Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
PYUU:scaffold_20371302477130315768113620.0
PYIR:scaffold_81069821075315563521e-84
PYIW:scaffold_71110790112594802035e-44
PYIR:scaffold_50242316304061742e-36
PHSO:scaffold_1279361327940063971702e-35
PHRA:scaffold_561609641614254701611e-32
PHCA:scaffold_8495232956244001341e-25
PHIF:NW_003303730.16734986736831861325e-25
PHIF:NW_003303626.12673492675341861325e-25
PHPA:scaffold_632447122451064011296e-24
PYIR:scaffold_2249144018354031258e-23
PHRA:scaffold_10612945131251821219e-22
PHSO:scaffold_3518113183272161193e-21
PHSO:scaffold_148187978190112161193e-21
PHSO:scaffold_56819666821802161193e-21
PHCA:scaffold_79046049047851851121e-19
PHPA:scaffold_226855766858372631082e-18
PHKE:scaffold_9860437607663391066e-18
PHRA:scaffold_267962798071831052e-17
PYVX:scaffold_27577338062339989e-16
PYAP:scaffold_5601275413057310989e-16
PHIF:NW_003303697.1394874395258392934e-14
PHKE:scaffold_62234833719239924e-14
HYAP:scaffold_5916160916170193911e-13
PYAR:scaffold_34592465255390872e-12
PHSO:scaffold_22679847267992482721e-08
PYIR:scaffold_1556000605859681e-07
PHRA:scaffold_433166533174282674e-07
PYUU:scaffold_203671322171326646625e-06
PYAP:scaffold_1821834192996625e-06
PYIR:scaffold_13195656570247596e-05
PYAR:scaffold_883954400047596e-05
PHSO:scaffold_81238275123834369586e-05
PHSO:scaffold_12167130167227102572e-04
PYUU:scaffold_203860170260174948562e-04
PHRA:scaffold_51384753854268562e-04
PHKE:scaffold_76139748085562e-04
PHCA:scaffold_2417227817235578562e-04
PYVX:scaffold_6392148218235558e-04
PHSO:scaffold_643815938313155558e-04
PHSO:scaffold_443652074365361155558e-04
PHPA:scaffold_3915027615033359558e-04
PHPA:scaffold_952415952422669558e-04
PHSO:scaffold_101090940109097637548e-04
PHCA:scaffold_67220373220555190548e-04
PHSO:scaffold_1652427652434166520.003
PHRA:scaffold_28921529162295520.003
PHRA:scaffold_4948165825895520.003
PHRA:scaffold_3317107117116495520.003
PYIW:scaffold_700342646338510.009
PLHA:NW_020189861.11846546184663996510.009
PHRA:scaffold_79256742571138510.009
PHPA:scaffold_6616263616270368510.009
PHPA:scaffold_463497356468510.009
PYVX:scaffold_121289382897740500.009
PYAP:scaffold_2891253212670140500.009
PHSO:scaffold_112022491202256070500.009
PYAR:scaffold_593157911588494480.032
PHKE:scaffold_8843691374959480.032
SADI:scaffold_2213484313486826470.11
PYVX:scaffold_6222228228660470.11
PYVX:scaffold_496103451037733460.11
PYUU:scaffold_178969853469858148460.11
PYIW:scaffold_7121277132448460.11
PYIR:scaffold_15900829011635460.11
PYAP:scaffold_216258952593238460.11
PHIF:NW_003303753.13772623377265028460.11
PYUU:scaffold_130813777813781235450.39
SAPA:scaffold_1230638030640627440.39
PYIW:scaffold_2828635866938440.39
PYAP:scaffold_328273922741827440.39
PHPA:scaffold_2036396936405082440.39
PHIF:NW_003303747.12704505270453127440.39
PHCA:scaffold_9314443214449463440.39
PYVX:scaffold_341235432360159431.4
PYUU:scaffold_202862075162079748431.4
PYUU:scaffold_202949490949496254431.4
PYIR:scaffold_88399911002939431.4
PYIR:scaffold_8718587864054431.4
PYAR:scaffold_6747403745654431.4
SADI:scaffold_10910394610397126421.4
PYVX:scaffold_183368473687731421.4
PYIR:scaffold_349783190073421.4
PHPA:scaffold_51016458101653278421.4
APAS:scaffold_1053570353572826421.4
SAPA:scaffold_82399113993323414.8
SAPA:scaffold_5610086210089030414.8
SAPA:scaffold_4420811020813223414.8
PYVX:scaffold_4084141416828414.8
PYVX:scaffold_2084101412323414.8
PYVX:scaffold_86328633289028414.8
PYUU:scaffold_202746985046987223414.8
PYAR:scaffold_538119571198933414.8
PYAR:scaffold_3206181620828414.8
PYAP:scaffold_12722310233728414.8
PHRA:scaffold_109644396446628414.8
PHRA:scaffold_765098865102033414.8
PHKE:scaffold_354147011479496414.8
PHIF:NW_003303752.13737089373711123414.8
SAPA:scaffold_219111051113027404.8
SAPA:scaffold_97143561439136404.8
SAPA:scaffold_612744312747332404.8
SAPA:scaffold_514255314257725404.8
SADI:scaffold_9817369617372127404.8
SADI:scaffold_5224573524575925404.8
SADI:scaffold_3254666454669432404.8
PYVX:scaffold_395165311656030404.8
PYVX:scaffold_305102341026330404.8
PYVX:scaffold_1654136416127404.8
PYIW:scaffold_783111561120550404.8
PYIR:scaffold_9184024405636404.8
PYIR:scaffold_203309273094620404.8
PYAR:scaffold_7277158717720404.8
PYAP:scaffold_23522785230730404.8
PHRA:scaffold_123248242485835404.8
PHPA:scaffold_190419874200620404.8
PHIF:NW_003303610.127021627025035404.8
PHCA:scaffold_1164922664925530404.8
ALCA:scaffold_40523525420404.8
BLASTN 2.9.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= PYU1_G001738

Length=681
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:p...  1229       0.0  
PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_sc...  318        1e-84
PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:pi...  184        5e-44
PYIR:scaffold_5024 pir_scaffold_5024 dna:supercontig supercontig:...  158        2e-36
PHSO:scaffold_1                                                       154        2e-35
PHRA:scaffold_56                                                      146        1e-32
PHCA:scaffold_84 PHYCAscaffold_84                                     122        1e-25
PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 ge...  120        5e-25
PHIF:NW_003303626.1 Phytophthora infestans T30-4 supercont1.133 g...  120        5e-25
PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 ...  117        6e-24
PYIR:scaffold_2249 pir_scaffold_2249 dna:supercontig supercontig:...  113        8e-23
PHRA:scaffold_106                                                     110        9e-22
PHSO:scaffold_35                                                      108        3e-21
PHSO:scaffold_14                                                      108        3e-21
PHSO:scaffold_5                                                       108        3e-21
PHCA:scaffold_7 PHYCAscaffold_7                                       102        1e-19
PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 ...  98.7       2e-18
PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercon...  96.9       6e-18
PHRA:scaffold_267                                                     96.0       2e-17
PYVX:scaffold_275 pve_scaffold_275 dna:supercontig supercontig:pv...  89.7       9e-16
PYAP:scaffold_560 pag1_scaffold_560 dna:supercontig supercontig:p...  89.7       9e-16
PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 ge...  85.1       4e-14
PHKE:scaffold_622 scf_22126_622.1 dna:supercontig supercontig:Phy...  84.2       4e-14
HYAP:scaffold_59 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_5...  83.3       1e-13
PYAR:scaffold_3459 par_scaffold_3459 dna:supercontig supercontig:...  79.7       2e-12
PHSO:scaffold_2                                                       66.2       1e-08
PYIR:scaffold_155 pir_scaffold_155 dna:supercontig supercontig:pi...  62.6       1e-07
PHRA:scaffold_4                                                       61.7       4e-07
PYUU:scaffold_2036 scf1117875582036 dna:supercontig supercontig:p...  57.2       5e-06
PYAP:scaffold_182 pag1_scaffold_182 dna:supercontig supercontig:p...  57.2       5e-06
PYIR:scaffold_1319 pir_scaffold_1319 dna:supercontig supercontig:...  54.5       6e-05
PYAR:scaffold_88 par_scaffold_88 dna:supercontig supercontig:par_...  54.5       6e-05
PHSO:scaffold_8                                                       53.6       6e-05
PHSO:scaffold_12                                                      52.7       2e-04
PYUU:scaffold_2038 scf1117875582038 dna:supercontig supercontig:p...  51.8       2e-04
PHRA:scaffold_51                                                      51.8       2e-04
PHKE:scaffold_761 scf_22126_761.1_contig_1 dna:supercontig superc...  51.8       2e-04
PHCA:scaffold_24 PHYCAscaffold_24                                     51.8       2e-04
PYVX:scaffold_639 pve_scaffold_639 dna:supercontig supercontig:pv...  50.9       8e-04
PHSO:scaffold_64                                                      50.9       8e-04
PHSO:scaffold_4                                                       50.9       8e-04
PHPA:scaffold_39 NW_008649025.1 Phytophthora parasitica INRA-310 ...  50.9       8e-04
PHPA:scaffold_9 NW_008648995.1 Phytophthora parasitica INRA-310 u...  50.9       8e-04
PHSO:scaffold_10                                                      50.0       8e-04
PHCA:scaffold_67 PHYCAscaffold_67                                     50.0       8e-04
PHSO:scaffold_16                                                      48.2       0.003
PHRA:scaffold_2892                                                    48.2       0.003
PHRA:scaffold_494                                                     48.2       0.003
PHRA:scaffold_33                                                      48.2       0.003
PYIW:scaffold_7003 piw_scaffold_7003 dna:supercontig supercontig:...  47.3       0.009
PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig:...  47.3       0.009
PHRA:scaffold_79                                                      47.3       0.009
PHPA:scaffold_66 NW_008649052.1 Phytophthora parasitica INRA-310 ...  47.3       0.009
PHPA:scaffold_46 NW_008649032.1 Phytophthora parasitica INRA-310 ...  47.3       0.009
PYVX:scaffold_121 pve_scaffold_121 dna:supercontig supercontig:pv...  46.4       0.009
PYAP:scaffold_289 pag1_scaffold_289 dna:supercontig supercontig:p...  46.4       0.009
PHSO:scaffold_11                                                      46.4       0.009
PYAR:scaffold_593 par_scaffold_593 dna:supercontig supercontig:pa...  44.6       0.032
PHKE:scaffold_884 scf_22126_884.1_contig_1 dna:supercontig superc...  44.6       0.032
SADI:scaffold_22 supercont1.22 dna:supercontig supercontig:Sap_di...  43.7       0.11 
PYVX:scaffold_622 pve_scaffold_622 dna:supercontig supercontig:pv...  43.7       0.11 
PYVX:scaffold_496 pve_scaffold_496 dna:supercontig supercontig:pv...  42.8       0.11 
PYUU:scaffold_1789 scf1117875581789 dna:supercontig supercontig:p...  42.8       0.11 
PYIW:scaffold_712 piw_scaffold_712 dna:supercontig supercontig:pi...  42.8       0.11 
PYIR:scaffold_15 pir_scaffold_15 dna:supercontig supercontig:pir_...  42.8       0.11 
PYAP:scaffold_216 pag1_scaffold_216 dna:supercontig supercontig:p...  42.8       0.11 
PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 gen...  42.8       0.11 
PYUU:scaffold_1308 scf1117875581308 dna:supercontig supercontig:p...  41.9       0.39 
SAPA:scaffold_12 supercont2.12 dna:supercontig supercontig:ASM151...  41.0       0.39 
PYIW:scaffold_282 piw_scaffold_282 dna:supercontig supercontig:pi...  41.0       0.39 
PYAP:scaffold_328 pag1_scaffold_328 dna:supercontig supercontig:p...  41.0       0.39 
PHPA:scaffold_20 NW_008649006.1 Phytophthora parasitica INRA-310 ...  41.0       0.39 
PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 ge...  41.0       0.39 
PHCA:scaffold_93 PHYCAscaffold_93                                     41.0       0.39 
PYVX:scaffold_341 pve_scaffold_341 dna:supercontig supercontig:pv...  40.1       1.4  
PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:p...  40.1       1.4  
PYUU:scaffold_2029 scf1117875582029 dna:supercontig supercontig:p...  40.1       1.4  
PYIR:scaffold_883 pir_scaffold_883 dna:supercontig supercontig:pi...  40.1       1.4  
PYIR:scaffold_871 pir_scaffold_871 dna:supercontig supercontig:pi...  40.1       1.4  
PYAR:scaffold_674 par_scaffold_674 dna:supercontig supercontig:pa...  40.1       1.4  
SADI:scaffold_109 supercont1.109 dna:supercontig supercontig:Sap_...  39.2       1.4  
PYVX:scaffold_183 pve_scaffold_183 dna:supercontig supercontig:pv...  39.2       1.4  
PYIR:scaffold_3497 pir_scaffold_3497 dna:supercontig supercontig:...  39.2       1.4  
PHPA:scaffold_5 NW_008648991.1 Phytophthora parasitica INRA-310 u...  39.2       1.4  
APAS:scaffold_10 supercont1.10 dna:supercontig supercontig:Apha_a...  39.2       1.4  
SAPA:scaffold_82 supercont2.82 dna:supercontig supercontig:ASM151...  38.3       4.8  
SAPA:scaffold_56 supercont2.56 dna:supercontig supercontig:ASM151...  38.3       4.8  
SAPA:scaffold_44 supercont2.44 dna:supercontig supercontig:ASM151...  38.3       4.8  
PYVX:scaffold_408 pve_scaffold_408 dna:supercontig supercontig:pv...  38.3       4.8  
PYVX:scaffold_208 pve_scaffold_208 dna:supercontig supercontig:pv...  38.3       4.8  
PYVX:scaffold_86 pve_scaffold_86 dna:supercontig supercontig:pve_...  38.3       4.8  
PYUU:scaffold_2027 scf1117875582027 dna:supercontig supercontig:p...  38.3       4.8  
PYAR:scaffold_538 par_scaffold_538 dna:supercontig supercontig:pa...  38.3       4.8  
PYAR:scaffold_320 par_scaffold_320 dna:supercontig supercontig:pa...  38.3       4.8  
PYAP:scaffold_1272 pag1_scaffold_1272 dna:supercontig supercontig...  38.3       4.8  
PHRA:scaffold_109                                                     38.3       4.8  
PHRA:scaffold_7                                                       38.3       4.8  
PHKE:scaffold_354 scf_22126_354.1_contig_1 dna:supercontig superc...  38.3       4.8  
PHIF:NW_003303752.1 Phytophthora infestans T30-4 supercont1.7 gen...  38.3       4.8  
SAPA:scaffold_219 supercont2.219 dna:supercontig supercontig:ASM1...  37.4       4.8  
SAPA:scaffold_97 supercont2.97 dna:supercontig supercontig:ASM151...  37.4       4.8  
SAPA:scaffold_6 supercont2.6 dna:supercontig supercontig:ASM15154...  37.4       4.8  
SAPA:scaffold_5 supercont2.5 dna:supercontig supercontig:ASM15154...  37.4       4.8  
SADI:scaffold_98 supercont1.98 dna:supercontig supercontig:Sap_di...  37.4       4.8  
SADI:scaffold_52 supercont1.52 dna:supercontig supercontig:Sap_di...  37.4       4.8  
SADI:scaffold_32 supercont1.32 dna:supercontig supercontig:Sap_di...  37.4       4.8  
PYVX:scaffold_395 pve_scaffold_395 dna:supercontig supercontig:pv...  37.4       4.8  
PYVX:scaffold_305 pve_scaffold_305 dna:supercontig supercontig:pv...  37.4       4.8  
PYVX:scaffold_165 pve_scaffold_165 dna:supercontig supercontig:pv...  37.4       4.8  
PYIW:scaffold_783 piw_scaffold_783 dna:supercontig supercontig:pi...  37.4       4.8  
PYIR:scaffold_918 pir_scaffold_918 dna:supercontig supercontig:pi...  37.4       4.8  
PYIR:scaffold_203 pir_scaffold_203 dna:supercontig supercontig:pi...  37.4       4.8  
PYAR:scaffold_727 par_scaffold_727 dna:supercontig supercontig:pa...  37.4       4.8  
PYAP:scaffold_23 pag1_scaffold_23 dna:supercontig supercontig:pag...  37.4       4.8  
PHRA:scaffold_123                                                     37.4       4.8  
PHPA:scaffold_190 NW_008649176.1 Phytophthora parasitica INRA-310...  37.4       4.8  
PHIF:NW_003303610.1 Phytophthora infestans T30-4 supercont1.149 g...  37.4       4.8  
PHCA:scaffold_11 PHYCAscaffold_11                                     37.4       4.8  
ALCA:scaffold_405 AcNc2_CONTIG_405_length_22299 dna:supercontig s...  37.4       4.8  

>PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:pug:scf1117875582037:1:1414051:1 
REF
Length=1414051

 Score = 1229 bits (1362),  Expect = 0.0
 Identities = 681/681 (100%), Gaps = 0/681 (0%)
 Strand=Plus/Minus

Query  1        ATGGCACCATGGTTCCACCCCACGGTGGCGCTCGCGCTTCTGAGCGCAGTTGCCGTCCAC  60
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303157  ATGGCACCATGGTTCCACCCCACGGTGGCGCTCGCGCTTCTGAGCGCAGTTGCCGTCCAC  1303098

Query  61       GCGCAGCACAAGGTGCTGTACCCCGAGCCGTTCTACCTCGTCGACGGCGATGAAGCCCAG  120
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303097  GCGCAGCACAAGGTGCTGTACCCCGAGCCGTTCTACCTCGTCGACGGCGATGAAGCCCAG  1303038

Query  121      TCGGCCCCTGTGGCGCATCTCGAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGAC  180
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1303037  TCGGCCCCTGTGGCGCATCTCGAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGAC  1302978

Query  181      TTCATGAAGCAGAAGGGGTATGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTAC  240
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302977  TTCATGAAGCAGAAGGGGTATGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTAC  1302918

Query  241      AACGTGAACCCGGATGCGCTCGACGAGTGCGGGTACACGGACCCGACGGTCGAGTCACAG  300
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302917  AACGTGAACCCGGATGCGCTCGACGAGTGCGGGTACACGGACCCGACGGTCGAGTCACAG  1302858

Query  301      CCGATCCCAGTGACCAACGCCTTCATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAG  360
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302857  CCGATCCCAGTGACCAACGCCTTCATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAG  1302798

Query  361      GTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACAAAGTACCCCGGT  420
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302797  GTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACAAAGTACCCCGGT  1302738

Query  421      ACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGG  480
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302737  ACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGG  1302678

Query  481      CTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTGTCG  540
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302677  CTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTGTCG  1302618

Query  541      TTGCGTGGGAATGGCGTCCAAAGCTCGGAGACTCCGACACCGATCGCCGTGGCCTCAGCA  600
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302617  TTGCGTGGGAATGGCGTCCAAAGCTCGGAGACTCCGACACCGATCGCCGTGGCCTCAGCA  1302558

Query  601      ACACCAACGACCGCCGAAGCCCCAGGAAAAGGCAAGGCGGCGAAAAGCGACTGGGGCTGG  660
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1302557  ACACCAACGACCGCCGAAGCCCCAGGAAAAGGCAAGGCGGCGAAAAGCGACTGGGGCTGG  1302498

Query  661      CTCGAGCTTTTCTGGTCATAA  681
                |||||||||||||||||||||
Sbjct  1302497  CTCGAGCTTTTCTGGTCATAA  1302477

 Score = 344 bits (381),  Expect = 2e-92
 Identities = 375/492 (76%), Gaps = 12/492 (2%)
 Strand=Plus/Plus

Query  55       GTCCACGCGCAGCACAAGGTGCTGTACCCCGAGCCGTTCTACCTCGTCGACGGCGATGAA  114
                ||| | || || || | | || | | |||||||||||||| ||||||||||||| | || 
Sbjct  1299484  GTCGATGCACATCAGATGATGATCTTCCCCGAGCCGTTCTTCCTCGTCGACGGCAAGGAC  1299543

Query  115      GCCCAGTCG--GCCCCTGTGGCGCAT--CTCGAGGAGCAGGGCATCAAGACGAGCGCCGA  170
                || || | |  ||| ||    |||||  || ||| | |||||| | || ||||| || ||
Sbjct  1299544  GCACAATGGAAGCCGCT----CGCATTCCTTGAGAACCAGGGCGTGAACACGAGTGCTGA  1299599

Query  171      CGTCTCGGACTTCATGAAGCAGAAGGGGTATGCGAACCTTCGCGCGATGCTGGACGACCA  230
                 ||| | |  |||||||||||||||||||| |||||| | |||||| || |||||||  |
Sbjct  1299600  TGTCGCCGGGTTCATGAAGCAGAAGGGGTACGCGAACTTGCGCGCGTTGATGGACGATGA  1299659

Query  231      GAAGCTCTACAACGTGAACCCGGATGCGCTCGACGAGTGCGGGTACACGGACCCGACGGT  290
                 ||||||||| | || ||| |||| ||||||   |||||||||||||||||||| |||  
Sbjct  1299660  AAAGCTCTACGAAGTTAACACGGACGCGCTCTTTGAGTGCGGGTACACGGACCCAACGTA  1299719

Query  291      CGAGTCACAGCCGATCCCAGTGAC--CAACGCCTTCATCTCCACGGGGTACGTCTTGAAT  348
                |||||| || ||||||||   |||   ||| | |||  ||| |||||||||  |    ||
Sbjct  1299720  CGAGTCGCAACCGATCCCCACGACGGGAAC-CATTC-GCTCGACGGGGTACACCCACGAT  1299777

Query  349      GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
                || ||||| || ||||||||||| ||| ||||||||||||||| |   |||||||||   
Sbjct  1299778  GGGCCGTGTGAAGTGTGGCTCGATGACGTCAAGGTCATGTCGGGCGACAACTGCCACGAC  1299837

Query  409      AAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTG  468
                |||| ||| || | || |||   |||||||||||||||||||||||| || |||| ||||
Sbjct  1299838  AAGTTCCCAGGCAAGACCTTCCCGCTCGACTACAGCTCGTGCAAGGGTTCATGCACGCTG  1299897

Query  469      CGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAG  528
                |||||||||||||||||| | |    | ||||  ||   |||||||||||| | ||||||
Sbjct  1299898  CGGTGGTACTGGCTCGGCGTGCGCTACCTGAAGAAGCGATACTCGTGGCAGATTTACAAG  1299957

Query  529      GTCTGCGTGTCG  540
                |  ||||| |||
Sbjct  1299958  GAGTGCGTCTCG  1299969

 Score = 148 bits (163),  Expect = 4e-33
 Identities = 277/404 (69%), Gaps = 10/404 (2%)
 Strand=Plus/Plus

Query  139      CTCGAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGACTTCATGAAGCAGAAGGGG  198
                |||||| | ||||||  |||||| | ||||||| ||   | || |   |||   ||||| 
Sbjct  1298104  CTCGAGAACCAGGGCTACAAGACCACCGCCGACTTCAACGCCTACTACAAGTCCAAGGGC  1298163

Query  199      TATGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGATGCG  258
                ||   |   || |||||| |  |||||||| |||||   ||||| || ||| || | || 
Sbjct  1298164  TACAAGTCGCTGCGCGCGTTCATGGACGACAAGAAGGCGTACAAGGTCAACTCGAACGCC  1298223

Query  259      CTCGACGAGTGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTGACCAAC  318
                  |  ||||||||| |||||  ||  ||  | || |   || |||||||| |   |||||
Sbjct  1298224  GACTTCGAGTGCGGCTACACCAACAAGAACGGCGCGCGCCAACCGATCCCGG---CCAAC  1298280

Query  319      GCCTTCATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTC  378
                   |||  | |||||||||||       | || ||||||||||||||||||||| ||  |
Sbjct  1298281  ---TTCCGCACCACGGGGTACACGCACGACGGTCCGTGCGAGGTGTGGCTCGACAACACC  1298337

Query  379      AAGGTCATGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGC--TCG  436
                |||||| ||||||     ||||| ||||   | | |||||| | || |   | ||  |  
Sbjct  1298338  AAGGTCTTGTCGGGTTCCAACTGTCACAAGGACTTCCCCGGCAAGACC--CACGCCATGA  1298395

Query  437      ACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCG  496
                 ||||    |||||||||| ||||||| | |||| ||||||||| | |||||||    | 
Sbjct  1298396  GCTACGCGGCGTGCAAGGGCTCGTGCACGTTGCGCTGGTACTGGATGGGCATCCGCTTCC  1298455

Query  497      TGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTGTCG  540
                | || |  | | |||||||||| ||||||||||  |||||| ||
Sbjct  1298456  TCAAGGGCAAGCACTCGTGGCAAGTGTACAAGGAGTGCGTGCCG  1298499

 Score = 124 bits (137),  Expect = 4e-26
 Identities = 285/424 (67%), Gaps = 24/424 (6%)
 Strand=Plus/Plus

Query  123      GGCCCCTGTGGCGCATCTCGAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGACTT  182
                ||||||  || ||   |||||| || | ||  ||||||| |||||   ||||   | |||
Sbjct  1301057  GGCCCCGCTGTCGTTCCTCGAGAAGAACGGTGTCAAGACAAGCGCGAGCGTCAATGGCTT  1301116

Query  183      CATGAAGCAGAAGGGGTATGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAA  242
                ||||||| ||||||||||    |  || ||||   |  ||||||||||||||||||||||
Sbjct  1301117  CATGAAGGAGAAGGGGTACAACACGCTCCGCGATCTCATGGACGACCAGAAGCTCTACAA  1301176

Query  243      CGTGAACCCGGATGCGCTCGACGA------GTGCGGGTACACGGACCCGACGGTCGAGTC  296
                 || ||| || | ||   |||  |       ||||| ||||||||||||||    |  ||
Sbjct  1301177  GGTCAACTCGAACGC---CGATAACTTTCTCTGCGGCTACACGGACCCGACCAAGGGCTC  1301233

Query  297      ACAGCCGAT-CCCAGTGACCAACGCCTTCATCTCCACGGGGTACGTCTTGAATGGACCGT  355
                 |||||||| ||||  || || | || |   | | || || |||  |      || ||||
Sbjct  1301234  GCAGCCGATCCCCAAAGA-CAGCACCATGCGCACGACCGGATACACCCACGTGGGCCCGT  1301292

Query  356      GCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCAC--ACAA---A  410
                | || || ||| |||||||| ||||||||||  | | |   |||||||||  ||||   |
Sbjct  1301293  GTGAAGTCTGGATCGACGACGTCAAGGTCATCGCAGGCGACAACTGCCACGAACAAGTGA  1301352

Query  411      GTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCG  470
                | | |     || | |   | | | |||||||||   ||||||||   ||||| | ||| 
Sbjct  1301353  GCAAC-----ACCACC---AAGGTGGACTACAGCAACTGCAAGGGCAAGTGCACGATGCA  1301404

Query  471      GTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGT  530
                 ||||||||||||||  | |    | | ||  ||| ||  |||||||| |||||||||  
Sbjct  1301405  CTGGTACTGGCTCGGATTGCGCTTCCTCAAGAAGAAGTGGTCGTGGCAAGTGTACAAGAA  1301464

Query  531      CTGC  534
                ||||
Sbjct  1301465  CTGC  1301468

 Score = 118 bits (130),  Expect = 2e-24
 Identities = 141/189 (75%), Gaps = 2/189 (1%)
 Strand=Plus/Plus

Query  349      GGACCGTGCGAGGTGTGGCTCGACGACCTCAAG-GTCATGTCGGACATGAACTGCCACAC  407
                || || |||||||||||||||||  | | |  | || |||  || ||  ||||||||| |
Sbjct  1294640  GGTCCATGCGAGGTGTGGCTCGAT-AGCACGCGCGTGATGAAGGGCAACAACTGCCACTC  1294698

Query  408      AAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCT  467
                  ||| ||| || |||| ||| |   ||||||||   ||||||||||| ||||||| |||
Sbjct  1294699  GGAGTTCCCAGGCACGACCTTCAAAATCGACTACTCGTCGTGCAAGGGCTCGTGCACGCT  1294758

Query  468      GCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAA  527
                ||| ||||||||| | || || |    | | || |  | |||||||||||||||||||||
Sbjct  1294759  GCGCTGGTACTGGATGGGTATTCGCTTCCTCAAGGGCAAGTACTCGTGGCAGGTGTACAA  1294818

Query  528      GGTCTGCGT  536
                |  ||||||
Sbjct  1294819  GAACTGCGT  1294827

 Score = 105 bits (116),  Expect = 1e-20
 Identities = 136/188 (72%), Gaps = 0/188 (0%)
 Strand=Plus/Plus

Query  349      GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
                || || |||||||||||||||||| ||  |   || |||  || ||  ||||||||| | 
Sbjct  1288916  GGTCCATGCGAGGTGTGGCTCGACAACACCCTTGTGATGAAGGGCAACAACTGCCACTCG  1288975

Query  409      AAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTG  468
                 ||| ||| || ||||     | | ||   |||   ||||||||||| ||||||| ||||
Sbjct  1288976  GAGTTCCCAGGCACGACGCACAAGATCAGTTACGCTTCGTGCAAGGGCTCGTGCACGCTG  1289035

Query  469      CGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAG  528
                || ||||||||| | || || |    | | || |  | ||||||||||||||||||||||
Sbjct  1289036  CGCTGGTACTGGATGGGTATTCGCTTCCTCAAGGGCAAGTACTCGTGGCAGGTGTACAAG  1289095

Query  529      GTCTGCGT  536
                  ||||||
Sbjct  1289096  AACTGCGT  1289103

 Score = 103 bits (113),  Expect = 1e-19
 Identities = 140/193 (73%), Gaps = 2/193 (1%)
 Strand=Plus/Plus

Query  349      GGACCGTGCGAGGTGTGGCTCGACGACCTCAAG-GTCATGTCGGACATGAACTGCCACAC  407
                || || |||||||||||||||||| | | |  | || |||  || ||  |||||||||||
Sbjct  1296177  GGTCCATGCGAGGTGTGGCTCGAC-AGCACGCGCGTGATGAAGGGCAACAACTGCCACAC  1296235

Query  408      AAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCT  467
                  ||| | | || ||||     |   ||||||||   ||||||||||| ||||||| |||
Sbjct  1296236  CGAGTTCACTGGAACGACGCACACAATCGACTACTCGTCGTGCAAGGGCTCGTGCACGCT  1296295

Query  468      GCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAA  527
                ||| ||||||||| | || || |    | | || |    |||||||||||||||||||||
Sbjct  1296296  GCGCTGGTACTGGATGGGTATTCGCTTCCTCAAGGGCGAGTACTCGTGGCAGGTGTACAA  1296355

Query  528      GGTCTGCGTGTCG  540
                   ||||||| ||
Sbjct  1296356  AAACTGCGTGCCG  1296368

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 33/40 (83%), Gaps = 2/40 (5%)
 Strand=Plus/Plus

Query  368     TCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACAC  407
               |||||||||||||||||| |   ||||  |||||| ||||
Sbjct  671685  TCGACGACCTCAAGGTCAAGCACGACA--AACTGCAACAC  671722

>PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_8:1:111390:1 
REF
Length=111390

 Score = 318 bits (352),  Expect = 1e-84
 Identities = 410/556 (74%), Gaps = 15/556 (3%)
 Strand=Plus/Plus

Query  1       ATGGCACCATGGTTCCACCCCACGGTGGCGCTCGC-GCTTCTGAGCGCAGTTGCCGTC-C  58
               ||||| |  | ||||| ||| | | | ||| |||| ||  | | || ||| | | ||| |
Sbjct  106982  ATGGCGCGCTCGTTCCTCCCGATGCTCGCGGTCGCCGCCGCGGCGCTCAGCT-CTGTCAC  107040

Query  59      A--CGCGCAGCACAAGGTGCTGTACCCCGAGCCGTTCTACCTCGTCGACGGCGATGAAGC  116
               |  |||||| || ||| |  | ||||| |||||||||| |||||| |||||| | ||   
Sbjct  107041  AGTCGCGCACCAGAAGCTCATCTACCCGGAGCCGTTCTTCCTCGTGGACGGCCAGGACAT  107100

Query  117     CCAGTCGGCCCCTGTGGCGCATCTCGAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTC  176
                |||| |   ||  | |||   |||||| | |||   ||||| |||||||||||| |  |
Sbjct  107101  GCAGTGGCAGCCGCTCGCGTTCCTCGAGAACCAGAAGATCAACACGAGCGCCGACTTTGC  107160

Query  177     GGACTTCATGAAGCAGAAGGGGTATGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCT  236
                | |||| | |||||||| ||||| || ||||| ||||| ||| |||||||| |||||||
Sbjct  107161  CGGCTTCCTCAAGCAGAAAGGGTACGCAAACCTGCGCGCCATGATGGACGACGAGAAGCT  107220

Query  237     CTACAACGTGAACCCGGATGCGCTCGACGAGTGCGGGTACACGGACCCGACGGTCGAGTC  296
               |||| | |||||||  |||||||||  ||| ||||| |||||||||||||||  ||||||
Sbjct  107221  CTACGAGGTGAACCTCGATGCGCTCTTCGACTGCGGCTACACGGACCCGACGTACGAGTC  107280

Query  297     ACAGCCGATCCCAGTGACCAACGCC---TTCATCTCCACGGG--GTACGTCTTGAATGGA  351
                |||||||||||   |||||||| |    ||  |||||||||   |||| |  | | || 
Sbjct  107281  GCAGCCGATCCC---GACCAACGGCCAGATCCGCTCCACGGGCTATACG-CACG-ACGGC  107335

Query  352     CCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACAAAG  411
               ||||||||||| |||||||||||| ||||||| |||||||    ||||||||| ||  ||
Sbjct  107336  CCGTGCGAGGTTTGGCTCGACGACGTCAAGGTTATGTCGGGAGAGAACTGCCATACCGAG  107395

Query  412     TACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGG  471
               |  || || | ||  || | | ||||||||    |||||||||||||||||| |||||| 
Sbjct  107396  TTTCCGGGCAAGACGTTCAAGATCGACTACTCGACGTGCAAGGGATCGTGCACGCTGCGC  107455

Query  472     TGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTC  531
               ||||||||| | ||| | |    | | ||  | | ||  |||||||||||||||||||  
Sbjct  107456  TGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAG  107515

Query  532     TGCGTGTCGTTGCGTG  547
               || ||  || || |||
Sbjct  107516  TGTGTAGCGCTGAGTG  107531

 Score = 119 bits (131),  Expect = 2e-24
 Identities = 268/402 (67%), Gaps = 12/402 (3%)
 Strand=Plus/Plus

Query  139     CTCGAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGACTTCATGAAGCAGAAGGGG  198
               |||||| || | ||  ||||||| ||||||  ||||   | |||||||||| ||||||| 
Sbjct  108878  CTCGAGAAGAACGGTGTCAAGACCAGCGCCAGCGTCGATGGCTTCATGAAGGAGAAGGGC  108937

Query  199     TATGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGATGCG  258
               ||  | |  || |||||  |  ||||||||   ||||||||||| || ||| || | || 
Sbjct  108938  TACTCCACGCTGCGCGCACTCATGGACGACAGCAAGCTCTACAAGGTCAACTCGAACGC-  108996

Query  259     CTCGACGAGT------GCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTG  312
                 |||| | |      |||||||||| || |||||    |  || |||   |||||   |
Sbjct  108997  --CGACAACTTCCTCTGCGGGTACACAGATCCGACCAAGGGCTCGCAGGTCATCCCCAAG  109054

Query  313     ACCAACGCCTTCATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGAC  372
                 || | || |   | | || || |||  |      || ||||||||||| ||| |||||
Sbjct  109055  GACAGCACCATGCGCACGACCGGATACACCCACGTGGGTCCGTGCGAGGTCTGGATCGAC  109114

Query  373     GACCTCAAGGTCATGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATG  432
                || ||   |||||  | | |   |||||||||    ||  | ||   |||| |   | |
Sbjct  109115  AACGTCCGCGTCATCGCCGGCGACAACTGCCACGAGCAGGTCTCCAACACGACC---AAG  109171

Query  433     CTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
                | |||||||||   || ||||| |||||||   |||| ||||||||||||||  | |  
Sbjct  109172  GTGGACTACAGCAACTGTAAGGGCTCGTGCACCATGCGCTGGTACTGGCTCGGACTGCGC  109231

Query  493     CCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGC  534
                 | ||||  ||| ||  ||||||||||||||||||  ||||
Sbjct  109232  TACCTGAAAAAGAAGTGGTCGTGGCAGGTGTACAAGAACTGC  109273

 Score = 82.4 bits (90),  Expect = 1e-13
 Identities = 71/87 (82%), Gaps = 6/87 (7%)
 Strand=Plus/Plus

Query  446     CGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGT---GAACG  502
               |||||||||| |||||||| |||||  |||||||| | |||||||    |||   |||||
Sbjct  110847  CGTGCAAGGGCTCGTGCATACTGCGCCGGTACTGGATGGGCATCCGCTACGTCAAGAACG  110906

Query  503     AGACGTACTCGTGGCAGGTGTACAAGG  529
               ||   ||||||||||||||||||||||
Sbjct  110907  AG---TACTCGTGGCAGGTGTACAAGG  110930

>PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_711:1:15030:1 
REF
Length=15030

 Score = 184 bits (203),  Expect = 5e-44
 Identities = 332/480 (69%), Gaps = 23/480 (5%)
 Strand=Plus/Plus

Query  70     AAGGTGCTGTACCCCGAGCCGTTCTACCTCGTCGACGGCGATGAAGCCCAGTCGGCCCCT  129
              || |||  |||||| ||||| |||| |||  | ||||||||  | |   |||||||| | 
Sbjct  10790  AAAGTGACGTACCCGGAGCCCTTCTTCCTGCTGGACGGCGACTACG---AGTCGGCCGCG  10846

Query  130    ---GTGGCGCATCTCGAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGACTTCATG  186
                 || || |  ||||| || ||   | | |  |||||||| |||||| ||| |||| | 
Sbjct  10847  TCCGTCGCCCGCCTCGAAGACCAAAACGTGACCACGAGCGCTGACGTCGCGGGCTTCCTC  10906

Query  187    AAGCAGAAGGGGTATGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTG  246
              || |||||||| || || |  || ||||| |||||||||||| ||| ||||||| |||| 
Sbjct  10907  AAACAGAAGGGCTACGCCAGTCTGCGCGCCATGCTGGACGACGAGACGCTCTACGACGTC  10966

Query  247    AACCCGGATGCGCTCGACGAGTGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATC  306
              |||   ||  |  ||   |||||||| |||||||||||||||  |||||| ||||| |||
Sbjct  10967  AACATCGACTCAATCTTTGAGTGCGGCTACACGGACCCGACGTACGAGTCGCAGCCTATC  11026

Query  307    CCAGTGACCAACG----CCTTCATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGT  362
              ||   ||| ||||     || | | | ||| || ||| |   | | || ||||||||| |
Sbjct  11027  CC---GACAAACGGCAAGCTGCGT-TTCACAGGCTACATGAAGGACGGGCCGTGCGAGAT  11082

Query  363    GTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACAAAGTACCCCGGTAC  422
               ||| |||||||||||||| |  | ||      ||||||| | |   | | ||| || ||
Sbjct  11083  CTGGATCGACGACCTCAAGCTGCTCTCCAGTGCGAACTGCAAGAAGGACTTCCCGGGCAC  11142

Query  423    GAACTTTATGCTCGACTAC---AGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTG  479
              || |   |  |||||||||   |||   ||||||||   ||||| |||||| ||||||  
Sbjct  11143  GAGCACAAAACTCGACTACTCGAGC---TGCAAGGGCGAGTGCACGCTGCGCTGGTACGC  11199

Query  480    GCT---CGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGT  536
              |||   ||  | | || |   |  ||   ||||||||||| |||| ||||||  ||||||
Sbjct  11200  GCTGAGCGTGAGCAAGACGACGGGCGGCTCGTACTCGTGGGAGGTCTACAAGAACTGCGT  11259

 Score = 80.6 bits (88),  Expect = 4e-13
 Identities = 262/405 (65%), Gaps = 18/405 (4%)
 Strand=Plus/Plus

Query  139   CTCGAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGACTTCATGAAGCAGAAGGGG  198
             |||||| || | ||| | ||||||||||    ||||   | |||||||||| | ||||| 
Sbjct  5254  CTCGAGAAGAACGGCGTGAAGACGAGCGAGAGCGTCGACGGCTTCATGAAGGACAAGGGC  5313

Query  199   TATGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGATGCG  258
             ||    |  || |||||| |  ||||||||   ||||| |||||    ||| || | || 
Sbjct  5314  TACAGCACGCTGCGCGCGCTCATGGACGACAGCAAGCTGTACAAGACCAACTCGAACGC-  5372

Query  259   CTCGACGAGT------GCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTG  312
               |||| | |      |||| |||||||||||||     |  || |||   |||||   |
Sbjct  5373  --CGACAACTTCCTCTGCGGCTACACGGACCCGAGCAAGGGCTCGCAGGTCATCCCCAAG  5430

Query  313   ACCAACGCCTTCATCTCCACGGGGTACGT---CTTGAATGGACCGTGCGAGGTGTGGCTC  369
               || | || |   | | || || |||     | ||   || ||||||||||| ||| ||
Sbjct  5431  GACAGCACCATGCGCACGACCGGCTACACGCACGTG---GGCCCGTGCGAGGTCTGGATC  5487

Query  370   GACGACCTCAAGGTCATGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTT  429
             ||||||      |||||  | | |   ||||| |||    ||  | ||   |||| |   
Sbjct  5488  GACGACGAGCGTGTCATCGCCGGCGACAACTGTCACGAGCAGGTCTCCAACACGACC---  5544

Query  430   ATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATC  489
             | | | |||||||||   ||||||||   |||||   |||| ||||||||||||||| | 
Sbjct  5545  AAGGTGGACTACAGCAACTGCAAGGGCGAGTGCACCATGCGCTGGTACTGGCTCGGCCTG  5604

Query  490   CAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGC  534
             |    | | ||  ||| ||  ||||||||||||||||||  ||||
Sbjct  5605  CGCTACCTCAAGAAGAAGTGGTCGTGGCAGGTGTACAAGAACTGC  5649

>PYIR:scaffold_5024 pir_scaffold_5024 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_5024:1:718:1 
REF
Length=718

 Score = 158 bits (174),  Expect = 2e-36
 Identities = 284/406 (70%), Gaps = 12/406 (3%)
 Strand=Plus/Plus

Query  138  TCTCGAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGACTTCATGAAGCAGAAGGG  197
            ||||||| | ||||||  |||||| | ||| ||| ||   | || ||| |||   |||||
Sbjct  231  TCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTACATCAAGTCCAAGGG  290

Query  198  GTATGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGATG-  256
             ||   || |||||| ||| |  |||||||| |||||   ||||| ||  || |||  | 
Sbjct  291  CTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGG  350

Query  257  CGCTCGAC---GAGTGCGGGTACACGGACC-CGACGGTCGAGTCACAGCCGATCCCAGTG  312
            ||| | ||   |||||||| |||||  ||  | |||| | ||   ||||||||||||| |
Sbjct  351  CGC-CAACTTTGAGTGCGGCTACACCAACATCAACGG-CAAGCGCCAGCCGATCCCAGCG  408

Query  313  ACCAACGCCTTCATCTCCACGGGGTACG-TCTTGAATGGACCGTGCGAGGTGTGGCTCGA  371
              ||   |  ||  |||||| || |||  ||  ||  || ||||||||||| ||||| ||
Sbjct  409  GGCA---CAATCCGCTCCACAGGTTACACTCACGAC-GGTCCGTGCGAGGTCTGGCTTGA  464

Query  372  CGACCTCAAGGTCATGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTAT  431
            | ||  |||||||||||||| ||  |||||| |||   | | ||| || | || |     
Sbjct  465  CAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACCCACTC  524

Query  432  GCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCA  491
            | ||  ||||   ||||||||||| ||||||| |||||| ||||||||| | ||| | | 
Sbjct  525  GATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCG  584

Query  492  GCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTG  537
               | | ||  | | ||  |||||||||||||||||||  ||||||
Sbjct  585  CTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTG  630

>PHSO:scaffold_1
Length=13391543

 Score = 154 bits (170),  Expect = 2e-35
 Identities = 275/397 (69%), Gaps = 6/397 (2%)
 Strand=Plus/Minus

Query  143      AGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGA-CTTCATGAAGCAGAAGGGGTAT  201
                ||||||||||| | || ||||||  ||| | | | || ||  ||| || || | || || 
Sbjct  2794006  AGGAGCAGGGCGTGAATACGAGCATCGAAG-CGCAGAGCTGGATGCAGGAGCACGGCTAC  2793948

Query  202      GCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGATGCGCTC  261
                |||   || ||||| |||||||||||| ||  ||||||||| ||||    ||| ||||| 
Sbjct  2793947  GCGTCGCTGCGCGCCATGCTGGACGACGAGTCGCTCTACAAGGTGACGGAGGAGGCGCTG  2793888

Query  262      GACGAGTGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTGACCAACGCC  321
                  ||| |||||   ||||  ||| | |  |||| | ||||| |||||    | || | ||
Sbjct  2793887  TTCGACTGCGGCCTCACGAGCCCCAAGACCGAGACGCAGCCCATCCCGAGCAACAGCTCC  2793828

Query  322      TTCATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAG  381
                ||     |  |||| |||    || | || || |||||||| ||||| ||||||  ||||
Sbjct  2793827  TTTCAGACGTCGGGCTACACGCTGGACGGCCCCTGCGAGGTCTGGCTGGACGACACCAAG  2793768

Query  382      GTCATGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGC--TCGACT  439
                ||     | | |   |||||||||||  ||| |||  | |||  |   | |   ||||||
Sbjct  2793767  GTGGCTGCTGGCCGCAACTGCCACACGCAGTTCCC--GCACGGCCAGCACGAGATCGACT  2793710

Query  440      ACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGA  499
                ||||| |||||   |  ||||||| |||  |||||||||||||||||||| ||  |||  
Sbjct  2793709  ACAGCGCGTGCGGAGACTCGTGCACGCTCTGGTGGTACTGGCTCGGCATCAAGTACGTCG  2793650

Query  500      ACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGT  536
                | |   | |||||||||||||| ||||||  ||||||
Sbjct  2793649  AGGGCGCCTACTCGTGGCAGGTCTACAAGAACTGCGT  2793613

 Score = 91.5 bits (100),  Expect = 2e-16
 Identities = 90/113 (80%), Gaps = 4/113 (4%)
 Strand=Plus/Minus

Query  433      CTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
                ||||||||||||||||||||||| || ||||  ||||| ||||||||||| ||| | |  
Sbjct  2791514  CTCGACTACAGCTCGTGCAAGGGCTCCTGCACCCTGCGCTGGTACTGGCTGGGCGTGCGC  2791455

Query  493      CCCGTGAACGAGACG--TACTCGTGGCAGGTGTACAAGGTCTGCGTGTCGTTG  543
                  | | || || |||  |||||||||||||| |||||||  |||||| || ||
Sbjct  2791454  TTCCTCAA-GA-ACGAATACTCGTGGCAGGTTTACAAGGCGTGCGTGCCGCTG  2791404

 Score = 82.4 bits (90),  Expect = 1e-13
 Identities = 136/194 (70%), Gaps = 12/194 (6%)
 Strand=Plus/Plus

Query  349      GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
                || ||||||||||| ||||||||||||  || |||||||  | ||   |||||||||   
Sbjct  2790631  GGCCCGTGCGAGGTTTGGCTCGACGACACCATGGTCATGCAGTACGACAACTGCCAC---  2790687

Query  409      AAGT---ACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATG  465
                 |||    |  ||| | | |||  |   ||||||||||||||||||      |||||| |
Sbjct  2790688  GAGTCCATCAGCGGCAAGGACTACACCATCGACTACAGCTCGTGCACCTCCACGTGCACG  2790747

Query  466      CTGCGGTGGTACTGGCTCGGCAT---CCAGCCCGTGAACGAGACGTACTCGTGGCAGGTG  522
                ||    |||| |||||| ||| |   | | | |  ||||||   ||||||||||||| | 
Sbjct  2790748  CTCTACTGGTTCTGGCTGGGCGTGCGCTACCTCAAGAACGA---GTACTCGTGGCAGATC  2790804

Query  523      TACAAGGTCTGCGT  536
                |||||||  |||||
Sbjct  2790805  TACAAGGCGTGCGT  2790818

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  349      GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGT  383
                || ||||||||||| ||| ||||||||  || |||
Sbjct  2592431  GGCCCGTGCGAGGTCTGGATCGACGACACCATGGT  2592465

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  349      GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGT  383
                || ||||||||||| ||| ||||||||  || |||
Sbjct  2595281  GGCCCGTGCGAGGTCTGGATCGACGACACCATGGT  2595247

>PHRA:scaffold_56
Length=334739

 Score = 146 bits (161),  Expect = 1e-32
 Identities = 319/470 (68%), Gaps = 16/470 (3%)
 Strand=Plus/Plus

Query  73      GTGCTGTACCCCGAGCCGTTCTACCTCGTCGACGGCGATGAAGCCCAGTCGGCCC--CTG  130
               |||||| ||||   ||| |||| | |||| ||||||   ||   ||||  |||    |  
Sbjct  160964  GTGCTGCACCCGCCGCCCTTCTTCATCGTGGACGGCCTGGACTTCCAG--GGCATGGCGC  161021

Query  131     TGGCGCATCTCGAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGACTTCATGAAGC  190
               ||||  ||||  ||||||||||| | || ||||||  ||| | |  || ||  ||| |||
Sbjct  161022  TGGCCTATCTGCAGGAGCAGGGCGTGAACACGAGCATCGAGGCCCAGGGCTGGATGCAGC  161081

Query  191     AGAAGGGGTATGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACC  250
               || | || || |||   || ||| | |||||||||||| ||  ||| ||| | ||||   
Sbjct  161082  AGCACGGCTACGCGTCGCTGCGCTCCATGCTGGACGACGAGTCGCTGTACCAGGTGACGG  161141

Query  251     CGGATGCGCTCGACGAGTGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAG  310
                ||| ||  ||  ||| |||||   ||||  ||| |     ||  | ||||  |||||  
Sbjct  161142  AGGAGGCCATCTTCGACTGCGGACTCACGAGCCCCAAAACTGAAACGCAGCTCATCCC--  161199

Query  311     TGACCAACGCCTTCATC---TCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGC  367
                |||||||  ||   ||   ||  |||| |||    |  | || ||||| ||||| ||||
Sbjct  161200  -GACCAACAGCTCGTTCCAGTCGTCGGGCTACACGCTCGACGGCCCGTGTGAGGTCTGGC  161258

Query  368     TCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACT  427
               | ||||||  |||||    | ||| |   |||||||||||  ||| |||  | |||  | 
Sbjct  161259  TGGACGACACCAAGGCGGCGGCGGGCCGCAACTGCCACACCGAGTTCCC--GCACGGCCA  161316

Query  428     TTAT--GCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGG  485
                 |   | ||||||| ||| |||||   |   |||||||||| |||||||||||||||||
Sbjct  161317  GCACCAGATCGACTATAGCGCGTGCGGAGCCGCGTGCATGCTCCGGTGGTACTGGCTCGG  161376

Query  486     CATCCAGCCCGT-GAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGC  534
               |||| ||  ||| ||| | | |||||||||||||||| ||||||  ||||
Sbjct  161377  CATCAAGTACGTCGAAGGCG-CGTACTCGTGGCAGGTCTACAAGAACTGC  161425

 Score = 74.3 bits (81),  Expect = 7e-11
 Identities = 83/110 (75%), Gaps = 6/110 (5%)
 Strand=Plus/Plus

Query  434     TCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCC---  490
               |||||||||| ||||||| |||  | ||||  ||||  ||||||||| | ||| | |   
Sbjct  162911  TCGACTACAGTTCGTGCACGGGTACCTGCACACTGCACTGGTACTGGATGGGCGTGCGCT  162970

Query  491     AGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTGTCG  540
               | | |  |||||   ||||||| |||||||||||||||| ||| ||| ||
Sbjct  162971  ACCTCAAGAACG---CGTACTCCTGGCAGGTGTACAAGGCCTGTGTGCCG  163017

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 130/190 (68%), Gaps = 4/190 (2%)
 Strand=Plus/Minus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
               || ||||||||||| ||||| ||||||  || |||||||  | |    |||||||||   
Sbjct  163796  GGTCCGTGCGAGGTCTGGCTGGACGACACCATGGTCATGCAGTATGATAACTGCCACG--  163739

Query  409     AAGTACCC--CGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGC  466
               | ||   |  ||| | | ||| ||   |||||||||| || |||| |    | |||| ||
Sbjct  163738  AGGTCATCAGCGGCAAGGACTATACCATCGACTACAGTTCATGCACGTCCACCTGCACGC  163679

Query  467     TGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACA  526
               |    |||| |||| | ||| | |    | | ||| |  | ||||| |||||||||||||
Sbjct  163678  TTTACTGGTTCTGGATGGGCGTGCGCTACCTCAACAACGCCTACTCCTGGCAGGTGTACA  163619

Query  527     AGGTCTGCGT  536
               |||  |||||
Sbjct  163618  AGGCGTGCGT  163609

>PHCA:scaffold_84 PHYCAscaffold_84
Length=182275

 Score = 122 bits (134),  Expect = 1e-25
 Identities = 274/400 (69%), Gaps = 14/400 (4%)
 Strand=Plus/Minus

Query  145    GAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGA-CTTCATGAAGCAGAAGGGGTATGC  203
              ||||||||  | || || |||  ||| | ||| || ||  ||| ||||| | || ||  |
Sbjct  95624  GAGCAGGGAGTTAACACAAGCATCGAAG-CTCAGAGCTGGATGGAGCAGCACGGCTACAC  95566

Query  204    GAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGATGCGCTCGA  263
              |    | || || |||||||||||  ||  ||| ||| | ||||    ||| ||  ||  
Sbjct  95565  GTCATTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGTGACGGAGGAAGCTATCTT  95506

Query  264    CGAGTGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTGACCAACGCCTT  323
               ||||||||   ||||   || | |  |||| | ||||| |||||    | |||| | ||
Sbjct  95505  TGAGTGCGGCCTCACGAGTCCCAAGACCGAGACGCAGCCCATCCCGACCAACAACTCGTT  95446

Query  324    CATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGAC-CTCAAG-  381
              |    |  |||| |||    || | || ||||||||||| ||||| |||||| || ||| 
Sbjct  95445  CCAGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGT  95386

Query  382    GTCATGTCGGACATGAACTGCCACACAAAGTACCCC---GGTACGAACTTTATGCTCGAC  438
              ||| || ||| |   |||||||||||  | | |||    |||  | ||     | |||||
Sbjct  95385  GTC-TG-CGGGCCGCAACTGCCACACCGAATTCCCGCAGGGTCAGCACCA---GGTCGAC  95331

Query  439    TACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGT-  497
              ||||||||||||   |  || |||| | ||  ||||||||||||||||||| ||  ||| 
Sbjct  95330  TACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTC  95271

Query  498    GAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTG  537
              ||| ||  | ||||||||||| |||||||||  |||||||
Sbjct  95270  GAAGGAATC-TACTCGTGGCAAGTGTACAAGAACTGCGTG  95232

 Score = 113 bits (124),  Expect = 8e-23
 Identities = 145/195 (74%), Gaps = 14/195 (7%)
 Strand=Plus/Minus

Query  347    ATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAG-GTCAT---GTCGGACATGAACTGC  402
              |||| ||||||||||| |||||||||  || |  | ||| |   ||||||||   |||||
Sbjct  93942  ATGGTCCGTGCGAGGTTTGGCTCGACT-CCACGCGCGTCCTCCAGTCGGACA---ACTGC  93887

Query  403    CACACAAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGC  462
              |||   | || ||| || | ||  |  |  || |||||||||||||||||||| ||||||
Sbjct  93886  CACGAGACGTTCCCGGGCAAGACGTACAACCTGGACTACAGCTCGTGCAAGGGCTCGTGC  93827

Query  463    ATGCTGCGGTGGTACTGGCTCGGCA---TCCAGCCCGTGAACGAGACGTACTCGTGGCAG  519
              |||||||| ||||||||| | || |    |   | |  ||||||   | |||||||||||
Sbjct  93826  ATGCTGCGTTGGTACTGGTTGGGAACGCGCTTCCTCAAGAACGA---GCACTCGTGGCAG  93770

Query  520    GTGTACAAGGTCTGC  534
              |||||||||| ||||
Sbjct  93769  GTGTACAAGGCCTGC  93755

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 132/196 (67%), Gaps = 8/196 (4%)
 Strand=Plus/Plus

Query  349    GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
              || |||||||| |||||||| |||||    | |||||||  | ||   ||||| |||  |
Sbjct  93026  GGTCCGTGCGAAGTGTGGCTGGACGATACGATGGTCATGCAGTACGACAACTGTCACG-A  93084

Query  409    AAGTACCC-CGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCT  467
                 || |  ||| | | |||  |   | |||||||| || |||| |    | |||| | |
Sbjct  93085  GGCTATCAGCGGCAAGGACTACACCATAGACTACAGTTCTTGCACGTCCACCTGCACGTT  93144

Query  468    GCGGTGGTACTGGCTCGGCATCCAGCCCGT---GAACGAGACGTACTCGTGGCAGGTGTA  524
                  |||| |||||||||  ||| |  | |   |||||||   |||||||||||| | ||
Sbjct  93145  ATACTGGTTCTGGCTCGGTGTCCGGTACCTCAAGAACGAG---TACTCGTGGCAGATCTA  93201

Query  525    CAAGGTCTGCGTGTCG  540
              ||||| ||| ||| ||
Sbjct  93202  CAAGGCCTGTGTGCCG  93217

>PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 
genomic scaffold, whole genome shotgun sequence
Length=2113949

 Score = 120 bits (132),  Expect = 5e-25
 Identities = 138/186 (74%), Gaps = 0/186 (0%)
 Strand=Plus/Plus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
               |||||||||||||||||||||||||||   | |||  ||   | |   ||||| |||   
Sbjct  673498  GGACCGTGCGAGGTGTGGCTCGACGACAAGATGGTGCTGGATGGCGACAACTGTCACGAG  673557

Query  409     AAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTG  468
               |||| ||| || | | |||  |   | ||||||   || ||||||||  |||||| ||||
Sbjct  673558  AAGTTCCCAGGCAAGGACTACACTGTGGACTACTCGTCATGCAAGGGCACGTGCACGCTG  673617

Query  469     CGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAG  528
               || ||||||||||| |||||||    | ||||  | | |||||||||||||||||| |||
Sbjct  673618  CGCTGGTACTGGCTGGGCATCCGCTTCCTGAAGAACAAGTACTCGTGGCAGGTGTATAAG  673677

Query  529     GTCTGC  534
               | ||||
Sbjct  673678  GCCTGC  673683

 Score = 106 bits (117),  Expect = 1e-20
 Identities = 135/186 (73%), Gaps = 0/186 (0%)
 Strand=Plus/Plus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
               ||||||||||| |||||||| ||||||   | |||  ||   | |   ||||| |||   
Sbjct  697205  GGACCGTGCGAAGTGTGGCTTGACGACAAGATGGTGCTGGATGGCGACAACTGTCACGAG  697264

Query  409     AAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTG  468
               |||| ||| || | | |||  |   | ||||||   || ||||||||  |||||| ||||
Sbjct  697265  AAGTTCCCAGGCAAGGACTACACTGTGGACTACTCGTCATGCAAGGGCACGTGCACGCTG  697324

Query  469     CGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAG  528
               || ||||||||||| ||| | |    | ||||  |  |||||||||||||||||||||||
Sbjct  697325  CGCTGGTACTGGCTGGGCGTGCGCTTCTTGAAGAACTCGTACTCGTGGCAGGTGTACAAG  697384

Query  529     GTCTGC  534
               | ||||
Sbjct  697385  GCCTGC  697390

>PHIF:NW_003303626.1 Phytophthora infestans T30-4 supercont1.133 
genomic scaffold, whole genome shotgun sequence
Length=313873

 Score = 120 bits (132),  Expect = 5e-25
 Identities = 138/186 (74%), Gaps = 0/186 (0%)
 Strand=Plus/Plus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
               |||||||||||||||||||||||||||   | |||  ||   | |   ||||| |||   
Sbjct  267349  GGACCGTGCGAGGTGTGGCTCGACGACAAGATGGTGCTGGATGGCGACAACTGTCACGAG  267408

Query  409     AAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTG  468
               |||| ||| || | | |||  |   | ||||||   || ||||||||  |||||| ||||
Sbjct  267409  AAGTTCCCAGGCAAGGACTACACTGTGGACTACTCGTCATGCAAGGGCACGTGCACGCTG  267468

Query  469     CGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAG  528
               || ||||||||||| |||||||    | ||||  | | |||||||||||||||||| |||
Sbjct  267469  CGCTGGTACTGGCTGGGCATCCGCTTCCTGAAGAACAAGTACTCGTGGCAGGTGTATAAG  267528

Query  529     GTCTGC  534
               | ||||
Sbjct  267529  GCCTGC  267534

>PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.63, whole genome shotgun 
sequence
Length=342508

 Score = 117 bits (129),  Expect = 6e-24
 Identities = 271/401 (68%), Gaps = 12/401 (3%)
 Strand=Plus/Minus

Query  143     AGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGA-CTTCATGAAGCAGAAGGGGTAT  201
               ||||||||||| |||| ||||||  ||| | | | || ||  ||| ||||| | || || 
Sbjct  245106  AGGAGCAGGGCGTCAACACGAGCATCGAAG-CGCAGAGCTGGATGCAGCAGCACGGATAC  245048

Query  202     GCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGATGCGCTC  261
                |    || || || |||||||||||| ||   || ||||| ||||    ||| ||  ||
Sbjct  245047  ACTTCGCTGCGTGCCATGCTGGACGACGAGTCCCTGTACAAGGTGACGGAGGAGGCCATC  244988

Query  262     GACGAGTGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTGACCAACGCC  321
                 |||||||||   |||    || | |   ||| | ||||| |||||    | |||| | 
Sbjct  244987  TTCGAGTGCGGACTCACAAGTCCCAGGACTGAGACGCAGCCTATCCCGACAAACAACTCG  244928

Query  322     TTCATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAG  381
               |||    |  |||| ||     || |||| ||||||||||| ||||| ||||||   |||
Sbjct  244927  TTCCAGACGTCGGGATATACGCTGGATGGCCCGTGCGAGGTCTGGCTGGACGACACGAAG  244868

Query  382     GTCATGTCGGACATGAACTGCCACACAAAGTACCC---CGGTACGAACTTTATGCTCGAC  438
               ||    |||| |   |||||||||||  | | |||   |||  | | | | | | |||||
Sbjct  244867  GTGTCCTCGGGCCGCAACTGCCACACCGAATTCCCTCACGG--CCAGCATGAGG-TCGAC  244811

Query  439     TACAGCTCGTGCAAGGGAT--CGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCG  496
               |||||||| |||  ||||   ||||||  ||   |||||| |||||||||||  ||  | 
Sbjct  244810  TACAGCTCATGC--GGGAAGGCGTGCACACTCTCGTGGTATTGGCTCGGCATTAAGTACA  244753

Query  497     TGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTG  537
               |  | |  |  |||||||||||||| ||||||  |||||||
Sbjct  244752  TTGAGGGAATCTACTCGTGGCAGGTCTACAAGAACTGCGTG  244712

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 138/206 (67%), Gaps = 6/206 (3%)
 Strand=Plus/Minus

Query  327     CTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGAC---CTCAAGGT  383
               ||||||||| |||  |    |||| ||||| ||||| |||||||||  |   | |  | |
Sbjct  243241  CTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCT  243182

Query  384     CATGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGCTCGACTACAG  443
               |  ||||||||   ||||||||   |    |   || | ||  |  |  || ||||||||
Sbjct  243181  CCAGTCGGACA---ACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAG  243125

Query  444     CTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGA  503
               ||||||||  ||  | ||||  || || ||||||||||| ||| | |    | | ||  |
Sbjct  243124  CTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAA  243065

Query  504     GACGTACTCGTGGCAGGTGTACAAGG  529
                 | |||||||||||| | |||||||
Sbjct  243064  TGCCTACTCGTGGCAGATCTACAAGG  243039

 Score = 59.0 bits (64),  Expect = 1e-06
 Identities = 129/190 (68%), Gaps = 4/190 (2%)
 Strand=Plus/Plus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
               || ||||| ||||||||||| ||||||  || |||||||  | ||   ||||||||   |
Sbjct  242275  GGCCCGTGTGAGGTGTGGCTGGACGACACCATGGTCATGCAGTACGACAACTGCCATGAA  242334

Query  409     AAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTG  468
                    |   || |   |||  | | ||||||| |||||||||| |    | ||||  || 
Sbjct  242335  GCCATCAGTGGCAAATACTACACGATCGACTATAGCTCGTGCACGTCCACCTGCACACTC  242394

Query  469     CGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACG--TACTCGTGGCAGGTGTACA  526
                  |||| |||||| ||  |||    | |||| || |||  |||||||||||| | ||||
Sbjct  242395  TATTGGTTCTGGCTGGGTGTCCGCTACCTGAA-GA-ACGAATACTCGTGGCAGATTTACA  242452

Query  527     AGGTCTGCGT  536
               ||| ||| ||
Sbjct  242453  AGGCCTGTGT  242462

>PYIR:scaffold_2249 pir_scaffold_2249 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_2249:1:3349:1 
REF
Length=3349

 Score = 113 bits (125),  Expect = 8e-23
 Identities = 274/403 (68%), Gaps = 14/403 (3%)
 Strand=Plus/Minus

Query  142   GAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGACTTCATGAAGCAGAAGGGGTAT  201
             ||| | |||||| ||||||| |  || ||| ||   | || |   |||   ||||| || 
Sbjct  1835  GAGAACCAGGGCTTCAAGACCACGGCGGACTTCGACGCCTACTACAAGGCCAAGGGCTAC  1776

Query  202   GCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTC-TACAACGTGAACCCGGATGCGCT  260
               || ||| || ||| |  |||||||| ||| || | ||||| ||   | | |||| || 
Sbjct  1775  AAGACCCTCCGTGCGTTCATGGACGACAAGA-GCGCGTACAAGGT---CGCCGATG-GCG  1721

Query  261   CG-AC---GAGTGCGGGTACACGGACC-CGACGGTCGAGTCACAGCCGATCCCAGTGA-C  314
             || ||   || ||||| |  ||  | | || ||| |  | | ||||||||||| || | |
Sbjct  1720  CGGACTTTGAATGCGGCTGGACCAAGCTCGCCGG-CACGCCGCAGCCGATCCC-GTCAGC  1663

Query  315   CAACGCCTTCATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGA  374
             || | |  |   |||||| || |||  |    | || ||||||||||| ||||||||| |
Sbjct  1662  CAGCACGGTGCGCTCCACAGGCTACACCCACGACGGTCCGTGCGAGGTCTGGCTCGACAA  1603

Query  375   CCTCAAGGTCATGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGCT  434
                |   ||  |   || ||  ||||||||| |  ||| ||| || |||| ||| | | |
Sbjct  1602  GACCCGTGTGCTCAAGGGCACCAACTGCCACTCGGAGTTCCCGGGCACGACCTTCAAGAT  1543

Query  435   CGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCC  494
             ||||||    || |||||||| |||||| ||||||| ||||||||| | |||||||    
Sbjct  1542  CGACTATTCGTCTTGCAAGGGTTCGTGCGTGCTGCGCTGGTACTGGATGGGCATCCGCTT  1483

Query  495   CGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTG  537
             | | || |    |||||| |||||||||||||||  |||||||
Sbjct  1482  CCTTAAGGGCCAGTACTCATGGCAGGTGTACAAGAACTGCGTG  1440

>PHRA:scaffold_106
Length=147471

 Score = 110 bits (121),  Expect = 9e-22
 Identities = 135/182 (74%), Gaps = 2/182 (1%)
 Strand=Plus/Minus

Query  349    GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCAT-GTCGGACATGAACTGCCACAC  407
              || ||||||||||||||||||||||||   | |||  | | |||  | ||||||||||  
Sbjct  13125  GGTCCGTGCGAGGTGTGGCTCGACGACACGATGGTGCTCGACGGCGA-GAACTGCCACGA  13067

Query  408    AAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCT  467
               |||| ||| || | | |||  |   ||||||||   || ||||||||  |||||| |||
Sbjct  13066  GAAGTTCCCTGGCAAGGACTACACCGTCGACTACTCGTCCTGCAAGGGCACGTGCACGCT  13007

Query  468    GCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAA  527
               || ||||||||| | ||  |||    | |||| || || ||||||||||| ||||||||
Sbjct  13006  TCGTTGGTACTGGATGGGTGTCCGATTCCTGAAGGAAACCTACTCGTGGCAAGTGTACAA  12947

Query  528    GG  529
              ||
Sbjct  12946  GG  12945

>PHSO:scaffold_35
Length=32414

 Score = 108 bits (119),  Expect = 3e-21
 Identities = 156/216 (72%), Gaps = 7/216 (3%)
 Strand=Plus/Minus

Query  349    GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
              || ||||||||||||||||||||||||   | |||  ||   | |   |||||||||   
Sbjct  18327  GGCCCGTGCGAGGTGTGGCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAG  18268

Query  409    AAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTG  468
              |||| ||| || | | |||  | | | ||||||   |||||||||||  |||||| ||| 
Sbjct  18267  AAGTTCCCGGGCAAGGACTACACGGTGGACTACTCATCGTGCAAGGGCACGTGCACGCTT  18208

Query  469    CGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGA-GACGTACTCGTGGCAGGTGTACAA  527
              || ||||||||||| ||  | |    | ||||  | ||| ||||||||||||||||||||
Sbjct  18207  CGCTGGTACTGGCTGGGAGTGCGTTTCTTGAAGAATGAC-TACTCGTGGCAGGTGTACAA  18149

Query  528    GGTCTGCGTGTCGTTG-CGTGGG----AATGGCGTC  558
              ||  ||| |  || || ||| ||    |||||||||
Sbjct  18148  GGCTTGCATCCCGCTGACGTCGGGATCAATGGCGTC  18113

>PHSO:scaffold_14
Length=1806347

 Score = 108 bits (119),  Expect = 3e-21
 Identities = 156/216 (72%), Gaps = 7/216 (3%)
 Strand=Plus/Minus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
               || ||||||||||||||||||||||||   | |||  ||   | |   |||||||||   
Sbjct  819011  GGCCCGTGCGAGGTGTGGCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAG  818952

Query  409     AAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTG  468
               |||| ||| || | | |||  | | | ||||||   |||||||||||  |||||| ||| 
Sbjct  818951  AAGTTCCCGGGCAAGGACTACACGGTGGACTACTCATCGTGCAAGGGCACGTGCACGCTT  818892

Query  469     CGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGA-GACGTACTCGTGGCAGGTGTACAA  527
               || ||||||||||| ||  | |    | ||||  | ||| ||||||||||||||||||||
Sbjct  818891  CGCTGGTACTGGCTGGGAGTGCGTTTCTTGAAGAATGAC-TACTCGTGGCAGGTGTACAA  818833

Query  528     GGTCTGCGTGTCGTTG-CGTGGG----AATGGCGTC  558
               ||  ||| |  || || ||| ||    |||||||||
Sbjct  818832  GGCTTGCATCCCGCTGACGTCGGGATCAATGGCGTC  818797

 Score = 86.9 bits (95),  Expect = 1e-14
 Identities = 123/175 (70%), Gaps = 10/175 (6%)
 Strand=Plus/Minus

Query  360     GGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACAAAGTACCCCGG  419
               ||||||||||||||||   | |||  ||   | |   |||||||||   |||| ||| ||
Sbjct  815530  GGTGTGGCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAGAAGTTCCCGGG  815471

Query  420     TACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTG  479
                | | |||  | | ||||||||   ||||| ||||| ||||||| ||| || ||||||||
Sbjct  815470  CAAGGACTACACGGTCGACTACTCGTCGTGTAAGGGCTCGTGCACGCTTCGCTGGTACTG  815411

Query  480     GCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGC  534
               | | ||           ||||  |  ||||||||||| |||||||||||| ||||
Sbjct  815410  GATGGGA----------TGAAGAACTCGTACTCGTGGAAGGTGTACAAGGCCTGC  815366

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 59/79 (75%), Gaps = 0/79 (0%)
 Strand=Plus/Plus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
               || ||||||||||||||||||||||||   |||||  ||  || |   |||||||||   
Sbjct  814243  GGCCCGTGCGAGGTGTGGCTCGACGACACGAAGGTGCTGGAGGGCGACAACTGCCACGAG  814302

Query  409     AAGTACCCCGGTACGAACT  427
               |||| ||| || | | |||
Sbjct  814303  AAGTTCCCGGGCAAGGACT  814321

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 23/23 (100%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  507     GTACTCGTGGCAGGTGTACAAGG  529
               |||||||||||||||||||||||
Sbjct  814327  GTACTCGTGGCAGGTGTACAAGG  814349

>PHSO:scaffold_5
Length=6830280

 Score = 108 bits (119),  Expect = 3e-21
 Identities = 156/216 (72%), Gaps = 7/216 (3%)
 Strand=Plus/Minus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
               || ||||||||||||||||||||||||   | |||  ||   | |   |||||||||   
Sbjct  682180  GGCCCGTGCGAGGTGTGGCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAG  682121

Query  409     AAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTG  468
               |||| ||| || | | |||  | | | ||||||   |||||||||||  |||||| ||| 
Sbjct  682120  AAGTTCCCGGGCAAGGACTACACGGTGGACTACTCATCGTGCAAGGGCACGTGCACGCTT  682061

Query  469     CGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGA-GACGTACTCGTGGCAGGTGTACAA  527
               || ||||||||||| ||  | |    | ||||  | ||| ||||||||||||||||||||
Sbjct  682060  CGCTGGTACTGGCTGGGAGTGCGTTTCTTGAAGAATGAC-TACTCGTGGCAGGTGTACAA  682002

Query  528     GGTCTGCGTGTCGTTG-CGTGGG----AATGGCGTC  558
               ||  ||| |  || || ||| ||    |||||||||
Sbjct  682001  GGCTTGCATCCCGCTGACGTCGGGATCAATGGCGTC  681966

>PHCA:scaffold_7 PHYCAscaffold_7
Length=1368812

 Score = 102 bits (112),  Expect = 1e-19
 Identities = 136/185 (74%), Gaps = 7/185 (4%)
 Strand=Plus/Plus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATG--TCG-GACATGAACTGCCAC  405
               || ||||| || |||||||| ||||||   | |||  ||  | | ||||   ||||||||
Sbjct  904604  GGTCCGTGTGAAGTGTGGCTTGACGACACGATGGTGCTGGATGGTGACA---ACTGCCAC  904660

Query  406     -ACAAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCAT  464
                | ||| | ||||||||   |||  | | | ||||||   || ||||||||  |||||| 
Sbjct  904661  GAGAAATTTCCCCGGTAAAGACTACACGGTGGACTACTCGTCTTGCAAGGGCACGTGCAC  904720

Query  465     GCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTA  524
               ||| || ||||||||||| |||||||    | ||||  |   ||||||||||||||||||
Sbjct  904721  GCTTCGCTGGTACTGGCTGGGCATCCGTTTCTTGAAGAATCAGTACTCGTGGCAGGTGTA  904780

Query  525     CAAGG  529
               |||||
Sbjct  904781  CAAGG  904785

 Score = 101 bits (111),  Expect = 5e-19
 Identities = 183/265 (69%), Gaps = 6/265 (2%)
 Strand=Plus/Minus

Query  268     TGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTGACCAACGCCTTCATC  327
               || ||||  || ||||||| ||    | | ||||| || || | |  ||||||| |   |
Sbjct  905743  TGTGGGTTTACCGACCCGAAGGGTACGCCGCAGCCCATTCCGGCGGGCAACGCCATGCGC  905684

Query  328     TCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATG  387
               |||||||| |||       |||| ||||| || |||||||| ||||||   | |||  ||
Sbjct  905683  TCCACGGGTTACACGCACGATGGTCCGTGTGAAGTGTGGCTTGACGACACGATGGTGCTG  905624

Query  388     --TCG-GACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGCTCGACTACAGC  444
                 | | ||||   ||||||||   || |  ||||| | | |||  | | | ||||||   
Sbjct  905623  GATGGTGACA---ACTGCCACGAGAAATTTCCCGGCAAGGACTACACGGTGGACTACTCG  905567

Query  445     TCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAG  504
               || ||||||||  |||||| ||| || ||||||||||| ||  | |    | ||||  | 
Sbjct  905566  TCTTGCAAGGGCACGTGCACGCTTCGTTGGTACTGGCTGGGTGTTCGCTTCTTGAAGAAC  905507

Query  505     ACGTACTCGTGGCAGGTGTACAAGG  529
                ||||||||||||||||||||||||
Sbjct  905506  GCGTACTCGTGGCAGGTGTACAAGG  905482

 Score = 86.0 bits (94),  Expect = 1e-14
 Identities = 186/268 (69%), Gaps = 8/268 (3%)
 Strand=Plus/Plus

Query  266     AGTGCGGGTACACGGACCCGA-CGGTCGAGTCACAGCCGATCCCAGTGACCAACGCCTTC  324
               ||||||| |  || ||||| | ||||   | | ||||| || || | |   |||||| | 
Sbjct  908950  AGTGCGGCTTTACCGACCCCAACGGTAC-GCCGCAGCCCATTCCGGCGGGTAACGCCATG  909008

Query  325     ATCTCCACGGGGTACGT-CTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGT  383
                  |||||||| |||   | ||| ||| ||||| ||||||||||| |||||    | |||
Sbjct  909009  CGTTCCACGGGTTACACGCATGA-TGGTCCGTGTGAGGTGTGGCTTGACGATACGATGGT  909067

Query  384     CATGT-CGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGCTCGACTACA  442
                 ||  |||| | |||||| |||   |||| ||| |||| |  ||  |   |||||||| 
Sbjct  909068  GCTGGACGGAGA-GAACTGTCACGAGAAGTTCCCTGGTAAGGGCTACACCATCGACTACT  909126

Query  443     GCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACG  502
                 || ||||||||  | |||| ||||   |||| |||||| ||  | |    | ||||  
Sbjct  909127  CGTCTTGCAAGGGCACCTGCACGCTGTACTGGTTCTGGCTTGGTGTTCGCTTCCTGAAGA  909186

Query  503     A-GACGTACTCGTGGCAGGTGTACAAGG  529
               | ||| ||||||||||||||||||||||
Sbjct  909187  ACGAC-TACTCGTGGCAGGTGTACAAGG  909213

 Score = 84.2 bits (92),  Expect = 4e-14
 Identities = 179/265 (68%), Gaps = 2/265 (1%)
 Strand=Plus/Plus

Query  266     AGTGCGGGTACACGGACCCGA-CGGTCGAGTCACAGCCGATCCCAGTGACCAACGCCTTC  324
               ||||||| || || ||||| | ||||   | | ||||| || || |    ||||||| | 
Sbjct  901628  AGTGCGGCTATACCGACCCCAACGGTAC-GCCGCAGCCCATTCCTGCAGGCAACGCCATG  901686

Query  325     ATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTC  384
                 ||||||||| |||       | || ||||| || |||||| | || |||   | ||| 
Sbjct  901687  CGCTCCACGGGTTACACGCACGACGGTCCGTGTGAAGTGTGGATTGATGACACGATGGTG  901746

Query  385     ATGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGCTCGACTACAGC  444
               |||   | |   |||||||||   |||| ||| |||| |  ||  |   ||||||||   
Sbjct  901747  ATGGAAGGCGATAACTGCCACGAGAAGTTCCCTGGTAAGGGCTACACCATCGACTACTCG  901806

Query  445     TCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAG  504
                | ||||||||   ||||| ||||   ||||||||||| ||  | |    | ||||  | 
Sbjct  901807  CCCTGCAAGGGCAAGTGCACGCTGTACTGGTACTGGCTGGGTGTTCGCTTCCTGAAAAAC  901866

Query  505     ACGTACTCGTGGCAGGTGTACAAGG  529
                ||||||||||||||||||||||||
Sbjct  901867  TCGTACTCGTGGCAGGTGTACAAGG  901891

 Score = 73.4 bits (80),  Expect = 7e-11
 Identities = 127/183 (69%), Gaps = 4/183 (2%)
 Strand=Plus/Minus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGA--ACTGCCACA  406
               || ||||| ||||||||| | || |||   | ||| |||  | |  |||  |||||||| 
Sbjct  876420  GGTCCGTGTGAGGTGTGGATTGATGACACGATGGTGATG--GAAGGTGACAACTGCCACG  876363

Query  407     CAAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGC  466
                 |||| ||| |||| | |||  |   ||||||||    | ||||||||   ||||| ||
Sbjct  876362  AGAAGTTCCCTGGTAAGGACTACACCATCGACTACTCGCCCTGCAAGGGCAAGTGCACGC  876303

Query  467     TGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACA  526
               ||   ||||||||||| ||  | |    | | ||  | |  |||||||||||||||||||
Sbjct  876302  TGTACTGGTACTGGCTGGGTGTGCGTTTCCTCAAAAACAGATACTCGTGGCAGGTGTACA  876243

Query  527     AGG  529
               |||
Sbjct  876242  AGG  876240

>PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.22, whole genome shotgun 
sequence
Length=998868

 Score = 98.7 bits (108),  Expect = 2e-18
 Identities = 181/263 (69%), Gaps = 2/263 (1%)
 Strand=Plus/Plus

Query  268     TGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTGACCAACGCCTTCATC  327
               ||||| |  |||||||| | || |    | ||||| || || | |  ||||||| |    
Sbjct  685576  TGCGGTTTTACGGACCCCAAGGGCACCCCGCAGCCCATTCCGGCGGGCAACGCCATGCGT  685635

Query  328     TCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGT-CAT  386
               ||||| || |||       |||| ||||| || ||||||||||||||    | ||| | |
Sbjct  685636  TCCACCGGATACACGCACGATGGCCCGTGTGAAGTGTGGCTCGACGATACTATGGTGCTT  685695

Query  387     GTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTC  446
               | |||  |  ||||| |||   |||| ||| || | | |||  |   | ||||||   ||
Sbjct  685696  GACGGCGAC-AACTGTCACGAGAAGTTCCCTGGCAAGGACTACACTGTGGACTACTCGTC  685754

Query  447     GTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGAC  506
               ||||||||| ||||| | ||| || ||||||||||| ||  | |    | ||||  |  |
Sbjct  685755  GTGCAAGGGCTCGTGTACGCTTCGCTGGTACTGGCTGGGTGTGCGTTTCTTGAAGAACTC  685814

Query  507     GTACTCGTGGCAGGTGTACAAGG  529
               |||||||||||||||||||||||
Sbjct  685815  GTACTCGTGGCAGGTGTACAAGG  685837

 Score = 86.0 bits (94),  Expect = 1e-14
 Identities = 132/186 (71%), Gaps = 2/186 (1%)
 Strand=Plus/Minus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGT-CATGTCGGACATGAACTGCCACAC  407
               || ||||| || ||||||||||||||    | ||| | ||  ||  |  ||||| |||  
Sbjct  686833  GGCCCGTGTGAAGTGTGGCTCGACGATACTATGGTGCTTGATGGTGAA-AACTGTCACGA  686775

Query  408     AAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCT  467
                |||| ||| || | | |||  |   | ||||||   |||||||||||  |||||| |||
Sbjct  686774  GAAGTTCCCTGGCAAGGACTACACTGTGGACTACTCGTCGTGCAAGGGCACGTGCACGCT  686715

Query  468     GCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAA  527
                || ||||||||||| || || |    | | ||  |   |||||||||||||||||||||
Sbjct  686714  CCGTTGGTACTGGCTGGGTATTCGCTTCCTCAAGAACCAGTACTCGTGGCAGGTGTACAA  686655

Query  528     GGTCTG  533
               || |||
Sbjct  686654  GGCCTG  686649

 Score = 82.4 bits (90),  Expect = 1e-13
 Identities = 89/117 (76%), Gaps = 1/117 (1%)
 Strand=Plus/Plus

Query  434     TCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGC  493
               ||||||||   |||||||| ||| | ||||  || || ||||||||| | |||||||   
Sbjct  714551  TCGACTACTCATCGTGCAAAGGAACATGCACACTTCGATGGTACTGGTTGGGCATCCGCT  714610

Query  494     CCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTGTCGTTGCGTGGGA  550
                | ||||  |  ||||||| ||||||||||||||||  ||| |  ||||| ||||||
Sbjct  714611  TCCTGAAGAATGCGTACTCATGGCAGGTGTACAAGGAATGCATTCCGTTG-GTGGGA  714666

 Score = 79.7 bits (87),  Expect = 2e-12
 Identities = 182/269 (68%), Gaps = 4/269 (1%)
 Strand=Plus/Minus

Query  268     TGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTGACCAACGCCTTCATC  327
               ||||| |  |||||||| | || |    | ||||| || || | |  ||||||| |    
Sbjct  682675  TGCGGTTTTACGGACCCCAAGGGCACCCCGCAGCCCATTCCGGCGGGCAACGCCATGCGT  682616

Query  328     TCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGT-CAT  386
               ||||| || |||       |||| ||||| || ||||||||||||||    | ||| | |
Sbjct  682615  TCCACCGGATACACGCACGATGGCCCGTGTGAAGTGTGGCTCGACGATACTATGGTGCTT  682556

Query  387     GTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTC  446
               | |||  |  ||||| |||   |||| ||| || | | |||  |   | ||||||   ||
Sbjct  682555  GACGGCGAC-AACTGTCACGAGAAGTTCCCTGGCAAGGACTACACTGTGGACTACTCGTC  682497

Query  447     GTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGA-GA  505
               |||||||||  |||||| |||    ||||||||||| ||  | |    | ||||  | ||
Sbjct  682496  GTGCAAGGGCACGTGCACGCTTTACTGGTACTGGCTAGGTGTGCGTTTCCTGAAGAACGA  682437

Query  506     CGTACTCGTGGCAGGTGTACAAGGTCTGC  534
               | ||||||||||| || ||||||| ||||
Sbjct  682436  C-TACTCGTGGCAAGTATACAAGGCCTGC  682409

>PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_98.1_contig_1:1:103693:1 
REF
Length=103693

 Score = 96.9 bits (106),  Expect = 6e-18
 Identities = 229/339 (68%), Gaps = 18/339 (5%)
 Strand=Plus/Minus

Query  207    CCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGATGCGCTCGACGA  266
              ||| ||||| |||||||||||| ||   |||||||| || |    ||| || |||   ||
Sbjct  60766  CCTACGCGCCATGCTGGACGACGAGGCACTCTACAAGGTAACGGAGGAGGCTCTCTTTGA  60707

Query  267    GTGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTGACCAACG---CCTT  323
               |||||   ||||  ||| | |  |||| | ||||  |||||   |||||||    ||||
Sbjct  60706  CTGCGGTCTCACGAGCCCAAAGACCGAGACGCAGCTCATCCC---GACCAACAGCACCTT  60650

Query  324    CATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGT  383
              |    |  | || |||    || | |||||||| ||||| ||||| ||||||   || ||
Sbjct  60649  CCAGACTTCAGGTTACACAATGGACGGACCGTGTGAGGTCTGGCTAGACGACAAGAAAGT  60590

Query  384    CATGTC-GGACATGAACTGCCACACAAAGTACCCC---GGTACGAACTTTATGCTCGACT  439
                 | | ||||   || ||||||||  | | |||    || | | |||  ||   |||||
Sbjct  60589  GGCGGCTGGACGC-AATTGCCACACGGAATTCCCTCATGGGATGCACTCGAT---CGACT  60534

Query  440    ACAGCTCGTGCAAGGGA--TCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGT  497
              ||||||| ||   || |  ||||||| | || ||||||| ||||||||  || ||     
Sbjct  60533  ACAGCTCCTGT--GGAAACTCGTGCACGTTGTGGTGGTATTGGCTCGGTGTCAAGTATAC  60476

Query  498    GAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGT  536
              | |||||   |||||||||||||| ||||||  ||||||
Sbjct  60475  GGACGAGGGATACTCGTGGCAGGTTTACAAGAACTGCGT  60437

 Score = 72.5 bits (79),  Expect = 2e-10
 Identities = 79/104 (76%), Gaps = 6/104 (6%)
 Strand=Plus/Minus

Query  436    GACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG---  492
              ||||| || ||||||| |||  | ||||  ||||| ||||||||| | ||| |||     
Sbjct  58811  GACTATAGTTCGTGCACGGGCACATGCACCCTGCGCTGGTACTGGTTGGGCGTCCGTTTT  58752

Query  493    CCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGT  536
              | |  |||||||   ||||||||||||||||||||||  |||||
Sbjct  58751  CTCAAGAACGAG---TACTCGTGGCAGGTGTACAAGGCGTGCGT  58711

 Score = 65.3 bits (71),  Expect = 3e-08
 Identities = 167/248 (67%), Gaps = 10/248 (4%)
 Strand=Plus/Plus

Query  298    CAGCCGATCCCAGTGACCAACGCCTTCATCTCCACGGGGTACGT-CTTGAATGGACCGTG  356
              ||||| |||||||    ||| ||| |    || ||||| |||   | |||  || || ||
Sbjct  57730  CAGCCCATCCCAGACGACAATGCCATGCGTTCGACGGGTTACACGCATGAC-GGTCCCTG  57788

Query  357    CGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCAC-ACAAAGTACC  415
              |||||||||||| |||||    | |||||||  | |||  || |||||| ||    | | 
Sbjct  57789  CGAGGTGTGGCTGGACGATACGATGGTCATGCAGTACAACAATTGCCACGACTCCAT-CA  57847

Query  416    CCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGT  475
                || | | |||  |   | |||||||||||||| | |    | || | |||    ||||
Sbjct  57848  GTGGCAAGGACTACACTATTGACTACAGCTCGTGTACGTCTACTTGTACGCTCTACTGGT  57907

Query  476    ACTGGCTCGGCATCC---AGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCT  532
               |||| | ||| |||   | | |  |||||||   ||||||||||||||||||||||  |
Sbjct  57908  TCTGGATGGGCGTCCGCTATCTCAAGAACGAG---TACTCGTGGCAGGTGTACAAGGCGT  57964

Query  533    GCGTGTCG  540
              ||||| ||
Sbjct  57965  GCGTGCCG  57972

>PHRA:scaffold_267
Length=29552

 Score = 96.0 bits (105),  Expect = 2e-17
 Identities = 134/183 (73%), Gaps = 4/183 (2%)
 Strand=Plus/Plus

Query  349   GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCAT-GTCGGACATGAACTGCCACAC  407
             || ||||||||||||||||| ||||||   | |||  | | |||  |  ||||| |||  
Sbjct  9627  GGTCCGTGCGAGGTGTGGCTTGACGACACGATGGTGCTCGACGGCGAC-AACTGTCACGA  9685

Query  408   AAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCT  467
              |||| ||| || | | |||  |   ||||||||   || ||||||||  |||||| |||
Sbjct  9686  GAAGTTCCCTGGCAAGGACTACACCGTCGACTACTCGTCCTGCAAGGGCACGTGCACGCT  9745

Query  468   GCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGA-GACGTACTCGTGGCAGGTGTACA  526
              || ||||||||||| |||||||    | | ||  | ||| ||||||||||| |||||||
Sbjct  9746  TCGTTGGTACTGGCTGGGCATCCGTTTCCTCAAGAACGAC-TACTCGTGGCAAGTGTACA  9804

Query  527   AGG  529
             |||
Sbjct  9805  AGG  9807

>PYVX:scaffold_275 pve_scaffold_275 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_275:1:32274:1 
REF
Length=32274

 Score = 89.7 bits (98),  Expect = 9e-16
 Identities = 226/339 (67%), Gaps = 15/339 (4%)
 Strand=Plus/Plus

Query  208   CTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGATGCGCTCGACGAG  267
             || |||||  |  |||||||| |   |||||||   |||||| ||   |||  |  |   
Sbjct  7733  CTCCGCGCCTTCATGGACGACGACTCGCTCTACTCGGTGAACGCGTCCGCGGACTTCCGA  7792

Query  268   TGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTGACCAACGCCTTCAT-  326
             ||||| | ||||||||||   | || | | ||||| ||||| |      ||| | | || 
Sbjct  7793  TGCGGCTTCACGGACCCGGACGCCGCGCCGCAGCCCATCCCCG------ACGGCATTATG  7846

Query  327   --CTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTC  384
               |||||||||||||       | || ||||||||||| ||||||||||||      || 
Sbjct  7847  CGCTCCACGGGGTACACGCACGACGGCCCGTGCGAGGTCTGGCTCGACGACACGCGTGTG  7906

Query  385   ATGTCGGACATGAACTGCCACACAAAGTA--CCCCGGTACGAACTTTATGCTCGACTACA  442
              ||  | ||   ||||||||    | ||   | |||| |  | ||     || |||||| 
Sbjct  7907  CTGCAGCACGACAACTGCCATG--AGGTCATCTCCGGCAAAACCTACGACCTTGACTACT  7964

Query  443   GCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAA-C  501
                ||||||| || ||||||| ||||   ||||||||||||||| | |    | | || |
Sbjct  7965  CGGCGTGCAACGGCTCGTGCACGCTGTACTGGTACTGGCTCGGCGTGCGCTACCTCAAGC  8024

Query  502   GAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTGTCG  540
              || | |||||||||||||||||||||| ||||||| ||
Sbjct  8025  AAGTC-TACTCGTGGCAGGTGTACAAGGCCTGCGTGCCG  8062

 Score = 78.8 bits (86),  Expect = 2e-12
 Identities = 308/473 (65%), Gaps = 20/473 (4%)
 Strand=Plus/Plus

Query  72    GGTGCTGTACCCCGAGCCGTTCTACCTCGTCGACGGCGATGAAGCCCAGTCGGCCC--CT  129
             |||||| |||||   |||||||| | | || |||||| ||| |   | | |||| |  | 
Sbjct  6490  GGTGCTCTACCCGCCGCCGTTCTTCGTGGTGGACGGC-ATGGACTACCG-CGGCTCGCCC  6547

Query  130   GTGGCGCATCTCGAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGACTTCA-TGAA  188
             |||||| | || ||| |||||||| |  | |||  |  ||| | | | ||| |   ||  
Sbjct  6548  GTGGCGTACCTGGAGCAGCAGGGCGTGCACACGGCCATCGAGG-CGCAGACCTGGCTGGC  6606

Query  189   GCAGAAGGGGTATGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAA  248
             | ||   || || ||||  || |||||| |  |||||||| |    ||||||   || | 
Sbjct  6607  GGAGCGCGGCTACGCGACGCTGCGCGCGCTCATGGACGACGACGGACTCTACTCGGTCAC  6666

Query  249   CCCGGATGCGCTCGACGAGTGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCC  308
                ||| | ||||  ||| |||||    ||   |||||     ||| | |||||||||||
Sbjct  6667  GGAGGAGGGGCTCTTCGACTGCGGACTTACCTTCCCGAACACGGAGACGCAGCCGATCCC  6726

Query  309   AGTGACCAACGCCT---TCATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTG  365
                |||||||| ||   ||||| |  | || |||    || | || ||||||||| | ||
Sbjct  6727  ---GACCAACGGCTCGTTCATCACATCCGGCTACACGCTGGACGGGCCGTGCGAGATCTG  6783

Query  366   GCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAA  425
             | ||||| ||     ||   || ||| |   |||||||||||  ||| ||| |      |
Sbjct  6784  GATCGACAACACGCTGGCGCTGGCGGGCCGCAACTGCCACACGGAGTTCCCGGAGGGCCA  6843

Query  426   CTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCG----GTGGTACTGGC  481
             |   | | |||||||||||  ||||  | ||  | || ||| |||    ||||| |||||
Sbjct  6844  CCACACGATCGACTACAGCGTGTGCG-GCGA--GAGC-TGCCGCGTGTCGTGGTTCTGGC  6899

Query  482   TCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGC  534
             |||||||| ||  |  |  ||||   |||||||||||||| | ||||  ||||
Sbjct  6900  TCGGCATCAAGTACCAGGGCGAGCGCTACTCGTGGCAGGTCTTCAAGAACTGC  6952

 Score = 71.6 bits (78),  Expect = 2e-10
 Identities = 78/104 (75%), Gaps = 0/104 (0%)
 Strand=Plus/Plus

Query  434    TCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGC  493
              ||||||||   ||||||||||| ||||||| ||||   ||||||||| | ||  | |   
Sbjct  12716  TCGACTACTCGTCGTGCAAGGGCTCGTGCACGCTGTACTGGTACTGGATGGGTGTGCGCT  12775

Query  494    CCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTG  537
               | |||| |   ||||||||||||| |||||||||  ||| |||
Sbjct  12776  ACCTGAAGGGAGCGTACTCGTGGCAAGTGTACAAGAACTGTGTG  12819

 Score = 68.9 bits (75),  Expect = 3e-09
 Identities = 130/189 (69%), Gaps = 2/189 (1%)
 Strand=Plus/Minus

Query  349    GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCAC-AC  407
              || ||||||||||| ||||||||||||   | |||  ||  | ||   ||||||||| ||
Sbjct  14643  GGTCCGTGCGAGGTCTGGCTCGACGACACGATGGTGCTGCAGTACGACAACTGCCACGAC  14584

Query  408    AAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCT  467
                | | | | || | || ||     |||||||||   || |||| |    |||||| |||
Sbjct  14583  TCAAT-CTCTGGCAAGACCTACGACCTCGACTACTCGTCCTGCACGTCCACGTGCACGCT  14525

Query  468    GCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAA  527
                  |||| |||| | ||| |||    | | ||| |   |||||||||||||||||||||
Sbjct  14524  CTACTGGTTCTGGATGGGCGTCCGCTACCTCAACAACGAGTACTCGTGGCAGGTGTACAA  14465

Query  528    GGTCTGCGT  536
              |  ||||||
Sbjct  14464  GAACTGCGT  14456

 Score = 63.5 bits (69),  Expect = 1e-07
 Identities = 78/107 (73%), Gaps = 0/107 (0%)
 Strand=Plus/Minus

Query  434   TCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGC  493
             ||||||||   |||||||  || ||||||| ||||   |||| |||| | ||  | |   
Sbjct  8972  TCGACTACTCGTCGTGCAGCGGCTCGTGCACGCTGTACTGGTTCTGGATGGGTGTGCGCT  8913

Query  494   CCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTGTCG  540
              | |||| |   ||||||||||||| |||||||||  ||||||| ||
Sbjct  8912  ACCTGAAGGGAGCGTACTCGTGGCAAGTGTACAAGAACTGCGTGCCG  8866

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  508    TACTCGTGGCAGGTGTACAAGGTCTGCGTG  537
              ||||||||||| |||||||||  ||| |||
Sbjct  13995  TACTCGTGGCAAGTGTACAAGAACTGTGTG  14024

>PYAP:scaffold_560 pag1_scaffold_560 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_560:1:21458:1 
REF
Length=21458

 Score = 89.7 bits (98),  Expect = 9e-16
 Identities = 211/310 (68%), Gaps = 18/310 (6%)
 Strand=Plus/Plus

Query  237    CTACAACGTGAACCCGGATGCGCTCGACGAGTGCGGGTACACGGACCCGA-CGGTCGAGT  295
              |||||| |  |||  || ||||   | |||||| || |||||||| |||| ||  | |  
Sbjct  12754  CTACAAGGCTAACAAGGGTGCGACTGTCGAGTGTGGTTACACGGATCCGAACGCGCCAC-  12812

Query  296    CACAGCCGATCCCAGTGACCAACGCCTTCATCTCCACGGGGTACGT-CTTGAATGGACCG  354
              | ||||||||||||  || |  ||  |||  | |  |||| |||   |  ||| || |||
Sbjct  12813  CGCAGCCGATCCCAACGAACGGCGAGTTCCGCACATCGGGATACACGCACGAA-GGCCCG  12871

Query  355    TGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCAC-ACAAAGTA  413
              |||||| | ||| |||||||  | | ||||| |   | || |||||| ||| || |  | 
Sbjct  12872  TGCGAGATCTGGATCGACGATGTGATGGTCAAGAGCGGCAAGAACTGTCACTACGACAT-  12930

Query  414    CCCCGGTACGAA--CTTT-------ATGCTCGACTACAGCTCGTGCAAGGGATCGTGCAT  464
               | |||   |||  | ||       | | | ||||||||  | ||||||||   ||||||
Sbjct  12931  -CTCGGA--GAAGGCGTTCACTGACAAGATTGACTACAGTGCATGCAAGGGCAAGTGCAT  12987

Query  465    GCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTA  524
              |||   ||||||||||||||||||||  ||  ||  | ||| ||| || |||||| | ||
Sbjct  12988  GCTCAAGTGGTACTGGCTCGGCATCCGTCCAATGGGCAAGAAGTATTCATGGCAGATCTA  13047

Query  525    CAAGGTCTGC  534
              ||||| ||||
Sbjct  13048  CAAGGCCTGC  13057

 Score = 54.5 bits (59),  Expect = 6e-05
 Identities = 78/110 (71%), Gaps = 9/110 (8%)
 Strand=Plus/Minus

Query  434   TCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGC  493
             |||||| |  |  |||||||||    |||||||| || ||||||||||||||||   |||
Sbjct  8177  TCGACTTCTCCAAGTGCAAGGGCAACTGCATGCTCCGTTGGTACTGGCTCGGCA---AGC  8121

Query  494   CCGTGAACG------AGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTG  537
              | | | ||      ||| ||  ||||||||| | |||||||  || |||
Sbjct  8120  GCCTCATCGGTGGCAAGAAGTGGTCGTGGCAGATCTACAAGGCGTGTGTG  8071

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 63/85 (74%), Gaps = 6/85 (7%)
 Strand=Plus/Minus

Query  447    GTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACG--AG  504
              |||||||||    |||||||| || ||||||||||| |||    ||| |  ||  |  ||
Sbjct  10908  GTGCAAGGGCAACTGCATGCTCCGTTGGTACTGGCT-GGC--GAAGCGCAAGATTGGCAG  10852

Query  505    -ACGTACTCGTGGCAGGTGTACAAG  528
               | ||  ||||||||||||||||||
Sbjct  10851  CAAGTGGTCGTGGCAGGTGTACAAG  10827

>PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 
genomic scaffold, whole genome shotgun sequence
Length=695754

 Score = 85.1 bits (93),  Expect = 4e-14
 Identities = 257/392 (66%), Gaps = 14/392 (4%)
 Strand=Plus/Minus

Query  143     AGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGA-CTTCATGAAGCAGAAGGGGTA-  200
               |||||||||| ||||| ||||||  ||| | | | || ||  ||| | ||  | || || 
Sbjct  395258  AGGAGCAGGGAATCAACACGAGCATCGAGG-CACAGAGCTGGATGCAACAACAAGGATAC  395200

Query  201     --TGCGAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGATGCG  258
                 | ||   || ||||| |||||||| ||  |   ||| ||||| ||||    ||| || 
Sbjct  395199  AGTTCG---CTGCGCGCCATGCTGGATGATGAATCGCTTTACAAGGTGACAGAGGAGGCC  395143

Query  259     CTCGACGAGTGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTGACCAAC  318
                ||  |||||||||   |||   ||| | |   ||| | ||||| |||||   || ||||
Sbjct  395142  ATCTTCGAGTGCGGACTCACAAGCCCTAGGACTGAGACTCAGCCCATCCCGACGAACAAC  395083

Query  319     GCCTTCATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTC  378
                | ||     |  |||| |||    || | || ||||| ||| | ||||| ||||||  |
Sbjct  395082  TCGTTTCAGACGTCGGGCTACACGCTGGACGGCCCGTGTGAGATCTGGCTGGACGACACC  395023

Query  379     AAGGTCATGTCGGACATGAACTGCCACACAAAGTACCC---CGGTACGAACTTTATGCTC  435
               |||||    |||| |   |||||||| ||  | | |||   |||   | ||     | ||
Sbjct  395022  AAGGTGGCCTCGGGCCGCAACTGCCATACCGAATTCCCACACGGCCAGCACCA---GGTC  394966

Query  436     GACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCC  495
               ||||||||||| |||   || ||||||   ||    |||||||||||||||||| |   |
Sbjct  394965  GACTACAGCTCATGCGGCGGCTCGTGCCATCTATCTTGGTACTGGCTCGGCATCAAATAC  394906

Query  496     GTGAACGAGACGTACTCGTGGCAGGTGTACAA  527
               ||  | |  |  ||||| |||||||| |||||
Sbjct  394905  GTCGAGGGAATCTACTCTTGGCAGGTCTACAA  394874

 Score = 65.3 bits (71),  Expect = 3e-08
 Identities = 129/188 (69%), Gaps = 10/188 (5%)
 Strand=Plus/Minus

Query  347     ATGGACCGTGCGAGGTGTGGCTCGACGAC---CTCAAGGTCATGTCGGACATGAACTGCC  403
               |||| ||||| ||||| |||||||||  |   | |  | ||  |||||| |   ||||||
Sbjct  358884  ATGGCCCGTGTGAGGTTTGGCTCGACAGCACACGCGTGCTCCAGTCGGATA---ACTGCC  358828

Query  404     ACACAA--AGTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTG  461
               ||  ||  | ||    || | || || ||   | ||||||||||||||||||||  | ||
Sbjct  358827  ACGAAACCATTATT--GGCAAGACCTATAATTTGGACTACAGCTCGTGCAAGGGCACCTG  358770

Query  462     CATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGT  521
               || ||| || ||||||||||| ||  | |      | ||  |  | |||||||||||| |
Sbjct  358769  CACGCTACGCTGGTACTGGCTTGGTGTGCGTTTTCTCAAAAACGCCTACTCGTGGCAGAT  358710

Query  522     GTACAAGG  529
                |||||||
Sbjct  358709  CTACAAGG  358702

>PHKE:scaffold_622 scf_22126_622.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_622.1:1:14582:1 
REF
Length=14582

 Score = 84.2 bits (92),  Expect = 4e-14
 Identities = 163/239 (68%), Gaps = 4/239 (2%)
 Strand=Plus/Minus

Query  298   CAGCCGATCCCAGTGACCAACGCCTTCATCTCCACGGGGTACGTCTTGAATGGACCGTGC  357
             ||||| || || | |  ||||||| |   ||||||||| |||       | |||||||||
Sbjct  3719  CAGCCCATTCCGGAGGGCAACGCCATGCGCTCCACGGGATACACGCACGACGGACCGTGC  3660

Query  358   GAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGA--ACTGCCACACAAAGTACC  415
             ||||| ||| |||||||   |   |  |||  ||  ||||  ||||||||     || ||
Sbjct  3659  GAGGTCTGGATCGACGATACCCTTGCGATG--GGCAATGACAACTGCCACGAGGCGTTCC  3602

Query  416   CCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGT  475
             |||| | | |||  |   ||||||||    | ||||||||  ||||||  || || ||||
Sbjct  3601  CCGGCAAGGACTACACCATCGACTACTCGGCCTGCAAGGGCACGTGCACACTCCGTTGGT  3542

Query  476   ACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGC  534
             ||||||| ||| | |    | | ||  |  | |||||||||||||| ||||||| ||||
Sbjct  3541  ACTGGCTGGGCGTGCGTTTCCTCAAGAATTCCTACTCGTGGCAGGTATACAAGGCCTGC  3483

 Score = 67.1 bits (73),  Expect = 1e-08
 Identities = 89/124 (72%), Gaps = 0/124 (0%)
 Strand=Plus/Plus

Query  411  GTACCCCGGTACGAACTTTATGCTCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCG  470
            || |||||| | | |||  |   ||||||||    | ||||||||  ||||||  || ||
Sbjct  3    GTTCCCCGGCAAGGACTACACCATCGACTACTCGGCCTGCAAGGGCACGTGCACACTCCG  62

Query  471  GTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGGT  530
             ||||||||||| ||| | |    | | ||  |  | |||||||||||||||||||||| 
Sbjct  63   CTGGTACTGGCTGGGCGTGCGTTTCCTCAAGAATGCCTACTCGTGGCAGGTGTACAAGGC  122

Query  531  CTGC  534
            ||||
Sbjct  123  CTGC  126

>HYAP:scaffold_59 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_59:1:376122:1 
REF
Length=376122

 Score = 83.3 bits (91),  Expect = 1e-13
 Identities = 74/93 (80%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  436     GACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCC  495
               |||||||||||||||   |  |||||||  || |||||||||||||||||||| |||  |
Sbjct  161609  GACTACAGCTCGTGCGGAGACTCGTGCACCCTCCGGTGGTACTGGCTCGGCATTCAGTAC  161668

Query  496     GTGAACGAGACGTACTCGTGGCAGGTGTACAAG  528
                || | |  |  ||||||||||||||||| |||
Sbjct  161669  ATGGATGGTATCTACTCGTGGCAGGTGTATAAG  161701

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 31/36 (86%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  211     CGCGCGATGCTGGACGACCAGAAGCTCTACAACGTG  246
               ||||||||||||||||| |||  ||| ||| |||||
Sbjct  161381  CGCGCGATGCTGGACGATCAGTCGCTGTACCACGTG  161416

>PYAR:scaffold_3459 par_scaffold_3459 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_3459:1:3265:1 
REF
Length=3265

 Score = 79.7 bits (87),  Expect = 2e-12
 Identities = 73/90 (81%), Gaps = 2/90 (2%)
 Strand=Plus/Plus

Query  446   CGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCG-TGAACGAG  504
             ||||||||||  ||||||||||   |||||||||||| ||||||| |||||  |  | ||
Sbjct  2465  CGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCC-GCCCGACGGGCAAG  2523

Query  505   ACGTACTCGTGGCAGGTGTACAAGGTCTGC  534
             |  |||||||||||| | ||||||| ||||
Sbjct  2524  AGCTACTCGTGGCAGATCTACAAGGCCTGC  2553

>PHSO:scaffold_2
Length=11587142

 Score = 66.2 bits (72),  Expect = 1e-08
 Identities = 65/82 (79%), Gaps = 8/82 (10%)
 Strand=Plus/Minus

Query  460      TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAAC---GAGA-CGTACTCGTG  515
                |||||||||||||  |||||||| | | |||||  |||| ||   |||| |||    |||
Sbjct  2679924  TGCATGCTGCGGTTCTACTGGCTGGCCTTCCAGGGCGTGGACAGCGAGATCGT----GTG  2679869

Query  516      GCAGGTGTACAAGGTCTGCGTG  537
                |||||||||||||| |||||||
Sbjct  2679868  GCAGGTGTACAAGGACTGCGTG  2679847

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 28/31 (90%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  513      GTGGCAGGTGTACAAGGTCTGCGTGTCGTTG  543
                ||||||||||||||||| ||||||  |||||
Sbjct  2560109  GTGGCAGGTGTACAAGGACTGCGTACCGTTG  2560139

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 61/87 (70%), Gaps = 6/87 (7%)
 Strand=Plus/Plus

Query  460      TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACG---AGACGTACTCGTGG  516
                |||||| | || |  |||||||| |   | |||| | |  |||   |||| ||||   ||
Sbjct  2550970  TGCATGTTTCGTTTCTACTGGCTGGCGCTGCAGCGCCTCGACGGCAAGACCTACT---GG  2551026

Query  517      CAGGTGTACAAGGTCTGCGTGTCGTTG  543
                ||||||||||||  |||| |  |||||
Sbjct  2551027  CAGGTGTACAAGAACTGCATCCCGTTG  2551053

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  215      CGATGCTGGACGACCAGAAGCTCTACAACG  244
                ||||| ||||| ||||||||||||  ||||
Sbjct  3144861  CGATGGTGGACTACCAGAAGCTCTCGAACG  3144832

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 36/46 (78%), Gaps = 3/46 (7%)
 Strand=Plus/Minus

Query  96       CCTCGTCGACGGCGATGAAGCCCAGTCGGCCC---CTGTGGCGCAT  138
                |||||  | ||||||||||||| || | || |   |||||||||||
Sbjct  4892166  CCTCGAAGCCGGCGATGAAGCCGAGGCCGCGCGGGCTGTGGCGCAT  4892121

>PYIR:scaffold_155 pir_scaffold_155 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_155:1:48358:1 
REF
Length=48358

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 49/59 (83%), Gaps = 0/59 (0%)
 Strand=Plus/Plus

Query  434   TCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
             |||||| |   || |||||||| || ||||||||||| |||| |||||||||| |||||
Sbjct  6000  TCGACTTCTCATCCTGCAAGGGCTCATGCATGCTGCGCTGGTTCTGGCTCGGCCTCCAG  6058

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 41/48 (85%), Gaps = 0/48 (0%)
 Strand=Plus/Minus

Query  445   TCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
             || || ||||| |||||||||||||| |||| |||||||||  |||||
Sbjct  2586  TCCTGTAAGGGCTCGTGCATGCTGCGCTGGTTCTGGCTCGGTCTCCAG  2539

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 38/48 (79%), Gaps = 0/48 (0%)
 Strand=Plus/Minus

Query  445  TCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
            |||||||||||    ||||||||||| |  |  ||||||||| |||||
Sbjct  433  TCGTGCAAGGGCAACTGCATGCTGCGCTTTTTTTGGCTCGGCCTCCAG  386

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  348   TGGACCGTGCGAGGTGTGGCTCGACGAC  375
             ||| ||||||||| | ||||||||||||
Sbjct  2689  TGGCCCGTGCGAGATCTGGCTCGACGAC  2662

>PHRA:scaffold_4
Length=963095

 Score = 61.7 bits (67),  Expect = 4e-07
 Identities = 64/82 (78%), Gaps = 8/82 (10%)
 Strand=Plus/Plus

Query  460     TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAA---CGAGA-CGTACTCGTG  515
               |||||||||||||  |||||||| | | |||||  |||  |   ||||| |||    |||
Sbjct  331665  TGCATGCTGCGGTTCTACTGGCTGGCCTTCCAGGGCGTCGATAGCGAGATCGT----GTG  331720

Query  516     GCAGGTGTACAAGGTCTGCGTG  537
               |||||||||||||| |||||||
Sbjct  331721  GCAGGTGTACAAGGACTGCGTG  331742

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 64/85 (75%), Gaps = 2/85 (2%)
 Strand=Plus/Plus

Query  460     TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTC-GTGGCA  518
               |||||||| ||||  |||||| | | | |||||   ||| ||   | | |||  ||||||
Sbjct  240071  TGCATGCTCCGGTTCTACTGGTTGGCCTTCCAGGGTGTGGACAGCAAG-ACTGTGTGGCA  240129

Query  519     GGTGTACAAGGTCTGCGTGTCGTTG  543
               ||||||||||| ||||||| || ||
Sbjct  240130  GGTGTACAAGGACTGCGTGCCGCTG  240154

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 60/79 (76%), Gaps = 2/79 (3%)
 Strand=Plus/Plus

Query  460     TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGT-GAACGAGACGTACTCGTGGCA  518
               |||||||||||||  |||||||| | | |||||  ||| ||  |   | |  | ||||||
Sbjct  333420  TGCATGCTGCGGTTCTACTGGCTGGCCTTCCAGGGCGTCGACAGCTCCATGGT-GTGGCA  333478

Query  519     GGTGTACAAGGTCTGCGTG  537
               ||||||||||  |||||||
Sbjct  333479  GGTGTACAAGAACTGCGTG  333497

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 35/43 (81%), Gaps = 1/43 (2%)
 Strand=Plus/Plus

Query  349     GGACCGTGCGAGGTGTGGC-TCGACGACCTCAAGGTCATGTCG  390
               |||| |||||||||||||| |||||  |  |||| | ||||||
Sbjct  182248  GGACGGTGCGAGGTGTGGCATCGACAGCTGCAAGATGATGTCG  182290

>PYUU:scaffold_2036 scf1117875582036 dna:supercontig supercontig:pug:scf1117875582036:1:1090657:1 
REF
Length=1090657

 Score = 57.2 bits (62),  Expect = 5e-06
 Identities = 40/46 (87%), Gaps = 0/46 (0%)
 Strand=Plus/Minus

Query  446     CGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCA  491
               |||||||||| ||||||||||| ||||  |||||||||||  ||||
Sbjct  713266  CGTGCAAGGGTTCGTGCATGCTTCGGTTCTACTGGCTCGGTCTCCA  713221

>PYAP:scaffold_182 pag1_scaffold_182 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_182:1:48098:1 
REF
Length=48098

 Score = 57.2 bits (62),  Expect = 5e-06
 Identities = 70/96 (73%), Gaps = 0/96 (0%)
 Strand=Plus/Plus

Query  434   TCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGC  493
             |||||| |  |  ||| |||||    |||||| | || ||||||||||||||||| |  |
Sbjct  1834  TCGACTTCTCCAAGTGTAAGGGCGACTGCATGATCCGCTGGTACTGGCTCGGCATGCGCC  1893

Query  494   CCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGG  529
                |   | ||| ||  |||||||||||||||||||
Sbjct  1894  TACTCGGCAAGAAGTGGTCGTGGCAGGTGTACAAGG  1929

>PYIR:scaffold_1319 pir_scaffold_1319 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_1319:1:8199:1 
REF
Length=8199

 Score = 54.5 bits (59),  Expect = 6e-05
 Identities = 40/47 (85%), Gaps = 0/47 (0%)
 Strand=Plus/Minus

Query  446   CGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
             |||||||||| ||||||||||| || |  |||||||||||| | |||
Sbjct  5702  CGTGCAAGGGCTCGTGCATGCTCCGCTTCTACTGGCTCGGCCTGCAG  5656

>PYAR:scaffold_88 par_scaffold_88 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_88:1:34485:1 
REF
Length=34485

 Score = 54.5 bits (59),  Expect = 6e-05
 Identities = 40/47 (85%), Gaps = 0/47 (0%)
 Strand=Plus/Plus

Query  446   CGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
             |||||||||| ||||| |||||||| |  |||||||||||| | |||
Sbjct  3954  CGTGCAAGGGCTCGTGTATGCTGCGCTTCTACTGGCTCGGCCTTCAG  4000

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 33/40 (83%), Gaps = 0/40 (0%)
 Strand=Plus/Plus

Query  446  CGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGG  485
            ||||||||||    ||||||||||| |  |||||||||||
Sbjct  561  CGTGCAAGGGGAGCTGCATGCTGCGCTTCTACTGGCTCGG  600

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 33/40 (83%), Gaps = 0/40 (0%)
 Strand=Plus/Plus

Query  446   CGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGG  485
             ||||||||||    ||||||||||| |  |||||||||||
Sbjct  2682  CGTGCAAGGGGAGCTGCATGCTGCGCTTCTACTGGCTCGG  2721

>PHSO:scaffold_8
Length=3549547

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 53/69 (77%), Gaps = 0/69 (0%)
 Strand=Plus/Plus

Query  348      TGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACAC  407
                ||| ||||||||||| |||  |||||||  ||||||  |||  |||    ||||||| ||
Sbjct  1238275  TGGTCCGTGCGAGGTCTGGTGCGACGACACCAAGGTGCTGTTCGACTACGACTGCCAGAC  1238334

Query  408      AAAGTACCC  416
                 ||||||||
Sbjct  1238335  CAAGTACCC  1238343

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  509      ACTCGTGGCAGGTGTACAAGGTCTGCGTGT  538
                || ||||||||||||||| || ||||||||
Sbjct  1238430  ACCCGTGGCAGGTGTACACGGACTGCGTGT  1238459

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  512      CGTGGCAGGTGTACAAGGTCTGCGTGT  538
                ||||||||||||||| || ||||||||
Sbjct  1236563  CGTGGCAGGTGTACACGGACTGCGTGT  1236589

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 51/71 (72%), Gaps = 0/71 (0%)
 Strand=Plus/Plus

Query  349      GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
                || ||||||||||| |||   ||||||  ||||||  |||  |||    ||||||| || 
Sbjct  1240767  GGTCCGTGCGAGGTCTGGTGTGACGACACCAAGGTACTGTTCGACTACGACTGCCAGACG  1240826

Query  409      AAGTACCCCGG  419
                || | | ||||
Sbjct  1240827  AAATTCGCCGG  1240837

>PHSO:scaffold_12
Length=2105860

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 75/102 (74%), Gaps = 8/102 (8%)
 Strand=Plus/Minus

Query  432     GCTCGACTACAGCTCGTGCAAGGGATCG-TGCATGCTGCGGTGGTACTGGCTCGGCATCC  490
               ||| |||||||||   |||  ||||| | ||||| |||   ||||||||||| ||| | |
Sbjct  167227  GCTGGACTACAGCGGCTGCG-GGGATAGCTGCATCCTGTACTGGTACTGGCTGGGCGTGC  167169

Query  491     ---AGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGG  529
                  |||   |||| |  | || ||||||||| ||||||||||
Sbjct  167168  GTAAGC---TGAAGGGCAAGTTCTCGTGGCAAGTGTACAAGG  167130

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 46/58 (79%), Gaps = 0/58 (0%)
 Strand=Plus/Minus

Query  472     TGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGG  529
               ||||||||||| ||| | |    | | ||| | | |||||||||||||||||||||||
Sbjct  168488  TGGTACTGGCTGGGCGTGCGCTTCCTCAACAACAAGTACTCGTGGCAGGTGTACAAGG  168431

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 70/99 (71%), Gaps = 5/99 (5%)
 Strand=Plus/Minus

Query  432     GCTCGACTACAGCTCGTGCAAGGGATCG-TGCATGCTGCGGTGGTACTGGCTCGGCATCC  490
               ||| ||||||||| |||||  | ||  | ||| || ||   ||||||||||| ||| |  
Sbjct  162032  GCTGGACTACAGCGCGTGCG-GAGACAGCTGCGTGTTGTACTGGTACTGGCTGGGCGT--  161976

Query  491     AGCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAAGG  529
                || | | | | ||     ||||| ||||||||||||||
Sbjct  161975  -GCGCTTCATCAAGGGCATCTCGTAGCAGGTGTACAAGG  161938

>PYUU:scaffold_2038 scf1117875582038 dna:supercontig supercontig:pug:scf1117875582038:1:913258:1 
REF
Length=913258

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 40/48 (83%), Gaps = 0/48 (0%)
 Strand=Plus/Plus

Query  445     TCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
               || ||||||||||| |||||||| || |  |||||||||||  |||||
Sbjct  601702  TCATGCAAGGGATCCTGCATGCTTCGCTTCTACTGGCTCGGTTTCCAG  601749

>PHRA:scaffold_51
Length=360848

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 52/68 (76%), Gaps = 0/68 (0%)
 Strand=Plus/Minus

Query  349    GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
              |||||||||||||| |||  ||| |||  ||||||  |||  |||    ||||||| || 
Sbjct  38542  GGACCGTGCGAGGTCTGGTGCGATGACACCAAGGTGCTGTTCGACTACGACTGCCAGACC  38483

Query  409    AAGTACCC  416
              ||||||||
Sbjct  38482  AAGTACCC  38475

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  509    ACTCGTGGCAGGTGTACAAGGTCTGCGTGT  538
              || ||||||||||||||| || ||||||||
Sbjct  38388  ACCCGTGGCAGGTGTACACGGACTGCGTGT  38359

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  514    TGGCAGGTGTACAAGGTCTGCGTGT  538
              ||||||||||||| || ||||||||
Sbjct  40128  TGGCAGGTGTACACGGACTGCGTGT  40104

>PHKE:scaffold_761 scf_22126_761.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_761.1_contig_1:1:9298:1 
REF
Length=9298

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 63/85 (74%), Gaps = 1/85 (1%)
 Strand=Plus/Minus

Query  450  CAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTA  509
            ||||| | | ||||||||||| ||||||||| | ||  | |    | | ||  |  | ||
Sbjct  480  CAAGGCACC-TGCATGCTGCGCTGGTACTGGTTGGGTGTTCGCTTCCTCAAGAACTCTTA  422

Query  510  CTCGTGGCAGGTGTACAAGGTCTGC  534
            |||||||||||||||||| | ||||
Sbjct  421  CTCGTGGCAGGTGTACAAAGCCTGC  397

>PHCA:scaffold_24 PHYCAscaffold_24
Length=787421

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 58/78 (74%), Gaps = 0/78 (0%)
 Strand=Plus/Plus

Query  460     TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAG  519
               |||||||||||||  |||||| | |   |||||  |||| ||   | |     |||||||
Sbjct  172278  TGCATGCTGCGGTTCTACTGGTTGGCGTTCCAGGGCGTGGACAGCAAGATTGTGTGGCAG  172337

Query  520     GTGTACAAGGTCTGCGTG  537
               |||||||||| |||||||
Sbjct  172338  GTGTACAAGGACTGCGTG  172355

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 58/78 (74%), Gaps = 6/78 (8%)
 Strand=Plus/Plus

Query  460     TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGC-CCGTGAACG--AGACGTACTCGTGG  516
               |||||| | || |  ||||||||||   | |||| ||||||  |  | |||  || ||||
Sbjct  170878  TGCATGTTCCGCTATTACTGGCTCGCTCTGCAGCGCCGTGACAGCAAAACG--CT-GTGG  170934

Query  517     CAGGTGTACAAGGTCTGC  534
               ||||||||||||  ||||
Sbjct  170935  CAGGTGTACAAGAACTGC  170952

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 52/72 (72%), Gaps = 6/72 (8%)
 Strand=Plus/Plus

Query  460     TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACG---AGACGTACTCGTGG  516
               |||||| | ||||  |||||| | |   | ||||   || |||   |||||||||   ||
Sbjct  169380  TGCATGTTCCGGTTCTACTGGTTGGCGCTACAGCGTCTGGACGGTAAGACGTACT---GG  169436

Query  517     CAGGTGTACAAG  528
               ||||||||||||
Sbjct  169437  CAGGTGTACAAG  169448

>PYVX:scaffold_639 pve_scaffold_639 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_639:1:17349:1 
REF
Length=17349

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 32/35 (91%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  349   GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGT  383
             || ||||||||||||||||||||||||  ||||||
Sbjct  2182  GGGCCGTGCGAGGTGTGGCTCGACGACACCAAGGT  2148

>PHSO:scaffold_64
Length=40116

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 104/155 (67%), Gaps = 0/155 (0%)
 Strand=Plus/Plus

Query  327    CTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCAT  386
              ||||||||| |||  |    |||| ||||||||||| ||| ||||| ||      ||  |
Sbjct  38159  CTCCACGGGCTACACCCACGATGGCCCGTGCGAGGTCTGGATCGACAACACGCGCGTGCT  38218

Query  387    GTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTC  446
              |  || |   |||||||||   |||  | |||  | |  ||  | | ||||||||    |
Sbjct  38219  GCAGGGCGACAACTGCCACGAGAAGATCGCCGACAAGGGCTACACGATCGACTACTCGGC  38278

Query  447    GTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGC  481
               || |||||  |||||| ||| || ||||||||||
Sbjct  38279  TTGTAAGGGCACGTGCACGCTCCGTTGGTACTGGC  38313

>PHSO:scaffold_4
Length=7609242

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 104/155 (67%), Gaps = 0/155 (0%)
 Strand=Plus/Plus

Query  327      CTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCAT  386
                ||||||||| |||  |    |||| ||||||||||| ||| ||||| ||      ||  |
Sbjct  4365207  CTCCACGGGCTACACCCACGATGGTCCGTGCGAGGTCTGGATCGACAACACGCGCGTGCT  4365266

Query  387      GTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTC  446
                |  || |   |||||||||   |||  | |||  | |  ||  | | ||||||||    |
Sbjct  4365267  GCAGGGCGACAACTGCCACGAGAAGATCGCCGACAAGGGCTACACGATCGACTACTCGGC  4365326

Query  447      GTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGC  481
                 || |||||  |||||| ||| || ||||||||||
Sbjct  4365327  TTGTAAGGGCACGTGCACGCTCCGTTGGTACTGGC  4365361

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 104/155 (67%), Gaps = 0/155 (0%)
 Strand=Plus/Minus

Query  327      CTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCAT  386
                ||||||||| |||  |    |||| ||||||||||| ||| ||||| ||      ||  |
Sbjct  4374086  CTCCACGGGCTACACCCACGATGGTCCGTGCGAGGTCTGGATCGACAACACGCGCGTGCT  4374027

Query  387      GTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGCTCGACTACAGCTC  446
                |  || |   |||||||||   |||  | |||  | |  ||  | | ||||||||    |
Sbjct  4374026  GCAGGGCGACAACTGCCACGAGAAGATCGCCGACAAGGGCTACACGATCGACTACTCGGC  4373967

Query  447      GTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGC  481
                 || |||||  |||||| ||| || ||||||||||
Sbjct  4373966  TTGTAAGGGCACGTGCACGCTCCGTTGGTACTGGC  4373932

>PHPA:scaffold_39 NW_008649025.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.39, whole genome shotgun 
sequence
Length=634653

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 48/59 (81%), Gaps = 2/59 (3%)
 Strand=Plus/Plus

Query  472     TGGTACTGGCTCGGCATCCAGCCCG-TGAACGAGACGTACTCGTGGCAGGTGTACAAGG  529
               ||||||||||| ||| | | ||  | |||| |  | |||||||||||||||||||||||
Sbjct  150276  TGGTACTGGCTGGGCGTGC-GCAAGCTGAAGGGCAAGTACTCGTGGCAGGTGTACAAGG  150333

 Score = 45.5 bits (49),  Expect = 0.032
 Identities = 26/27 (96%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  503     AGACGTACTCGTGGCAGGTGTACAAGG  529
               ||| |||||||||||||||||||||||
Sbjct  151489  AGAAGTACTCGTGGCAGGTGTACAAGG  151515

>PHPA:scaffold_9 NW_008648995.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.9, whole genome shotgun 
sequence
Length=1651025

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 54/69 (78%), Gaps = 2/69 (3%)
 Strand=Plus/Plus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGAC-ATGAACTGCCACAC  407
               || ||||||||||| |||  |||||||  ||||||  |||  ||| ||| ||||||| ||
Sbjct  524159  GGTCCGTGCGAGGTCTGGTGCGACGACACCAAGGTGTTGTTCGACTATG-ACTGCCAGAC  524217

Query  408     AAAGTACCC  416
                || |||||
Sbjct  524218  CAAATACCC  524226

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 53/73 (73%), Gaps = 0/73 (0%)
 Strand=Plus/Plus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
               || ||||||||||| |||  |||||||   |||||  |||  |||    ||||||| || 
Sbjct  538489  GGTCCGTGCGAGGTCTGGTGCGACGACACTAAGGTGCTGTTCGACTACGACTGCCAGACC  538548

Query  409     AAGTACCCCGGTA  421
               || | ||| ||||
Sbjct  538549  AAATTCCCGGGTA  538561

>PHSO:scaffold_10
Length=2388181

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 33/37 (89%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  218      TGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGA  254
                |||||||| ||||||||||| |||| ||| |||||||
Sbjct  1090940  TGCTGGACTACCAGAAGCTCAACAAGGTGGACCCGGA  1090976

>PHCA:scaffold_67 PHYCAscaffold_67
Length=292061

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 128/190 (67%), Gaps = 14/190 (7%)
 Strand=Plus/Minus

Query  347     ATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCA---TGTCGGACATGAACTGCC  403
               |||| ||||||||| | ||| | |  |||   ||| ||    ||||| || | |||||||
Sbjct  220555  ATGGCCCGTGCGAGATCTGGATGGGGGAC---AAGCTCGCTCTGTCGTACCTCAACTGCC  220499

Query  404     ACACAAAGTACCCCGGTACGAACTTTATGCTCGACTACAG---CTCGTGCAAGGGATCG-  459
               ||  |  |  |||||    ||  || | ||||||||||||   || |||   | ||| | 
Sbjct  220498  ACGAATCGATCCCCGAGCAGACGTTCAAGCTCGACTACAGTGGCT-GTG---GTGATAGC  220443

Query  460     TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAG  519
               |||||  ||   ||||||||||| ||  | |      | || |  | |||||||||||||
Sbjct  220442  TGCATTTTGTACTGGTACTGGCTGGGAGTGCGTAAACTCAAGGGCAAGTACTCGTGGCAG  220383

Query  520     GTGTACAAGG  529
               ||||||||||
Sbjct  220382  GTGTACAAGG  220373

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 104/149 (70%), Gaps = 10/149 (7%)
 Strand=Plus/Minus

Query  386     TGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTT-ATGCTCGACTACAG-  443
               ||||| || | |||||||||  ||   | | |||  |  || || | |||||||||||| 
Sbjct  219508  TGTCGTACCTCAACTGCCACG-AATCCATCACGGACCAGACGTTCAAGCTCGACTACAGT  219450

Query  444     --CTCGTGCAAGGGATCG-TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAA  500
                 || |||   | ||| | ||||| |||   ||||||||||| ||  | |    | | ||
Sbjct  219449  GGCT-GTG---GTGATAGCTGCATTCTGTACTGGTACTGGCTGGGAGTTCGCTACCTCAA  219394

Query  501     CGAGACGTACTCGTGGCAGGTGTACAAGG  529
                 ||| |||||||||||| ||||||||||
Sbjct  219393  GAAGAAGTACTCGTGGCAAGTGTACAAGG  219365

>PHSO:scaffold_16
Length=803425

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 50/66 (76%), Gaps = 0/66 (0%)
 Strand=Plus/Minus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
               || ||||||||| | ||||||||||||  ||||||  |||| ||     ||||| |||  
Sbjct  524341  GGTCCGTGCGAGATCTGGCTCGACGACAACAAGGTGCTGTCTGAGGACGACTGCTACAGC  524282

Query  409     AAGTAC  414
               ||||||
Sbjct  524281  AAGTAC  524276

 Score = 47.3 bits (51),  Expect = 0.009
 Identities = 53/70 (76%), Gaps = 6/70 (9%)
 Strand=Plus/Minus

Query  348     TGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATG---TCGGACATGAACTGCCA  404
               ||| ||||||||| | ||||||||||||   |||||||||    |||||    ||||| |
Sbjct  551343  TGGTCCGTGCGAGATCTGGCTCGACGACAAGAAGGTCATGGCTGCGGAC---GACTGCTA  551287

Query  405     CACAAAGTAC  414
               ||  ||||||
Sbjct  551286  CAGCAAGTAC  551277

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 89/125 (71%), Gaps = 7/125 (6%)
 Strand=Plus/Minus

Query  264     CGAGTGCGGGTACACGGACCCGA-CGGTCGAGTCACAGCCGATCCC-AGTGAC--CAACG  319
               ||| ||||| | ||| ||||||| ||||   | | ||||| ||||| |  |||  ||| |
Sbjct  554039  CGACTGCGGCTTCACCGACCCGAACGGTAC-GCCGCAGCCCATCCCGACCGACGGCAAGG  553981

Query  320     CCTTCATCTC-CACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTC  378
               || || |||| | |||  | | ||   |  || ||||||||| | ||||||||||||   
Sbjct  553980  CCGTCTTCTCTCGCGGCCT-CATCCACACGGGCCCGTGCGAGTTCTGGCTCGACGACAAA  553922

Query  379     AAGGT  383
               |||||
Sbjct  553921  AAGGT  553917

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 89/125 (71%), Gaps = 7/125 (6%)
 Strand=Plus/Plus

Query  264     CGAGTGCGGGTACACGGACCCGA-CGGTCGAGTCACAGCCGATCCC-AGTGAC--CAACG  319
               ||| ||||| | ||| ||||||| ||||   | | ||||| ||||| |  |||  ||| |
Sbjct  557113  CGACTGCGGCTTCACCGACCCGAACGGTAC-GCCGCAGCCCATCCCGACCGACGGCAAGG  557171

Query  320     CCTTCATCTC-CACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTC  378
               || || |||| | |||  | | ||   |  || ||||||||| | ||||||||||||   
Sbjct  557172  CCGTCTTCTCTCGCGGCCT-CATCCACACGGGCCCGTGCGAGTTCTGGCTCGACGACAAA  557230

Query  379     AAGGT  383
               |||||
Sbjct  557231  AAGGT  557235

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  460     TGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
               |||||| |||| |  |||||||||||| |||||
Sbjct  551207  TGCATGATGCGCTTCTACTGGCTCGGCTTCCAG  551175

>PHRA:scaffold_2892
Length=2014

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 69/95 (73%), Gaps = 2/95 (2%)
 Strand=Plus/Minus

Query  436   GACTACAGCTCGTGCAAGGGATCG-TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCC  494
             |||||||||   |||  ||||| | ||||| |||   ||||||||||| ||    |    
Sbjct  1622  GACTACAGCGGATGCG-GGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGCGCGATA  1564

Query  495   CGTGAACGAGACGTACTCGTGGCAGGTGTACAAGG  529
             | |||| |  |  ||||||||||||||||||||||
Sbjct  1563  CCTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGG  1529

>PHRA:scaffold_494
Length=11395

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 69/95 (73%), Gaps = 2/95 (2%)
 Strand=Plus/Minus

Query  436   GACTACAGCTCGTGCAAGGGATCG-TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCC  494
             |||||||||   |||  ||||| | ||||| |||   ||||||||||| ||    |    
Sbjct  8258  GACTACAGCGGATGCG-GGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGCGCGATA  8200

Query  495   CGTGAACGAGACGTACTCGTGGCAGGTGTACAAGG  529
             | |||| |  |  ||||||||||||||||||||||
Sbjct  8199  CCTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGG  8165

>PHRA:scaffold_33
Length=496317

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 69/95 (73%), Gaps = 2/95 (2%)
 Strand=Plus/Minus

Query  436     GACTACAGCTCGTGCAAGGGATCG-TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCC  494
               |||||||||   |||  ||||| | ||||| |||   ||||||||||| ||    |    
Sbjct  171164  GACTACAGCGGATGCG-GGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGCGCGATA  171106

Query  495     CGTGAACGAGACGTACTCGTGGCAGGTGTACAAGG  529
               | |||| |  |  ||||||||||||||||||||||
Sbjct  171105  CCTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGG  171071

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 69/95 (73%), Gaps = 2/95 (2%)
 Strand=Plus/Minus

Query  436     GACTACAGCTCGTGCAAGGGATCG-TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCC  494
               |||||||||   |||  ||||| | ||||| |||   ||||||||||| ||    |    
Sbjct  175523  GACTACAGCGGATGCG-GGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGCGCGATA  175465

Query  495     CGTGAACGAGACGTACTCGTGGCAGGTGTACAAGG  529
               | |||| |  |  ||||||||||||||||||||||
Sbjct  175464  CCTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGG  175430

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 58/78 (74%), Gaps = 1/78 (1%)
 Strand=Plus/Plus

Query  453     GGGATCG-TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACT  511
               ||||| | ||||| |||   ||||||||||| ||  | |    | |||| |  |  ||||
Sbjct  370976  GGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGTGCGATACCTGAAGGGCAGCTACT  371035

Query  512     CGTGGCAGGTGTACAAGG  529
               ||||||||||||||||||
Sbjct  371036  CGTGGCAGGTGTACAAGG  371053

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGT  383
               || ||||||||| | ||||||||||||  ||||||
Sbjct  430673  GGTCCGTGCGAGATCTGGCTCGACGACACCAAGGT  430639

>PYIW:scaffold_7003 piw_scaffold_7003 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_7003:1:774:1 
REF
Length=774

 Score = 47.3 bits (51),  Expect = 0.009
 Identities = 33/38 (87%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  448  TGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGG  485
            ||||||||   |||||||||||| |||| |||||||||
Sbjct  426  TGCAAGGGCAAGTGCATGCTGCGCTGGTTCTGGCTCGG  463

>PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2956, whole genome shotgun sequence
Length=1921269

 Score = 47.3 bits (51),  Expect = 0.009
 Identities = 69/96 (72%), Gaps = 4/96 (4%)
 Strand=Plus/Minus

Query  434      TCGACTACAGCTCGTGCAAGGGA--TCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCA  491
                |||||||||||| |||   ||||  || || | |||   |||||||||||| || ||| |
Sbjct  1846639  TCGACTACAGCTTGTGT--GGGAATTCATGTAAGCTTGTGTGGTACTGGCTTGGAATCAA  1846582

Query  492      GCCCGTGAACGAGACGTACTCGTGGCAGGTGTACAA  527
                |  |||  | | ||  || || ||||| || |||||
Sbjct  1846581  GTACGTCGAAGGGATTTATTCATGGCAAGTCTACAA  1846546

>PHRA:scaffold_79
Length=220511

 Score = 47.3 bits (51),  Expect = 0.009
 Identities = 33/38 (87%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  506    CGTACTCGTGGCAGGTGTACAAGGTCTGCGTGTCGTTG  543
              ||||||||||||||||||||||||  ||| | ||| ||
Sbjct  25711  CGTACTCGTGGCAGGTGTACAAGGAGTGCATCTCGCTG  25674

>PHPA:scaffold_66 NW_008649052.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.66, whole genome shotgun 
sequence
Length=310063

 Score = 47.3 bits (51),  Expect = 0.009
 Identities = 51/68 (75%), Gaps = 0/68 (0%)
 Strand=Plus/Minus

Query  460     TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAG  519
               ||| |||| || ||||||||| | ||  |||    | | ||  |  ||||||||||||||
Sbjct  162703  TGCGTGCTACGCTGGTACTGGTTGGGTGTCCGCTTCCTCAAAAACTCGTACTCGTGGCAG  162644

Query  520     GTGTACAA  527
               ||||||||
Sbjct  162643  GTGTACAA  162636

>PHPA:scaffold_46 NW_008649032.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.46, whole genome shotgun 
sequence
Length=493760

 Score = 47.3 bits (51),  Expect = 0.009
 Identities = 51/68 (75%), Gaps = 0/68 (0%)
 Strand=Plus/Minus

Query  460   TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAG  519
             ||| |||| || ||||||||| | ||  |||    | | ||  |  ||||||||||||||
Sbjct  3564  TGCGTGCTACGCTGGTACTGGTTGGGTGTCCGCTTCCTCAAAAACTCGTACTCGTGGCAG  3505

Query  520   GTGTACAA  527
             ||||||||
Sbjct  3504  GTGTACAA  3497

>PYVX:scaffold_121 pve_scaffold_121 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_121:1:49194:1 
REF
Length=49194

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 34/40 (85%), Gaps = 0/40 (0%)
 Strand=Plus/Minus

Query  349    GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGT  388
              || ||||||||| | ||||||||||||  || ||||||||
Sbjct  28977  GGTCCGTGCGAGATTTGGCTCGACGACACCATGGTCATGT  28938

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 29/33 (88%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  261    CGACGAGTGCGGGTACACGGACCCGACGGTCGA  293
              || ||||||||||||||||||||||   |||||
Sbjct  29138  CGCCGAGTGCGGGTACACGGACCCGGATGTCGA  29106

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 35/44 (80%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  349    GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGA  392
              || ||||||||| | ||||||||||||   | |||| |||| ||
Sbjct  19752  GGTCCGTGCGAGATCTGGCTCGACGACACTATGGTCCTGTCCGA  19709

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 33/41 (80%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  343    TTGAATGGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGT  383
              ||| | || ||||||||| | ||||||||||||  || |||
Sbjct  17641  TTGCAGGGTCCGTGCGAGATCTGGCTCGACGACACCATGGT  17601

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  349    GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGT  383
              || ||||||||| | ||||||||||||  || |||
Sbjct  27207  GGTCCGTGCGAGATCTGGCTCGACGACACCATGGT  27173

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  460    TGCATGCTGCGGTGGTACTGGCTCG  484
              |||||||||||||  ||||||||||
Sbjct  28848  TGCATGCTGCGGTTCTACTGGCTCG  28824

>PYAP:scaffold_289 pag1_scaffold_289 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_289:1:35482:1 
REF
Length=35482

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 96/140 (69%), Gaps = 5/140 (4%)
 Strand=Plus/Minus

Query  349    GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGCCACACA  408
              || ||||| ||| |||||||||||| |   | ||||  ||||| || | | ||   ||  
Sbjct  12670  GGCCCGTGTGAGCTGTGGCTCGACGGCGAGATGGTCGCGTCGGCCAAGCAGTGTGTCAAG  12611

Query  409    AAGTACCCCGGTACG-AACTTTATGCTCGACTACAGCTCGTGCAAGGGATC---GTGCAT  464
               |||| |||||  || ||  | | | |||||| ||||  ||||||| | ||   |||   
Sbjct  12610  GAGTA-CCCGGACCGTAAGATCAAGGTCGACTTCAGCAAGTGCAAGAGCTCCAAGTGTCA  12552

Query  465    GCTGCGGTGGTACTGGCTCG  484
              | |||| |||  ||||||||
Sbjct  12551  GTTGCGTTGGGTCTGGCTCG  12532

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  349    GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGC  402
              || ||||||||||| ||||| ||  ||  |||||||  ||||| || | | |||
Sbjct  14499  GGGCCGTGCGAGGTCTGGCTGGATAACACCAAGGTCGCGTCGGCCAAGGAATGC  14552

>PHSO:scaffold_11
Length=2192408

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 52/70 (74%), Gaps = 0/70 (0%)
 Strand=Plus/Minus

Query  460      TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGACGTACTCGTGGCAG  519
                |||| | |||  ||||||||||||||  | |    | | ||  |  ||||||||||||||
Sbjct  2022560  TGCACGATGCACTGGTACTGGCTCGGAGTGCGCTTCCTCAAGAACTCGTACTCGTGGCAG  2022501

Query  520      GTGTACAAGG  529
                || |||||||
Sbjct  2022500  GTCTACAAGG  2022491

>PYAR:scaffold_593 par_scaffold_593 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_593:1:15936:1 
REF
Length=15936

 Score = 44.6 bits (48),  Expect = 0.032
 Identities = 66/94 (70%), Gaps = 0/94 (0%)
 Strand=Plus/Minus

Query  436    GACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCC  495
              |||| ||||   ||||||||    |||| | | |  ||||||||||||| ||  |  | |
Sbjct  15884  GACTTCAGCGTCTGCAAGGGTGACTGCACGATCCACTGGTACTGGCTCGCCAAGCGTCTC  15825

Query  496    GTGAACGAGACGTACTCGTGGCAGGTGTACAAGG  529
               |   | ||| ||  |||||||||| ||||||||
Sbjct  15824  ATTGGCAAGAAGTGGTCGTGGCAGGCGTACAAGG  15791

>PHKE:scaffold_884 scf_22126_884.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_884.1_contig_1:1:6277:1 
REF
Length=6277

 Score = 44.6 bits (48),  Expect = 0.032
 Identities = 45/59 (76%), Gaps = 0/59 (0%)
 Strand=Plus/Minus

Query  434   TCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
             ||||||||   |||||||| ||    |||||||||  ||  |||||||||||  |||||
Sbjct  3749  TCGACTACTCATCGTGCAATGGTGACTGCATGCTGTCGTTTTACTGGCTCGGGTTCCAG  3691

>SADI:scaffold_22 supercont1.22 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.22:1:763575:1 
REF
Length=763575

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 25/26 (96%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGA  374
               || |||||||||||||||||||||||
Sbjct  134868  GGTCCGTGCGAGGTGTGGCTCGACGA  134843

>PYVX:scaffold_622 pve_scaffold_622 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_622:1:17888:1 
REF
Length=17888

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 47/60 (78%), Gaps = 2/60 (3%)
 Strand=Plus/Plus

Query  434   TCGACTACA-GCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
             ||||||||  |||| ||||||||    ||| ||||||| |  |||||||||||| | |||
Sbjct  2228  TCGACTACTCGCTC-TGCAAGGGCGACTGCGTGCTGCGCTTCTACTGGCTCGGCTTTCAG  2286

>PYVX:scaffold_496 pve_scaffold_496 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_496:1:22231:1 
REF
Length=22231

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 29/33 (88%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  343    TTGAATGGACCGTGCGAGGTGTGGCTCGACGAC  375
              ||| | || ||||||||||| ||||||||||||
Sbjct  10377  TTGCAGGGTCCGTGCGAGGTCTGGCTCGACGAC  10345

>PYUU:scaffold_1789 scf1117875581789 dna:supercontig supercontig:pug:scf1117875581789:1:837833:1 
REF
Length=837833

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 38/48 (79%), Gaps = 0/48 (0%)
 Strand=Plus/Plus

Query  445     TCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
               || || |||||  |||||||||||||   ||||||||| ||  |||||
Sbjct  698534  TCCTGTAAGGGGACGTGCATGCTGCGCATGTACTGGCTTGGATTCCAG  698581

>PYIW:scaffold_712 piw_scaffold_712 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_712:1:15016:1 
REF
Length=15016

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 38/48 (79%), Gaps = 0/48 (0%)
 Strand=Plus/Minus

Query  445   TCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
             ||||||||| |   |||| | ||||| |  |||||||||||| |||||
Sbjct  1324  TCGTGCAAGAGCAAGTGCGTCCTGCGCTTCTACTGGCTCGGCCTCCAG  1277

>PYIR:scaffold_15 pir_scaffold_15 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_15:1:94929:1 
REF
Length=94929

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 31/35 (89%), Gaps = 1/35 (3%)
 Strand=Plus/Minus

Query  46     GCAGTTGCCGTCCACG-CGCAGCACAAGGTGCTGT  79
              |||||||||||||| | ||||||||||| ||| ||
Sbjct  90116  GCAGTTGCCGTCCATGGCGCAGCACAAGATGCCGT  90082

>PYAP:scaffold_216 pag1_scaffold_216 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_216:1:44217:1 
REF
Length=44217

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 32/38 (84%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  448    TGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGG  485
              |||||||| ||||||||||| || |  |||||||| ||
Sbjct  25895  TGCAAGGGCTCGTGCATGCTTCGTTTCTACTGGCTTGG  25932

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 36/45 (80%), Gaps = 0/45 (0%)
 Strand=Plus/Minus

Query  448   TGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
             ||||||||   ||||||||| || |  |||||||||||  |||||
Sbjct  1828  TGCAAGGGCAAGTGCATGCTCCGCTTCTACTGGCTCGGTCTCCAG  1784

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 35/44 (80%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  448   TGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCA  491
             ||||||||   ||||||| |||| |  |||||||||||  ||||
Sbjct  3420  TGCAAGGGCAAGTGCATGATGCGTTTCTACTGGCTCGGTCTCCA  3377

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 33/41 (80%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  445    TCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGG  485
              || ||||||||   ||| ||||| ||||  |||||||||||
Sbjct  38449  TCATGCAAGGGGAAGTGTATGCTTCGGTTCTACTGGCTCGG  38489

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  348    TGGACCGTGCGAGGTGTGGCTCGACGAC  375
              ||||||||||||| ||||| | ||||||
Sbjct  38346  TGGACCGTGCGAGCTGTGGATTGACGAC  38373

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 35/45 (78%), Gaps = 0/45 (0%)
 Strand=Plus/Minus

Query  448  TGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
            ||||||||   ||||| ||| || |  |||||||||||  |||||
Sbjct  490  TGCAAGGGCAAGTGCACGCTCCGTTTCTACTGGCTCGGTCTCCAG  446

>PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 
genomic scaffold, whole genome shotgun sequence
Length=4722445

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 26/28 (93%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  348      TGGACCGTGCGAGGTGTGGCTCGACGAC  375
                ||||||||||||| | ||||||||||||
Sbjct  3772650  TGGACCGTGCGAGATCTGGCTCGACGAC  3772623

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 47/63 (75%), Gaps = 6/63 (10%)
 Strand=Plus/Plus

Query  475      TACTGGCTCGGCATCCAGCCCGTGAACG---AGACGTACTCGTGGCAGGTGTACAAGGTC  531
                |||||||| |   ||||||   || |||   | |||||||   |||||||||||||| ||
Sbjct  3736440  TACTGGCTGGCGCTCCAGCGTCTGGACGGCAAAACGTACT---GGCAGGTGTACAAGATC  3736496

Query  532      TGC  534
                |||
Sbjct  3736497  TGC  3736499

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 56/78 (72%), Gaps = 6/78 (8%)
 Strand=Plus/Minus

Query  460      TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACG---AGACGTACTCGTGG  516
                |||||||| || |  |||||||| |   ||||||   |  |||   | |||||||   ||
Sbjct  3772514  TGCATGCTCCGCTTCTACTGGCTGGCGCTCCAGCGTTTAGACGGCAAAACGTACT---GG  3772458

Query  517      CAGGTGTACAAGGTCTGC  534
                ||||||||||||  ||||
Sbjct  3772457  CAGGTGTACAAGAACTGC  3772440

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  348      TGGACCGTGCGAGGTGTGGCTCGACGAC  375
                ||| ||||||||| | ||||||||||||
Sbjct  3770463  TGGTCCGTGCGAGATTTGGCTCGACGAC  3770436

>PYUU:scaffold_1308 scf1117875581308 dna:supercontig supercontig:pug:scf1117875581308:1:205558:1 
REF
Length=205558

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  230     AGAAGCTCTACAACGTGAACCCGGATGCGCTCGAC  264
               |||| || | |||| ||||||||||||||||| ||
Sbjct  137778  AGAACCTGTCCAACATGAACCCGGATGCGCTCTAC  137812

>SAPA:scaffold_12 supercont2.12 dna:supercontig supercontig:ASM15154v2:supercont2.12:1:690970:1 
REF
Length=690970

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGAC  375
               || ||||||||||||||||| ||||||
Sbjct  306406  GGGCCGTGCGAGGTGTGGCTGGACGAC  306380

>PYIW:scaffold_282 piw_scaffold_282 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_282:1:21997:1 
REF
Length=21997

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 32/38 (84%), Gaps = 3/38 (8%)
 Strand=Plus/Minus

Query  154   ATCAAGACGAGCGCCGACGTCTCGGACTTCATGAAGCA  191
             |||||||||  || |||||   ||||||||||||||||
Sbjct  8669  ATCAAGACGCTCGGCGACG---CGGACTTCATGAAGCA  8635

>PYAP:scaffold_328 pag1_scaffold_328 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_328:1:32485:1 
REF
Length=32485

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  512    CGTGGCAGGTGTACAAGGTCTGCGTGT  538
              |||||||||||||||| | ||||||||
Sbjct  27418  CGTGGCAGGTGTACAATGACTGCGTGT  27392

>PHPA:scaffold_20 NW_008649006.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.20, whole genome shotgun 
sequence
Length=1049362

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 58/82 (71%), Gaps = 0/82 (0%)
 Strand=Plus/Plus

Query  446     CGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGAGA  505
               |||||||||||   ||  | ||    ||||||||||||||  | |    | | ||  |  
Sbjct  363969  CGTGCAAGGGAAACTGTGTTCTCTACTGGTACTGGCTCGGTGTGCGCTTCCTCAAGAATT  364028

Query  506     CGTACTCGTGGCAGGTGTACAA  527
               |||| |||||||||||||||||
Sbjct  364029  CGTATTCGTGGCAGGTGTACAA  364050

>PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 
genomic scaffold, whole genome shotgun sequence
Length=3552875

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  503      AGACGTACTCGTGGCAGGTGTACAAGG  529
                ||| |||||||||||| ||||||||||
Sbjct  2704531  AGAAGTACTCGTGGCAAGTGTACAAGG  2704505

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  507      GTACTCGTGGCAGGTGTACAAGG  529
                |||||| ||||||||||||||||
Sbjct  2743212  GTACTCCTGGCAGGTGTACAAGG  2743190

>PHCA:scaffold_93 PHYCAscaffold_93
Length=150113

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 48/63 (76%), Gaps = 3/63 (5%)
 Strand=Plus/Minus

Query  434     TCGACTACAGCTCGTGCAAG--GGATCG-TGCATGCTGCGGTGGTACTGGCTCGGCATCC  490
               ||||||||  |||||||     || | | |||||||||||||  |||||||| ||| | |
Sbjct  144494  TCGACTACTCCTCGTGCGCTTCGGGTGGCTGCATGCTGCGGTTCTACTGGCTTGGCTTGC  144435

Query  491     AGC  493
               |||
Sbjct  144434  AGC  144432

>PYVX:scaffold_341 pve_scaffold_341 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_341:1:29233:1 
REF
Length=29233

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 44/59 (75%), Gaps = 0/59 (0%)
 Strand=Plus/Minus

Query  434    TCGACTACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAG  492
              |||||||||    ||||  |||    ||| ||||||| |  |||||||||||| |||||
Sbjct  23601  TCGACTACACGCAGTGCTCGGGCGACTGCGTGCTGCGCTTCTACTGGCTCGGCTTCCAG  23543

>PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:pug:scf1117875582028:1:960197:1 
REF
Length=960197

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 39/48 (81%), Gaps = 2/48 (4%)
 Strand=Plus/Minus

Query  99      CGTCGACGGCGATGAAG-CCCAGTCGGCCCCTGTGGCGCATCTCGAGG  145
               || ||||||||||  || |||| |||  ||||||||||| ||||| ||
Sbjct  620797  CGCCGACGGCGATTCAGGCCCAATCGTTCCCTGTGGCGC-TCTCGGGG  620751

>PYUU:scaffold_2029 scf1117875582029 dna:supercontig supercontig:pug:scf1117875582029:1:1550222:1 
REF
Length=1550222

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  349     GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGC  402
               || |||||||| ||||||   ||||||  || |||   | || |||||||||||
Sbjct  494909  GGGCCGTGCGAAGTGTGGTGTGACGACAACATGGTGCAGACGAACATGAACTGC  494962

>PYIR:scaffold_883 pir_scaffold_883 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_883:1:13848:1 
REF
Length=13848

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 32/39 (82%), Gaps = 0/39 (0%)
 Strand=Plus/Minus

Query  142    GAGGAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGAC  180
              || ||| ||||||||||||| | ||||| |||  |||||
Sbjct  10029  GAAGAGAAGGGCATCAAGACCACCGCCGCCGTGCCGGAC  9991

>PYIR:scaffold_871 pir_scaffold_871 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_871:1:14137:1 
REF
Length=14137

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  349   GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGC  402
             || || |||||||| |||  |||||||  || ||||  |  | |||||||||||
Sbjct  8587  GGCCCTTGCGAGGTCTGGTGCGACGACAACATGGTCCAGCAGAACATGAACTGC  8640

>PYAR:scaffold_674 par_scaffold_674 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_674:1:14611:1 
REF
Length=14611

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  349   GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGTCATGTCGGACATGAACTGC  402
             || ||||| ||| | ||||||||||||  ||||||| | || | ||   |||||
Sbjct  7456  GGGCCGTGTGAGATCTGGCTCGACGACACCAAGGTCGTCTCAGCCACCGACTGC  7403

>SADI:scaffold_109 supercont1.109 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.109:1:154980:1 
REF
Length=154980

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  366     GCTCGACGACCTCAAGGTCATGTCGG  391
               |||||||||||||| |||||| ||||
Sbjct  103971  GCTCGACGACCTCACGGTCATCTCGG  103946

>PYVX:scaffold_183 pve_scaffold_183 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_183:1:40851:1 
REF
Length=40851

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  49     GTTGCCGTCCACGCGCAGCACAAGGTGCTGT  79
              || |||||||||||||||  ||| |||||||
Sbjct  36847  GTCGCCGTCCACGCGCAGTGCAACGTGCTGT  36877

>PYIR:scaffold_3497 pir_scaffold_3497 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_3497:1:1521:1 
REF
Length=1521

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 53/73 (73%), Gaps = 6/73 (8%)
 Strand=Plus/Minus

Query  349  GGACCGTGCGAGGTGTGGCTCGACGAC---CTCAAGGTCATGTCGGACATGAACTGCCAC  405
            || |||||||||||||||  |||||||   |||  | |||   || ||   ||||||  |
Sbjct  900  GGTCCGTGCGAGGTGTGGTGCGACGACGCGCTCGCGTTCA---CGAACGACAACTGCGCC  844

Query  406  ACAAAGTACCCCG  418
            | ||| |||||||
Sbjct  843  AAAAACTACCCCG  831

>PHPA:scaffold_5 NW_008648991.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.5, whole genome shotgun 
sequence
Length=2147012

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 56/78 (72%), Gaps = 6/78 (8%)
 Strand=Plus/Plus

Query  460      TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACG---AGACGTACTCGTGG  516
                |||||| | || |  |||||||| |   ||||||   || |||   |||||||||   ||
Sbjct  1016458  TGCATGTTCCGATTCTACTGGCTGGCGCTCCAGCGTCTGGACGGCAAGACGTACT---GG  1016514

Query  517      CAGGTGTACAAGGTCTGC  534
                |||||||| |||  ||||
Sbjct  1016515  CAGGTGTATAAGAACTGC  1016532

>APAS:scaffold_10 supercont1.10 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.10:1:1517454:1 
REF
Length=1517454

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  603     ACCAACGACCGCCGAAGCCCCAGGAA  628
               ||| ||||||||||| ||||||||||
Sbjct  535703  ACCGACGACCGCCGACGCCCCAGGAA  535728

>SAPA:scaffold_82 supercont2.82 dna:supercontig supercontig:ASM15154v2:supercont2.82:1:147639:1 
REF
Length=147639

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  156    CAAGACGAGCGCCGACGTCTCGG  178
              |||||||||||| ||||||||||
Sbjct  39911  CAAGACGAGCGCGGACGTCTCGG  39933

>SAPA:scaffold_56 supercont2.56 dna:supercontig supercontig:ASM15154v2:supercont2.56:1:239031:1 
REF
Length=239031

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 27/30 (90%), Gaps = 1/30 (3%)
 Strand=Plus/Plus

Query  350     GACCGTGCGAGGTGTGGCTCGACGACCTCA  379
               |||||||| ||||||||||| | |||||||
Sbjct  100862  GACCGTGC-AGGTGTGGCTCAAGGACCTCA  100890

>SAPA:scaffold_44 supercont2.44 dna:supercontig supercontig:ASM15154v2:supercont2.44:1:280942:1 
REF
Length=280942

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  353     CGTGCGAGGTGTGGCTCGACGAC  375
               |||||||||||||||| ||||||
Sbjct  208110  CGTGCGAGGTGTGGCTGGACGAC  208132

>PYVX:scaffold_408 pve_scaffold_408 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_408:1:26060:1 
REF
Length=26060

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  481   CTCGGCATCCAGCCCGTGAACGAGACGT  508
             |||||  ||||||||||||||||| |||
Sbjct  4168  CTCGGTCTCCAGCCCGTGAACGAGCCGT  4141

>PYVX:scaffold_208 pve_scaffold_208 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_208:1:38328:1 
REF
Length=38328

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  504   GACGTACTCGTGGCAGGTGTACA  526
             |||||||||||||| ||||||||
Sbjct  4123  GACGTACTCGTGGCCGGTGTACA  4101

>PYVX:scaffold_86 pve_scaffold_86 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_86:1:58034:1 
REF
Length=58034

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  511    TCGTGGCAGGTGTACAAGGTCTGCGTGT  538
              |||||||||||||||||| | | |||||
Sbjct  32890  TCGTGGCAGGTGTACAAGATGTTCGTGT  32863

>PYUU:scaffold_2027 scf1117875582027 dna:supercontig supercontig:pug:scf1117875582027:1:666937:1 
REF
Length=666937

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  243     CGTGAACCCGGATGCGCTCGACG  265
               || ||||||||||||||||||||
Sbjct  469872  CGCGAACCCGGATGCGCTCGACG  469850

>PYAR:scaffold_538 par_scaffold_538 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_538:1:16757:1 
REF
Length=16757

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  475    TACTGGCTCGGCATCCAGCCCGTGAACGAGACG  507
              ||||||||||||| |  || ||||||| |||||
Sbjct  11989  TACTGGCTCGGCAGCTCGCTCGTGAACCAGACG  11957

>PYAR:scaffold_320 par_scaffold_320 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_320:1:21270:1 
REF
Length=21270

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  481   CTCGGCATCCAGCCCGTGAACGAGACGT  508
             |||||  ||||||||||||||||| |||
Sbjct  6208  CTCGGGCTCCAGCCCGTGAACGAGCCGT  6181

>PYAP:scaffold_1272 pag1_scaffold_1272 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_1272:1:4976:1 
REF
Length=4976

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  99    CGTCGACGGCGATGAAGCCCAGTCGGCC  126
             |||||||||||| ||||| | |||||||
Sbjct  2310  CGTCGACGGCGAGGAAGCACCGTCGGCC  2337

>PHRA:scaffold_109
Length=149230

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  145    GAGCAGGGCATCAAGACGAGCGCCGACG  172
              || |||||||||||||||||||  ||||
Sbjct  64439  GACCAGGGCATCAAGACGAGCGAGGACG  64466

>PHRA:scaffold_7
Length=787762

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  492     GCCCGTGAACGAGACGTACTCGTGGCAGGTGTA  524
               ||||||||||||| ||||| ||| || | ||||
Sbjct  650988  GCCCGTGAACGAGTCGTACCCGTTGCCGTTGTA  651020

>PHKE:scaffold_354 scf_22126_354.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_354.1_contig_1:1:38044:1 
REF
Length=38044

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 69/96 (72%), Gaps = 4/96 (4%)
 Strand=Plus/Plus

Query  436    GACTACAGCTCGTGCAAGGGATCG-TGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCC  494
              ||||||||| |||||  ||||  | |||||  ||   ||||| ||| | ||  | | || 
Sbjct  14701  GACTACAGCGCGTGCG-GGGACAGCTGCATCTTGTACTGGTATTGGTTGGGAGTGC-GCA  14758

Query  495    CG-TGAACGAGACGTACTCGTGGCAGGTGTACAAGG  529
               | |||| |   |||||||||||||| | |||||||
Sbjct  14759  AGCTGAAGGGTTCGTACTCGTGGCAGATATACAAGG  14794

>PHIF:NW_003303752.1 Phytophthora infestans T30-4 supercont1.7 
genomic scaffold, whole genome shotgun sequence
Length=4595942

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  317      ACGCCTTCATCTCCACGGGGTAC  339
                |||||||||||||||||||| ||
Sbjct  3737111  ACGCCTTCATCTCCACGGGGGAC  3737089

>SAPA:scaffold_219 supercont2.219 dna:supercontig supercontig:ASM15154v2:supercont2.219:1:48557:1 
REF
Length=48557

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Minus

Query  458    CGTGCATGCTGCGGTGGTACTGGCTCG  484
              ||||||||||||||| ||||| |||||
Sbjct  11130  CGTGCATGCTGCGGTCGTACT-GCTCG  11105

>SAPA:scaffold_97 supercont2.97 dna:supercontig supercontig:ASM15154v2:supercont2.97:1:123216:1 
REF
Length=123216

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 30/36 (83%), Gaps = 3/36 (8%)
 Strand=Plus/Plus

Query  256    GCGCTCGACGAGTGCGGGTACAC---GGACCCGACG  288
              ||| ||||||||||| || ||||   ||||||||||
Sbjct  14356  GCGATCGACGAGTGCCGGCACACGATGGACCCGACG  14391

>SAPA:scaffold_6 supercont2.6 dna:supercontig supercontig:ASM15154v2:supercont2.6:1:961754:1 
REF
Length=961754

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 28/32 (88%), Gaps = 1/32 (3%)
 Strand=Plus/Minus

Query  457     TCGTGCATGCTGCGGTGGTACTGGCTCGGCAT  488
               ||| ||| || || ||||||||||||||||||
Sbjct  127473  TCGCGCA-GCAGCCGTGGTACTGGCTCGGCAT  127443

>SAPA:scaffold_5 supercont2.5 dna:supercontig supercontig:ASM15154v2:supercont2.5:1:1129684:1 
REF
Length=1129684

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  68      ACAAGGTGCTGTACCCCGAGCCGTT  92
               ||||||||||| ||||||||| |||
Sbjct  142577  ACAAGGTGCTGCACCCCGAGCTGTT  142553

>SADI:scaffold_98 supercont1.98 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.98:1:188273:1 
REF
Length=188273

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Minus

Query  458     CGTGCATGCTGCGGTGGTACTGGCTCG  484
               ||||||||||||||| ||||| |||||
Sbjct  173721  CGTGCATGCTGCGGTCGTACT-GCTCG  173696

>SADI:scaffold_52 supercont1.52 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.52:1:383575:1 
REF
Length=383575

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  492     GCCCGTGAACGAGACGTACTCGTGG  516
               || |||||||||| |||||||||||
Sbjct  245759  GCACGTGAACGAGCCGTACTCGTGG  245735

>SADI:scaffold_32 supercont1.32 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.32:1:666220:1 
REF
Length=666220

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 28/32 (88%), Gaps = 1/32 (3%)
 Strand=Plus/Plus

Query  457     TCGTGCATGCTGCGGTGGTACTGGCTCGGCAT  488
               ||| ||| || || ||||||||||||||||||
Sbjct  546664  TCGCGCA-GCAGCCGTGGTACTGGCTCGGCAT  546694

>PYVX:scaffold_395 pve_scaffold_395 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_395:1:26612:1 
REF
Length=26612

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  468    GCGGTGGTACTGGCTCGGCATCCAGCCCGT  497
              || ||||| |||||||||||||| || |||
Sbjct  16560  GCAGTGGTTCTGGCTCGGCATCCCGCTCGT  16531

>PYVX:scaffold_305 pve_scaffold_305 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_305:1:30708:1 
REF
Length=30708

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  509    ACTCGTGGCAGGTGTACAAGGTCTGCGTGT  538
              || |||||||||||||||  | ||||||||
Sbjct  10263  ACCCGTGGCAGGTGTACAGCGACTGCGTGT  10234

>PYVX:scaffold_165 pve_scaffold_165 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_165:1:42037:1 
REF
Length=42037

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Minus

Query  62    CGCAGCACAAGGTGCTGTACCCCGAGC  88
             ||||||||||||||||||  |||||||
Sbjct  4161  CGCAGCACAAGGTGCTGT-TCCCGAGC  4136

>PYIW:scaffold_783 piw_scaffold_783 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_783:1:14176:1 
REF
Length=14176

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 38/50 (76%), Gaps = 0/50 (0%)
 Strand=Plus/Plus

Query  261    CGACGAGTGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAG  310
              || || |||||| | ||||||||||| ||||  | |||   | |||||||
Sbjct  11156  CGCCGTGTGCGGCTTCACGGACCCGAAGGTCTCGCCACGCGCCATCCCAG  11205

>PYIR:scaffold_918 pir_scaffold_918 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_918:1:13065:1 
REF
Length=13065

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 30/36 (83%), Gaps = 3/36 (8%)
 Strand=Plus/Plus

Query  137   ATCTCGAGGAGCAGGGCATCAAGACGAGCGCCGACG  172
             ||| ||| ||||||   |||| ||||||||||||||
Sbjct  4024  ATCACGACGAGCAG---ATCATGACGAGCGCCGACG  4056

>PYIR:scaffold_203 pir_scaffold_203 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_203:1:41988:1 
REF
Length=41988

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  18     CCCCACGGTGGCGCTCGCGC  37
              ||||||||||||||||||||
Sbjct  30927  CCCCACGGTGGCGCTCGCGC  30946

>PYAR:scaffold_727 par_scaffold_727 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_727:1:13990:1 
REF
Length=13990

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  128   CTGTGGCGCATCTCGAGGAG  147
             ||||||||||||||||||||
Sbjct  7158  CTGTGGCGCATCTCGAGGAG  7177

>PYAP:scaffold_23 pag1_scaffold_23 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_23:1:110862:1 
REF
Length=110862

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  536    TGTCGTTGCGTGGGAATGGCGTCCAAAGCT  565
              |||||||||||||| ||||| || || |||
Sbjct  52307  TGTCGTTGCGTGGGCATGGCCTCGAAGGCT  52278

>PHRA:scaffold_123
Length=117378

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  349    GGACCGTGCGAGGTGTGGCTCGACGACCTCAAGGT  383
              || ||||||||||| ||| | ||||||  ||||||
Sbjct  24824  GGTCCGTGCGAGGTCTGGATTGACGACACCAAGGT  24858

>PHPA:scaffold_190 NW_008649176.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.190, whole genome 
shotgun sequence
Length=44361

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  356    GCGAGGTGTGGCTCGACGAC  375
              ||||||||||||||||||||
Sbjct  41987  GCGAGGTGTGGCTCGACGAC  42006

>PHIF:NW_003303610.1 Phytophthora infestans T30-4 supercont1.149 
genomic scaffold, whole genome shotgun sequence
Length=278822

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  89      CGTTCTACCTCGTCGACGGCGATGAAGCCCAGTCG  123
               |||||||||||||| ||||  | || || ||||||
Sbjct  270250  CGTTCTACCTCGTCCACGGTTAAGATGCGCAGTCG  270216

>PHCA:scaffold_11 PHYCAscaffold_11
Length=1076090

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  509     ACTCGTGGCAGGTGTACAAGGTCTGCGTGT  538
               || |||||||||||||||  | ||||||||
Sbjct  649255  ACCCGTGGCAGGTGTACACTGACTGCGTGT  649226

>ALCA:scaffold_405 AcNc2_CONTIG_405_length_22299 dna:supercontig 
supercontig:ASM107853v1:AcNc2_CONTIG_405_length_22299:1:22299:1 
REF
Length=22299

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  433  CTCGACTACAGCTCGTGCAA  452
            ||||||||||||||||||||
Sbjct  254  CTCGACTACAGCTCGTGCAA  235

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 840781779288

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2