold_2914269145002331332e-24
PHSO:scaffold_1280223028024632341136e-19
PHCA:scaffold_84103190103520331882e-12
PHRA:scaffold_56146549146692145876e-12
PYAP:scaffold_1622245622767315813e-10
PHKE:scaffold_98696956976975803e-10
PHPA:scaffold_63253359253579225763e-09
PHIF:NW_003303697.1433383433617237632e-05
PYVX:scaffold_132327937092540.003
PYVX:scaffold_8367804783431520.011
PYIW:scaffold_15914124415835500.037
PYAR:scaffold_50138291387850500.037
SAPA:scaffold_288138111384939480.13
SAPA:scaffold_568825468828734480.13
SAPA:scaffold_236125836128629480.13
SADI:scaffold_3814383314386634480.13
SADI:scaffold_31335711133573929480.13
PHSO:scaffold_41287663128770139480.13
SADI:scaffold_2967922667925126470.45
PYVX:scaffold_3008300833738470.45
PHSO:scaffold_1119443819449157470.45
APAS:scaffold_2510785610788126470.45
SAPA:scaffold_3711898911902133460.45
SADI:scaffold_86749097497163460.45
PYVX:scaffold_213305413308633460.45
PYUU:scaffold_20231532728153275528460.45
PHSO:scaffold_63464604346464949460.45
APIN:scaffold_31347430134746334460.45
SAPA:scaffold_42828238284725451.6
SAPA:scaffold_11045451104549141451.6
PYIR:scaffold_11824594461825451.6
PYIR:scaffold_6763967335451.6
SAPA:scaffold_54414064144339441.6
SAPA:scaffold_1829036629039329441.6
SADI:scaffold_11716016171604227441.6
PYVX:scaffold_5678001802727441.6
PYAR:scaffold_16343482350827441.6
PYAR:scaffold_547119771204772441.6
PYAP:scaffold_10473184321532441.6
PHRA:scaffold_191181684834441.6
PHRA:scaffold_4518444847027441.6
PHRA:scaffold_436115981163034441.6
PHRA:scaffold_2673973399927441.6
PHRA:scaffold_105533005332627441.6
SAPA:scaffold_52667076675751435.5
SAPA:scaffold_1458107658112954435.5
SADI:scaffold_1663381763386751435.5
SADI:scaffold_587084487087229435.5
PYIW:scaffold_42991566160642435.5
PYIW:scaffold_40381949199145435.5
PYIW:scaffold_14395339537234435.5
PYIR:scaffold_22501563159634435.5
PYAR:scaffold_23974502453029435.5
PYAR:scaffold_3417208723629435.5
PYAR:scaffold_32351253524435.5
APAS:scaffold_51497904981829435.5
APAS:scaffold_2444905044907931435.5
APAS:scaffold_2127869927872729435.5
SAPA:scaffold_60981283928425.5
SAPA:scaffold_3904257429945425.5
SAPA:scaffold_163139071394236425.5
SAPA:scaffold_147218362186631425.5
SAPA:scaffold_3328323528326026425.5
SAPA:scaffold_3423664123667737425.5
SAPA:scaffold_31882678829731425.5
SAPA:scaffold_1359012259015231425.5
SAPA:scaffold_948597148600131425.5
SAPA:scaffold_745170445173431425.5
SAPA:scaffold_4195141954936425.5
SADI:scaffold_1693918395942425.5
SADI:scaffold_793034306936425.5
SADI:scaffold_6213416513419531425.5
SADI:scaffold_3331500131503131425.5
PYVX:scaffold_586186001863133425.5
PYUU:scaffold_201219381019383526425.5
PYUU:scaffold_138126896626898621425.5
PYIW:scaffold_836023426431425.5
PYIW:scaffold_23732807283731425.5
PYIW:scaffold_88105641059533425.5
PYIR:scaffold_16285387541226425.5
PYIR:scaffold_3201543157331425.5
PYIR:scaffold_3032426246338425.5
PYIR:scaffold_2199528955933425.5
PYAR:scaffold_18945070510031425.5
PYAR:scaffold_170238322386333425.5
PYAR:scaffold_892841287131425.5
PYAP:scaffold_120340083403530425.5
PHRA:scaffold_123487254875633425.5
PHRA:scaffold_4816263216266736425.5
PHPA:scaffold_42326954232697421425.5
PHKE:scaffold_241270082703326425.5
PHIF:NW_003303750.12624942262496928425.5
PHIF:NW_003303732.149972849975326425.5
PHCA:scaffold_4781265130137425.5
PHCA:scaffold_102507545079037425.5
PHCA:scaffold_2226079126082737425.5
PHCA:scaffold_1586682086684021425.5
APIN:scaffold_2774578574580521425.5
APIN:scaffold_81001703100172826425.5
APAS:scaffold_39829698299426425.5
BLASTN 2.9.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= SPRG_06354

Length=2655
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

SAPA:scaffold_24 supercont2.24 dna:supercontig supercontig:ASM151...  3996       0.0   
SADI:scaffold_4 supercont1.4 dna:supercontig supercontig:Sap_dicl...  2835       0.0   
APIN:scaffold_20 supercont1.20 dna:supercontig supercontig:Apha_i...  378        5e-102
APAS:scaffold_12 supercont1.12 dna:supercontig supercontig:Apha_a...  355        6e-95 
PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_sc...  233        1e-58 
PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:pi...  194        1e-46 
PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:p...  149        4e-33 
PYAR:scaffold_29 par_scaffold_29 dna:supercontig supercontig:par_...  121        2e-24 
PHSO:scaffold_1                                                       103        6e-19 
PHCA:scaffold_84 PHYCAscaffold_84                                     80.6       2e-12 
PHRA:scaffold_56                                                      79.7       6e-12 
PYAP:scaffold_162 pag1_scaffold_162 dna:supercontig supercontig:p...  74.3       3e-10 
PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercon...  73.4       3e-10 
PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 ...  69.8       3e-09 
PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 ge...  58.1       2e-05 
PYVX:scaffold_1323 pve_scaffold_1323 dna:supercontig supercontig:...  50.0       0.003 
PYVX:scaffold_836 pve_scaffold_836 dna:supercontig supercontig:pv...  48.2       0.011 
PYIW:scaffold_1591 piw_scaffold_1591 dna:supercontig supercontig:...  46.4       0.037 
PYAR:scaffold_50 par_scaffold_50 dna:supercontig supercontig:par_...  46.4       0.037 
SAPA:scaffold_288 supercont2.288 dna:supercontig supercontig:ASM1...  44.6       0.13  
SAPA:scaffold_5 supercont2.5 dna:supercontig supercontig:ASM15154...  44.6       0.13  
SAPA:scaffold_2 supercont2.2 dna:supercontig supercontig:ASM15154...  44.6       0.13  
SADI:scaffold_38 supercont1.38 dna:supercontig supercontig:Sap_di...  44.6       0.13  
SADI:scaffold_3 supercont1.3 dna:supercontig supercontig:Sap_dicl...  44.6       0.13  
PHSO:scaffold_4                                                       44.6       0.13  
SADI:scaffold_29 supercont1.29 dna:supercontig supercontig:Sap_di...  43.7       0.45  
PYVX:scaffold_300 pve_scaffold_300 dna:supercontig supercontig:pv...  43.7       0.45  
PHSO:scaffold_11                                                      43.7       0.45  
APAS:scaffold_25 supercont1.25 dna:supercontig supercontig:Apha_a...  43.7       0.45  
SAPA:scaffold_37 supercont2.37 dna:supercontig supercontig:ASM151...  42.8       0.45  
SADI:scaffold_86 supercont1.86 dna:supercontig supercontig:Sap_di...  42.8       0.45  
PYVX:scaffold_2 pve_scaffold_2 dna:supercontig supercontig:pve_sc...  42.8       0.45  
PYUU:scaffold_2023 scf1117875582023 dna:supercontig supercontig:p...  42.8       0.45  
PHSO:scaffold_6                                                       42.8       0.45  
APIN:scaffold_3 supercont1.3 dna:supercontig supercontig:Apha_inv...  42.8       0.45  
SAPA:scaffold_42 supercont2.42 dna:supercontig supercontig:ASM151...  41.9       1.6   
SAPA:scaffold_1 supercont2.1 dna:supercontig supercontig:ASM15154...  41.9       1.6   
PYIR:scaffold_1182 pir_scaffold_1182 dna:supercontig supercontig:...  41.9       1.6   
PYIR:scaffold_67 pir_scaffold_67 dna:supercontig supercontig:pir_...  41.9       1.6   
SAPA:scaffold_54 supercont2.54 dna:supercontig supercontig:ASM151...  41.0       1.6   
SAPA:scaffold_18 supercont2.18 dna:supercontig supercontig:ASM151...  41.0       1.6   
SADI:scaffold_1 supercont1.1 dna:supercontig supercontig:Sap_dicl...  41.0       1.6   
PYVX:scaffold_567 pve_scaffold_567 dna:supercontig supercontig:pv...  41.0       1.6   
PYAR:scaffold_1634 par_scaffold_1634 dna:supercontig supercontig:...  41.0       1.6   
PYAR:scaffold_547 par_scaffold_547 dna:supercontig supercontig:pa...  41.0       1.6   
PYAP:scaffold_1047 pag1_scaffold_1047 dna:supercontig supercontig...  41.0       1.6   
PHRA:scaffold_1911                                                    41.0       1.6   
PHRA:scaffold_451                                                     41.0       1.6   
PHRA:scaffold_436                                                     41.0       1.6   
PHRA:scaffold_267                                                     41.0       1.6   
PHRA:scaffold_105                                                     41.0       1.6   
SAPA:scaffold_52 supercont2.52 dna:supercontig supercontig:ASM151...  40.1       5.5   
SAPA:scaffold_14 supercont2.14 dna:supercontig supercontig:ASM151...  40.1       5.5   
SADI:scaffold_16 supercont1.16 dna:supercontig supercontig:Sap_di...  40.1       5.5   
SADI:scaffold_5 supercont1.5 dna:supercontig supercontig:Sap_dicl...  40.1       5.5   
PYIW:scaffold_4299 piw_scaffold_4299 dna:supercontig supercontig:...  40.1       5.5   
PYIW:scaffold_4038 piw_scaffold_4038 dna:supercontig supercontig:...  40.1       5.5   
PYIW:scaffold_1439 piw_scaffold_1439 dna:supercontig supercontig:...  40.1       5.5   
PYIR:scaffold_2250 pir_scaffold_2250 dna:supercontig supercontig:...  40.1       5.5   
PYAR:scaffold_2397 par_scaffold_2397 dna:supercontig supercontig:...  40.1       5.5   
PYAR:scaffold_341 par_scaffold_341 dna:supercontig supercontig:pa...  40.1       5.5   
PYAR:scaffold_323 par_scaffold_323 dna:supercontig supercontig:pa...  40.1       5.5   
APAS:scaffold_51 supercont1.51 dna:supercontig supercontig:Apha_a...  40.1       5.5   
APAS:scaffold_24 supercont1.24 dna:supercontig supercontig:Apha_a...  40.1       5.5   
APAS:scaffold_21 supercont1.21 dna:supercontig supercontig:Apha_a...  40.1       5.5   
SAPA:scaffold_609 supercont2.609 dna:supercontig supercontig:ASM1...  39.2       5.5   
SAPA:scaffold_390 supercont2.390 dna:supercontig supercontig:ASM1...  39.2       5.5   
SAPA:scaffold_163 supercont2.163 dna:supercontig supercontig:ASM1...  39.2       5.5   
SAPA:scaffold_147 supercont2.147 dna:supercontig supercontig:ASM1...  39.2       5.5   
SAPA:scaffold_33 supercont2.33 dna:supercontig supercontig:ASM151...  39.2       5.5   
SAPA:scaffold_34 supercont2.34 dna:supercontig supercontig:ASM151...  39.2       5.5   
SAPA:scaffold_31 supercont2.31 dna:supercontig supercontig:ASM151...  39.2       5.5   
SAPA:scaffold_13 supercont2.13 dna:supercontig supercontig:ASM151...  39.2       5.5   
SAPA:scaffold_9 supercont2.9 dna:supercontig supercontig:ASM15154...  39.2       5.5   
SAPA:scaffold_7 supercont2.7 dna:supercontig supercontig:ASM15154...  39.2       5.5   
SAPA:scaffold_4 supercont2.4 dna:supercontig supercontig:ASM15154...  39.2       5.5   
SADI:scaffold_169 supercont1.169 dna:supercontig supercontig:Sap_...  39.2       5.5   
SADI:scaffold_79 supercont1.79 dna:supercontig supercontig:Sap_di...  39.2       5.5   
SADI:scaffold_62 supercont1.62 dna:supercontig supercontig:Sap_di...  39.2       5.5   
SADI:scaffold_33 supercont1.33 dna:supercontig supercontig:Sap_di...  39.2       5.5   
PYVX:scaffold_586 pve_scaffold_586 dna:supercontig supercontig:pv...  39.2       5.5   
PYUU:scaffold_2012 scf1117875582012 dna:supercontig supercontig:p...  39.2       5.5   
PYUU:scaffold_1381 scf1117875581381 dna:supercontig supercontig:p...  39.2       5.5   
PYIW:scaffold_8360 piw_scaffold_8360 dna:supercontig supercontig:...  39.2       5.5   
PYIW:scaffold_2373 piw_scaffold_2373 dna:supercontig supercontig:...  39.2       5.5   
PYIW:scaffold_88 piw_scaffold_88 dna:supercontig supercontig:piw_...  39.2       5.5   
PYIR:scaffold_1628 pir_scaffold_1628 dna:supercontig supercontig:...  39.2       5.5   
PYIR:scaffold_320 pir_scaffold_320 dna:supercontig supercontig:pi...  39.2       5.5   
PYIR:scaffold_303 pir_scaffold_303 dna:supercontig supercontig:pi...  39.2       5.5   
PYIR:scaffold_219 pir_scaffold_219 dna:supercontig supercontig:pi...  39.2       5.5   
PYAR:scaffold_1894 par_scaffold_1894 dna:supercontig supercontig:...  39.2       5.5   
PYAR:scaffold_170 par_scaffold_170 dna:supercontig supercontig:pa...  39.2       5.5   
PYAR:scaffold_89 par_scaffold_89 dna:supercontig supercontig:par_...  39.2       5.5   
PYAP:scaffold_120 pag1_scaffold_120 dna:supercontig supercontig:p...  39.2       5.5   
PHRA:scaffold_123                                                     39.2       5.5   
PHRA:scaffold_48                                                      39.2       5.5   
PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 u...  39.2       5.5   
PHKE:scaffold_241 scf_22126_241.1_contig_1 dna:supercontig superc...  39.2       5.5   
PHIF:NW_003303750.1 Phytophthora infestans T30-4 supercont1.9 gen...  39.2       5.5   
PHIF:NW_003303732.1 Phytophthora infestans T30-4 supercont1.27 ge...  39.2       5.5   
PHCA:scaffold_478 PHYCAscaffold_478                                   39.2       5.5   
PHCA:scaffold_102 PHYCAscaffold_102                                   39.2       5.5   
PHCA:scaffold_22 PHYCAscaffold_22                                     39.2       5.5   
PHCA:scaffold_15 PHYCAscaffold_15                                     39.2       5.5   
APIN:scaffold_27 supercont1.27 dna:supercontig supercontig:Apha_i...  39.2       5.5   
APIN:scaffold_8 supercont1.8 dna:supercontig supercontig:Apha_inv...  39.2       5.5   
APAS:scaffold_39 supercont1.39 dna:supercontig supercontig:Apha_a...  39.2       5.5   

>SAPA:scaffold_24 supercont2.24 dna:supercontig supercontig:ASM15154v2:supercont2.24:1:471063:1 
REF
Length=471063

 Score = 3996 bits (4431),  Expect = 0.0
 Identities = 2646/3054 (87%), Gaps = 408/3054 (13%)
 Strand=Plus/Plus

Query  10      AGCAAATTGCGTCTCTACGACCGGTCCGAGCAGCCTGTCAAGTCGCAGCCCTACATGAAC  69
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  426711  AGCAAATTGCGTCTCTACGACCGGTCCGAGCAGCCTGTCAAGTCGCAGCCCTACATGAAC  426770

Query  70      TCGTCGGGCTTCAACGTAGCGTCGCTAAAGCTTGATCTGGCGCCGCCCCCGACCGAGCCC  129
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  426771  TCGTCGGGCTTCAACGTAGCGTCGCTAAAGCTTGATCTGGCGCCGCCCCCGACCGAGCCC  426830

Query  130     GACGCGGTGCCGCCGACACGGCCGGCAGTTGCTCGGAAAAGAAAATCGACCGTCGCCACT  189
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  426831  GACGCGGTGCCGCCGACACGGCCGGCAGTTGCTCGGAAAAGAAAATCGACCGTCGCCACT  426890

Query  190     GTCCAGCTCTCGTTCCCAGGGGCGAAGGACGAATTGGTCGATGCAGTGCCAGTTGAAGAC  249
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  426891  GTCCAGCTCTCGTTCCCAGGGGCGAAGGACGAATTGGTCGATGCAGTGCCAGTTGAAGAC  426950

Query  250     CCCGCGACAGACGACGGCCCGATCGAGCCCACCGACACGATTGACG--------------  295
               ||||||||||||||||||||||||||||||||||||||||||||||              
Sbjct  426951  CCCGCGACAGACGACGGCCCGATCGAGCCCACCGACACGATTGACGTACTTCTTCCATCA  427010

Query  296     ----------------------------AGTTGCGCAACAACGTCGAGAAGATTCGCGGC  327
                                           ||||||||||||||||||||||||||||||||
Sbjct  427011  CCTCGACCCTTGTAATGTGGTTTGTAGGAGTTGCGCAACAACGTCGAGAAGATTCGCGGC  427070

Query  328     TACAACGACCTCCTCGACACCTACAG----------------------------------  353
               ||||||||||||||||||||||||||                                  
Sbjct  427071  TACAACGACCTCCTCGACACCTACAGGTCATGCTCCAGCTCTTGCGACCCCATTTGTTGA  427130

Query  354     ------------------CCTGCATCAGTTTATCATTCGGAAGGGCCAAACGCTTTCCGA  395
                                 ||||||||||||||||||||||||||||||||||||||||||
Sbjct  427131  AACATTACGCGTGCGTAGCCTGCATCAGTTTATCATTCGGAAGGGCCAAACGCTTTCCGA  427190

Query  396     GACGCCGGAATTCATCTCGTTCAAGCGCATCACTGAAGACCTTTGGGGCAGCGTCTCGAT  455
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427191  GACGCCGGAATTCATCTCGTTCAAGCGCATCACTGAAGACCTTTGGGGCAGCGTCTCGAT  427250

Query  456     GGCGATCCGCGAGCTCGAGACGCTCTTGGTCCACTACTCGGTGCCGCTCGCCTACATTGA  515
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427251  GGCGATCCGCGAGCTCGAGACGCTCTTGGTCCACTACTCGGTGCCGCTCGCCTACATTGA  427310

Query  516     TGGTCAAAAGCTGCTCAAAATCGCAGCCATGGACGCGGTGTCACGCTCCAAGTCGGAGCT  575
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427311  TGGTCAAAAGCTGCTCAAAATCGCAGCCATGGACGCGGTGTCACGCTCCAAGTCGGAGCT  427370

Query  576     GCTCACATGTGTGCTCAACGTCGACGAGGTTACGACCTTTATGGCGCGGCCAGGCCAGCG  635
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427371  GCTCACATGTGTGCTCAACGTCGACGAGGTTACGACCTTTATGGCGCGGCCAGGCCAGCG  427430

Query  636     CTTCAAGGGCGGGGATGGCCGGCACGCGGCGGCGATCGTCATCCAGTCGGTCTACCGCAT  695
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427431  CTTCAAGGGCGGGGATGGCCGGCACGCGGCGGCGATCGTCATCCAGTCGGTCTACCGCAT  427490

Query  696     GCATCGCACGCGGCGGCTGCTGCGGCAGCACCACGGGCACTCGTACGCGACGCACATTCA  755
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427491  GCATCGCACGCGGCGGCTGCTGCGGCAGCACCACGGGCACTCGTACGCGACGCACATTCA  427550

Query  756     GCGCGTGTATCGAACGTACAAGTGCGTCAAAGACATCCAAGTCAAGCTACGACTGGCGCG  815
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427551  GCGCGTGTATCGAACGTACAAGTGCGTCAAAGACATCCAAGTCAAGCTACGACTGGCGCG  427610

Query  816     CGAGGCCGACGCCCGCACATGGGAGACGCAAATGACCACGTTCCACGCCAACTGGGACA-  874
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct  427611  CGAGGCCGACGCCCGCACATGGGAGACGCAAATGACCACGTTCCACGCCAACTGGGACAA  427670

Query  875     -------------------------------------------AGATCAAAATGCAACGG  891
                                                          |||||||||||||||||
Sbjct  427671  GGTGGAGTGGACGCGTTGGATCGGATGGACTTGATATATTGATAGATCAAAATGCAACGG  427730

Query  892     CGGGTCGTCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCGCGCGGCTCAACATGGAC  951
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427731  CGGGTCGTCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCGCGCGGCTCAACATGGAC  427790

Query  952     AACTTTGCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCGCGATCGCGGATCCCAAC  1011
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427791  AACTTTGCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCGCGATCGCGGATCCCAAC  427850

Query  1012    GTCGACGTCATCTACATCTCGCCGTTCGAGCTCTCGGTCGACATTCAAAAGTACATGATG  1071
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427851  GTCGACGTCATCTACATCTCGCCGTTCGAGCTCTCGGTCGACATTCAAAAGTACATGATG  427910

Query  1072    CGCCTGCTGCAGCTGGGCGGCGTCGCGGACCCGCACTCGCGCGTCCGGATGCTGCACCCG  1131
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427911  CGCCTGCTGCAGCTGGGCGGCGTCGCGGACCCGCACTCGCGCGTCCGGATGCTGCACCCG  427970

Query  1132    GAGAACGCCGAGCGCTTCCCCGAGCACTTTTCGCTGGCGACGATCCTCCTCTACTCGCCG  1191
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  427971  GAGAACGCCGAGCGCTTCCCCGAGCACTTTTCGCTGGCGACGATCCTCCTCTACTCGCCG  428030

Query  1192    CACTGTCTCAAGAAGATCAAACGCTACGTCCGCGGCAAGGAGGCGTACATCGTCGCAGGC  1251
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  428031  CACTGTCTCAAGAAGATCAAACGCTACGTCCGCGGCAAGGAGGCGTACATCGTCGCAGGC  428090

Query  1252    ACGGTGGGTCCCGAAGACAAGCGGCTCGCGATCCGACTGCAGCTGCCGCTGCTGGGCATG  1311
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  428091  ACGGTGGGTCCCGAAGACAAGCGGCTCGCGATCCGACTGCAGCTGCCGCTGCTGGGCATG  428150

Query  1312    GACCCGGACCGCGCTTTGCTCTACGGCACACGC---------------------------  1344
               |||||||||||||||||||||||||||||||||                           
Sbjct  428151  GACCCGGACCGCGCTTTGCTCTACGGCACACGCGTACGCTGTCTGTTTTGTCGTCTTCTT  428210

Query  1345    -------------TCGGGTGCGAAGCGGCTTTTTACGCAAGCCGACGTCAACATTCCGTA  1391
                            |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  428211  ATGCTGGGTGTAGTCGGGTGCGAAGCGGCTTTTTACGCAAGCCGACGTCAACATTCCGTA  428270

Query  1392    CGGCGCCCACGACATTTACGACGAAGACGAGCTGATTCTGAGCTTGGCCAAGCTCACGGC  1451
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  428271  CGGCGCCCACGACATTTACGACGAAGACGAGCTGATTCTGAGCTTGGCCAAGCTCACGGC  428330

Query  1452    CGCCAACTTGCACCAAGGCATGTGGCTCATCA----------------------------  1483
               ||||||||||||||||||||||||||||||||                            
Sbjct  428331  CGCCAACTTGCACCAAGGCATGTGGCTCATCAAGGTGCGTTGACTTTTAGTCATCCGTAT  428390

Query  1484    ----------AGCTGGATGCGGACCCGTCCGACACGGGCTTGGCGGCCATCGACATGCAC  1533
                         ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  428391  CACTCTGCGTAGCTGGATGCGGACCCGTCCGACACGGGCTTGGCGGCCATCGACATGCAC  428450

Query  1534    GCGCTCGAGTGCGTCAACAAAGTCCGCGCCGAGAAGCGCGCGATGAAGAACGACGAGTAC  1593
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  428451  GCGCTCGAGTGCGTCAACAAAGTCCGCGCCGAGAAGCGCGCGATGAAGAACGACGAGTAC  428510

Query  1594    TACAGCCAGCCAAACATCAAAGAAGGGATCGTGCGGGCGATCGTCGCCGAACTCAGCGAG  1653
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  428511  TACAGCCAGCCAAACATCAAAGAAGGGATCGTGCGGGCGATCGTCGCCGAACTCAGCGAG  428570

Query  1654    CAATTTCACCGACTCATTTCGCCCTGTTTTCCCGAC------------------------  1689
               ||||||||||||||||||||||||||||||||||||                        
Sbjct  428571  CAATTTCACCGACTCATTTCGCCCTGTTTTCCCGACGTATGCGACTCAACTCTCTGATCG  428630

Query  1690    ------------------GTCTACCCGACGTGGCAGCACATGCGTCCCGTGGTCAACCGC  1731
                                 ||||||||||||||||||||||||||||||||||||||||||
Sbjct  428631  GATCCTCACTTGCAGTAGGTCTACCCGACGTGGCAGCACATGCGTCCCGTGGTCAACCGC  428690

Query  1732    ATCGGCGCCGTCATCGAA------------------------------------------  1749
               ||||||||||||||||||                                          
Sbjct  428691  ATCGGCGCCGTCATCGAAGTACGAGCATATTGACTTGTTGGTATTCGACAATCGACACCG  428750

Query  1750    ------GCGTAcccccccAAGGTCCTTGCGCGCGTTCGCGCCAACGTCTTCATCGAACCG  1803
                     ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  428751  GCGTAGGCGTACCCCCCCAAGGTCCTTGCGCGCGTTCGCGCCAACGTCTTCATCGAACCG  428810

Query  1804    TCCGGCGGCGTGCACGTGACGTCGGCGCAGGAGCAGTTGATGCACGTCAAGAACAAGCAC  1863
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  428811  TCCGGCGGCGTGCACGTGACGTCGGCGCAGGAGCAGTTGATGCACGTCAAGAACAAGCAC  428870

Query  1864    CAAAGCGTCGGCGCCGTGTACCCGCCAACGGCCGTGCCCTACGCAGCGATCCGC------  1917
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||      
Sbjct  428871  CAAAGCGTCGGCGCCGTGTACCCGCCAACGGCCGTGCCCTACGCAGCGATCCGCGTGCGT  428930

Query  1918    ----------------------------------------------GGCGCGTCGTTGGC  1931
                                                             ||||||||||||||
Sbjct  428931  CGACGCATGTTCTTATTGCGTCTTATTGTGAGGACGATGCTTTTAGGGCGCGTCGTTGGC  428990

Query  1932    GGTCGCGCAAGCCATGTACGCGAGCGGCATCATTGGCTACGCGAGCATCGACTATGTGGC  1991
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  428991  GGTCGCGCAAGCCATGTACGCGAGCGGCATCATTGGCTACGCGAGCATCGACTATGTGGC  429050

Query  1992    GTTTCTCGACGTCAAGACGGTCAACGGGAAGGCGGGGCCGCCGCACTTGCGGCTCTGGGC  2051
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  429051  GTTTCTCGACGTCAAGACGGTCAACGGGAAGGCGGGGCCGCCGCACTTGCGGCTCTGGGC  429110

Query  2052    CCTCCAGCTCTTGCCGTGCCTCACGCCGACGGCCATGTCCTTCGTGCTCTTCACCTTTTT  2111
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  429111  CCTCCAGCTCTTGCCGTGCCTCACGCCGACGGCCATGTCCTTCGTGCTCTTCACCTTTTT  429170

Query  2112    GTCGTGCGCGACGCTGGACGCGGCGACGGGCCGCAGTTTCCTCCCGCTGCCCGCACCGCG  2171
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  429171  GTCGTGCGCGACGCTGGACGCGGCGACGGGCCGCAGTTTCCTCCCGCTGCCCGCACCGCG  429230

Query  2172    TCCGTCGTCGCTTGCGGGCCCGCCAGCAACCGAGACGCAGTTGGCGGTCGAAAAAATCTT  2231
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  429231  TCCGTCGTCGCTTGCGGGCCCGCCAGCAACCGAGACGCAGTTGGCGGTCGAAAAAATCTT  429290

Query  2232    GGGCGAGAGTTCGCCTGCCGCGACGATGGGGGCCGAGCGCGCCTACATTGCGCACGAGTA  2291
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  429291  GGGCGAGAGTTCGCCTGCCGCGACGATGGGGGCCGAGCGCGCCTACATTGCGCACGAGTA  429350

Query  2292    CATCTTCCACCCGAACATGGCCACGCTCCAGTACGCCGTCTTCTTCAACATGTGCCGCGT  2351
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  429351  CATCTTCCACCCGAACATGGCCACGCTCCAGTACGCCGTCTTCTTCAACATGTGCCGCGT  429410

Query  2352    GCACGGCGTGAGCTTTGACCTGC-------------------------------------  2374
               |||||||||||||||||||||||                                     
Sbjct  429411  GCACGGCGTGAGCTTTGACCTGCAGGTACGTCTACGTCGTCGACCGCGATCTCGTGTCAA  429470

Query  2375    -------------AGAAATCGATTGGCGCCGCGTTCGTGTTGGCCGACAGCCTCACGGCC  2421
                            |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  429471  CAAGGTGGCGCGTAGAAATCGATTGGCGCCGCGTTCGTGTTGGCCGACAGCCTCACGGCC  429530

Query  2422    GGCGTCGTCGGGCTTCTCTGCATCGGCGAGTCGGACAAGGAGGCGGTGCGCTTGACCCGG  2481
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  429531  GGCGTCGTCGGGCTTCTCTGCATCGGCGAGTCGGACAAGGAGGCGGTGCGCTTGACCCGG  429590

Query  2482    GCCGCGCTTGAGCTCATTGGCGACCAAGTCGGCGTGCAGCCTGCACCGGACGCGCTCACG  2541
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  429591  GCCGCGCTTGAGCTCATTGGCGACCAAGTCGGCGTGCAGCCTGCACCGGACGCGCTCACG  429650

Query  2542    GGCGAGCGGCTTGGTAACTTTGCTGCCGTCCTCGGTGCGATCCGATTGCGCCACGACGAC  2601
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  429651  GGCGAGCGGCTTGGTAACTTTGCTGCCGTCCTCGGTGCGATCCGATTGCGCCACGACGAC  429710

Query  2602    ATGGTCAAGCGAGCGAAGAAGGCGCGGTCCAACACGTCTGCGTGCTTGGTGTAG  2655
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  429711  ATGGTCAAGCGAGCGAAGAAGGCGCGGTCCAACACGTCTGCGTGCTTGGTGTAG  429764

>SADI:scaffold_4 supercont1.4 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.4:1:1391842:1 
REF
Length=1391842

 Score = 2835 bits (3143),  Expect = 0.0
 Identities = 2377/3027 (79%), Gaps = 409/3027 (14%)
 Strand=Plus/Minus

Query  10      AGCAAATTGCGTCTCTACGACCGGTCCGAGCAGCCTGTCAAGTCGCAGCCCTACATGAAC  69
               ||||||||||| || |||||||||||||| ||||| |||||||| |||||||||||||||
Sbjct  176290  AGCAAATTGCGGCTGTACGACCGGTCCGAACAGCCCGTCAAGTCCCAGCCCTACATGAAC  176231

Query  70      TCGTCGGGCTTCAACGTAGCGTCGCTAAAGCTTGATCTGGCGCCGCCCCCGACCGAGCCC  129
               |||||| ||||||| || |||||||| ||||| ||  |||||||||| ||||||||||| 
Sbjct  176230  TCGTCGAGCTTCAATGTTGCGTCGCTCAAGCTCGACTTGGCGCCGCCACCGACCGAGCCG  176171

Query  130     GACGCGGTGCCGCCGACACGGCCGGCAGTTGCTCGGAAAAGAAAATCGACCGTCGCCACT  189
               ||| ||  ||||  ||| ||||  || || |||||||| | ||||||  | || || || 
Sbjct  176170  GACCCGACGCCGTTGACGCGGCTAGCTGTCGCTCGGAATAAAAAATCAGCGGTTGCGACG  176111

Query  190     GTCCAGCTCTCGTTCCCAGGGGCGAAGGACGAATTGGTCGATGCAGTGCCAGTTGAAGAC  249
               ||||||||| |||| ||||| || |||||||||   | ||| |  ||||| || ||||||
Sbjct  176110  GTCCAGCTCACGTTTCCAGGCGCAAAGGACGAA---GGCGACGTGGTGCCCGTCGAAGAC  176054

Query  250     CCCGCGACAGACGACGGCCCGATCGAGCCCACCGACACGATTGACG--------------  295
               ||  |||| |||||||||||||| ||||||||||||||||||||||              
Sbjct  176053  CCGACGACCGACGACGGCCCGATTGAGCCCACCGACACGATTGACGTATAAGTCCTTCGT  175994

Query  296     ------------------------------AGTTGCGCAACAACGTCGAGAAGATTCGCG  325
                                             | |||||||||||||||||||||||||| |
Sbjct  175993  CTACTTGCATCCGAGTCACACTTGCGTAGGAATTGCGCAACAACGTCGAGAAGATTCGAG  175934

Query  326     GCTACAACGACCTCCTCGACACCTACAGC-----------CTGC----------------  358
               ||||||||||||||||||||||||||||            ||||                
Sbjct  175933  GCTACAACGACCTCCTCGACACCTACAGGTCTCCCCGCTGCTGCCACGACTCGTATATTG  175874

Query  359     -----------------ATCAGTTTATCATTCGGAAGGGCCAAACGCTTTCCGAGACGCC  401
                                |||| |||||||||||||| |||||||||||  ||||||||||
Sbjct  175873  ATTTGGGCCTAGTTTACATCAATTTATCATTCGGAAAGGCCAAACGCTCGCCGAGACGCC  175814

Query  402     GGAATTCATCTCGTTCAAGCGCATCACTGAAGACCTTTGGGGCAGCGTCTCGATGGCGAT  461
                |||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||
Sbjct  175813  CGAATTCATCTCGTTCAAGCGCATCACGGAAGACCTCTGGGGCAGTGTCTCGATGGCGAT  175754

Query  462     CCGCGAGCTCGAGACGCTCTTGGTCCACTACTCGGTGCCGCTCGCCTACATTGATGGTCA  521
                |||||||||||||||||| |  || |||||||||||||||||||||| ||||| || ||
Sbjct  175753  TCGCGAGCTCGAGACGCTCCTCATCAACTACTCGGTGCCGCTCGCCTATATTGACGGGCA  175694

Query  522     AAAGCTGCTCAAAATCGCAGCCATGGACGCGGTGTCACGCTCCAAGTCGGAGCTGCTCAC  581
               |||||||||||| || |||||||||||||| ||||| |||||||| |||||||| || ||
Sbjct  175693  AAAGCTGCTCAAGATTGCAGCCATGGACGCCGTGTCCCGCTCCAAATCGGAGCTACTTAC  175634

Query  582     ATGTGTGCTCAACGTCGACGAGGTTACGACCTTTATGGCGCGGCCAGGCCAGCGCTTCAA  641
                ||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct  175633  GTGTGTTCTCAACGTCGACGAGGTCACAACCTTTATGGCGCGGCCAGGCCAGCGCTTCAA  175574

Query  642     GGGCGGGGATGGCCGGCACGCGGCGGCGATCGTCATCCAGTCGGTCTACCGCATGCATCG  701
               |||||  ||  |||||||||| ||||| ||  || |||||||||| |||||||||||   
Sbjct  175573  GGGCGAAGACAGCCGGCACGCAGCGGCCATACTCCTCCAGTCGGTGTACCGCATGCACTT  175514

Query  702     CACGCGGCGGCTGCTGCGGCAGCACCACGGGCACTCGTACGCGACGCACATTCAGCGCGT  761
                ||||| || | ||||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct  175513  GACGCGACGCCGGCTGCGGCAACACCACGGGCACTCGTACGCGTCGCACATTCAGCGCGT  175454

Query  762     GTATCGAACGTACAAGTGCGTCAAAGACATCCAAGTCAAGCTACGACTGGCGCGCGAGGC  821
               ||| || ||||||||| |||||||||| |||||||||||  | |||||||| ||||||||
Sbjct  175453  GTACCGGACGTACAAGAGCGTCAAAGAGATCCAAGTCAAATTGCGACTGGCTCGCGAGGC  175394

Query  822     CGACGCCCGCACATGGGAGACGCAAATGACCACGTTCCACGCCAACTGGGACAAG-----  876
               |||||||||||| |||||||||||||||||| |||| ||||||||||||||||||     
Sbjct  175393  CGACGCCCGCACGTGGGAGACGCAAATGACCGCGTTTCACGCCAACTGGGACAAGGTTGG  175334

Query  877     ------------------------------------ATCAAAATGCAACGGCGGGTCGTC  900
                                                   ||||||||||| ||||||||||||
Sbjct  175333  GGTCCCTGTTGCCAGGGTTGCTTGATAAGTTGATAGATCAAAATGCAGCGGCGGGTCGTC  175274

Query  901     GTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCGCGCGGCTCAACATGGACAACTTTGCG  960
               || |||||||||||||||||||||||||||||| |||||||||| |||||||||||||| 
Sbjct  175273  GTGCACGTGCCGTCCTTCTCGGCCGAAGAGCGCACGCGGCTCAATATGGACAACTTTGCA  175214

Query  961     ATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCGCGATCGCGGATCCCAACGTCGACGTC  1020
               ||||| |||||| |||| ||||||||||||||||||||||| ||||| ||||||||||||
Sbjct  175213  ATTCGCCAGAATTTGCAAATGGCGCGTCTCTGCGCGATCGCAGATCCGAACGTCGACGTC  175154

Query  1021    ATCTACATCTCGCCGTTCGAGCTCTCGGTCGACATTCAAAAGTACATGATGCGCCTGCTG  1080
               |||||||| |||||||||||||||||||  ||||||||||||||||||||||| ||||||
Sbjct  175153  ATCTACATTTCGCCGTTCGAGCTCTCGGCTGACATTCAAAAGTACATGATGCGACTGCTG  175094

Query  1081    CAGCTGGGCGGCGTCGCGGACCCGCACTCGCGCGTCCGGATGCTGCACCCGGAGAACGCC  1140
               ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct  175093  CAGCTCGGCGGCGTCGCGGACCCGCACTCGCGCGTCCGAATGCTGCACCCGGAGAACGCC  175034

Query  1141    GAGCGCTTCCCCGAGCACTTTTCGCTGGCGACGATCCTCCTCTACTCGCCGCACTGTCTC  1200
               |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||
Sbjct  175033  GAGCGCTTCCCCGAGCACTTTTCGTTGGCGACGATCCTCCTCTACTCGCCGCACTGCCTC  174974

Query  1201    AAGAAGATCAAACGCTACGTCCGCGGCAAGGAGGCGTACATCGTCGCAGGCACGGTGGGT  1260
               ||||||||||| |||||||||||||| || ||||||||||||||||| ||||| ||||| 
Sbjct  174973  AAGAAGATCAAGCGCTACGTCCGCGGGAAAGAGGCGTACATCGTCGCGGGCACCGTGGGG  174914

Query  1261    CCCGAAGACAAGCGGCTCGCGATCCGACTGCAGCTGCCGCTGCTGGGCATGGACCCGGAC  1320
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct  174913  CCCGAAGACAAGCGGCTCGCGATCCGACTGCAGCTGCCGCTACTGGGCATGGACCCGGAC  174854

Query  1321    CGCGCTTTGCTCTACGGCACACG-------------------------------------  1343
               |||||  ||||||||||||||||                                     
Sbjct  174853  CGCGCGCTGCTCTACGGCACACGTGTACGCTGTATTGGCATCAGACAGTGTCTCATGCGG  174794

Query  1344    ------CTCGGGTGCGAAGCGGCTTTTTACGCAAGCCGACGTCAACATTCCGTACGGCGC  1397
                      |||||||| |||||||| ||||| ||||||||||||||||||||||  |||||
Sbjct  174793  GATCTAGTCGGGTGCCAAGCGGCTATTTACTCAAGCCGACGTCAACATTCCGTTTGGCGC  174734

Query  1398    CCACGACATTTACGACGAAGACGAGCTGATTCTGAGCTTGGCCAAGCTCACGGCCGCCAA  1457
               ||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||
Sbjct  174733  CCATGACATTTACGACGAGGACGAACTGATTCTGAGCTTGGCCAAGCTCACGGCCGCCAA  174674

Query  1458    CTTGCACCAAGGCATGTGGCTCATCA----------------------------------  1483
               ||||||||||||||||||||||||||                                  
Sbjct  174673  CTTGCACCAAGGCATGTGGCTCATCAAGGTGATTTCATTGCATTTCTGGCATTTCGCTAA  174614

Query  1484    ---------------AGCTGGATGCGGACCCGTCCGACACGGGCTTGGCGGCCATCGACA  1528
                              ||||||||||||||||||||||||||||||||||| | |||||||
Sbjct  174613  ACTTGTATCGGGTGTAGCTGGATGCGGACCCGTCCGACACGGGCTTGGCGTCTATCGACA  174554

Query  1529    TGCACGCGCTCGAGTGCGTCAACAAAGTCCGCGCCGAGAAGCGCGCGATGAAGAACGACG  1588
               |||||||||||||||||||||| || |||||| ||||||||||||| |||||||||||||
Sbjct  174553  TGCACGCGCTCGAGTGCGTCAATAAGGTCCGCACCGAGAAGCGCGCCATGAAGAACGACG  174494

Query  1589    AGTACTACAGCCAGCCAAACATCAAAGAAGGGATCGTGCGGGCGATCGTCGCCGAACTCA  1648
               |||||||||||||||| |||||||| ||||| ||||||||||||||||| ||||| ||||
Sbjct  174493  AGTACTACAGCCAGCCCAACATCAAGGAAGGCATCGTGCGGGCGATCGTGGCCGAGCTCA  174434

Query  1649    GCGAGCAATTTCACCGACTCATTTCGCCCTGTTTTCCCGAC-------------------  1689
               ||||||| |||||||| ||||||||||| || |||||||||                   
Sbjct  174433  GCGAGCAGTTTCACCGGCTCATTTCGCCTTGCTTTCCCGACGTATCCCCGTCGTCCTGGA  174374

Query  1690    --------------------------GTCTACCCGACGTGGCAGCACATGCGTCCCGTGG  1723
                                         |||||||| |||||||||||||||||||||||||
Sbjct  174373  ACAGGATGCCAACGCCATTGCATTAGGTCTACCCCACGTGGCAGCACATGCGTCCCGTGG  174314

Query  1724    TCAACCGCATCGGCGCCGTCATCGAA----------------------------------  1749
               |||||||||||||||||||||| |||                                  
Sbjct  174313  TCAACCGCATCGGCGCCGTCATTGAAGTACGAGCATTTTGGTTATTGGTTGCCGATGGCG  174254

Query  1750    ----------GCGTAcccccccAAGGTCCTTGCGCGCGTTCGCGCCAACGTCTTCATCGA  1799
                         |||||||| ||||| ||||| |||||||| ||||||||||||||||||||
Sbjct  174253  CTCGGTGTAGGCGTACCCACCCAAAGTCCTCGCGCGCGTCCGCGCCAACGTCTTCATCGA  174194

Query  1800    ACCGTCCGGCGGCGTGCACGTGACGTCGGCGCAGGAGCAGTTGATGCACGTCAAGAACAA  1859
                ||||||||||| |||||| |||||||||||||||||||||||||||| | |||||||||
Sbjct  174193  GCCGTCCGGCGGTGTGCACTTGACGTCGGCGCAGGAGCAGTTGATGCAGGCCAAGAACAA  174134

Query  1860    GCACCAAAGCGTCGGCGCCGTGTACCCGCCAACGGCCGTGCCCTACGCAGCGATCCGC--  1917
                ||||||||||||||||||||||||||| | ||| ||||||| || ||||||||||||  
Sbjct  174133  ACACCAAAGCGTCGGCGCCGTGTACCCGTCGACGACCGTGCCTTATGCAGCGATCCGCGT  174074

Query  1918    ------------------------------------------GGCGCGTCGTTGGCGGTC  1935
                                                         || |||||||||||||| 
Sbjct  174073  ACGTTGCCGCCTTTCTTATTGCGTCTTAGTGCGCTCATAAAGGGAGCGTCGTTGGCGGTT  174014

Query  1936    GCGCAAGCCATGTACGCGAGCGGCATCATTGGCTACGCGAGCATCGACTATGTGGCGTTT  1995
               |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct  174013  GCGCAAGCCATGTACGCGAGCGGCATCATTGGCTACGCAAGCATCGACTATGTGGCGTTT  173954

Query  1996    CTCGACGTCAAGACGGTCAACGGGAAGGCGGGGCCGCCGCACTTGCGGCTCTGGGCCCTC  2055
               ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || 
Sbjct  173953  CTCGATGTCAAGACGGTCAACGGGAAGGCGGGGCCGCCGCACTTGCGGCTCTGGGCGCTG  173894

Query  2056    CAGCTCTTGCCGTGCCTCACGCCGACGGCCATGTCCTTCGTGCTCTTCACCTTTTTGTCG  2115
               ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||
Sbjct  173893  CAGCTCTTGCCGTGCCTCACGCCGACGGCCATGTCGTTCGTGCTCTTCACGTTTTTGTCG  173834

Query  2116    TGCGCGACGCTGGACGCGGCGACGGGCCGCAGTTTCCTCCCGCTGCCCGCACCGCGTCCG  2175
               || |||||||||||||| ||||| || ||||| ||||| |||| ||||||||||| ||| 
Sbjct  173833  TGTGCGACGCTGGACGCAGCGACAGGGCGCAGCTTCCTTCCGCAGCCCGCACCGCATCCC  173774

Query  2176    TCGTCGCTTGCGGGCC---CGCCAGCAACCGAGACGCAGTTGGCGGTCGAAAAAATCTTG  2232
               ||| ||    |||| |    ||| |  |||||||||||||||||||||||||| ||||||
Sbjct  173773  TCGCCGGCGACGGGGCAATTGCCGGTGACCGAGACGCAGTTGGCGGTCGAAAAGATCTTG  173714

Query  2233    GGCGAGAGTTCGC-CTGCCGCGACGATGGGGGCCGAGCGCGCCTACATTGCGCACGAGTA  2291
                |||||||| ||| | |     ||| ||||| | ||||||||||||||||||||||||||
Sbjct  173713  AGCGAGAGTCCGCGCAGTTCAAACG-TGGGGCCTGAGCGCGCCTACATTGCGCACGAGTA  173655

Query  2292    CATCTTCCACCCGAACATGGCCACGCTCCAGTACGCCGTCTTCTTCAACATGTGCCGCGT  2351
               ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct  173654  CATCTTCCATCCGAACATGGCGACGCTCCAGTACGCCGTCTTCTTCAACATGTGCCGCGT  173595

Query  2352    GCACGGCGTGAGCTTTGACCTGC-------------------------------------  2374
               ||||||||||||||| |||||||                                     
Sbjct  173594  GCACGGCGTGAGCTTCGACCTGCAGGTATTTGCGGCACCCTCCCTCTCGGGTCTATAACT  173535

Query  2375    ----------AGAAATCGATTGGCGCCGCGTTCGTGTTGGCCGACAGCCTCACGGCCGGC  2424
                         ||||||| ||||| ||||||||||| |||||||||||||| || ||||||
Sbjct  173534  GTGGGCGCATAGAAATCCATTGGGGCCGCGTTCGTCTTGGCCGACAGCCTGACAGCCGGC  173475

Query  2425    GTCGTCGGGCTTCTCTGCATCGGCGAGTCGGACAAGGAGGCGGTGCGCTTGACCCGGGCC  2484
               |||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||
Sbjct  173474  GTCGTCGGGCTTCTCTGCATTGGCGAGTCGGACAAGGAGGCCGTGCGCTTGACCCGCGCC  173415

Query  2485    GCGCTTGAGCTCATTGGCGACCAAGTCGGCGTGCAGCCTGCACCGGACGCGCTCACGGGC  2544
               ||||| |||||||||||||||||||||||||||||||| || || |||||||| ||||||
Sbjct  173414  GCGCTCGAGCTCATTGGCGACCAAGTCGGCGTGCAGCCGGCGCCAGACGCGCTTACGGGC  173355

Query  2545    GAGCGGCTTGGTAACTTTGCTGCCGTCCTCGGTGCGATCCGATTGCGCCACGACGACATG  2604
               ||||| || || |||||||| |||||||| || |||||||| | ||| ||||||||||||
Sbjct  173354  GAGCGACTCGGCAACTTTGCCGCCGTCCTTGGAGCGATCCGGTCGCGGCACGACGACATG  173295

Query  2605    GTCAAGCGAGCGAAGAAGGCGCGGTCC  2631
               ||||||||||| || ||||| ||| ||
Sbjct  173294  GTCAAGCGAGCCAAAAAGGCCCGGACC  173268

>APIN:scaffold_20 supercont1.20 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.20:1:1003253:1 
REF
Length=1003253

 Score = 378 bits (418),  Expect = 5e-102
 Identities = 365/469 (78%), Gaps = 0/469 (0%)
 Strand=Plus/Minus

Query  875     AGATCAAAATGCAACGGCGGGTCGTCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCG  934
               ||||||| ||||| || || |||||||| || |||||||| || ||| |||| || ||  
Sbjct  378827  AGATCAAGATGCAGCGTCGAGTCGTCGTTCATGTGCCGTCGTTTTCGTCCGAGGAACGAA  378768

Query  935     CGCGGCTCAACATGGACAACTTTGCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCG  994
               | || || || ||||| || ||| ||||||  || || || || ||||||||  | || |
Sbjct  378767  CCCGCCTGAAGATGGAAAATTTTTCGATTCAGCAAAACCTCCAAATGGCGCGCATGTGTG  378708

Query  995     CGATCGCGGATCCCAACGTCGACGTCATCTACATCTCGCCGTTCGAGCTCTCGGTCGACA  1054
               ||||||| ||||| ||||||||| |||| ||||| ||||| |||||||| ||   |||||
Sbjct  378707  CGATCGCAGATCCGAACGTCGACATCATTTACATTTCGCCATTCGAGCTGTCTCCCGACA  378648

Query  1055    TTCAAAAGTACATGATGCGCCTGCTGCAGCTGGGCGGCGTCGCGGACCCGCACTCGCGCG  1114
               |||||||||||    | || || || || || || ||  |||| ||||| ||  ||||| 
Sbjct  378647  TTCAAAAGTACCAAGTCCGACTCCTCCAACTCGGTGGAATCGCCGACCCCCAGACGCGCA  378588

Query  1115    TCCGGATGCTGCACCCGGAGAACGCCGAGCGCTTCCCCGAGCACTTTTCGCTGGCGACGA  1174
               |||| ||||||||||| |||||||  || || || || |||||||||||| || ||||  
Sbjct  378587  TCCGCATGCTGCACCCCGAGAACGTGGACCGGTTTCCAGAGCACTTTTCGTTGACGACCG  378528

Query  1175    TCCTCCTCTACTCGCCGCACTGTCTCAAGAAGATCAAACGCTACGTCCGCGGCAAGGAGG  1234
               | ||| | ||||||||||||||||||||||||||||| || | ||| || ||||| || |
Sbjct  378527  TGCTCTTGTACTCGCCGCACTGTCTCAAGAAGATCAAGCGGTTCGTTCGGGGCAAAGATG  378468

Query  1235    CGTACATCGTCGCAGGCACGGTGGGTCCCGAAGACAAGCGGCTCGCGATCCGACTGCAGC  1294
               | ||||| ||  | || |  || || || ||||||||||||||||| ||   ||||||||
Sbjct  378467  CATACATTGTGACGGGGAACGTTGGCCCGGAAGACAAGCGGCTCGCCATTGCACTGCAGC  378408

Query  1295    TGCCGCTGCTGGGCATGGACCCGGACCGCGCTTTGCTCTACGGCACACG  1343
               | ||||| || || ||||||||||||   ||| ||||||||||||| ||
Sbjct  378407  TTCCGCTCCTCGGGATGGACCCGGACAAGGCTCTGCTCTACGGCACGCG  378359

 Score = 145 bits (160),  Expect = 5e-32
 Identities = 206/290 (71%), Gaps = 0/290 (0%)
 Strand=Plus/Minus

Query  356     TGCATCAGTTTATCATTCGGAAGGGCCAAACGCTTTCCGAGACGCCGGAATTCATCTCGT  415
               |||| ||||| ||||| || || ||| | |||||  |||| ||||| ||||| || ||||
Sbjct  379396  TGCACCAGTTCATCATCCGCAAAGGCAAGACGCTGGCCGACACGCCCGAATTTATTTCGT  379337

Query  416     TCAAGCGCATCACTGAAGACCTTTGGGGCAGCGTCTCGATGGCGATCCGCGAGCTCGAGA  475
               || | || |  || |||||| | ||||||||||| ||||   ||||||  || || ||  
Sbjct  379336  TCCAACGGACTACCGAAGACTTGTGGGGCAGCGTGTCGAAATCGATCCAGGAACTGGAAG  379277

Query  476     CGCTCTTGGTCCACTACTCGGTGCCGCTCGCCTACATTGATGGTCAAAAGCTGCTCAAAA  535
               || |  ||    |||||||||| ||| | || ||| | ||||||||||||||| | || |
Sbjct  379276  CGATGCTGACAAACTACTCGGTTCCGTTGGCTTACGTGGATGGTCAAAAGCTGATGAAGA  379217

Query  536     TCGCAGCCATGGACGCGGTGTCACGCTCCAAGTCGGAGCTGCTCACATGTGTGCTCAACG  595
               | || || ||||||| |  | | |||   | |  ||| || ||  | ||  | |||||| 
Sbjct  379216  TTGCCGCGATGGACGGGACGGCTCGCGGAACGATGGAACTTCTGTCGTGCATTCTCAACA  379157

Query  596     TCGACGAGGTTACGACCTTTATGGCGCGGCCAGGCCAGCGCTTCAAGGGC  645
               | ||||| || |   |  | |||   ||||| || |||||||||||||||
Sbjct  379156  TGGACGAAGTGAGCTCACTCATGCGACGGCCGGGTCAGCGCTTCAAGGGC  379107

 Score = 93.3 bits (102),  Expect = 3e-16
 Identities = 133/184 (72%), Gaps = 4/184 (2%)
 Strand=Plus/Minus

Query  2381    CGATTGGCGCCGCGTTCGTGTTGGCCGACAGCCTCACGGCCGGCGTCGTCGGGCTTCTCT  2440
               ||||||| || |||| | |  |||| ||||||||||| || |||||||| || ||  | |
Sbjct  377007  CGATTGGGGCGGCGTACATCCTGGCAGACAGCCTCACAGCAGGCGTCGTTGGTCTCATAT  376948

Query  2441    GCATCGGCGAGTCGGACAAGGAGGCGGTGCGCTTGACCCGGGCCGCGCTTGAGCTCATTG  2500
               |||| |||||    |||||||||||  | ||  |  |||||   ||  | ||||| ||||
Sbjct  376947  GCATTGGCGAAAGCGACAAGGAGGCATTCCGAATAGCCCGGCAGGCCGTGGAGCTAATTG  376888

Query  2501    GCGACCAAGTCGGCGTGC-AGC-CTGCACCGGACGCGCTCACGGGCGAGCGGCTTGGTAA  2558
               | ||||||||||| || | ||| |||  ||| |  | ||  | ||||| || || || ||
Sbjct  376887  GAGACCAAGTCGGTGTCCAAGCACTG--CCGAATTCTCTGTCTGGCGAACGCCTCGGCAA  376830

Query  2559    CTTT  2562
               ||||
Sbjct  376829  CTTT  376826

 Score = 86.0 bits (94),  Expect = 4e-14
 Identities = 98/132 (74%), Gaps = 0/132 (0%)
 Strand=Plus/Minus

Query  1354    AAGCGGCTTTTTACGCAAGCCGACGTCAACATTCCGTACGGCGCCCACGACATTTACGAC  1413
               |||||  |||| | |   || ||||| || |||||    || || |||||||||||||||
Sbjct  378298  AAGCGCATTTTCATGGCGGCAGACGTGAATATTCCCATGGGGGCGCACGACATTTACGAC  378239

Query  1414    GAAGACGAGCTGATTCTGAGCTTGGCCAAGCTCACGGCCGCCAACTTGCACCAAGGCATG  1473
               ||||||||||| |||| |||||||  |||||| |  || ||| |  |  ||||   |  |
Sbjct  378238  GAAGACGAGCTCATTCAGAGCTTGAGCAAGCTGATTGCAGCCGATATCGACCAGACCGAG  378179

Query  1474    TGGCTCATCAAG  1485
               ||||||||||||
Sbjct  378178  TGGCTCATCAAG  378167

 Score = 71.6 bits (78),  Expect = 9e-10
 Identities = 76/98 (78%), Gaps = 2/98 (2%)
 Strand=Plus/Minus

Query  1489    GATGCGGACCCGTCCGACACGGGC-TTGGCGGCCATCGACATGCACGCGCTCGAGTGCGT  1547
               |||||||| | |||| |||| ||| ||| | ||| || || || ||  | |  || ||||
Sbjct  378111  GATGCGGATCAGTCCAACACTGGCATTGCCAGCC-TCAACGTGGACAAGATGCAGAGCGT  378053

Query  1548    CAACAAAGTCCGCGCCGAGAAGCGCGCGATGAAGAACG  1585
               |  |||| |||||||||||||||||| ||||||| |||
Sbjct  378052  CGCCAAATTCCGCGCCGAGAAGCGCGAGATGAAGCACG  378015

 Score = 66.2 bits (72),  Expect = 4e-08
 Identities = 65/83 (78%), Gaps = 6/83 (7%)
 Strand=Plus/Minus

Query  25      TACGACCG---GTCCGAGCAGCCTGTCAAGTCGCAGCCCTACATGAACTCGTCGGGCTTC  81
               ||||||||   ||||   ||||| ||||||||   ||| |||| |||| |||||||||||
Sbjct  379895  TACGACCGAGCGTCC---CAGCCCGTCAAGTCCATGCCGTACACGAACCCGTCGGGCTTC  379839

Query  82      AACGTAGCGTCGCTAAAGCTTGA  104
               ||| | ||||| || ||| ||||
Sbjct  379838  AACATGGCGTCACTCAAGTTTGA  379816

 Score = 61.7 bits (67),  Expect = 2e-06
 Identities = 104/147 (71%), Gaps = 8/147 (5%)
 Strand=Plus/Minus

Query  1776    CGTTCGCGCCAACGTCTTCATCGAACCGTCCGGCGGCGTGCACGTGACGTCGGCGCAGGA  1835
               ||| ||| | ||| ||||||| || |||||||||||||| ||| | ||||| ||||| ||
Sbjct  377723  CGTCCGCACTAACATCTTCATTGAGCCGTCCGGCGGCGTTCACATTACGTCTGCGCACGA  377664

Query  1836    GCAGTTGATGCACGTCAAG--AACAAGCACCAAAGCGTC--GGCGCCGTGTACCCGCCAA  1891
                  ||| |||   | | ||  |||||||||    || ||   |||| || |  ||||   
Sbjct  377663  CGTGTTCATG--TGCCCAGTCAACAAGCAC--TTGCCTCAGTGCGCAGTCTTTCCGCAGT  377608

Query  1892    CGGCCGTGCCCTACGCAGCGATCCGCG  1918
               || |||| || ||   |||||||||||
Sbjct  377607  CGTCCGTTCCGTATCAAGCGATCCGCG  377581

>APAS:scaffold_12 supercont1.12 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.12:1:1206637:1 
REF
Length=1206637

 Score = 355 bits (393),  Expect = 6e-95
 Identities = 360/469 (77%), Gaps = 0/469 (0%)
 Strand=Plus/Plus

Query  875     AGATCAAAATGCAACGGCGGGTCGTCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCG  934
               |||| ||||||||||||||||| ||||| || |||||||| ||  |  | || || ||| 
Sbjct  730070  AGATGAAAATGCAACGGCGGGTGGTCGTACATGTGCCGTCGTTTGCATCAGACGACCGCA  730129

Query  935     CGCGGCTCAACATGGACAACTTTGCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCG  994
               ||||| | || |||||||||||| | || ||||| || || || ||||||||  | || |
Sbjct  730130  CGCGGTTGAAGATGGACAACTTTTCCATCCGTCAAAACCTCCAAATGGCGCGCATGTGTG  730189

Query  995     CGATCGCGGATCCCAACGTCGACGTCATCTACATCTCGCCGTTCGAGCTCTCGGTCGACA  1054
               ||||||| || || ||||| ||| | ||||||||||| ||||||||| | ||    ||||
Sbjct  730190  CGATCGCCGACCCAAACGTGGACATTATCTACATCTCACCGTTCGAGTTGTCCCCAGACA  730249

Query  1055    TTCAAAAGTACATGATGCGCCTGCTGCAGCTGGGCGGCGTCGCGGACCCGCACTCGCGCG  1114
               | |||| ||||    | ||  |||| ||||| || ||  || ||||||| ||  | ||| 
Sbjct  730250  TCCAAAGGTACCAAGTACGGTTGCTCCAGCTCGGGGGGATCACGGACCCCCAGACCCGCA  730309

Query  1115    TCCGGATGCTGCACCCGGAGAACGCCGAGCGCTTCCCCGAGCACTTTTCGCTGGCGACGA  1174
               |||| ||| ||||||| || || | ||| || || || ||||||||||| ||  ||||| 
Sbjct  730310  TCCGCATGTTGCACCCCGAAAATGTCGACCGGTTTCCAGAGCACTTTTCACTCACGACGT  730369

Query  1175    TCCTCCTCTACTCGCCGCACTGTCTCAAGAAGATCAAACGCTACGTCCGCGGCAAGGAGG  1234
               | || || || |||||||||||||||||||||||||| || |  || || || ||| | |
Sbjct  730370  TGCTACTGTATTCGCCGCACTGTCTCAAGAAGATCAAGCGGTTTGTGCGAGGAAAGAACG  730429

Query  1235    CGTACATCGTCGCAGGCACGGTGGGTCCCGAAGACAAGCGGCTCGCGATCCGACTGCAGC  1294
               ||||||| ||| |||| |  || || ||||||||||||||||| || |||   |||||| 
Sbjct  730430  CGTACATTGTCACAGGAAACGTCGGGCCCGAAGACAAGCGGCTGGCCATCGCGCTGCAGA  730489

Query  1295    TGCCGCTGCTGGGCATGGACCCGGACCGCGCTTTGCTCTACGGCACACG  1343
               | ||||||||||| |||||||| |||   ||  |||| |||||||||||
Sbjct  730490  TTCCGCTGCTGGGTATGGACCCAGACAAGGCGCTGCTGTACGGCACACG  730538

 Score = 136 bits (150),  Expect = 3e-29
 Identities = 206/292 (71%), Gaps = 6/292 (2%)
 Strand=Plus/Plus

Query  356     TGCATCAGTTTATCATTCGGAAGGGCCAAACGCTTTCCGAGACGCCGGAATTCATCTCGT  415
               |||||||||||||||| || || ||| | || || ||||| ||||| || || || ||||
Sbjct  729482  TGCATCAGTTTATCATCCGCAAAGGCAAGACACTGTCCGACACGCCCGAGTTTATTTCGT  729541

Query  416     TCAAGCGCATCACTGAAGACCTTTGGGGCAGCGTCTCGATGGCGATCCGCGAGCTCGAGA  475
               |  |||| |  || |||||| | ||||||||||| |||| | | || |  ||| | ||||
Sbjct  729542  TTCAGCGGACGACAGAAGACTTGTGGGGCAGCGTGTCGACGTCCATACAAGAGTTGGAGA  729601

Query  476     C---GCTCTTGGTCCACTACTCGGTGCCGCTCGCCTACATTGATGGTCAAAAGCTGCTCA  532
               |   ||||  |     ||| || |||||||| || ||| |||| || || |||||| | |
Sbjct  729602  CCATGCTCACG---AGCTATTCCGTGCCGCTGGCGTACGTTGACGGCCAGAAGCTGATGA  729658

Query  533     AAATCGCAGCCATGGACGCGGTGTCACGCTCCAAGTCGGAGCTGCTCACATGTGTGCTCA  592
               | ||||| || |||||||||    | |||  || | | |||||  |  | ||  | ||||
Sbjct  729659  AGATCGCCGCGATGGACGCGACAACGCGCGGCACGACCGAGCTCTTGTCGTGCATCCTCA  729718

Query  593     ACGTCGACGAGGTTACGACCTTTATGGCGCGGCCAGGCCAGCGCTTCAAGGG  644
               || | ||||| || |   |  | |||   ||||| || ||||||| ||||||
Sbjct  729719  ACATGGACGAAGTGAGTTCGCTCATGCGACGGCCTGGACAGCGCTACAAGGG  729770

 Score = 117 bits (129),  Expect = 3e-23
 Identities = 316/474 (67%), Gaps = 21/474 (4%)
 Strand=Plus/Plus

Query  1918    GGCGCGTCGTTGGCGGTCGCGCAAG--CCATGTACGCGAGCGGCATCATTGGCTACGCGA  1975
               ||||||||||||||| | ||  |||  |||||| |   |  |||||||||||||| || |
Sbjct  731421  GGCGCGTCGTTGGCGATTGC--AAGTTCCATGTTCATCAAAGGCATCATTGGCTATGCCA  731478

Query  1976    GCATCGACTATGTGGCGTTTCTCGACGTCAAGACGGTCAACGGGAAGGCGGGGCCGCCGC  2035
               ||||||||||  ||   ||   ||||  ||||||| |    |||  |||||| | ||| |
Sbjct  731479  GCATCGACTACATGAGCTTCGCCGACCCCAAGACGTTGGTGGGG--GGCGGG-CGGCCTC  731535

Query  2036    ACTTGCGGCTCTGGGCCCTCCAGCTCTTGCCGTGCCTCACGCCGACGGCCATGTCCTTCG  2095
                |  ||| || |||||| | ||  || | ||  | |||||    |||||| |||| || |
Sbjct  731536  GCCAGCGTCTGTGGGCCATGCAAGTCGTCCCTGGACTCACCAATACGGCCGTGTCGTTTG  731595

Query  2096    TGCTCTTCACCTTTTTGTCGTGCGCGACGCTGGACGCGGCGACGGGCCGCAGTTTCCTCC  2155
               |  | ||  | ||  |||| ||| ||  | |  || |    ||||||    ||   ||||
Sbjct  731596  TCATGTTTGCGTTCCTGTCCTGCTCGCAGTTCAACCCAATCACGGGCAAATGTCATCTCC  731655

Query  2156    CGCTGCCCGCACCGCGTCCG-TCGTCGCTTGCGGGCCCG------CCAGCAACCGAGACG  2208
                | || |||| ||||  ||  ||| ||| |  | | |||      ||| || || || ||
Sbjct  731656  AGGTGGCCGCCCCGCCCCCCATCGCCGCCTCGGCGACCGTCGCCCCCATCACCCAAG-CG  731714

Query  2209    CAGTTGGCGGTCGAAAAAATCTTGGGCGAGAGTTCGCC---TGCCGCGACGAT--GGGGG  2263
               |||  ||||||||| |  ||  || |||   |  ||||   || ||||    |  | || 
Sbjct  731715  CAGAAGGCGGTCGAGACCATTCTGAGCGCCCGACCGCCCAATGGCGCGGTTGTCTGCGGA  731774

Query  2264    CC-GAGCGCGCCTACATTGCGCACGAGTACATCTTCCACCCGAACATGGCCACGCTCCAG  2322
               || |||||  | ||||| | ||  || ||||| | |||||| |||||||| || || || 
Sbjct  731775  CCAGAGCGAACTTACATGGTGCTGGACTACATTTACCACCCCAACATGGCAACCCTGCAC  731834

Query  2323    TACGCCGTCTTCTTCAACATGTGCCGCGTGCACGGCGTGAGCTTTGACCTGCAG  2376
               |   ||   |||||||||| ||||||  |  |||||||||||||||||||||||
Sbjct  731835  TTTTCCACGTTCTTCAACACGTGCCGACTCAACGGCGTGAGCTTTGACCTGCAG  731888

 Score = 113 bits (125),  Expect = 3e-22
 Identities = 133/180 (74%), Gaps = 0/180 (0%)
 Strand=Plus/Plus

Query  2383    ATTGGCGCCGCGTTCGTGTTGGCCGACAGCCTCACGGCCGGCGTCGTCGGGCTTCTCTGC  2442
               |||||||| |||||| |  | || |||||||||||||| |||||  | ||| |  | |||
Sbjct  731952  ATTGGCGCGGCGTTCATTCTAGCGGACAGCCTCACGGCGGGCGTGATGGGGTTGATGTGC  732011

Query  2443    ATCGGCGAGTCGGACAAGGAGGCGGTGCGCTTGACCCGGGCCGCGCTTGAGCTCATTGGC  2502
               || |||||    |||||||||||| | ||  |  | |||   ||| | || || ||||| 
Sbjct  732012  ATTGGCGAAAACGACAAGGAGGCGTTTCGAATAGCACGGCAGGCGGTGGAACTGATTGGG  732071

Query  2503    GACCAAGTCGGCGTGCAGCCTGCACCGGACGCGCTCACGGGCGAGCGGCTTGGTAACTTT  2562
               |||||||| ||||||||| |    |||||| | ||| ||||||| || || || ||||||
Sbjct  732072  GACCAAGTGGGCGTGCAGGCGCTGCCGGACTCCCTCTCGGGCGAACGACTGGGCAACTTT  732131

 Score = 76.1 bits (83),  Expect = 8e-11
 Identities = 85/114 (75%), Gaps = 0/114 (0%)
 Strand=Plus/Plus

Query  1372    GCCGACGTCAACATTCCGTACGGCGCCCACGACATTTACGACGAAGACGAGCTGATTCTG  1431
               || ||||||||||||||    || || ||||| |||||||||||||||||||| ||||  
Sbjct  730625  GCAGACGTCAACATTCCCATGGGAGCGCACGATATTTACGACGAAGACGAGCTCATTCAA  730684

Query  1432    AGCTTGGCCAAGCTCACGGCCGCCAACTTGCACCAAGGCATGTGGCTCATCAAG  1485
               ||||||  |||| | |  |||||  || |  ||||   |  ||||||  |||||
Sbjct  730685  AGCTTGAGCAAGTTGATTGCCGCGGACGTTGACCAGAACGAGTGGCTTGTCAAG  730738

 Score = 64.4 bits (70),  Expect = 1e-07
 Identities = 62/80 (78%), Gaps = 0/80 (0%)
 Strand=Plus/Plus

Query  40      CAGCCTGTCAAGTCGCAGCCCTACATGAACTCGTCGGGCTTCAACGTAGCGTCGCTAAAG  99
               ||||| ||||| ||   ||| ||||  ||| |||||||||||||| | |||||||| |||
Sbjct  729006  CAGCCAGTCAAATCCATGCCGTACACCAACCCGTCGGGCTTCAACATGGCGTCGCTCAAG  729065

Query  100     CTTGATCTGGCGCCGCCCCC  119
                ||||  || || || ||||
Sbjct  729066  TTTGACATGTCGACGACCCC  729085

 Score = 57.2 bits (62),  Expect = 2e-05
 Identities = 46/56 (82%), Gaps = 0/56 (0%)
 Strand=Plus/Plus

Query  298     TTGCGCAACAACGTCGAGAAGATTCGCGGCTACAACGACCTCCTCGACACCTACAG  353
               ||||||   ||||||||||| || || ||||||||||| || || ||||| |||||
Sbjct  729334  TTGCGCCGAAACGTCGAGAAAATACGTGGCTACAACGAACTGCTTGACACGTACAG  729389

 Score = 57.2 bits (62),  Expect = 2e-05
 Identities = 70/96 (73%), Gaps = 0/96 (0%)
 Strand=Plus/Plus

Query  1489    GATGCGGACCCGTCCGACACGGGCTTGGCGGCCATCGACATGCACGCGCTCGAGTGCGTC  1548
               || || |||| ||||||||||||| | ||   |||| || | ||   | |  || |||| 
Sbjct  730801  GACGCCGACCAGTCCGACACGGGCATCGCCAGCATCAACGTCCAGCAGATGCAGAGCGTG  730860

Query  1549    AACAAAGTCCGCGCCGAGAAGCGCGCGATGAAGAAC  1584
                 |||||| |||||||||||||| |  |||||| ||
Sbjct  730861  GCCAAAGTTCGCGCCGAGAAGCGAGACATGAAGCAC  730896

 Score = 50.9 bits (55),  Expect = 0.003
 Identities = 101/146 (69%), Gaps = 8/146 (5%)
 Strand=Plus/Plus

Query  1777    GTTCGCGCCAACGTCTTCATCGAACCGTCCGGCGGCGTGCACGTGACGTCGGCGCAGGAG  1836
               || || ||||||||||| || || || || ||||| |||||| | ||||| || || || 
Sbjct  731215  GTCCGGGCCAACGTCTTTATTGAGCCTTCAGGCGGAGTGCACATCACGTCTGCACACGAC  731274

Query  1837    CAGTTGATGCACGTCAAG--AACAAGCACCAAAGCGTC--GGCGCCGTGTACCCGCCAAC  1892
                  || |||   ||| ||  ||||| ||||   || ||   ||||  | | |||||  ||
Sbjct  731275  TTATTCATG--AGTCCAGCCAACAAACACC--TGCCTCAGTGCGCTCTCTTCCCGCAGAC  731330

Query  1893    GGCCGTGCCCTACGCAGCGATCCGCG  1918
               | | ||||| ||   ||| |||||||
Sbjct  731331  GTCAGTGCCATATCAAGCCATCCGCG  731356

>PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_8:1:111390:1 
REF
Length=111390

 Score = 233 bits (258),  Expect = 1e-58
 Identities = 752/1152 (65%), Gaps = 29/1152 (3%)
 Strand=Plus/Minus

Query  289    ATTGACGAGTTGCGCAACAACGTCGAGAAGATTCGCGGCTACAACGACCTCCTCGACACC  348
              || |||||||||||||| ||||| |||||||| ||||| || ||||| ||||| ||||| 
Sbjct  99804  ATGGACGAGTTGCGCAAGAACGTGGAGAAGATCCGCGGGTATAACGAGCTCCTGGACACG  99745

Query  349    TACAGCCTGCATCAGTTTATCATTCGGAAGGGCCAAACGCTTTCCGAGACGCCGGAATTC  408
              ||||| ||||||||||| |||||||  ||||| |   || |   ||||||||| || |||
Sbjct  99744  TACAGTCTGCATCAGTTCATCATTCACAAGGGTCGGGCGATGCGCGAGACGCCCGAGTTC  99685

Query  409    ATCTCGTTCAAGCGCATCACTGAAGACCTTTGGGGCAGCGTCTCGATGGCGATCCGCGAG  468
               | |||||||||||| |  |  | ||  | ||||| ||||||  |  || |||| | |  
Sbjct  99684  GTGTCGTTCAAGCGCGTGGCGCAGGAAGTCTGGGGGAGCGTCGAGGAGGTGATCAGGGCC  99625

Query  469    CTCGAGACGCTCTTGGTCCACTACTCGGTGCCGCTCGCCTACATTGATGGTCAAAAGCTG  528
              || ||| ||||  |    | |||||  ||||| ||||| ||||| || || ||   ||  
Sbjct  99624  CTTGAGGCGCTGCTCACGCGCTACTTCGTGCCACTCGCGTACATCGACGGCCA---GCGA  99568

Query  529    CTCAAAA---TCGCAGCCATGGACGCGGTGTCACGCTCCAAGTCGGAGCTGCTCACATGT  585
              ||||  |   |||| || |||||   || | |   |  ||||   ||  ||||| | || 
Sbjct  99567  CTCATGACGGTCGCGGCGATGGAGATGGCGGCGTTCAGCAAGCGCGACTTGCTCTCGTGC  99508

Query  586    GTGCTCAACGTCGACGAGGTTACGACCTTTATGGCGCGGCCAGGCCAGCGCTTCAAGGGC  645
               |  | ||||  ||| ||||     |  ||||    || || || ||||| | |||||||
Sbjct  99507  ATCGTGAACGAAGACCAGGTCGGCTCGCTTATCCGACGCCCCGGACAGCGGTACAAGGGC  99448

Query  646    GGGGATGGCCGGCACGCGGCGGCGATCGTCATCCAGTCGGTCTACCGCATGC------AT  699
                 ||  ||  || |   || ||||||   |||||     ||| |||||||       ||
Sbjct  99447  AAAGACCGCAAGCGCCGCGCCGCGATCACGATCCAAAACTTCTTCCGCATGTGGTGGAAT  99388

Query  700    CGCACGCGG--CGGCTGCTGCGGCAGCACCA-CGGGCACTCGTACGCGACGCACATTCAG  756
              |  | |  |  |  | ||| | ||  ||||| |  |||  |||  | |||   ||| |||
Sbjct  99387  CAGAAGAAGTACACCCGCTTCCGC--CACCATCTCGCAAGCGTT-GTGAC---CATCCAG  99334

Query  757    CGCGTGTATCGAACGTACAAGTGCGTCAAAGACATCCAAGTCAAGCT--ACGACTGGCGC  814
              || || |  ||  ||| |  | ||  | ||  | || |   ||||||  |   |  ||||
Sbjct  99333  CGGGTATGGCGCGCGTTCGCGAGCCACGAAAGCCTCAAGCGCAAGCTCAAGTTCCAGCGC  99274

Query  815    GCGAGGCCGACGCCCGCACATGGGAGACGCAAATGACCACGTTCCACGC-CAACTGGGAC  873
              |||  || | | |  ||| ||||||| |  | ||| |  ||   || || | |||||   
Sbjct  99273  GCGCAGCAG-CACGAGCA-ATGGGAGGCCAAGATG-CAGCGCCTCAAGCGCGACTGGACG  99217

Query  874    AAGATCAAAATGCAACGGCGGGTCGTCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGC  933
               | |||||   | | || || || ||| |||||||||||||  |||||   || ||||| 
Sbjct  99216  CATATCAAGGGGAATCGCCGCGTGGTCATCCACGTGCCGTCGCTCTCGATTGACGAGCGG  99157

Query  934    GCGCGGCTCAACATGGACAACTTTGCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGC  993
               | ||  ||| |   ||||| ||  || |    |||||| | ||| |  |||| ||||||
Sbjct  99156  TCTCGCATCAGCGCCGACAATTTCTCGGTCAAGCAGAATATCCAGCTCTCGCGGCTCTGC  99097

Query  994    GCGATCGCGGATCCCAACGTCGACGTCATCTACATCTCGCCGTTCGAGCTCTCGGTCGAC  1053
              |   |    || || ||||||||| |  ||||| ||||||| || |||||| ||| ||||
Sbjct  99096  GGACTTATCGACCCAAACGTCGACATTGTCTACGTCTCGCCCTTTGAGCTCACGGCCGAC  99037

Query  1054   ATTCAAAAGTACATGATGCGCCTGCTGCAGCTGGGCGGCGTCGCGGACCCGCACTCGCGC  1113
               |     |||||  ||||    |||||||||| || ||  | ||||||||   | |||||
Sbjct  99036  GTGGCGCAGTACTCGATGAAGTTGCTGCAGCTTGGAGGGATTGCGGACCCCGTCGCGCGC  98977

Query  1114   GTCCGGATGCTGCACCCGGAGAACGCCGAGCGCTTCCCCGAGCACTTTTCGCTGGCGACG  1173
              ||     |  || | || ||| | || | ||| ||||| | ||||||||||||  |||||
Sbjct  98976  GTGAAACTCGTGTATCCTGAGCAAGCGGCGCGGTTCCCAGCGCACTTTTCGCTCACGACG  98917

Query  1174   ATCCTCCTCTACTCGCCGCACTGTCTCAAGAAGATCAAACGCTACGTCCGCGGCAAGGAG  1233
               || |  | |||||||||||||||||   |   ||| | || ||| |  |   |||||||
Sbjct  98916  CTCTTGTTGTACTCGCCGCACTGTCTGCGGCGTATCCAGCGGTACATTAGAAACAAGGAG  98857

Query  1234   GCGTACATCGTCGCAGGCACGGTGGGTCCCGAAGACAAGCGGCTCGCGATCCGACTGCAG  1293
              |||||| | ||| | || |     || | |||||||||||| |||||| |     || | 
Sbjct  98856  GCGTACTTGGTCACGGGGATTCCCGGACGCGAAGACAAGCGACTCGCGGTGGCGTTGAAC  98797

Query  1294   CTGCCGCTGCTGGGCATGGACCCGGACCGCGCTTTG-CTCTACGGCACACGCTCGGGTGC  1352
               ||||| | || |||||||||||   | |||| ||| | ||   |  || | |||||   
Sbjct  98796  GTGCCGATCCTCGGCATGGACCCACTCAGCGCATTGCCACTCATGACCAAG-TCGGGCAG  98738

Query  1353   GAAGCGGCTTTTTACGCAAGCCGACGTCAACATTCCGTACGGCGCCCACGACATTTACGA  1412
               |||||  | || | ||  || || || ||| | ||    ||| |  | ||||| |||||
Sbjct  98737  CAAGCGCTTCTTCATGCGCGCGGATGTGAACGTGCCCACGGGCACGTATGACATCTACGA  98678

Query  1413   CGAAGACGAGCT  1424
              ||| ||||||||
Sbjct  98677  CGAGGACGAGCT  98666

 Score = 93.3 bits (102),  Expect = 3e-16
 Identities = 120/166 (72%), Gaps = 0/166 (0%)
 Strand=Plus/Minus

Query  2267   AGCGCGCCTACATTGCGCACGAGTACATCTTCCACCCGAACATGGCCACGCTCCAGTACG  2326
              ||||| | ||| |||    ||||||||| |||||||||||| |  ||||| | || ||| 
Sbjct  97687  AGCGCACGTACGTTGTCAGCGAGTACATTTTCCACCCGAACGTATCCACGATGCAATACA  97628

Query  2327   CCGTCTTCTTCAACATGTGCCGCGTGCACGGCGTGAGCTTTGACCTGCAGAAATCGATTG  2386
               ||  |||||  |||  || ||  ||||||||||  |||||||| |  ||   |   | |
Sbjct  97627  GCGCGTTCTTTCACACCTGTCGGCTGCACGGCGTCTGCTTTGACGTCGAGCGCTGCGTCG  97568

Query  2387   GCGCCGCGTTCGTGTTGGCCGACAGCCTCACGGCCGGCGTCGTCGG  2432
              || ||| |||| || | |||||||| ||||| ||||| ||| ||||
Sbjct  97567  GCTCCGTGTTCCTGCTCGCCGACAGTCTCACCGCCGGGGTCTTCGG  97522

>PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_711:1:15030:1 
REF
Length=15030

 Score = 194 bits (214),  Expect = 1e-46
 Identities = 760/1166 (65%), Gaps = 57/1166 (5%)
 Strand=Plus/Minus

Query  289    ATTGACGAGTTGCGCAACAACGTCGAGAAGATTCGCGGCTACAACGACCTCCTCGACACC  348
              || |||||||||||||| || ||||||||||| ||||| |||||||| || || ||||| 
Sbjct  14422  ATGGACGAGTTGCGCAAGAATGTCGAGAAGATCCGCGGGTACAACGAGCTGCTGGACACG  14363

Query  349    TACAGCCTGCATCAGTTTATCATTCGGAAGGGCCAAACGCTTTCCGAGACGCCGGAATTC  408
              ||||| || || ||||| ||||| |  || ||||   || |   ||||||||| || || 
Sbjct  14362  TACAGTCTCCACCAGTTCATCATCCACAAAGGCCGCGCGATGCGCGAGACGCCTGAGTTT  14303

Query  409    ATCTCGTTCAAGCGCATCACTGAAGACCTTTGGGGCAGCGTCTCGATG--GCGATCCGCG  466
               | || ||||||||| |  |  | ||  ||||||||||||  ||||||  | ||||   |
Sbjct  14302  GTGTCCTTCAAGCGCGTGGCGCAGGAGGTTTGGGGCAGCG--TCGATGAAGTGATCAAGG  14245

Query  467    AGCTCGAGACGCTCTTGGTCCACTACTCGGTGCCGCTCGCCTACATTGATGGTCAAAAGC  526
                |||||| ||||  |    | |||||  ||||| ||||| ||| | || || |   |||
Sbjct  14244  CACTCGAGGCGCTGCTCACGCGCTACTTCGTGCCTCTCGCGTACGTCGACGGCC---AGC  14188

Query  527    TGCTCAAAA---TCGCAGCCATGGACGCGGTGTCACGCTCCAAGTCGGAGCTGCTCACAT  583
                ||||  |   |||| || |||||   || |||   |  ||||  ||| |||||| | |
Sbjct  14187  GACTCATGACGGTCGCGGCGATGGAGATGGCGTCCTACAGCAAGCGGGACCTGCTCTCGT  14128

Query  584    GTGTGCTCAACGTCGACGAGGTTACGACCTTTATGGCGCGGCCAGGCCAGCGCTTCAAGG  643
              |  |  ||||||  ||| ||||   | |  | ||   ||| || |||||||||| ||| |
Sbjct  14127  GCATCGTCAACGAGGACCAGGTCGGGTCGCTCATCCGGCGACCGGGCCAGCGCTACAAAG  14068

Query  644    GCGGGGATGGC---CGGCACGCGGCGGCGATCGTCATCCAGTCGGTCTACCGCATG-CAT  699
              ||  |||  ||   || | ||| || | || ||  || |||    ||| |||||||   |
Sbjct  14067  GCAAGGACCGCAAGCGCCGCGCAGCCGTGA-CG--ATTCAGAACTTCTTCCGCATGTGGT  14011

Query  700    CGCACGCG-------GCGGCTGCTGCGGCAGCACCACGGGCACTCGTACG-CGACGCACA  751
               | ||  |        | |  ||| | ||  ||||||   | | ||  || ||  || ||
Sbjct  14010  GGAACCAGAAGAAGTACAGTCGCTTCCGC--CACCAC---CTCGCGAGCGTCGTGGC-CA  13957

Query  752    TTCAGCGCGTGTATCGAACGTACAAGTGCGTCAAAGACATCCAAGTCAAGCT-ACGACTG  810
              |||| ||||| |  ||   |||   | ||  | | ||| || |   || | | | ||   
Sbjct  13956  TTCAACGCGTCTGGCGCGTGTATGCGAGCCACGATGACCTCAAGCGCAGGATCAAGA---  13900

Query  811    GCGCGCGAG-GCCGACGCCCGCACA-TGGGAGACGCAAATGACCACGTTCCACGC-CAAC  867
              ||  |||||  | |  || ||| || |||||  |  | ||| | |||   || || | ||
Sbjct  13899  GCCAGCGAGATCAGCAGCACGCGCAGTGGGAAGCCAAGATG-CAACGGCTCAAGCGCGAC  13841

Query  868    TGGGACAAG-ATCAAAATGCAA-CGGCGGGTCGTCGTCCACGTGCCGTCCTTCTCGGCCG  925
              | ||| | | ||| ||| |||| || || || ||| | |||||||| |||||||| |  |
Sbjct  13840  T-GGATACGCATC-AAAGGCAACCGCCGCGTGGTCATTCACGTGCCATCCTTCTCAGTTG  13783

Query  926    AAGAGCGCGCGCGGCTCAACATGGACAACTTTGCGATTCGTCAGAATCTGCAGATGGCGC  985
              | || |||  ||| |||| |   ||||| ||  || |    |||||||| ||| |  |||
Sbjct  13782  ACGAACGCTTGCGTCTCAGCGCCGACAATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGC  13723

Query  986    GTCTCTGCGCGATCGCGGATCCCAACGTCGACGTCATCTACATCTCGCCGTTCGAGCTC-  1044
              | |||||||   |||  ||  | ||||| ||| |  ||||  |||| || || |||||| 
Sbjct  13722  GACTCTGCGGCCTCGTCGACTCGAACGTAGACATTGTCTATGTCTCACCCTTTGAGCTCA  13663

Query  1045   --TCGGTCGACATTCAAAAGTACATGATGCGCCTGCTGCAGCTGGGCGGCGTCGCGGACC  1102
                 ||| ||   | ||| | |  |||| |   || || ||||| |||||| |||| ||||
Sbjct  13662  CGACGGACGTGGTGCAATACTCAATGAAG---CTTCTACAGCTTGGCGGCATCGCCGACC  13606

Query  1103   CGCACTCGCGCGTCCGGATGCTGCAC---CCGGAGAACGCCGAGCGCTTCCCCGAGCACT  1159
              |   | | |||||   || |||   |   || ||| | ||   ||| |||||    ||||
Sbjct  13605  CCGTCGCTCGCGT---GAAGCTCGTCTTTCCCGAGCATGCACCGCGGTTCCCGACACACT  13549

Query  1160   TTTCGCTGGCGACGATCCTCCTCTACTCGCCGCACTGTCTCAAGAAGATCAAACGCTACG  1219
              | |||||  ||||| || | || || || || ||||||||       ||| | || ||| 
Sbjct  13548  TCTCGCTCACGACGCTCTTGCTGTATTCCCCACACTGTCTTCGCCGTATCCAGCGGTACA  13489

Query  1220   TCCGCGGCAAGGAGGCGTACATCGTCGCAGGCACGGTGGGTCCCGAAGACAAGCGGCTCG  1279
              ||     ||||||||||||| | ||| | |||| |   ||||| || || ||||| ||||
Sbjct  13488  TCAAGAACAAGGAGGCGTACCTGGTCACGGGCATGCCCGGTCCAGAGGATAAGCGTCTCG  13429

Query  1280   CGATCCGACTGCAGCTGCCGCTGCTGGGCATGGACCCGGACCGCGCTTTG-CTCTACGGC  1338
              | ||    ||  |  ||||| | || || ||||| |||  | ||||  || | ||   | 
Sbjct  13428  CCATGGCGCTCAATGTGCCGATCCTCGGTATGGATCCGCTCAGCGCCCTGCCACTCATGA  13369

Query  1339   ACACGCTCGGGTGCGAAGCGGCTTTTTACGCAAGCCGACGTCAACATTCCGTACGGCGCC  1398
               || | || ||||  |||||  | || | ||  |||||||| ||  | ||    ||| | 
Sbjct  13368  CCAAG-TCTGGTGGCAAGCGCTTCTTCATGCGCGCCGACGTGAATGTGCCCACGGGCACG  13310

Query  1399   CACGACATTTACGACGAAGACGAGCT  1424
               |||||||||||||||| ||||||||
Sbjct  13309  TACGACATTTACGACGAGGACGAGCT  13284

 Score = 96.0 bits (105),  Expect = 8e-17
 Identities = 111/150 (74%), Gaps = 0/150 (0%)
 Strand=Plus/Minus

Query  2286   CGAGTACATCTTCCACCCGAACATGGCCACGCTCCAGTACGCCGTCTTCTTCAACATGTG  2345
              |||||||||||||||||||||| || | ||  | ||||||  || ||||||| |||  ||
Sbjct  12307  CGAGTACATCTTCCACCCGAACGTGTCGACCATGCAGTACAGCGCCTTCTTCCACACCTG  12248

Query  2346   CCGCGTGCACGGCGTGAGCTTTGACCTGCAGAAATCGATTGGCGCCGCGTTCGTGTTGGC  2405
               ||  ||||||||||  |||| ||| || ||   |   | ||| | |  ||  |  | ||
Sbjct  12247  TCGGCTGCACGGCGTCTGCTTCGACGTGGAGCGCTGTGTGGGCTCGGTCTTTCTCCTTGC  12188

Query  2406   CGACAGCCTCACGGCCGGCGTCGTCGGGCT  2435
              |||||||||||||||||| ||| |||| ||
Sbjct  12187  CGACAGCCTCACGGCCGGTGTCTTCGGCCT  12158

 Score = 45.5 bits (49),  Expect = 0.13
 Identities = 38/47 (81%), Gaps = 0/47 (0%)
 Strand=Plus/Minus

Query  1964   TTGGCTACGCGAGCATCGACTATGTGGCGTTTCTCGACGTCAAGACG  2010
              ||||||||||||||||||||| | ||| ||| |  || | |||| ||
Sbjct  12638  TTGGCTACGCGAGCATCGACTTTCTGGTGTTCCAGGAAGACAAGTCG  12592

>PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:pug:scf1117875582037:1:1414051:1 
REF
Length=1414051

 Score = 149 bits (164),  Expect = 4e-33
 Identities = 414/626 (66%), Gaps = 12/626 (2%)
 Strand=Plus/Plus

Query  899      TCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCGCGCGGCTCAACATG--GACAACTT  956
                || |||||||||||||  | |||  ||| || ||    ||  ||  | ||  ||||||||
Sbjct  1310420  TCATCCACGTGCCGTCGCTGTCGATCGACGAACGGTTCCGCATC--CGTGCCGACAACTT  1310477

Query  957      TGCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCGCGATCGCGGATCCCAACGTCGA  1016
                 ||| |    ||||| |||||| |  |||| |||||||  |||   ||  | || |||||
Sbjct  1310478  CGCGGTCAAGCAGAACCTGCAGCTCTCGCGGCTCTGCGGCATCATTGACGCGAATGTCGA  1310537

Query  1017     CGTCATCTACATCTCGCCGTTCGAGCTCTCGGTCGACATTCAAAAGTACATGATGCGCCT  1076
                | |  | ||| |||||||||| |||||  ||  |||  |     ||||| | |||   ||
Sbjct  1310538  CATTGTGTACGTCTCGCCGTTTGAGCTGACGTCCGAGGTCGGCCAGTACTTTATGAAGCT  1310597

Query  1077     GCTGCAGCTGGGCGGCGTCGCGGACCCGCACTCGCGCGTCCGGATGCTGCACCCGGAGAA  1136
                ||| || || || ||| |||| |||||     |||| |||    || ||   || ||| |
Sbjct  1310598  GCTACAACTTGGAGGCATCGCAGACCCCGTGACGCGAGTCAAACTGGTGTTTCCCGAGCA  1310657

Query  1137     CGCCGAGCGCTTCCCCGAGCACTTTTCGCTGGCGACGATCCTCCTCTACTCGCCGCACTG  1196
                 ||    || || || | ||| || |||||  ||||| | || || ||||||||||| ||
Sbjct  1310658  AGCGACTCGGTTTCCGGCGCATTTCTCGCTCACGACGGTGCTGCTGTACTCGCCGCATTG  1310717

Query  1197     TCTCAAGAAGATCAAACGCTACGTCCGCGGCAAGGAGGCGTACATCGTCGCAGGCACGGT  1256
                |||       |||  ||| | ||||   ||||| || |||||| | ||| | || | |  
Sbjct  1310718  TCTGCGCCGTATCCGACGGTGCGTCAAGGGCAAAGAAGCGTACCTGGTCACGGGGATGCC  1310777

Query  1257     GGGTCCCGAAGACAAGCGGCTCGCGATCCGACTGCAGCTGCCGCTGCTGGGCATGGACCC  1316
                 || |  |||||||| |||||||| ||    ||| |  ||||  | ||||| ||||||||
Sbjct  1310778  TGGCCAAGAAGACAAACGGCTCGCTATGGCGCTGAACGTGCCCATTCTGGGGATGGACCC  1310837

Query  1317     GGAC-CGCG-CTTTGCTCTACGGCACACGCTCGGGTGCGAAGCGGCTTTTTACGCAAGCC  1374
                  ||  ||| |  |||  |     |||   |||||    |||||| | || | ||  |||
Sbjct  1310838  --ACTTGCGACACTGCCGTTGATGACAAAGTCGGGCAGCAAGCGGTTCTTCATGCGGGCC  1310895

Query  1375     GACGTCAACATTCCGTACGGCGCCCACGACATTTACGACGAAGACGAGCTGA--TTCTGA  1432
                ||||||||  | ||    ||  |  ||||||| |||||||||||||||||||  ||||  
Sbjct  1310896  GACGTCAATGTGCCCACGGGAACGTACGACATCTACGACGAAGACGAGCTGATCTTCT-C  1310954

Query  1433     GCTTGGCCAAGCTCACGGCCGCCAACTTGCACCAAGGCATGTGGCTCATCAAGCTGGATG  1492
                |||| ||||||||||  |   || || |  | |||  | |||||||| | ||| | ||  
Sbjct  1310955  GCTT-GCCAAGCTCATCGTATCCCACATTGAGCAAAACGTGTGGCTCCTGAAGATCGACT  1311013

Query  1493     CGGACCCGTCCGACACGGGCTTGGCG  1518
                  ||||||| || ||| |||  ||||
Sbjct  1311014  ACGACCCGTTCGGCACCGGCACGGCG  1311039

 Score = 134 bits (148),  Expect = 9e-29
 Identities = 176/242 (73%), Gaps = 4/242 (2%)
 Strand=Plus/Plus

Query  289      ATTGACGAGTTGCGCAACAACGTCGAGAAGATTCGCGGCTACAACGACCTCCTCGACACC  348
                || |||||  | ||||| |||||||| ||||| ||||| ||||| || ||| | ||||||
Sbjct  1309807  ATGGACGATCTTCGCAAAAACGTCGAAAAGATCCGCGGATACAATGAGCTCTTGGACACC  1309866

Query  349      TACAGCCTGCATCAGTTTATCATTCGGAAGGGCCAAACGCTTTCCGAGACGCCGGAATTC  408
                |||||| |||| ||||| ||||| |  || ||  |  || |   |||||||||||| || 
Sbjct  1309867  TACAGCTTGCACCAGTTCATCATCCACAAAGGGAAGGCGATGCGCGAGACGCCGGAGTTT  1309926

Query  409      ATCTCGTTCAAGCGCATCACTGAAGACCTTTGGGGCAGCGTCTCGATG--GCGATCCGCG  466
                 | |||||||||||| |  |  ||||  | |||||| |||  |||| |  | ||||   |
Sbjct  1309927  GTGTCGTTCAAGCGCGTGGCACAAGAGATCTGGGGCGGCG--TCGAAGAAGTGATCAAAG  1309984

Query  467      AGCTCGAGACGCTCTTGGTCCACTACTCGGTGCCGCTCGCCTACATTGATGGTCAAAAGC  526
                 ||||||||||||||||   | |||||  || || ||||| ||  | || || |||  ||
Sbjct  1309985  CGCTCGAGACGCTCTTGACGCGCTACTTCGTTCCACTCGCGTATGTCGACGGGCAACGGC  1310044

Query  527      TG  528
                ||
Sbjct  1310045  TG  1310046

 Score = 68.0 bits (74),  Expect = 1e-08
 Identities = 109/157 (69%), Gaps = 0/157 (0%)
 Strand=Plus/Plus

Query  2285     ACGAGTACATCTTCCACCCGAACATGGCCACGCTCCAGTACGCCGTCTTCTTCAACATGT  2344
                |||| |||||||||||||| ||| || | ||  | ||||||  |   |||||| | |  |
Sbjct  1311919  ACGAATACATCTTCCACCCCAACGTGTCGACCATGCAGTACAGCTCGTTCTTCCATACCT  1311978

Query  2345     GCCGCGTGCACGGCGTGAGCTTTGACCTGCAGAAATCGATTGGCGCCGCGTTCGTGTTGG  2404
                | ||  |||| || ||| | || ||| |  ||   |   ||||| ||   ||| || |||
Sbjct  1311979  GTCGTCTGCATGGGGTGTGTTTCGACGTCGAGCGCTGCTTTGGCACCATCTTCATGCTGG  1312038

Query  2405     CCGACAGCCTCACGGCCGGCGTCGTCGGGCTTCTCTG  2441
                | || ||||||||||| |||||| | ||| |  ||||
Sbjct  1312039  CAGATAGCCTCACGGCTGGCGTCTTTGGGATCATCTG  1312075

>PYAR:scaffold_29 par_scaffold_29 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_29:1:42963:1 
REF
Length=42963

 Score = 121 bits (133),  Expect = 2e-24
 Identities = 168/233 (72%), Gaps = 2/233 (1%)
 Strand=Plus/Minus

Query  281    CCGACACGATTGACGAGTTGCGCAACAACGTCGAGAAGATTCGCGGCTACAACGACCTCC  340
              || || | || |||||  | || || || || || |||||||| || |||||||| || |
Sbjct  14500  CCAACGCCATGGACGATCTCCGTAAAAATGTGGAAAAGATTCGTGGATACAACGAGCTGC  14441

Query  341    TCGACACCTACAGCCTGCATCAGTTTATCATTCGGAAGGGCCAAACGCTTTCCGAGACGC  400
              ||||||| ||||| || || ||||| ||||| |  ||||| |   || |   |||||| |
Sbjct  14440  TCGACACGTACAGTCTCCACCAGTTCATCATCCATAAGGGTCGCGCGATGCGCGAGACCC  14381

Query  401    CGGAATTCATCTCGTTCAAGCGCATCACTGAAGACCTTTGGGGCAGCGTCT-CGATGGCG  459
              | || |||   |||||||||||| |     ||||  ||||||||  ||||  ||| |  |
Sbjct  14380  CCGAGTTCCAGTCGTTCAAGCGCGTGGGCCAAGAGATTTGGGGCGCCGTCGACGAAGT-G  14322

Query  460    ATCCGCGAGCTCGAGACGCTCTTGGTCCACTACTCGGTGCCGCTCGCCTACAT  512
              ||||||| ||||||| ||||  |    | |||||  ||||||||||||| |||
Sbjct  14321  ATCCGCGCGCTCGAGGCGCTGCTCACGCGCTACTTTGTGCCGCTCGCCTTCAT  14269

 Score = 84.2 bits (92),  Expect = 1e-13
 Identities = 116/162 (72%), Gaps = 3/162 (2%)
 Strand=Plus/Minus

Query  885    GCAACGGCGGGTCGTCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCGCGCGGCTCAA  944
              ||| || || || |||||||||||||| ||  | |||  ||| |||| ||||||  |   
Sbjct  13856  GCAGCGTCGCGTGGTCGTCCACGTGCCATCACTGTCGCTCGACGAGCACGCGCGCGTGTC  13797

Query  945    CATGGACAACTTTGCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCGCGATCGCGGA  1004
                | ||| |||||||| | |  ||||| |||||| | ||||| ||    ||  ||| |||
Sbjct  13796  GCTCGACCACTTTGCGGTGCAGCAGAACCTGCAGCTCGCGCGGCTAGCGGCCGTCGTGGA  13737

Query  1005   TCCCAACGTCG---ACGTCATCTACATCTCGCCGTTCGAGCT  1043
                | | |||||   ||||| ||||| |||||||||| |||||
Sbjct  13736  CGCGACCGTCGAGTACGTCGTCTACGTCTCGCCGTTTGAGCT  13695

 Score = 68.9 bits (75),  Expect = 1e-08
 Identities = 88/119 (74%), Gaps = 2/119 (2%)
 Strand=Plus/Minus

Query  1082   AGCTGGGCGGCGTCGCGGAC-CCGCACTCGCGCGTCCGGATGCTGCACCCGGAGAACGCC  1140
              ||||| ||||||||||  || |||| | | ||||||  |||  |    || ||  |||||
Sbjct  13613  AGCTGAGCGGCGTCGCCAACGCCGCGCAC-CGCGTCAAGATCGTCGTGCCCGAACACGCC  13555

Query  1141   GAGCGCTTCCCCGAGCACTTTTCGCTGGCGACGATCCTCCTCTACTCGCCGCACTGTCT  1199
              |    ||||||||  |||||||| ||||| |||   || || |||||||||||||||||
Sbjct  13554  GCCACCTTCCCCGGTCACTTTTCCCTGGCCACGCAGCTGCTTTACTCGCCGCACTGTCT  13496

 Score = 46.4 bits (50),  Expect = 0.037
 Identities = 28/30 (93%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  2402   TGGCCGACAGCCTCACGGCCGGCGTCGTCG  2431
              || ||||||||||||||||||||||| |||
Sbjct  12193  TGCCCGACAGCCTCACGGCCGGCGTCTTCG  12164

 Score = 44.6 bits (48),  Expect = 0.13
 Identities = 64/88 (73%), Gaps = 2/88 (2%)
 Strand=Plus/Minus

Query  1338   CACACGCTCGGGTGCGAAGCGGCTTTTTACGCAAG-CCGACGTCAACATTCCGTACGGCG  1396
              ||| ||| | || || ||||| ||| || | |||| ||||||||||| | ||    ||| 
Sbjct  13355  CACGCGCGCTGGCGCCAAGCG-CTTGTTCCTCAAGGCCGACGTCAACGTGCCCACGGGCA  13297

Query  1397   CCCACGACATTTACGACGAAGACGAGCT  1424
              |  ||||  | |||||||  ||||||||
Sbjct  13296  CGTACGATCTCTACGACGTCGACGAGCT  13269

>PHSO:scaffold_1
Length=13391543

 Score = 103 bits (113),  Expect = 6e-19
 Identities = 163/234 (70%), Gaps = 0/234 (0%)
 Strand=Plus/Plus

Query  288      GATTGACGAGTTGCGCAACAACGTCGAGAAGATTCGCGGCTACAACGACCTCCTCGACAC  347
                ||| || ||| || ||  ||||||||| ||||| ||||| |||||||| || || ||| |
Sbjct  2802230  GATGGAGGAGCTGGGCGCCAACGTCGACAAGATCCGCGGATACAACGAGCTGCTGGACGC  2802289

Query  348      CTACAGCCTGCATCAGTTTATCATTCGGAAGGGCCAAACGCTTTCCGAGACGCCGGAATT  407
                 ||||| ||||| |||||  | || |  ||||| | |||  |    || || || || ||
Sbjct  2802290  GTACAGTCTGCACCAGTTCTTGATCCACAAGGGACGAACCATGCGAGATACACCCGAGTT  2802349

Query  408      CATCTCGTTCAAGCGCATCACTGAAGACCTTTGGGGCAGCGTCTCGATGGCGATCCGCGA  467
                  | ||||||   ||| |  |  | || |||||||||||||||  |  |||  | |||| 
Sbjct  2802350  TGTGTCGTTCCGCCGCGTAGCGCAGGAGCTTTGGGGCAGCGTCGAGGAGGCCCTGCGCGC  2802409

Query  468      GCTCGAGACGCTCTTGGTCCACTACTCGGTGCCGCTCGCCTACATTGATGGTCA  521
                | | ||||| ||| |    || ||||  |||||||| || |||  |||||| ||
Sbjct  2802410  GTTGGAGACTCTCCTCACGCAGTACTTCGTGCCGCTGGCGTACGCTGATGGCCA  2802463

 Score = 58.1 bits (63),  Expect = 2e-05
 Identities = 358/567 (63%), Gaps = 14/567 (2%)
 Strand=Plus/Plus

Query  889      CGGCGGGTCGTCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCGCGCGGCTCAACATG  948
                || || || ||||| |||||||||||||| |||   || || | | |||| || | |   
Sbjct  2802834  CGACGCGTTGTCGTGCACGTGCCGTCCTTGTCGCTGGATGAACACTCGCGCCTTAGCGCC  2802893

Query  949      GACAACTTTGCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCGCGATCGC---GGAT  1005
                || ||||| ||  | |  ||||| || ||| || ||||  | |||||    ||   ||| 
Sbjct  2802894  GAGAACTTCGCAGTGCAGCAGAACCTCCAGCTGACGCGGATATGCGCTGCAGCTCTGGAC  2802953

Query  1006     CCCAACGTCGA---CGTCATCTACATCTCGCCGTTCGAGCTCTCGGTCGACATTCAAAAG  1062
                 | ||||| ||     |  | ||| |  | || ||||||||| | |  ||| |     | 
Sbjct  2802954  TCGAACGTGGATCTGCTTGTGTACGTGGCCCCCTTCGAGCTCACCGCTGACGTCTCGCAC  2803013

Query  1063     TACATGATGCGCCTGCTGCAGCTGGGCGGCGTCGCGGACCCGCACTCGCGCGTCCGGATG  1122
                ||| |  |    |||||||||||||||||  | || ||        |||||||   | | 
Sbjct  2803014  TACTTCCTCAAGCTGCTGCAGCTGGGCGGTCTGGCTGATAGTAGACCGCGCGTGAAGCTC  2803073

Query  1123     CTGCACCCGGAGAACGCCGAGCGCTTCCCCGAGCACTTTTCGCTGGCGACGATCCTCCTC  1182
                 ||   || ||| | || |  ||||| || | ||| || |||||  || |  || | || 
Sbjct  2803074  GTGTTTCCAGAGCAGGCTGCCCGCTTTCCAGCGCATTTCTCGCTCTCGTCAGTCTTGCTG  2803133

Query  1183     TACTCGCCGCACTGTCTCAAGAAGATCAAACGCTACGTCCGC-GGCAAGGAGGCGTACAT  1241
                |||||||| ||||||||   |   |||   | ||||  | || ||||| || || ||| |
Sbjct  2803134  TACTCGCCTCACTGTCTGCGGCGCATCCGGCACTAC-ACGGCAGGCAAAGACGCATACCT  2803192

Query  1242     CGTCGCAGGCACGGTGGGTCCCGAAGACAAGCGGCTCGCGATCCGACTGCAGCTGCCGCT  1301
                |||    ||   |   ||| | |||||| ||||||| || |||   ||| |  ||||  |
Sbjct  2803193  CGTGATGGGGTTGCCTGGTACAGAAGACCAGCGGCTGGCTATCGCCCTGGACTTGCCTAT  2803252

Query  1302     GCTGGGCATGGACCCGGACCGC--GCTTTGCTCTACGGCACACGCTCGGGTGCGAAGCGG  1359
                 || ||  || |||   ||| |  ||  | |  |    ||| ||||| ||||  ||||||
Sbjct  2803253  CCTTGG--TGCACCGCCACCTCAAGCACTACCATTGCTCACTCGCTCAGGTGGCAAGCGG  2803310

Query  1360     CTTTTTACGCAAGCCGACGTCAACATTCCGTACGGCGCCCACGACATTTACGACGAAGAC  1419
                ||  | |  |  || ||||| ||| | ||   |||| |  ||||  | ||||||||  ||
Sbjct  2803311  CTGCTCATCCGCGCTGACGTGAACGTCCCCACCGGCACTTACGAGCTCTACGACGAGCAC  2803370

Query  1420     GAGCTGATTCTGAGC-TTGGCCAAGCT  1445
                || ||| |||  |||  | ||||||||
Sbjct  2803371  GAACTG-TTCGCAGCACTTGCCAAGCT  2803396

 Score = 58.1 bits (63),  Expect = 2e-05
 Identities = 99/144 (69%), Gaps = 0/144 (0%)
 Strand=Plus/Plus

Query  2289     GTACATCTTCCACCCGAACATGGCCACGCTCCAGTACGCCGTCTTCTTCAACATGTGCCG  2348
                |||| ||||||||||| || || ||||  | |||||| | | ||||||| ||   |||||
Sbjct  2804332  GTACGTCTTCCACCCGCACGTGACCACCATGCAGTACACTGCCTTCTTCCACGCCTGCCG  2804391

Query  2349     CGTGCACGGCGTGAGCTTTGACCTGCAGAAATCGATTGGCGCCGCGTTCGTGTTGGCCGA  2408
                  |||| || ||| | || ||| |  ||    || | ||  |    ||| || |  | ||
Sbjct  2804392  ACTGCATGGAGTGTGTTTCGACGTTGAGCGCACGCTAGGAACGCTCTTCCTGCTCACAGA  2804451

Query  2409     CAGCCTCACGGCCGGCGTCGTCGG  2432
                ||| ||||| ||||| ||| ||||
Sbjct  2804452  CAGTCTCACAGCCGGTGTCTTCGG  2804475

>PHCA:scaffold_84 PHYCAscaffold_84
Length=182275

 Score = 80.6 bits (88),  Expect = 2e-12
 Identities = 220/331 (66%), Gaps = 6/331 (2%)
 Strand=Plus/Plus

Query  875     AGATCAAAATGCAACGGCGGGTCGTCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCG  934
               |||||  ||  || ||||| ||||| ||||||||||||||||| |||  ||| ||   | 
Sbjct  103190  AGATCGCAAGTCACCGGCGTGTCGTTGTCCACGTGCCGTCCTTGTCGCTCGACGAATACT  103249

Query  935     CGCGGCTCAACATGGACAACTTTGCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCG  994
               |||| ||||     || ||||| ||  | || |||||||| ||  |  | ||  ||||||
Sbjct  103250  CGCGTCTCAGTGCTGAAAACTTGGCAGTGCGGCAGAATCTTCAACTCACTCGGATCTGCG  103309

Query  995     C-GAT-CG-CGGATCCCAACGTCGA-CGTC--ATCTACATCTCGCCGTTCGAGCTCTCGG  1048
               | | | ||  |||  ||  ||| || | ||   | ||| | ||||| ||||||||| || 
Sbjct  103310  CTGCTGCGTTGGACTCCCGCGTGGATCTTCTAGTGTACGTGTCGCCTTTCGAGCTCACGA  103369

Query  1049    TCGACATTCAAAAGTACATGATGCGCCTGCTGCAGCTGGGCGGCGTCGCGGACCCGCACT  1108
                 ||| ||    ||||| | ||    ||||| ||||| || ||| |||| |||   |   
Sbjct  103370  CGGACGTTTCCCAGTACTTCATCAAGCTGCTACAGCTTGGTGGCCTCGCTGACAGTCGAC  103429

Query  1109    CGCGCGTCCGGATGCTGCACCCGGAGAACGCCGAGCGCTTCCCCGAGCACTTTTCGCTGG  1168
               | || |||    | ||    || ||| | |||  ||| || || | ||| || |||||  
Sbjct  103430  CTCGAGTCAAACTACTTTTTCCCGAGCAAGCCACGCGGTTTCCAGCGCATTTCTCGCTCT  103489

Query  1169    CGACGATCCTCCTCTACTCGCCGCACTGTCT  1199
               || || | || || ||||| ||||| |||||
Sbjct  103490  CGTCGTTGCTGCTTTACTCACCGCATTGTCT  103520

>PHRA:scaffold_56
Length=334739

 Score = 79.7 bits (87),  Expect = 6e-12
 Identities = 106/145 (73%), Gaps = 2/145 (1%)
 Strand=Plus/Minus

Query  2289    GTACATCTTCCACCCGAACATGGCCACGCTCCAGTACGCCGTCTTCTTCAACATGTGCCG  2348
               |||| | ||||||||| || || ||||| | |||||| | | ||| ||| ||   |||||
Sbjct  146692  GTACGTGTTCCACCCGCACGTGACCACGATGCAGTACTCTGCCTTTTTCCACGCTTGCCG  146633

Query  2349    CGTGCACGGCGTGAGCTTTGACCTGCAGAAATCGATTGGCGCCGC-GTTCGTGTTGGCCG  2407
                 ||||||||||| | |||||| || ||    || ||||   |||  ||| || | ||||
Sbjct  146632  GCTGCACGGCGTGTGTTTTGACGTGGAGCGTACG-TTGGGTACGCTCTTCCTGCTCGCCG  146574

Query  2408    ACAGCCTCACGGCCGGCGTCGTCGG  2432
               |||| ||||| || || ||| ||||
Sbjct  146573  ACAGTCTCACTGCTGGAGTCTTCGG  146549

 Score = 68.0 bits (74),  Expect = 1e-08
 Identities = 70/92 (76%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  289     ATTGACGAGTTGCGCAACAACGTCGAGAAGATTCGCGGCTACAACGACCTCCTCGACACC  348
               || || ||| || ||   |||||||| ||||| || ||||||||||| || || ||  | 
Sbjct  148790  ATGGAGGAGCTGGGCGCTAACGTCGACAAGATCCGTGGCTACAACGATCTGCTGGATGCG  148731

Query  349     TACAGCCTGCATCAGTTTATCATTCGGAAGGG  380
               |||||| |||| |||||| | ||||  |||||
Sbjct  148730  TACAGCTTGCACCAGTTTTTGATTCACAAGGG  148699

 Score = 59.0 bits (64),  Expect = 6e-06
 Identities = 56/72 (78%), Gaps = 0/72 (0%)
 Strand=Plus/Minus

Query  1128    CCCGGAGAACGCCGAGCGCTTCCCCGAGCACTTTTCGCTGGCGACGATCCTCCTCTACTC  1187
               ||| ||| | || | ||||||||| || ||||| || ||| || |  | || ||||||||
Sbjct  147942  CCCCGAGCAAGCTGCGCGCTTCCCGGACCACTTCTCTCTGTCGTCATTGCTGCTCTACTC  147883

Query  1188    GCCGCACTGTCT  1199
               ||| ||||||||
Sbjct  147882  GCCTCACTGTCT  147871

>PYAP:scaffold_162 pag1_scaffold_162 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_162:1:52209:1 
REF
Length=52209

 Score = 74.3 bits (81),  Expect = 3e-10
 Identities = 210/315 (67%), Gaps = 6/315 (2%)
 Strand=Plus/Plus

Query  885    GCAACGGCGGGTCGTCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCGCGCGGCTCAA  944
              ||| || ||||| ||  |||| ||  ||||| | || |  || |||||  |  |  |   
Sbjct  22456  GCAGCGCCGGGTGGTGATCCATGTTGCGTCCATTTCCGTTGATGAGCGTACCAGATTGTC  22515

Query  945    CATGGACAACTTT-GCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCGCGA-TCGCG  1002
               ||||| |||||| |||    | ||||| || ||| || | || ||| ||  || ||| |
Sbjct  22516  TATGGAGAACTTTAGCGTCAAG-CAGAACCTACAGCTGTCTCGCCTC-GCAGGACTCGTG  22573

Query  1003   GATCCCAACGTCGACGTCATCTACATCTCGCCGTTCGAGCTCTCGGTCGACAT-TCAAAA  1061
              ||||  || || ||  || | ||| |  ||||||||||||| |||   ||  | ||  ||
Sbjct  22574  GATCAGAATGTAGAGATCGTGTACGTGACGCCGTTCGAGCTGTCGACTGAAGTGTCGCAA  22633

Query  1062   GTACATGATGCGCCTGCTGCAGCTGGGCGGCGTCGCGGACCCGCACTCGCGCGTCCGGAT  1121
               ||| | ||    |||||||||||| ||||  ||||  || ||||  |||| |||||  |
Sbjct  22634  -TACTTCATCAAGCTGCTGCAGCTGAGCGGAATCGCCAACGCGCATACGCGAGTCCGACT  22692

Query  1122   GCTGCACCCGGAGAACGCCGAGCGCTTCCCCGAGCACTTTTCGCTGGCGACGATCCTCCT  1181
                ||   || ||| |||| |  |  || ||  ||||||| ||||| |||||    ||| |
Sbjct  22693  AGTGTTTCCAGAGCACGCAGCTCAGTTTCCGCAGCACTTCTCGCTCGCGACCCATCTCAT  22752

Query  1182   CTACTCGCCGCACTG  1196
              |||||| ||  ||||
Sbjct  22753  CTACTCCCCAAACTG  22767

>PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_98.1_contig_1:1:103693:1 
REF
Length=103693

 Score = 73.4 bits (80),  Expect = 3e-10
 Identities = 61/75 (81%), Gaps = 0/75 (0%)
 Strand=Plus/Plus

Query  306    CAACGTCGAGAAGATTCGCGGCTACAACGACCTCCTCGACACCTACAGCCTGCATCAGTT  365
              ||||||||| ||||| |||||||||||||| ||  | ||  |||||||  ||||||||||
Sbjct  69695  CAACGTCGACAAGATCCGCGGCTACAACGAACTATTGGATGCCTACAGTTTGCATCAGTT  69754

Query  366    TATCATTCGGAAGGG  380
              | | ||||  |||||
Sbjct  69755  TTTAATTCACAAGGG  69769

 Score = 47.3 bits (51),  Expect = 0.037
 Identities = 80/111 (72%), Gaps = 4/111 (4%)
 Strand=Plus/Plus

Query  1338   CACACGCTCGGGTGCGAAGCGGCTTTTTACGCAAGCCGACGTCAACATTCCGTAC-GGCG  1396
              |||||||||||| |  || ||||| || |  |  || || || ||| | || ||| ||| 
Sbjct  70736  CACACGCTCGGGAGGTAAACGGCTGTTAATCCGTGCTGATGTTAACGTGCC-TACGGGCA  70794

Query  1397   CCCACGACATTTACGACGAAGACGAGCTGATT-CTGAGCTTGGCCAAGCTC  1446
              || ||||  ||||||||||  | || ||  || | | |||| |||||||||
Sbjct  70795  CCTACGAGCTTTACGACGATCATGAACTCTTTGCAGCGCTT-GCCAAGCTC  70844

>PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.63, whole genome shotgun 
sequence
Length=342508

 Score = 69.8 bits (76),  Expect = 3e-09
 Identities = 152/225 (68%), Gaps = 6/225 (3%)
 Strand=Plus/Plus

Query  300     GCGCAACAACGTCGAGAAGATTCGCGGCTACAACGACCTCCTCGACACCTACAGCCTGCA  359
               ||||||  | ||||| || || || || |||||||| ||  | ||  | || ||| | ||
Sbjct  253359  GCGCAA--ATGTCGATAAAATCCGTGGTTACAACGAGCTGTTGGATGCGTATAGCTTACA  253416

Query  360     TCAGTTTATCATTCGGAAGGGCCAAACGCTTTCCGAGACGCCGGAATTCATCTCGTTCAA  419
               ||||||| | ||||  ||||| | |||  |    || || || || || || ||||||  
Sbjct  253417  TCAGTTTTTGATTCACAAGGGACGAACCATGCGAGACACACCCGAGTTTATTTCGTTCCG  253476

Query  420     GCGCATCACTGAAGACCTTTGGGGCAGCGTCTCGATG--GCGATCCGCGAGCTCGAGACG  477
                ||| |  |  |||| |||||||| || |||  || |  ||  | || | ||| ||| | 
Sbjct  253477  CCGCGTGGCACAAGAACTTTGGGGTAGTGTC--GAAGAAGCATTACGAGCGCTGGAGGCT  253534

Query  478     CTCTTGGTCCACTACTCGGTGCCGCTCGCCTACATTGATGGTCAA  522
               ||  ||  ||| || |  ||||| || || ||  |||||||||||
Sbjct  253535  CTGCTGACCCAGTATTTCGTGCCACTGGCTTATGTTGATGGTCAA  253579

>PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 
genomic scaffold, whole genome shotgun sequence
Length=695754

 Score = 58.1 bits (63),  Expect = 2e-05
 Identities = 156/237 (66%), Gaps = 4/237 (2%)
 Strand=Plus/Plus

Query  307     AACGTCGAGAAGATTCGCGGCTACAACGACCTCCTCGACACCTACAGCCTGCATCAGTTT  366
               || ||||| || ||||| || |||||||| || || ||    || ||  |||| ||||||
Sbjct  433383  AATGTCGATAAAATTCGTGGTTACAACGAACTGCTGGATGTGTATAGTTTGCACCAGTTT  433442

Query  367     ATCATTCGGAAGGGCCAAACGCTTTCCGAGACGCCGGAATTCATCTCGTTCAAGCGCATC  426
                | ||||  || || |  ||  |    || || || || ||  | ||||||   ||| | 
Sbjct  433443  CTGATTCACAAAGGACGGACCATGAGAGACACACCCGAGTTTGTTTCGTTCCGTCGCGTT  433502

Query  427     ACTGAAGACCTTTGGGGCAGCGTCTCGATGGCGATCCGCGA--GCTCGAGACGCTCTTGG  484
               ||  | || ||||||||||  || | || |  | || ||||  ||| ||||| ||  | |
Sbjct  433503  ACACAGGAGCTTTGGGGCA--GTGTAGAAGAGGCTCTGCGAGCGCTGGAGACTCTGCTCG  433560

Query  485     TCCACTACTCGGTGCCGCTCGCCTACATTGATGGTCAAAAGCTGCTCAAAATCGCAG  541
                 || || |  || || || || ||| ||||||| ||    ||||||  | ||||||
Sbjct  433561  CGCAGTATTTTGTACCTCTGGCTTACGTTGATGGCCAGCGACTGCTCGCACTCGCAG  433617

 Score = 50.0 bits (54),  Expect = 0.003
 Identities = 75/107 (70%), Gaps = 0/107 (0%)
 Strand=Plus/Plus

Query  889     CGGCGGGTCGTCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCGCGCGGCTCAACATG  948
               || || || || |||||||||||||| || |||  ||| || | | | || |||      
Sbjct  433968  CGACGTGTTGTGGTCCACGTGCCGTCGTTATCGCTCGATGAACACTCACGTCTCGGTGCT  434027

Query  949     GACAACTTTGCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCGC  995
               || |||||||| || |  ||||| || ||| || ||||  | |||||
Sbjct  434028  GAGAACTTTGCCATACAACAGAACCTCCAGCTGACGCGGGTATGCGC  434074

>PYVX:scaffold_1323 pve_scaffold_1323 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1323:1:4715:1 
REF
Length=4715

 Score = 50.0 bits (54),  Expect = 0.003
 Identities = 66/92 (72%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  2332  TTCTTCAACATGTGCCGCGTGCACGGCGTGAGCTTTGACCTGCAGAAATCGATTGGCGCC  2391
             |||||| | |  |||||| ||||||||||| || | ||| ||  |    ||   ||| | 
Sbjct  279   TTCTTCCAGACCTGCCGCCTGCACGGCGTGTGCCTCGACGTGGCGGCGGCGCGCGGCTCG  338

Query  2392  GCGTTCGTGTTGGCCGACAGCCTCACGGCCGG  2423
             |  ||| || || ||||||||||| |||||||
Sbjct  339   GTCTTCCTGCTGCCCGACAGCCTCGCGGCCGG  370

>PYVX:scaffold_836 pve_scaffold_836 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_836:1:11745:1 
REF
Length=11745

 Score = 48.2 bits (52),  Expect = 0.011
 Identities = 29/31 (94%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  911   CGTCCTTCTCGGCCGAAGAGCGCGCGCGGCT  941
             |||||||||||| ||| ||||||||||||||
Sbjct  7804  CGTCCTTCTCGGACGAGGAGCGCGCGCGGCT  7834

>PYIW:scaffold_1591 piw_scaffold_1591 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1591:1:8029:1 
REF
Length=8029

 Score = 46.4 bits (50),  Expect = 0.037
 Identities = 31/35 (89%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  1563  CGAGAAGCGCGCGATGAAGAACGACGAGTACTACA  1597
             ||||||| ||||| || |||||| |||||||||||
Sbjct  4124  CGAGAAGAGCGCGCTGCAGAACGGCGAGTACTACA  4158

>PYAR:scaffold_50 par_scaffold_50 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_50:1:38960:1 
REF
Length=38960

 Score = 46.4 bits (50),  Expect = 0.037
 Identities = 40/50 (80%), Gaps = 0/50 (0%)
 Strand=Plus/Minus

Query  1374   CGACGTCAACATTCCGTACGGCGCCCACGACATTTACGACGAAGACGAGC  1423
              ||| ||| | ||||||||||  ||||||||||||| | || || | ||||
Sbjct  13878  CGAGGTCCAGATTCCGTACGTGGCCCACGACATTTGCAACCAAAAGGAGC  13829

>SAPA:scaffold_288 supercont2.288 dna:supercontig supercontig:ASM15154v2:supercont2.288:1:14296:1 
REF
Length=14296

 Score = 44.6 bits (48),  Expect = 0.13
 Identities = 33/39 (85%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  2484   CGCGCTTGAGCTCATTGGCGACCAAGTCGGCGTGCAGCC  2522
              ||||||||||| ||| ||||| |||||||  ||| ||||
Sbjct  13811  CGCGCTTGAGCACATCGGCGATCAAGTCGATGTGGAGCC  13849

>SAPA:scaffold_5 supercont2.5 dna:supercontig supercontig:ASM15154v2:supercont2.5:1:1129684:1 
REF
Length=1129684

 Score = 44.6 bits (48),  Expect = 0.13
 Identities = 30/34 (88%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  441     GGGCAGCGTCTCGATGGCGATCCGCGAGCTCGAG  474
               |||||||  ||||  |||||||||||||||||||
Sbjct  688254  GGGCAGCTACTCGTCGGCGATCCGCGAGCTCGAG  688287

 Score = 42.8 bits (46),  Expect = 0.45
 Identities = 35/43 (81%), Gaps = 0/43 (0%)
 Strand=Plus/Minus

Query  1820    TGACGTCGGCGCAGGAGCAGTTGATGCACGTCAAGAACAAGCA  1862
               ||||| ||||||||  ||||  ||||||||||| |||  ||||
Sbjct  203157  TGACGCCGGCGCAGATGCAGCAGATGCACGTCATGAAGCAGCA  203115

>SAPA:scaffold_2 supercont2.2 dna:supercontig supercontig:ASM15154v2:supercont2.2:1:1567649:1 
REF
Length=1567649

 Score = 44.6 bits (48),  Expect = 0.13
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  914     CCTTCTCGGCCGAAGAGCGCGCGCGGCTC  942
               ||||||||| ||||||||||||||| |||
Sbjct  361258  CCTTCTCGGACGAAGAGCGCGCGCGCCTC  361286

>SADI:scaffold_38 supercont1.38 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.38:1:581926:1 
REF
Length=581926

 Score = 44.6 bits (48),  Expect = 0.13
 Identities = 30/34 (88%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  441     GGGCAGCGTCTCGATGGCGATCCGCGAGCTCGAG  474
               |||||||  ||||  |||||||||||||||||||
Sbjct  143833  GGGCAGCTACTCGTCGGCGATCCGCGAGCTCGAG  143866

>SADI:scaffold_3 supercont1.3 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.3:1:1523884:1 
REF
Length=1523884

 Score = 44.6 bits (48),  Expect = 0.13
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  914      CCTTCTCGGCCGAAGAGCGCGCGCGGCTC  942
                ||||||||| ||||||||||||||| |||
Sbjct  1335711  CCTTCTCGGACGAAGAGCGCGCGCGTCTC  1335739

 Score = 44.6 bits (48),  Expect = 0.13
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  914      CCTTCTCGGCCGAAGAGCGCGCGCGGCTC  942
                ||||||||| ||||||||||||||| |||
Sbjct  1338319  CCTTCTCGGACGAAGAGCGCGCGCGTCTC  1338347

>PHSO:scaffold_4
Length=7609242

 Score = 44.6 bits (48),  Expect = 0.13
 Identities = 33/39 (85%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  1293     GCTGCCGCTGCTGGGCATGGACCCGGACCGCGCTTTGCT  1331
                |||||||||||||| | | ||||||||| ||||  ||||
Sbjct  1287663  GCTGCCGCTGCTGGACTTCGACCCGGACGGCGCGCTGCT  1287701

>SADI:scaffold_29 supercont1.29 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.29:1:692626:1 
REF
Length=692626

 Score = 43.7 bits (47),  Expect = 0.45
 Identities = 25/26 (96%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  2296    TTCCACCCGAACATGGCCACGCTCCA  2321
               || |||||||||||||||||||||||
Sbjct  679226  TTGCACCCGAACATGGCCACGCTCCA  679251

>PYVX:scaffold_300 pve_scaffold_300 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_300:1:30972:1 
REF
Length=30972

 Score = 43.7 bits (47),  Expect = 0.45
 Identities = 33/38 (87%), Gaps = 1/38 (3%)
 Strand=Plus/Minus

Query  1048  GTCGACATTC-AAAAGTACATGATGCGCCTGCTGCAGC  1084
             |||||||| | |||||| ||||  ||||||||||||||
Sbjct  8337  GTCGACATGCCAAAAGTTCATGGAGCGCCTGCTGCAGC  8300

>PHSO:scaffold_11
Length=2192408

 Score = 43.7 bits (47),  Expect = 0.45
 Identities = 44/57 (77%), Gaps = 3/57 (5%)
 Strand=Plus/Minus

Query  1071    GCGCCTGCTGCAGCTGGGCGGCGTCGCGGACCCGCACTCGCGCGTCCGGATGCTGCA  1127
               ||||||||||||||   |||||| |   | |  |||| ||||||||||  |||||||
Sbjct  194491  GCGCCTGCTGCAGC---GCGGCGACCACGTCTTGCACGCGCGCGTCCGCCTGCTGCA  194438

>APAS:scaffold_25 supercont1.25 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.25:1:849228:1 
REF
Length=849228

 Score = 43.7 bits (47),  Expect = 0.45
 Identities = 25/26 (96%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  2118    CGCGACGCTGGACGCGGCGACGGGCC  2143
               ||||||||||||||| ||||||||||
Sbjct  107856  CGCGACGCTGGACGCCGCGACGGGCC  107881

>SAPA:scaffold_37 supercont2.37 dna:supercontig supercontig:ASM15154v2:supercont2.37:1:335642:1 
REF
Length=335642

 Score = 42.8 bits (46),  Expect = 0.45
 Identities = 29/33 (88%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  742     GCGACGCACATTCAGCGCGTGTATCGAACGTAC  774
               ||||||||||| |||||||| ||||||  ||||
Sbjct  118989  GCGACGCACATCCAGCGCGTCTATCGAGGGTAC  119021

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  108   GGCGCCGCCCCCGACCGAGCCCGACGCGG  136
             |||||||||||| ||| ||||||||||||
Sbjct  7273  GGCGCCGCCCCC-ACCAAGCCCGACGCGG  7300

>SADI:scaffold_86 supercont1.86 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.86:1:217417:1 
REF
Length=217417

 Score = 42.8 bits (46),  Expect = 0.45
 Identities = 49/63 (78%), Gaps = 5/63 (8%)
 Strand=Plus/Minus

Query  1393   GGCGC-CCACGACATTTACGACGAAGACGAGCTGATTCTG---AGCTTGGCCAAGCT-CA  1447
              ||||| |||||  || ||||||||||||| ||||  ||||    |  |||||||||| ||
Sbjct  74971  GGCGCTCCACGCTATCTACGACGAAGACGTGCTGGGTCTGCAACGGGTGGCCAAGCTCCA  74912

Query  1448   CGG  1450
              |||
Sbjct  74911  CGG  74909

>PYVX:scaffold_2 pve_scaffold_2 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_2:1:145175:1 
REF
Length=145175

 Score = 42.8 bits (46),  Expect = 0.45
 Identities = 29/33 (88%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  443     GCAGCGTCTCGATGGCGATCCGCGAGCTCGAGA  475
               ||||| |||||   |||||||||||||||||||
Sbjct  133086  GCAGCTTCTCGTCCGCGATCCGCGAGCTCGAGA  133054

>PYUU:scaffold_2023 scf1117875582023 dna:supercontig supercontig:pug:scf1117875582023:1:1683196:1 
REF
Length=1683196

 Score = 42.8 bits (46),  Expect = 0.45
 Identities = 26/28 (93%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  922      GCCGAAGAGCGCGCGCGGCTCAACATGG  949
                |||||||||||||||| |||| ||||||
Sbjct  1532728  GCCGAAGAGCGCGCGCTGCTCGACATGG  1532755

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  1794    CATCGAACCGTCCGGCGGCGTGCACGTGACG  1824
               ||| || ||||||||  ||||||||||||||
Sbjct  414556  CATGGATCCGTCCGGGAGCGTGCACGTGACG  414586

>PHSO:scaffold_6
Length=4785000

 Score = 42.8 bits (46),  Expect = 0.45
 Identities = 40/49 (82%), Gaps = 3/49 (6%)
 Strand=Plus/Plus

Query  1275     GCTCGCGATCCGACTGCAGCTGCCGCTGCTGGGCATGGACCCGGACCGC  1323
                |||| ||||| |||||||  || ||||||||||| | | | ||||||||
Sbjct  3464604  GCTCACGATC-GACTGCA--TGGCGCTGCTGGGCCTCGTCTCGGACCGC  3464649

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 32/37 (86%), Gaps = 4/37 (11%)
 Strand=Plus/Minus

Query  1288     CTGCAGC-TGCCGCTGCTGGGCATGG---ACCCGGAC  1320
                ||||||| ||| ||||||||||||||   ||||||||
Sbjct  3176359  CTGCAGCGTGCTGCTGCTGGGCATGGTGCACCCGGAC  3176323

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 26/28 (93%), Gaps = 1/28 (4%)
 Strand=Plus/Minus

Query  649     GATGGCCGGCACGCGGCGGC-GATCGTC  675
               ||||||||||||||||| || |||||||
Sbjct  235143  GATGGCCGGCACGCGGCTGCAGATCGTC  235116

>APIN:scaffold_3 supercont1.3 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.3:1:3119476:1 
REF
Length=3119476

 Score = 42.8 bits (46),  Expect = 0.45
 Identities = 31/34 (91%), Gaps = 3/34 (9%)
 Strand=Plus/Minus

Query  1831     CAGGAGCAGTTGATGCAC-GTC--AAGAACAAGC  1861
                |||||||||||||||||| |||  ||||||||||
Sbjct  1347463  CAGGAGCAGTTGATGCACAGTCTGAAGAACAAGC  1347430

>SAPA:scaffold_42 supercont2.42 dna:supercontig supercontig:ASM15154v2:supercont2.42:1:293104:1 
REF
Length=293104

 Score = 41.9 bits (45),  Expect = 1.6
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  1765   GTCCTTGCGCGCGTTCGCGCCAACG  1789
              ||| |||||||||||||||||||||
Sbjct  82847  GTCATTGCGCGCGTTCGCGCCAACG  82823

>SAPA:scaffold_1 supercont2.1 dna:supercontig supercontig:ASM15154v2:supercont2.1:1:1615555:1 
REF
Length=1615555

 Score = 41.9 bits (45),  Expect = 1.6
 Identities = 34/41 (83%), Gaps = 3/41 (7%)
 Strand=Plus/Plus

Query  1062     GTACATGATGCG---CCTGCTGCAGCTGGGCGGCGTCGCGG  1099
                |||||||| |||   ||||| | |||||||||||| |||||
Sbjct  1045451  GTACATGAAGCGGTCCCTGCGGAAGCTGGGCGGCGACGCGG  1045491

>PYIR:scaffold_1182 pir_scaffold_1182 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_1182:1:9522:1 
REF
Length=9522

 Score = 41.9 bits (45),  Expect = 1.6
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  700   CGCACGCGGCGGCTGCTGCGGCAGC  724
             ||||||||||||| |||||||||||
Sbjct  4618  CGCACGCGGCGGCAGCTGCGGCAGC  4594

>PYIR:scaffold_67 pir_scaffold_67 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_67:1:62380:1 
REF
Length=62380

 Score = 41.9 bits (45),  Expect = 1.6
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  1563  CGAGAAGCGCGCGATGAAGAACGACGAGTACTACA  1597
             ||||||| ||| | || |||||| |||||||||||
Sbjct  673   CGAGAAGAGCGTGCTGCAGAACGGCGAGTACTACA  639

>SAPA:scaffold_54 supercont2.54 dna:supercontig supercontig:ASM15154v2:supercont2.54:1:242776:1 
REF
Length=242776

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 33/39 (85%), Gaps = 1/39 (3%)
 Strand=Plus/Minus

Query  1930   GCGGTCGCGCAAGCCATGTACGCGAGCGGCATCATTGGC  1968
              |||||||||||||||| | | || ||| ||||| |||||
Sbjct  41443  GCGGTCGCGCAAGCCAAGGAGGCCAGC-GCATCGTTGGC  41406

>SAPA:scaffold_18 supercont2.18 dna:supercontig supercontig:ASM15154v2:supercont2.18:1:504189:1 
REF
Length=504189

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  1435    TTGGCCAAGCTCACGGCCGCCAACTTGCA  1463
               ||||||||||||||||||| | |||||||
Sbjct  290366  TTGGCCAAGCTCACGGCCGAC-ACTTGCA  290393

>SADI:scaffold_1 supercont1.1 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.1:1:1813439:1 
REF
Length=1813439

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  463      CGCGAGCTCGAGACGCTCTTGGTCCAC  489
                |||||||||||||||||||| || |||
Sbjct  1716042  CGCGAGCTCGAGACGCTCTTCGTGCAC  1716016

>PYVX:scaffold_567 pve_scaffold_567 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_567:1:19415:1 
REF
Length=19415

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  2327  CCGTCTTCTTCAACATGTGCCGCGTGC  2353
             |||||||||||||||| ||||||| ||
Sbjct  8027  CCGTCTTCTTCAACATCTGCCGCGCGC  8001

>PYAR:scaffold_1634 par_scaffold_1634 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1634:1:7566:1 
REF
Length=7566

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  1288  CTGCAGCTGCCGCTGCTGGGCATGGAC  1314
             |||| |||||||||||||||| |||||
Sbjct  3508  CTGCTGCTGCCGCTGCTGGGCCTGGAC  3482

>PYAR:scaffold_547 par_scaffold_547 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_547:1:16661:1 
REF
Length=16661

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 54/72 (75%), Gaps = 5/72 (7%)
 Strand=Plus/Plus

Query  2274   CTACATTG---CGCACGAGTACATCTTCCACCCGAACATGGCC-ACGCTCCAGTACGCCG  2329
              ||||||||   ||| |||  ||| |   ||||||| |||||   |||| | ||  |||||
Sbjct  11977  CTACATTGTGCCGCTCGAAGACAACAAGCACCCGATCATGGAGGACGCGC-AGATCGCCG  12035

Query  2330   TCTTCTTCAACA  2341
              ||||||||||||
Sbjct  12036  TCTTCTTCAACA  12047

>PYAP:scaffold_1047 pag1_scaffold_1047 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_1047:1:8012:1 
REF
Length=8012

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  1905  CGCAGCGATCCGCGGCGCGTCGTTGGCGGTCG  1936
             ||||||||||||| | | ||||||||| ||||
Sbjct  3184  CGCAGCGATCCGCTGGGAGTCGTTGGCAGTCG  3215

>PHRA:scaffold_1911
Length=3698

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 30/34 (88%), Gaps = 1/34 (3%)
 Strand=Plus/Plus

Query  286  ACGATTGACGAGTTGCGCAACAACGTCGAGAAGA  319
            ||||| |||  |||||| ||||||||||||||||
Sbjct  816  ACGAT-GACACGTTGCGGAACAACGTCGAGAAGA  848

>PHRA:scaffold_451
Length=12299

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  1849  GTCAAGAACAAGCACCAAAGCGTCGGC  1875
             ||||||||  |||||||||||||||||
Sbjct  8444  GTCAAGAAGGAGCACCAAAGCGTCGGC  8470

>PHRA:scaffold_436
Length=12848

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 30/34 (88%), Gaps = 1/34 (3%)
 Strand=Plus/Plus

Query  286    ACGATTGACGAGTTGCGCAACAACGTCGAGAAGA  319
              ||||| |||  |||||| ||||||||||||||||
Sbjct  11598  ACGAT-GACACGTTGCGGAACAACGTCGAGAAGA  11630

>PHRA:scaffold_267
Length=29552

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  1849  GTCAAGAACAAGCACCAAAGCGTCGGC  1875
             ||||||||  |||||||||||||||||
Sbjct  3999  GTCAAGAAGGAGCACCAAAGCGTCGGC  3973

>PHRA:scaffold_105
Length=157074

 Score = 41.0 bits (44),  Expect = 1.6
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  1849   GTCAAGAACAAGCACCAAAGCGTCGGC  1875
              ||||||||  |||||||||||||||||
Sbjct  53300  GTCAAGAAGGAGCACCAAAGCGTCGGC  53326

>SAPA:scaffold_52 supercont2.52 dna:supercontig supercontig:ASM15154v2:supercont2.52:1:228074:1 
REF
Length=228074

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 40/51 (78%), Gaps = 1/51 (2%)
 Strand=Plus/Minus

Query  1497   CCCGTCCGACACGGGCTTGGCGGCCATCGACATGCACGCGCTCGA-GTGCG  1546
              |||| ||||||||||||||||   || |    || |||||||||| |||||
Sbjct  66757  CCCGCCCGACACGGGCTTGGCCAACAACCTAGTGTACGCGCTCGACGTGCG  66707

>SAPA:scaffold_14 supercont2.14 dna:supercontig supercontig:ASM15154v2:supercont2.14:1:615410:1 
REF
Length=615410

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  1993    TTTCTCGACGTCAAGACGGTCAACGGGAAGGCGGGGCCGCCGCACTTGCGGCTC  2046
               ||| |||||||||||||| ||||      |||||||||| | |||| |  ||||
Sbjct  581129  TTTTTCGACGTCAAGACGCTCAAAAATTGGGCGGGGCCGTCCCACTGGAAGCTC  581076

>SADI:scaffold_16 supercont1.16 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.16:1:806927:1 
REF
Length=806927

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 40/51 (78%), Gaps = 1/51 (2%)
 Strand=Plus/Minus

Query  1497    CCCGTCCGACACGGGCTTGGCGGCCATCGACATGCACGCGCTCGA-GTGCG  1546
               |||| ||||||||||||||||   || |    || |||||||||| |||||
Sbjct  633867  CCCGCCCGACACGGGCTTGGCCAACAACCTGGTGTACGCGCTCGACGTGCG  633817

>SADI:scaffold_5 supercont1.5 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.5:1:1310751:1 
REF
Length=1310751

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  119     CGACCGAGCCCGACGCGGTGCCGCCGACA  147
               |||||| | ||||||||||||||| ||||
Sbjct  870872  CGACCGCGACCGACGCGGTGCCGCAGACA  870844

>PYIW:scaffold_4299 piw_scaffold_4299 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_4299:1:2154:1 
REF
Length=2154

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 36/42 (86%), Gaps = 4/42 (10%)
 Strand=Plus/Minus

Query  2313  CACGCTCCAGTACGCCG-TCTTCTTCAACATGTGC--CGCGT  2351
             ||||||||||  ||||| |||||||||||||| ||  |||||
Sbjct  1606  CACGCTCCAGG-CGCCGCTCTTCTTCAACATGCGCAACGCGT  1566

>PYIW:scaffold_4038 piw_scaffold_4038 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_4038:1:2400:1 
REF
Length=2400

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 37/45 (82%), Gaps = 3/45 (7%)
 Strand=Plus/Minus

Query  1263  CGAAGACAAGCGGCTCGCGATCCGAC-TGCAGCTGCCGCTGCTGG  1306
             ||||  || | |||| ||||  |||| ||||||||||||||||||
Sbjct  1991  CGAATGCACGAGGCTAGCGA--CGACCTGCAGCTGCCGCTGCTGG  1949

>PYIW:scaffold_1439 piw_scaffold_1439 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1439:1:8936:1 
REF
Length=8936

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  908   TGCCGTCCTTCTCGGCCGAAGAGCGCGCGCGGCT  941
             || || ||||| ||||||| ||||||||||| ||
Sbjct  5339  TGGCGGCCTTCACGGCCGAGGAGCGCGCGCGCCT  5372

>PYIR:scaffold_2250 pir_scaffold_2250 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_2250:1:3331:1 
REF
Length=3331

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  466   GAGCTCGAGACGCTCTTGGTCCACTACTCGGTGC  499
             |||||||| ||| ||  | |||||||||||||||
Sbjct  1563  GAGCTCGACACGATCGAGTTCCACTACTCGGTGC  1596

>PYAR:scaffold_2397 par_scaffold_2397 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_2397:1:5173:1 
REF
Length=5173

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  1561  GCCGAGAAGCGCGCGATGAAGAACGACGA  1589
             |||||||  ||||| ||||||||||||||
Sbjct  4530  GCCGAGAGACGCGCCATGAAGAACGACGA  4502

>PYAR:scaffold_341 par_scaffold_341 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_341:1:20695:1 
REF
Length=20695

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  992   GCGCGATCGCGGATCCCAACGTCGACGTC  1020
             |||||||||||| || |||| ||||||||
Sbjct  7208  GCGCGATCGCGGGTCTCAACCTCGACGTC  7236

>PYAR:scaffold_323 par_scaffold_323 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_323:1:21214:1 
REF
Length=21214

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  705  GCGGCGGCTGCTGCGGCAGCACCA  728
            ||||||||||| ||||||||||||
Sbjct  512  GCGGCGGCTGCGGCGGCAGCACCA  535

>APAS:scaffold_51 supercont1.51 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.51:1:442152:1 
REF
Length=442152

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  1550   ACAAAGTCCGCGCCGAGAAGCGCGCGATG  1578
              || ||| |||||||||||||| |||||||
Sbjct  49790  ACGAAGCCCGCGCCGAGAAGCACGCGATG  49818

>APAS:scaffold_24 supercont1.24 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.24:1:781221:1 
REF
Length=781221

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 28/31 (90%), Gaps = 1/31 (3%)
 Strand=Plus/Minus

Query  2248    GCCGCGACGATGGGGGCCGAGCGCGCCTACA  2278
               ||||||||| ||| ||||||||||||| |||
Sbjct  449079  GCCGCGACG-TGGTGGCCGAGCGCGCCGACA  449050

>APAS:scaffold_21 supercont1.21 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.21:1:877946:1 
REF
Length=877946

 Score = 40.1 bits (43),  Expect = 5.5
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  102     TGATCTGGCGCCGCCCCCGACCGAGCCCG  130
               ||| ||||||||||||| | |||||||||
Sbjct  278699  TGACCTGGCGCCGCCCCAGCCCGAGCCCG  278727

>SAPA:scaffold_609 supercont2.609 dna:supercontig supercontig:ASM15154v2:supercont2.609:1:4831:1 
REF
Length=4831

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 26/28 (93%), Gaps = 1/28 (4%)
 Strand=Plus/Minus

Query  2577  TGCGATCCGATTGCGCCA-CGACGACAT  2603
             |||||||||||||||||| || ||||||
Sbjct  839   TGCGATCCGATTGCGCCATCGTCGACAT  812

>SAPA:scaffold_390 supercont2.390 dna:supercontig supercontig:ASM15154v2:supercont2.390:1:11537:1 
REF
Length=11537

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 37/45 (82%), Gaps = 2/45 (4%)
 Strand=Plus/Plus

Query  1881  GTACCCGCCAACGGCCGTGCCCTACGCAGCGATCCGCGGCGCGTC  1925
             |||||||||||| | |||| || |||| ||| |||| ||| ||||
Sbjct  4257  GTACCCGCCAACTGACGTG-CCGACGCCGCG-TCCGAGGCCCGTC  4299

>SAPA:scaffold_163 supercont2.163 dna:supercontig supercontig:ASM15154v2:supercont2.163:1:47609:1 
REF
Length=47609

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  2286   CGAGTACATCTTCCACCCGAACATGGCCACGCTCCA  2321
              || ||||||||||| ||| |||| |  |||||||||
Sbjct  13907  CGCGTACATCTTCCGCCCCAACACGAGCACGCTCCA  13942

>SAPA:scaffold_147 supercont2.147 dna:supercontig supercontig:ASM15154v2:supercont2.147:1:60233:1 
REF
Length=60233

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  1514   TGGCGGCCATCGACATGCACGCGCTCGAGTG  1544
              || |||  ||||||||| |||||||||||||
Sbjct  21866  TGTCGGAGATCGACATGGACGCGCTCGAGTG  21836

>SAPA:scaffold_33 supercont2.33 dna:supercontig supercontig:ASM15154v2:supercont2.33:1:345601:1 
REF
Length=345601

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  1026    CATCTCGCCGTTCGAGCTCTCGGTCG  1051
               ||||||| ||| ||||||||||||||
Sbjct  283235  CATCTCGTCGTCCGAGCTCTCGGTCG  283260

>SAPA:scaffold_34 supercont2.34 dna:supercontig supercontig:ASM15154v2:supercont2.34:1:347721:1 
REF
Length=347721

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 31/37 (84%), Gaps = 3/37 (8%)
 Strand=Plus/Minus

Query  1533    CGCGCTCGAGTGCGTCAACAA---AGTCCGCGCCGAG  1566
               || ||||||| ||||||| ||   |||||||||||||
Sbjct  236677  CGTGCTCGAGCGCGTCAAGAACCAAGTCCGCGCCGAG  236641

>SAPA:scaffold_31 supercont2.31 dna:supercontig supercontig:ASM15154v2:supercont2.31:1:358087:1 
REF
Length=358087

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  2112   GTCGTGCGCGACGCTGGACGCGGCGACGGGC  2142
              ||||  ||||||||||||  |||||||||||
Sbjct  88297  GTCGGCCGCGACGCTGGATCCGGCGACGGGC  88267

>SAPA:scaffold_13 supercont2.13 dna:supercontig supercontig:ASM15154v2:supercont2.13:1:731627:1 
REF
Length=731627

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  2255    CGATGGGGGCCGAGCGCGCCTACATTGCGCA  2285
               |||| |  ||||||||| |||||||||||||
Sbjct  590122  CGATTGCAGCCGAGCGCACCTACATTGCGCA  590152

>SAPA:scaffold_9 supercont2.9 dna:supercontig supercontig:ASM15154v2:supercont2.9:1:812807:1 
REF
Length=812807

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  1713    GCGTCCCGTGGTCAACCGCATCGGCGCCGTC  1743
               ||||| ||| ||| | |||||||||||||||
Sbjct  486001  GCGTCGCGTCGTCCATCGCATCGGCGCCGTC  485971

>SAPA:scaffold_7 supercont2.7 dna:supercontig supercontig:ASM15154v2:supercont2.7:1:943373:1 
REF
Length=943373

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  1553    AAGTCCGCGCCGAGAAGCGCGCGATGAAGAA  1583
               |||||||||||||||||| |||| |  ||||
Sbjct  451734  AAGTCCGCGCCGAGAAGCTCGCGCTCGAGAA  451704

>SAPA:scaffold_4 supercont2.4 dna:supercontig supercontig:ASM15154v2:supercont2.4:1:1210272:1 
REF
Length=1210272

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  2286   CGAGTACATCTTCCACCCGAACATGGCCACGCTCCA  2321
              || ||||||||||| ||| |||| |  |||||||||
Sbjct  19514  CGCGTACATCTTCCGCCCCAACACGAGCACGCTCCA  19549

>SADI:scaffold_169 supercont1.169 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.169:1:52845:1 
REF
Length=52845

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 34/42 (81%), Gaps = 3/42 (7%)
 Strand=Plus/Plus

Query  1017  CGTCATCTACATC---TCGCCGTTCGAGCTCTCGGTCGACAT  1055
             || |||||||||    | | |||| |||||||||||||||||
Sbjct  3918  CGCCATCTACATGCTTTTGGCGTTTGAGCTCTCGGTCGACAT  3959

>SADI:scaffold_79 supercont1.79 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.79:1:234383:1 
REF
Length=234383

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  2286  CGAGTACATCTTCCACCCGAACATGGCCACGCTCCA  2321
             || ||||||||||| ||| |||| |  |||||||||
Sbjct  3034  CGCGTACATCTTCCGCCCCAACACGAGCACGCTCCA  3069

>SADI:scaffold_62 supercont1.62 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.62:1:321638:1 
REF
Length=321638

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  65      TGAACTCGTCGGGCTTCAACGTAGCGTCGCT  95
               || || || |||||||||||| |||||||||
Sbjct  134195  TGCACCCGACGGGCTTCAACGCAGCGTCGCT  134165

>SADI:scaffold_33 supercont1.33 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.33:1:632372:1 
REF
Length=632372

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  1514    TGGCGGCCATCGACATGCACGCGCTCGAGTG  1544
               || |||  ||||||||| |||||||||||||
Sbjct  315031  TGTCGGAGATCGACATGGACGCGCTCGAGTG  315001

>PYVX:scaffold_586 pve_scaffold_586 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_586:1:18830:1 
REF
Length=18830

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 29/33 (88%), Gaps = 1/33 (3%)
 Strand=Plus/Minus

Query  1217   ACGTCCGCGGCAAGGAGGCGTACATCGTCGCAG  1249
              |||| ||||||||||| | ||||||||| ||||
Sbjct  18631  ACGTGCGCGGCAAGGACGTGTACATCGT-GCAG  18600

>PYUU:scaffold_2012 scf1117875582012 dna:supercontig supercontig:pug:scf1117875582012:1:298282:1 
REF
Length=298282

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  917     TCTCGGCCGAAGAGCGCGCGCGGCTC  942
               |||||||||| |||||||||||| ||
Sbjct  193810  TCTCGGCCGAGGAGCGCGCGCGGTTC  193835

>PYUU:scaffold_1381 scf1117875581381 dna:supercontig supercontig:pug:scf1117875581381:1:502691:1 
REF
Length=502691

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  1279    GCGATCCGACTGCAGCTGCCG  1299
               |||||||||||||||||||||
Sbjct  268966  GCGATCCGACTGCAGCTGCCG  268986

>PYIW:scaffold_8360 piw_scaffold_8360 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_8360:1:474:1 
REF
Length=474

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  1290  GCAGCTGCCGCTGCTGGGCATGGACCCGGAC  1320
             |||| || |||||||||||||||| | ||||
Sbjct  234   GCAGGTGACGCTGCTGGGCATGGAACTGGAC  264

>PYIW:scaffold_2373 piw_scaffold_2373 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_2373:1:5184:1 
REF
Length=5184

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  127   CCCGACGCGGTGCCGCCGACACGGCCGGCAG  157
             || |||||||||||||||||| || | ||||
Sbjct  2837  CCGGACGCGGTGCCGCCGACAAGGTCAGCAG  2807

>PYIW:scaffold_88 piw_scaffold_88 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_88:1:32191:1 
REF
Length=32191

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 29/33 (88%), Gaps = 1/33 (3%)
 Strand=Plus/Plus

Query  1217   ACGTCCGCGGCAAGGAGGCGTACATCGTCGCAG  1249
              |||| ||||||||||| | ||||||||| ||||
Sbjct  10564  ACGTGCGCGGCAAGGACGTGTACATCGT-GCAG  10595

>PYIR:scaffold_1628 pir_scaffold_1628 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_1628:1:5926:1 
REF
Length=5926

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  135   GGTGCCGCCGACACGGCCGGCAGTTG  160
             ||||||||||||||||||| ||| ||
Sbjct  5412  GGTGCCGCCGACACGGCCGACAGATG  5387

>PYIR:scaffold_320 pir_scaffold_320 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_320:1:31522:1 
REF
Length=31522

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  1143  GCGCTTCCCCGAGCACTTTTCGCTGGCGACG  1173
             |||||||| ||||||||||| | || |||||
Sbjct  1573  GCGCTTCCTCGAGCACTTTTTGGTGACGACG  1543

>PYIR:scaffold_303 pir_scaffold_303 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_303:1:32962:1 
REF
Length=32962

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 32/38 (84%), Gaps = 1/38 (3%)
 Strand=Plus/Plus

Query  1529  TGCACGCGCTCGAGTGCGTCAACAAAG-TCCGCGCCGA  1565
             || |||| |||||||||||| |||| | || |||||||
Sbjct  2426  TGGACGCTCTCGAGTGCGTCGACAATGTTCTGCGCCGA  2463

>PYIR:scaffold_219 pir_scaffold_219 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_219:1:39998:1 
REF
Length=39998

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 29/33 (88%), Gaps = 1/33 (3%)
 Strand=Plus/Minus

Query  1217  ACGTCCGCGGCAAGGAGGCGTACATCGTCGCAG  1249
             |||| ||||||||||| | ||||||||| ||||
Sbjct  9559  ACGTGCGCGGCAAGGACGTGTACATCGT-GCAG  9528

>PYAR:scaffold_1894 par_scaffold_1894 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1894:1:6631:1 
REF
Length=6631

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  1569  GCGCGCGATGAAGAACGACGAGTACTACAGC  1599
             || |||| | |||||||||||||||| ||||
Sbjct  5100  GCTCGCGTTCAAGAACGACGAGTACTGCAGC  5070

>PYAR:scaffold_170 par_scaffold_170 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_170:1:27305:1 
REF
Length=27305

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 29/33 (88%), Gaps = 1/33 (3%)
 Strand=Plus/Plus

Query  2129   ACGCGGCGACGGGCCGCAGTTTCCTCCCGCTGC  2161
              ||||||||||||| |||| || || ||||||||
Sbjct  23832  ACGCGGCGACGGGGCGCA-TTACCACCCGCTGC  23863

>PYAR:scaffold_89 par_scaffold_89 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_89:1:34464:1 
REF
Length=34464

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  443   GCAGCGTCTCGATGGCGATCCGCGAGCTCGA  473
             |||||  ||||  ||||||||||||||||||
Sbjct  2841  GCAGCTACTCGTCGGCGATCCGCGAGCTCGA  2871

>PYAP:scaffold_120 pag1_scaffold_120 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_120:1:61856:1 
REF
Length=61856

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 28/30 (93%), Gaps = 2/30 (7%)
 Strand=Plus/Plus

Query  721    CAGCACCACGGGCACTCGTACGCGACGCAC  750
              |||||| |||||||| ||||||||||||||
Sbjct  34008  CAGCAC-ACGGGCAC-CGTACGCGACGCAC  34035

>PHRA:scaffold_123
Length=117378

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 29/33 (88%), Gaps = 1/33 (3%)
 Strand=Plus/Plus

Query  1217   ACGTCCGCGGCAAGGAGGCGTACATCGTCGCAG  1249
              |||| ||||||||||| | ||||||||| ||||
Sbjct  48725  ACGTGCGCGGCAAGGACGTGTACATCGT-GCAG  48756

>PHRA:scaffold_48
Length=382763

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  1106    ACTCGCGCGTCCGGATGCTGCACCCGGAGAACGCCG  1141
               || |||||| || |  |||| |||||||||||||||
Sbjct  162632  ACACGCGCGCCCTGGAGCTGGACCCGGAGAACGCCG  162667

>PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.4, whole genome shotgun 
sequence
Length=2787191

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  2294     TCTTCCACCCGAACATGGCCA  2314
                |||||||||||||||||||||
Sbjct  2326954  TCTTCCACCCGAACATGGCCA  2326974

>PHKE:scaffold_241 scf_22126_241.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_241.1_contig_1:1:53856:1 
REF
Length=53856

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  745    ACGCACATTCAGCGCGTGTATCGAAC  770
              |||||||| ||| |||||||||||||
Sbjct  27033  ACGCACATACAGGGCGTGTATCGAAC  27008

>PHIF:NW_003303750.1 Phytophthora infestans T30-4 supercont1.9 
genomic scaffold, whole genome shotgun sequence
Length=4027111

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 26/28 (93%), Gaps = 1/28 (4%)
 Strand=Plus/Plus

Query  2309     TGGCCACGCTCCAGTACGC-CGTCTTCT  2335
                ||||||||||| ||||||| ||||||||
Sbjct  2624942  TGGCCACGCTCGAGTACGCGCGTCTTCT  2624969

>PHIF:NW_003303732.1 Phytophthora infestans T30-4 supercont1.27 
genomic scaffold, whole genome shotgun sequence
Length=2178769

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  705     GCGGCGGCTGCTGCGGCAGCACCACG  730
               ||||||||||||||||| |||| |||
Sbjct  499728  GCGGCGGCTGCTGCGGCTGCACGACG  499753

>PHCA:scaffold_478 PHYCAscaffold_478
Length=3878

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 31/37 (84%), Gaps = 3/37 (8%)
 Strand=Plus/Minus

Query  1724  TCAACCG---CATCGGCGCCGTCATCGAAGCGTAccc  1757
             |||||||   || ||||||||  ||||||||||||||
Sbjct  1301  TCAACCGTTCCAGCGGCGCCGAAATCGAAGCGTACCC  1265

>PHCA:scaffold_102 PHYCAscaffold_102
Length=120866

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 31/37 (84%), Gaps = 3/37 (8%)
 Strand=Plus/Minus

Query  1724   TCAACCG---CATCGGCGCCGTCATCGAAGCGTAccc  1757
              |||||||   || ||||||||  ||||||||||||||
Sbjct  50790  TCAACCGTTCCAGCGGCGCCGAAATCGAAGCGTACCC  50754

>PHCA:scaffold_22 PHYCAscaffold_22
Length=843021

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 31/37 (84%), Gaps = 3/37 (8%)
 Strand=Plus/Plus

Query  1724    TCAACCG---CATCGGCGCCGTCATCGAAGCGTAccc  1757
               |||||||   || ||||||||  ||||||||||||||
Sbjct  260791  TCAACCGTTCCAGCGGCGCCGAAATCGAAGCGTACCC  260827

>PHCA:scaffold_15 PHYCAscaffold_15
Length=1032281

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  867     CTGGGACAAGATCAAAATGCA  887
               |||||||||||||||||||||
Sbjct  866840  CTGGGACAAGATCAAAATGCA  866820

>APIN:scaffold_27 supercont1.27 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.27:1:843962:1 
REF
Length=843962

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  2502    CGACCAAGTCGGCGTGCAGCC  2522
               |||||||||||||||||||||
Sbjct  745785  CGACCAAGTCGGCGTGCAGCC  745805

>APIN:scaffold_8 supercont1.8 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.8:1:1936381:1 
REF
Length=1936381

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  916      TTCTCGGCCGAAGAGCGCGCGCGGCT  941
                ||||||| ||||||||||||||| ||
Sbjct  1001703  TTCTCGGACGAAGAGCGCGCGCGTCT  1001728

>APAS:scaffold_39 supercont1.39 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.39:1:524933:1 
REF
Length=524933

 Score = 39.2 bits (42),  Expect = 5.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  657    GCACGCGGCGGCGATCGTCATCCAGT  682
              ||| ||||||||| ||||||||||||
Sbjct  82969  GCATGCGGCGGCGCTCGTCATCCAGT  82994

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 3396641768562

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2