Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
PYIW:scaffold_7111276915016224844960.0
PYIR:scaffold_898138100443232022530.0
PYUU:scaffold_203713097831311361158415930.0
PHSO:scaffold_12802208280355813765201e-129
PHRA:scaffold_5614742714881314083863e-93
PHCA:scaffold_8410260310392813393755e-90
PYAR:scaffold_2914048145044593629e-87
PYAP:scaffold_16221848222644172992e-69
PHKE:scaffold_9870280710057312732e-62
PHIF:NW_003303697.14339674346837201971e-41
PHPA:scaffold_632539482546737291904e-40
PLHA:NW_020189861.1184174718424246821332e-24
SAPA:scaffold_244277204281644521271e-22
APAS:scaffold_127294787297702941253e-22
APIN:scaffold_203791043794002981181e-20
PYVX:scaffold_13232763801061049e-17
SADI:scaffold_417357017366091877e-12
ALLA:FR82410491399328190702e-07
ALCA:scaffold_9064576668213685e-07
PHSO:scaffold_2818928192534530.012
PYIR:scaffold_1632948029598120520.012
PYIW:scaffold_24493389342335510.042
PYUU:scaffold_201435824535828137490.15
SADI:scaffold_1736881236884029480.15
SAPA:scaffold_5415418115422141470.51
PYIW:scaffold_526141891421931470.51
PYAR:scaffold_7088911894131470.51
SADI:scaffold_101972739729523460.51
SADI:scaffold_57783307835728460.51
SADI:scaffold_2519179319183543460.51
SADI:scaffold_142907742910530460.51
PYIW:scaffold_2719608964235460.51
PYIW:scaffold_155212526857460.51
PHSO:scaffold_41613792161382837460.51
PHPA:scaffold_111488252148828737460.51
APAS:scaffold_1516424516428743460.51
SAPA:scaffold_2143791943795641451.8
SADI:scaffold_101038014103804835451.8
PYVX:scaffold_5809201923637451.8
PYVX:scaffold_125129751299925451.8
PHSO:scaffold_53897163389720240451.8
SADI:scaffold_5225154325157937441.8
SADI:scaffold_1310557910561537441.8
SADI:scaffold_1247343747346327441.8
PYVX:scaffold_9369123694332441.8
PYUU:scaffold_202555896955899022441.8
PYUU:scaffold_123966212566215127441.8
PYAR:scaffold_27143516354227441.8
PYAR:scaffold_4457700775259441.8
PYAR:scaffold_169253862542237441.8
APAS:scaffold_91341813420222441.8
SAPA:scaffold_769485969492773436.3
SADI:scaffold_185294692949224436.3
SADI:scaffold_7719688619691429436.3
PYVX:scaffold_6726312634534436.3
PYVX:scaffold_10608126084029436.3
PYUU:scaffold_201116869516872329436.3
PYIW:scaffold_13189413946250436.3
PYAR:scaffold_324862564926436.3
PYAR:scaffold_12096585661329436.3
PYAR:scaffold_10509654967724436.3
PYAR:scaffold_633138081385346436.3
PYAR:scaffold_150125841261431436.3
PHSO:scaffold_383625083629344436.3
PHPA:scaffold_6018493418495724436.3
PHKE:scaffold_1910108410112341436.3
APIN:scaffold_247148861490924436.3
APAS:scaffold_5720878720883448436.3
SAPA:scaffold_1416617216620435426.3
SAPA:scaffold_848795348798433426.3
SAPA:scaffold_478803378805321426.3
SADI:scaffold_2935913235915726426.3
SADI:scaffold_2315728815732942426.3
SADI:scaffold_1610618210620221426.3
SADI:scaffold_271276171278626426.3
PYVX:scaffold_6266225625733426.3
PYVX:scaffold_14398273986135426.3
PYUU:scaffold_20231012567101261148426.3
PYIW:scaffold_716915318331426.3
PYIW:scaffold_19415567560236426.3
PYIW:scaffold_605124271245226426.3
PYIW:scaffold_227208612088626426.3
PYIR:scaffold_413118751190531426.3
PYIR:scaffold_2307663768826426.3
PYIR:scaffold_202397253976541426.3
PYIR:scaffold_199365413657131426.3
PYAR:scaffold_4687669769426426.3
PHSO:scaffold_8138941394553426.3
PHRA:scaffold_449035049038031426.3
APAS:scaffold_131086863108689331426.3
BLASTN 2.9.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= PYIW_18793

Length=2994
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:pi...  4055       0.0   
PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_sc...  2032       0.0   
PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:p...  1437       0.0   
PHSO:scaffold_1                                                       470        1e-129
PHRA:scaffold_56                                                      349        3e-93 
PHCA:scaffold_84 PHYCAscaffold_84                                     339        5e-90 
PYAR:scaffold_29 par_scaffold_29 dna:supercontig supercontig:par_...  327        9e-87 
PYAP:scaffold_162 pag1_scaffold_162 dna:supercontig supercontig:p...  270        2e-69 
PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercon...  247        2e-62 
PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 ge...  178        1e-41 
PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 ...  172        4e-40 
PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig:...  121        2e-24 
SAPA:scaffold_24 supercont2.24 dna:supercontig supercontig:ASM151...  115        1e-22 
APAS:scaffold_12 supercont1.12 dna:supercontig supercontig:Apha_a...  113        3e-22 
APIN:scaffold_20 supercont1.20 dna:supercontig supercontig:Apha_i...  107        1e-20 
PYVX:scaffold_1323 pve_scaffold_1323 dna:supercontig supercontig:...  95.1       9e-17 
SADI:scaffold_4 supercont1.4 dna:supercontig supercontig:Sap_dicl...  79.7       7e-12 
ALLA:FR824104 dna:supercontig supercontig:ENA1:FR824104:1:105594:...  64.4       2e-07 
ALCA:scaffold_90 AcNc2_CONTIG_90_length_79489 dna:supercontig sup...  62.6       5e-07 
PHSO:scaffold_2                                                       49.1       0.012 
PYIR:scaffold_163 pir_scaffold_163 dna:supercontig supercontig:pi...  48.2       0.012 
PYIW:scaffold_2449 piw_scaffold_2449 dna:supercontig supercontig:...  47.3       0.042 
PYUU:scaffold_2014 scf1117875582014 dna:supercontig supercontig:p...  45.5       0.15  
SADI:scaffold_17 supercont1.17 dna:supercontig supercontig:Sap_di...  44.6       0.15  
SAPA:scaffold_54 supercont2.54 dna:supercontig supercontig:ASM151...  43.7       0.51  
PYIW:scaffold_526 piw_scaffold_526 dna:supercontig supercontig:pi...  43.7       0.51  
PYAR:scaffold_708 par_scaffold_708 dna:supercontig supercontig:pa...  43.7       0.51  
SADI:scaffold_101 supercont1.101 dna:supercontig supercontig:Sap_...  42.8       0.51  
SADI:scaffold_57 supercont1.57 dna:supercontig supercontig:Sap_di...  42.8       0.51  
SADI:scaffold_25 supercont1.25 dna:supercontig supercontig:Sap_di...  42.8       0.51  
SADI:scaffold_1 supercont1.1 dna:supercontig supercontig:Sap_dicl...  42.8       0.51  
PYIW:scaffold_271 piw_scaffold_271 dna:supercontig supercontig:pi...  42.8       0.51  
PYIW:scaffold_15 piw_scaffold_15 dna:supercontig supercontig:piw_...  42.8       0.51  
PHSO:scaffold_4                                                       42.8       0.51  
PHPA:scaffold_11 NW_008648997.1 Phytophthora parasitica INRA-310 ...  42.8       0.51  
APAS:scaffold_15 supercont1.15 dna:supercontig supercontig:Apha_a...  42.8       0.51  
SAPA:scaffold_21 supercont2.21 dna:supercontig supercontig:ASM151...  41.9       1.8   
SADI:scaffold_10 supercont1.10 dna:supercontig supercontig:Sap_di...  41.9       1.8   
PYVX:scaffold_580 pve_scaffold_580 dna:supercontig supercontig:pv...  41.9       1.8   
PYVX:scaffold_125 pve_scaffold_125 dna:supercontig supercontig:pv...  41.9       1.8   
PHSO:scaffold_5                                                       41.9       1.8   
SADI:scaffold_52 supercont1.52 dna:supercontig supercontig:Sap_di...  41.0       1.8   
SADI:scaffold_13 supercont1.13 dna:supercontig supercontig:Sap_di...  41.0       1.8   
SADI:scaffold_12 supercont1.12 dna:supercontig supercontig:Sap_di...  41.0       1.8   
PYVX:scaffold_9 pve_scaffold_9 dna:supercontig supercontig:pve_sc...  41.0       1.8   
PYUU:scaffold_2025 scf1117875582025 dna:supercontig supercontig:p...  41.0       1.8   
PYUU:scaffold_1239 scf1117875581239 dna:supercontig supercontig:p...  41.0       1.8   
PYAR:scaffold_2714 par_scaffold_2714 dna:supercontig supercontig:...  41.0       1.8   
PYAR:scaffold_445 par_scaffold_445 dna:supercontig supercontig:pa...  41.0       1.8   
PYAR:scaffold_169 par_scaffold_169 dna:supercontig supercontig:pa...  41.0       1.8   
APAS:scaffold_91 supercont1.91 dna:supercontig supercontig:Apha_a...  41.0       1.8   
SAPA:scaffold_7 supercont2.7 dna:supercontig supercontig:ASM15154...  40.1       6.3   
SADI:scaffold_185 supercont1.185 dna:supercontig supercontig:Sap_...  40.1       6.3   
SADI:scaffold_77 supercont1.77 dna:supercontig supercontig:Sap_di...  40.1       6.3   
PYVX:scaffold_672 pve_scaffold_672 dna:supercontig supercontig:pv...  40.1       6.3   
PYVX:scaffold_10 pve_scaffold_10 dna:supercontig supercontig:pve_...  40.1       6.3   
PYUU:scaffold_2011 scf1117875582011 dna:supercontig supercontig:p...  40.1       6.3   
PYIW:scaffold_1318 piw_scaffold_1318 dna:supercontig supercontig:...  40.1       6.3   
PYAR:scaffold_3248 par_scaffold_3248 dna:supercontig supercontig:...  40.1       6.3   
PYAR:scaffold_1209 par_scaffold_1209 dna:supercontig supercontig:...  40.1       6.3   
PYAR:scaffold_1050 par_scaffold_1050 dna:supercontig supercontig:...  40.1       6.3   
PYAR:scaffold_633 par_scaffold_633 dna:supercontig supercontig:pa...  40.1       6.3   
PYAR:scaffold_150 par_scaffold_150 dna:supercontig supercontig:pa...  40.1       6.3   
PHSO:scaffold_3                                                       40.1       6.3   
PHPA:scaffold_60 NW_008649046.1 Phytophthora parasitica INRA-310 ...  40.1       6.3   
PHKE:scaffold_19 scf_22126_19.1 dna:supercontig supercontig:PhyKe...  40.1       6.3   
APIN:scaffold_247 supercont1.247 dna:supercontig supercontig:Apha...  40.1       6.3   
APAS:scaffold_57 supercont1.57 dna:supercontig supercontig:Apha_a...  40.1       6.3   
SAPA:scaffold_14 supercont2.14 dna:supercontig supercontig:ASM151...  39.2       6.3   
SAPA:scaffold_8 supercont2.8 dna:supercontig supercontig:ASM15154...  39.2       6.3   
SAPA:scaffold_4 supercont2.4 dna:supercontig supercontig:ASM15154...  39.2       6.3   
SADI:scaffold_29 supercont1.29 dna:supercontig supercontig:Sap_di...  39.2       6.3   
SADI:scaffold_23 supercont1.23 dna:supercontig supercontig:Sap_di...  39.2       6.3   
SADI:scaffold_16 supercont1.16 dna:supercontig supercontig:Sap_di...  39.2       6.3   
SADI:scaffold_2 supercont1.2 dna:supercontig supercontig:Sap_dicl...  39.2       6.3   
PYVX:scaffold_626 pve_scaffold_626 dna:supercontig supercontig:pv...  39.2       6.3   
PYVX:scaffold_14 pve_scaffold_14 dna:supercontig supercontig:pve_...  39.2       6.3   
PYUU:scaffold_2023 scf1117875582023 dna:supercontig supercontig:p...  39.2       6.3   
PYIW:scaffold_7169 piw_scaffold_7169 dna:supercontig supercontig:...  39.2       6.3   
PYIW:scaffold_1941 piw_scaffold_1941 dna:supercontig supercontig:...  39.2       6.3   
PYIW:scaffold_605 piw_scaffold_605 dna:supercontig supercontig:pi...  39.2       6.3   
PYIW:scaffold_227 piw_scaffold_227 dna:supercontig supercontig:pi...  39.2       6.3   
PYIR:scaffold_413 pir_scaffold_413 dna:supercontig supercontig:pi...  39.2       6.3   
PYIR:scaffold_230 pir_scaffold_230 dna:supercontig supercontig:pi...  39.2       6.3   
PYIR:scaffold_202 pir_scaffold_202 dna:supercontig supercontig:pi...  39.2       6.3   
PYIR:scaffold_199 pir_scaffold_199 dna:supercontig supercontig:pi...  39.2       6.3   
PYAR:scaffold_468 par_scaffold_468 dna:supercontig supercontig:pa...  39.2       6.3   
PHSO:scaffold_8                                                       39.2       6.3   
PHRA:scaffold_4                                                       39.2       6.3   
APAS:scaffold_13 supercont1.13 dna:supercontig supercontig:Apha_a...  39.2       6.3   

>PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_711:1:15030:1 
REF
Length=15030

 Score = 4055 bits (4496),  Expect = 0.0
 Identities = 2248/2248 (100%), Gaps = 0/2248 (0%)
 Strand=Plus/Minus

Query  1      ATGGCGCAGCACGCGCGGCTTCTGCCGAGCGTCAACAAGTGCGACCCAAGCGCGCCGACG  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  15016  ATGGCGCAGCACGCGCGGCTTCTGCCGAGCGTCAACAAGTGCGACCCAAGCGCGCCGACG  14957

Query  61     CCCGAGCTCTCGGAGCAGGACGCGAAGAACGGCATGCTCAGCCTCGTGAACCGGGGCTTC  120
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14956  CCCGAGCTCTCGGAGCAGGACGCGAAGAACGGCATGCTCAGCCTCGTGAACCGGGGCTTC  14897

Query  121    TTGCCCGTGGGGACCGACCTCACGTCCGCGTTCGTCAACAGCCACGGAGGCATAATCCAG  180
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14896  TTGCCCGTGGGGACCGACCTCACGTCCGCGTTCGTCAACAGCCACGGAGGCATAATCCAG  14837

Query  181    AACCACAAGACACGCATCTACGACCGCCAGGAACAGCCGATCCGGGCCGTGCCGCACACT  240
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14836  AACCACAAGACACGCATCTACGACCGCCAGGAACAGCCGATCCGGGCCGTGCCGCACACT  14777

Query  241    AATCCGTCGGGCTTCAACATCGCGACCTTGAAGTTCGACCTCGCCGCCACTGCCGAGTGC  300
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14776  AATCCGTCGGGCTTCAACATCGCGACCTTGAAGTTCGACCTCGCCGCCACTGCCGAGTGC  14717

Query  301    CGAGAGGGCGATGGCTCGGACTCGCCCTCGCAACACAAAGCCGCCCTGGCTGTTGTAAAC  360
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14716  CGAGAGGGCGATGGCTCGGACTCGCCCTCGCAACACAAAGCCGCCCTGGCTGTTGTAAAC  14657

Query  361    GGATCACAACTGGATCACGACAGCGCCGAAACGCGTGCTCGTGGCCCAAATGTACTCACT  420
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14656  GGATCACAACTGGATCACGACAGCGCCGAAACGCGTGCTCGTGGCCCAAATGTACTCACT  14597

Query  421    GTGAGCTTCCAAGGCGACGCCCGTCGAGGCAACTTTCACGCCACGGTCAGATCAGCACAG  480
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14596  GTGAGCTTCCAAGGCGACGCCCGTCGAGGCAACTTTCACGCCACGGTCAGATCAGCACAG  14537

Query  481    CAGCAGCATTCTGGAATCCGCCACCACGCGTCAGCGAACCAGGAGGCCGAGAGCCCCGAG  540
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14536  CAGCAGCATTCTGGAATCCGCCACCACGCGTCAGCGAACCAGGAGGCCGAGAGCCCCGAG  14477

Query  541    ACGAATGTGGACGAAGACCTCATGTACGACGAGAAGGACGACGACGCGAACGCCATGGAC  600
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14476  ACGAATGTGGACGAAGACCTCATGTACGACGAGAAGGACGACGACGCGAACGCCATGGAC  14417

Query  601    GAGTTGCGCAAGAATGTCGAGAAGATCCGCGGGTACAACGAGCTGCTGGACACGTACAGT  660
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14416  GAGTTGCGCAAGAATGTCGAGAAGATCCGCGGGTACAACGAGCTGCTGGACACGTACAGT  14357

Query  661    CTCCACCAGTTCATCATCCACAAAGGCCGCGCGATGCGCGAGACGCCTGAGTTTGTGTCC  720
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14356  CTCCACCAGTTCATCATCCACAAAGGCCGCGCGATGCGCGAGACGCCTGAGTTTGTGTCC  14297

Query  721    TTCAAGCGCGTGGCGCAGGAGGTTTGGGGCAGCGTCGATGAAGTGATCAAGGCACTCGAG  780
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14296  TTCAAGCGCGTGGCGCAGGAGGTTTGGGGCAGCGTCGATGAAGTGATCAAGGCACTCGAG  14237

Query  781    GCGCTGCTCACGCGCTACTTCGTGCCTCTCGCGTACGTCGACGGCCAGCGACTCATGACG  840
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14236  GCGCTGCTCACGCGCTACTTCGTGCCTCTCGCGTACGTCGACGGCCAGCGACTCATGACG  14177

Query  841    GTCGCGGCGATGGAGATGGCGTCCTACAGCAAGCGGGACCTGCTCTCGTGCATCGTCAAC  900
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14176  GTCGCGGCGATGGAGATGGCGTCCTACAGCAAGCGGGACCTGCTCTCGTGCATCGTCAAC  14117

Query  901    GAGGACCAGGTCGGGTCGCTCATCCGGCGACCGGGCCAGCGCTACAAAGGCAAGGACCGC  960
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14116  GAGGACCAGGTCGGGTCGCTCATCCGGCGACCGGGCCAGCGCTACAAAGGCAAGGACCGC  14057

Query  961    AAGCGCCGCGCAGCCGTGACGATTCAGAACTTCTTCCGCATGTGGTGGAACCAGAAGAAG  1020
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  14056  AAGCGCCGCGCAGCCGTGACGATTCAGAACTTCTTCCGCATGTGGTGGAACCAGAAGAAG  13997

Query  1021   TACAGTCGCTTCCGCCACCACCTCGCGAGCGTCGTGGCCATTCAACGCGTCTGGCGCGTG  1080
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13996  TACAGTCGCTTCCGCCACCACCTCGCGAGCGTCGTGGCCATTCAACGCGTCTGGCGCGTG  13937

Query  1081   TATGCGAGCCACGATGACCTCAAGCGCAGGATCAAGAGCCAGCGAGATCAGCAGCACGCG  1140
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13936  TATGCGAGCCACGATGACCTCAAGCGCAGGATCAAGAGCCAGCGAGATCAGCAGCACGCG  13877

Query  1141   CAGTGGGAAGCCAAGATGCAACGGCTCAAGCGCGACTGGATACGCATCAAAGGCAACCGC  1200
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13876  CAGTGGGAAGCCAAGATGCAACGGCTCAAGCGCGACTGGATACGCATCAAAGGCAACCGC  13817

Query  1201   CGCGTGGTCATTCACGTGCCATCCTTCTCAGTTGACGAACGCTTGCGTCTCAGCGCCGAC  1260
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13816  CGCGTGGTCATTCACGTGCCATCCTTCTCAGTTGACGAACGCTTGCGTCTCAGCGCCGAC  13757

Query  1261   AATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCCTCGTCGACTCGAAC  1320
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13756  AATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCCTCGTCGACTCGAAC  13697

Query  1321   GTAGACATTGTCTATGTCTCACCCTTTGAGCTCACGACGGACGTGGTGCAATACTCAATG  1380
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13696  GTAGACATTGTCTATGTCTCACCCTTTGAGCTCACGACGGACGTGGTGCAATACTCAATG  13637

Query  1381   AAGCTTCTACAGCTTGGCGGCATCGCCGACCCCGTCGCTCGCGTGAAGCTCGTCTTTCCC  1440
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13636  AAGCTTCTACAGCTTGGCGGCATCGCCGACCCCGTCGCTCGCGTGAAGCTCGTCTTTCCC  13577

Query  1441   GAGCATGCACCGCGGTTCCCGACACACTTCTCGCTCACGACGCTCTTGCTGTATTCCCCA  1500
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13576  GAGCATGCACCGCGGTTCCCGACACACTTCTCGCTCACGACGCTCTTGCTGTATTCCCCA  13517

Query  1501   CACTGTCTTCGCCGTATCCAGCGGTACATCAAGAACAAGGAGGCGTACCTGGTCACGGGC  1560
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13516  CACTGTCTTCGCCGTATCCAGCGGTACATCAAGAACAAGGAGGCGTACCTGGTCACGGGC  13457

Query  1561   ATGCCCGGTCCAGAGGATAAGCGTCTCGCCATGGCGCTCAATGTGCCGATCCTCGGTATG  1620
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13456  ATGCCCGGTCCAGAGGATAAGCGTCTCGCCATGGCGCTCAATGTGCCGATCCTCGGTATG  13397

Query  1621   GATCCGCTCAGCGCCCTGCCACTCATGACCAAGTCTGGTGGCAAGCGCTTCTTCATGCGC  1680
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13396  GATCCGCTCAGCGCCCTGCCACTCATGACCAAGTCTGGTGGCAAGCGCTTCTTCATGCGC  13337

Query  1681   GCCGACGTGAATGTGCCCACGGGCACGTACGACATTTACGACGAGGACGAGCTCGTGTTC  1740
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13336  GCCGACGTGAATGTGCCCACGGGCACGTACGACATTTACGACGAGGACGAGCTCGTGTTC  13277

Query  1741   TCGCTCGCCAAGCTCATCGTCTCGCACATTGAGCAGAGCGTGTGGGTGCTCAAGATCGAC  1800
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13276  TCGCTCGCCAAGCTCATCGTCTCGCACATTGAGCAGAGCGTGTGGGTGCTCAAGATCGAC  13217

Query  1801   TATGACCCGTTCAGCACAGGCACAGCGCTGCTTGACGTCTCAACCATGGTGGCACTGCGT  1860
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13216  TATGACCCGTTCAGCACAGGCACAGCGCTGCTTGACGTCTCAACCATGGTGGCACTGCGT  13157

Query  1861   GAGATTCGACGCGAGAAGAGAAGTCCCGAGTACTGGAGGCAGCCTGGGACGCGAGACAAC  1920
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13156  GAGATTCGACGCGAGAAGAGAAGTCCCGAGTACTGGAGGCAGCCTGGGACGCGAGACAAC  13097

Query  1921   GCCGCGCGCGTGATCATCGCCGAGCTGGAGCGGACGCTGGGTAATCTCGTCACGCCGCTG  1980
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13096  GCCGCGCGCGTGATCATCGCCGAGCTGGAGCGGACGCTGGGTAATCTCGTCACGCCGCTG  13037

Query  1981   CATCCAGAGCTGTATCCAAGTTGGCAGGACTATGCAGACGCGATCGTGCAGTTTGGTGTC  2040
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  13036  CATCCAGAGCTGTATCCAAGTTGGCAGGACTATGCAGACGCGATCGTGCAGTTTGGTGTC  12977

Query  2041   GTCGTGGAGGCCGCTCCAAGTGCAGTCGTTGGCCACGTGCGTGCAAATCTGTTTGTCGAG  2100
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12976  GTCGTGGAGGCCGCTCCAAGTGCAGTCGTTGGCCACGTGCGTGCAAATCTGTTTGTCGAG  12917

Query  2101   CCCAGTGGCGAGGTGCATGTCTCGTCGACGCAGGACATCCTCCTGAGCAGCAGCGGAGGG  2160
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12916  CCCAGTGGCGAGGTGCATGTCTCGTCGACGCAGGACATCCTCCTGAGCAGCAGCGGAGGG  12857

Query  2161   TGCGGAGGGAAACCTGGTGGGGCGTACAGACACAAGTCGGTCGGGTATGCGTTTCCTCAG  2220
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12856  TGCGGAGGGAAACCTGGTGGGGCGTACAGACACAAGTCGGTCGGGTATGCGTTTCCTCAG  12797

Query  2221   ACTGCAGCGCCGTACGAAGCCATTCGGG  2248
              ||||||||||||||||||||||||||||
Sbjct  12796  ACTGCAGCGCCGTACGAAGCCATTCGGG  12769

 Score = 1350 bits (1496),  Expect = 0.0
 Identities = 748/748 (100%), Gaps = 0/748 (0%)
 Strand=Plus/Minus

Query  2247   GGGTGCGTCGACCGCAATCGGAAAGCTCCTGGCTGAAGACAACGTGTTTGGCTACGCGAG  2306
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12685  GGGTGCGTCGACCGCAATCGGAAAGCTCCTGGCTGAAGACAACGTGTTTGGCTACGCGAG  12626

Query  2307   CATCGACTTTCTGGTGTTCCAGGAAGACAAGTCGCACACGGCGCGGCTCTGGGCCATGGC  2366
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12625  CATCGACTTTCTGGTGTTCCAGGAAGACAAGTCGCACACGGCGCGGCTCTGGGCCATGGC  12566

Query  2367   ACTGCGTCCGTACTTGACAGACTCGGCCGCGACCTTCACGACATTCCATTTGCTCAACCG  2426
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12565  ACTGCGTCCGTACTTGACAGACTCGGCCGCGACCTTCACGACATTCCATTTGCTCAACCG  12506

Query  2427   CGGCGCTTTGAACACAACCTCGGGTCTGTATTACCTCCCAGCAGCCACGGTGACGTCTGC  2486
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12505  CGGCGCTTTGAACACAACCTCGGGTCTGTATTACCTCCCAGCAGCCACGGTGACGTCTGC  12446

Query  2487   TTCGTTAGTCCAACTCCAATCCAGCAGTGCAGCCTTCGCCAGCGGGGCGTCGGCAGCAGA  2546
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12445  TTCGTTAGTCCAACTCCAATCCAGCAGTGCAGCCTTCGCCAGCGGGGCGTCGGCAGCAGA  12386

Query  2547   TCTCGTGCTGCACGAGGCGACGCACTCGGGACTCGTGTCCCTCGAGAAGGTTGGCGCTCA  2606
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12385  TCTCGTGCTGCACGAGGCGACGCACTCGGGACTCGTGTCCCTCGAGAAGGTTGGCGCTCA  12326

Query  2607   GCACACGTACGTTGTAAGCGAGTACATCTTCCACCCGAACGTGTCGACCATGCAGTACAG  2666
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12325  GCACACGTACGTTGTAAGCGAGTACATCTTCCACCCGAACGTGTCGACCATGCAGTACAG  12266

Query  2667   CGCCTTCTTCCACACCTGTCGGCTGCACGGCGTCTGCTTCGACGTGGAGCGCTGTGTGGG  2726
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12265  CGCCTTCTTCCACACCTGTCGGCTGCACGGCGTCTGCTTCGACGTGGAGCGCTGTGTGGG  12206

Query  2727   CTCGGTCTTTCTCCTTGCCGACAGCCTCACGGCCGGTGTCTTCGGCCTCATGTGCTGCAG  2786
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12205  CTCGGTCTTTCTCCTTGCCGACAGCCTCACGGCCGGTGTCTTCGGCCTCATGTGCTGCAG  12146

Query  2787   CGACACGGCGAGCGGCGCGCTGGGCTTTCTACGCACAGCGCTGGAAGTGGTCGGCCGGGA  2846
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12145  CGACACGGCGAGCGGCGCGCTGGGCTTTCTACGCACAGCGCTGGAAGTGGTCGGCCGGGA  12086

Query  2847   GGTGGGCACCCAGGCGCTCACGGACGAGTTCACGAGCGGCGGCGAAGCGGAAACGGGCAA  2906
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12085  GGTGGGCACCCAGGCGCTCACGGACGAGTTCACGAGCGGCGGCGAAGCGGAAACGGGCAA  12026

Query  2907   CTTCGCGGACGTACTGGCTGCGATTCGCGCATTGACGGGCGGCAAGTCAGCCAAGCTGGA  2966
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12025  CTTCGCGGACGTACTGGCTGCGATTCGCGCATTGACGGGCGGCAAGTCAGCCAAGCTGGA  11966

Query  2967   GAAGATCCGGCGCCTGCGCAGGAACTGA  2994
              ||||||||||||||||||||||||||||
Sbjct  11965  GAAGATCCGGCGCCTGCGCAGGAACTGA  11938

>PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_8:1:111390:1 
REF
Length=111390

 Score = 2032 bits (2253),  Expect = 0.0
 Identities = 1842/2320 (79%), Gaps = 88/2320 (4%)
 Strand=Plus/Minus

Query  1       ATGGCGCAGCACGCGCGGCTTCTGCCGAGCGTCAACAAGTGCGACCCAAGCGCGCCGACG  60
               ||||| ||| ||||||| || ||||||||||||||||| |  ||||| ||||| || |||
Sbjct  100443  ATGGCACAGAACGCGCGCCTGCTGCCGAGCGTCAACAAATCTGACCCGAGCGCCCCCACG  100384

Query  61      CCCGAGCTCTCGGAGCAGGACGCGAAGAACGGCATGCTCAGCCTCGTGAACCGGGGCTTC  120
               ||||||||||||||||||||||| || | |||||||||||||||||||||||| ||||||
Sbjct  100383  CCCGAGCTCTCGGAGCAGGACGCCAAAAGCGGCATGCTCAGCCTCGTGAACCGCGGCTTC  100324

Query  121     TTGCCCGTGGGGACCGACCTCACGTCCGCGTTCGTCAACAGCCACGGAGGCATAATCCAG  180
                ||||||| ||  | ||||||||  | || ||| |||||| ||||||  |||| ||| ||
Sbjct  100323  CTGCCCGTCGGCGCGGACCTCACACCGGCATTCATCAACAACCACGGGAGCATCATCAAG  100264

Query  181     AACCACAAGACACGCATCTACGACCGCCAGGAACAGCCGATCCGGGCCGTGCCGCACACT  240
               |||  |||||| |||||||||||||||||||| || ||||||||  |  ||||   ||| 
Sbjct  100263  AACAGCAAGACGCGCATCTACGACCGCCAGGAGCAACCGATCCGCTCGATGCCATCCACG  100204

Query  241     AATCCGTCGGGCTTCAACATCGCGACCTTGAAGTTCGACCT--CGCCGCCACTGCCGAGT  298
               || |||||||| |||||| ||||| |  | ||||| ||| |  |||| |||    |||  
Sbjct  100203  AACCCGTCGGGTTTCAACGTCGCGTCGCTCAAGTTTGACATTGCGCCACCATCCACGACG  100144

Query  299     GCC-------GAGAGG---GCGATGGCTCGGACTCGCCCTCGCAACAC---AAAGCCGCC  345
               | |       |||||    || ||||||||||   ||| || | |||    | ||| || 
Sbjct  100143  GTCTCGGATAGAGAGAACAGCAATGGCTCGGA---GCCGTCACTACAGCGGACAGCGGCG  100087

Query  346     CTG--GCTGTT---GTAAACGG-------ATCACAACTGGATCA-CG-----------AC  381
                 |  || |||   || || ||       ||| | ||||  ||  ||           ||
Sbjct  100086  GCGACGCAGTTTGTGTCAAAGGGGGGGTCATCGCTACTGAGTCCTCGTCAGTATGAGAAC  100027

Query  382     AGCGCCGAAACGCGTGCTCGTGGCCCAAATGTACTCACTGTGAGCTTCCAAGGCGACGCC  441
               || ||  |   |||  |||| ||  | || ||  ||||||||| |||||| ||||| || 
Sbjct  100026  AGTGCTAATGTGCGCTCTCGCGGAGCGAAGGTGGTCACTGTGAACTTCCAGGGCGATGCG  99967

Query  442     CGTCGAGGCAACTTTCACGCCACGGTCAGATCAGC-ACAGCAGCAGC-ATTCTGGAATCC  499
                 |||||||||||| || ||| ||||  | || |  |||||||| || || ||   | | 
Sbjct  99966   GTTCGAGGCAACTTGCAAGCCTCGGTGGGCTCCGTGACAGCAGCGGCGATGCTCTCAACG  99907

Query  500     GCCACCACGCGTCAGCGAACCAGGAGGCCGAGAGCCCCGAGACGAATGTGGACGAAGACC  559
               |  ||||         || |||||| ||||||||||||||||||||  ||||||| ||  
Sbjct  99906   G--ACCA---------GAGCCAGGAAGCCGAGAGCCCCGAGACGAACTTGGACGACGAAG  99858

Query  560     TCATGTACG------------------ACGAGAAGGACGACGACGCGAACGCCATGGACG  601
               |||  | ||                  ||||  |  | |||||| ||| |||||||||||
Sbjct  99857   TCAACTCCGGTGGCAATGATAATGCTGACGACGACAATGACGACACGAGCGCCATGGACG  99798

Query  602     AGTTGCGCAAGAATGTCGAGAAGATCCGCGGGTACAACGAGCTGCTGGACACGTACAGTC  661
               ||||||||||||| || ||||||||||||||||| |||||||| ||||||||||||||||
Sbjct  99797   AGTTGCGCAAGAACGTGGAGAAGATCCGCGGGTATAACGAGCTCCTGGACACGTACAGTC  99738

Query  662     TCCACCAGTTCATCATCCACAAAGGCCGCGCGATGCGCGAGACGCCTGAGTTTGTGTCCT  721
               | || ||||||||||| ||||| || || ||||||||||||||||| ||||| ||||| |
Sbjct  99737   TGCATCAGTTCATCATTCACAAGGGTCGGGCGATGCGCGAGACGCCCGAGTTCGTGTCGT  99678

Query  722     TCAAGCGCGTGGCGCAGGAGGTTTGGGGCAGCGTCGATGAAGTGATCAAGGCACTCGAGG  781
               ||||||||||||||||||| || ||||| |||||||| || ||||||| ||| || ||||
Sbjct  99677   TCAAGCGCGTGGCGCAGGAAGTCTGGGGGAGCGTCGAGGAGGTGATCAGGGCCCTTGAGG  99618

Query  782     CGCTGCTCACGCGCTACTTCGTGCCTCTCGCGTACGTCGACGGCCAGCGACTCATGACGG  841
               ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||
Sbjct  99617   CGCTGCTCACGCGCTACTTCGTGCCACTCGCGTACATCGACGGCCAGCGACTCATGACGG  99558

Query  842     TCGCGGCGATGGAGATGGCGTCCTACAGCAAGCGGGACCTGCTCTCGTGCATCGTCAACG  901
               |||||||||||||||||||| | | ||||||||| ||| |||||||||||||||| ||||
Sbjct  99557   TCGCGGCGATGGAGATGGCGGCGTTCAGCAAGCGCGACTTGCTCTCGTGCATCGTGAACG  99498

Query  902     AGGACCAGGTCGGGTCGCTCATCCGGCGACCGGGCCAGCGCTACAAAGGCAAGGACCGCA  961
               | ||||||||||| ||||| ||||| || || || ||||| ||||| ||||| |||||||
Sbjct  99497   AAGACCAGGTCGGCTCGCTTATCCGACGCCCCGGACAGCGGTACAAGGGCAAAGACCGCA  99438

Query  962     AGCGCCGCGCAGCCGTGACGATTCAGAACTTCTTCCGCATGTGGTGGAACCAGAAGAAGT  1021
               |||||||||| ||  | ||||| || ||||||||||||||||||||||| ||||||||||
Sbjct  99437   AGCGCCGCGCCGCGATCACGATCCAAAACTTCTTCCGCATGTGGTGGAATCAGAAGAAGT  99378

Query  1022    ACAGTCGCTTCCGCCACCACCTCGCGAGCGTCGTGGCCATTCAACGCGTCTGGCGCGTGT  1081
               |||  |||||||||||||| ||||| ||||| ||| |||| || || || ||||||| ||
Sbjct  99377   ACACCCGCTTCCGCCACCATCTCGCAAGCGTTGTGACCATCCAGCGGGTATGGCGCGCGT  99318

Query  1082    ATGCGAGCCACGATGACCTCAAGCGCAGGATCAAGAGCCAGCGAGATCAGCAGCACGCGC  1141
                 |||||||||||   ||||||||||| | |||||  |||||| |  |||||||||| ||
Sbjct  99317   TCGCGAGCCACGAAAGCCTCAAGCGCAAGCTCAAGTTCCAGCGCGCGCAGCAGCACGAGC  99258

Query  1142    AGTGGGAAGCCAAGATGCAACGGCTCAAGCGCGACTGGATACGCATCAAAGGCAACCGCC  1201
               | ||||| ||||||||||| || ||||||||||||||||  |  ||||| || || ||||
Sbjct  99257   AATGGGAGGCCAAGATGCAGCGCCTCAAGCGCGACTGGACGCATATCAAGGGGAATCGCC  99198

Query  1202    GCGTGGTCATTCACGTGCCATCCTTCTCAGTTGACGAACGCTTGCGTCTCAGCGCCGACA  1261
               |||||||||| |||||||| ||  ||||  ||||||| || |  ||  ||||||||||||
Sbjct  99197   GCGTGGTCATCCACGTGCCGTCGCTCTCGATTGACGAGCGGTCTCGCATCAGCGCCGACA  99138

Query  1262    ATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCCTCGTCGACTCGAACG  1321
               |||||||||||||||||||| ||||||| ||||| |||||||| ||  ||||| | ||||
Sbjct  99137   ATTTCTCGGTCAAGCAGAATATCCAGCTCTCGCGGCTCTGCGGACTTATCGACCCAAACG  99078

Query  1322    TAGACATTGTCTATGTCTCACCCTTTGAGCTCACGACGGACGTGGTGCAATACTCAATGA  1381
               | ||||||||||| ||||| ||||||||||||||| | ||||||| ||| ||||| ||||
Sbjct  99077   TCGACATTGTCTACGTCTCGCCCTTTGAGCTCACGGCCGACGTGGCGCAGTACTCGATGA  99018

Query  1382    AGCTTCTACAGCTTGGCGGCATCGCCGACCCCGTCGCTCGCGTGAAGCTCGTCTTTCCCG  1441
               || | || |||||||| || || || ||||||||||| |||||||| ||||| | ||| |
Sbjct  99017   AGTTGCTGCAGCTTGGAGGGATTGCGGACCCCGTCGCGCGCGTGAAACTCGTGTATCCTG  98958

Query  1442    AGCATGCACCGCGGTTCCCGACACACTTCTCGCTCACGACGCTCTTGCTGTATTCCCCAC  1501
               |||| ||  ||||||||||  | ||||| |||||||||||||||||| |||| || || |
Sbjct  98957   AGCAAGCGGCGCGGTTCCCAGCGCACTTTTCGCTCACGACGCTCTTGTTGTACTCGCCGC  98898

Query  1502    ACTGTCTTCGCCGTATCCAGCGGTACATCAAGAACAAGGAGGCGTACCTGGTCACGGGCA  1561
               ||||||| || ||||||||||||||||| |  ||||||||||||||| |||||||||| |
Sbjct  98897   ACTGTCTGCGGCGTATCCAGCGGTACATTAGAAACAAGGAGGCGTACTTGGTCACGGGGA  98838

Query  1562    TGCCCGGTCCAGAGGATAAGCGTCTCGCCATGGCGCTCAATGTGCCGATCCTCGGTATGG  1621
               | ||||| |  || || ||||| |||||  ||||| | || |||||||||||||| ||||
Sbjct  98837   TTCCCGGACGCGAAGACAAGCGACTCGCGGTGGCGTTGAACGTGCCGATCCTCGGCATGG  98778

Query  1622    ATCCGCTCAGCGCCCTGCCACTCATGACCAAGTCTGGTGGCAAGCGCTTCTTCATGCGCG  1681
               | || ||||||||  ||||||||||||||||||| ||  |||||||||||||||||||||
Sbjct  98777   ACCCACTCAGCGCATTGCCACTCATGACCAAGTCGGGCAGCAAGCGCTTCTTCATGCGCG  98718

Query  1682    CCGACGTGAATGTGCCCACGGGCACGTACGACATTTACGACGAGGACGAGCTCGTGTTCT  1741
               | || ||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||
Sbjct  98717   CGGATGTGAACGTGCCCACGGGCACGTATGACATCTACGACGAGGACGAGCTCGTGTTCT  98658

Query  1742    CGCTCGCCAAGCTCATCGTCTCGCACATTGAGCAGAGCGTGTGGGTGCTCAAGATCGACT  1801
               ||||||||||||||||| | |||||||| ||||| ||||| ||||||||||||||||| |
Sbjct  98657   CGCTCGCCAAGCTCATCATGTCGCACATCGAGCAAAGCGTCTGGGTGCTCAAGATCGATT  98598

Query  1802    ATGACCCGTTCAGCACAGGCACAGCGCTGCTTGACGTCTCAACCATGGTGGCACTGCGTG  1861
               | ||||||||| | || ||||| ||||| || |||||||| ||||||   |  ||||| |
Sbjct  98597   ACGACCCGTTCGGTACTGGCACGGCGCTACTCGACGTCTCGACCATGACAGTGCTGCGCG  98538

Query  1862    AGATTCGACGCGAGAAGAGAAGTCCCGAGTACTGGAGGCAGCCTGGGACGCGAGACAACG  1921
               |||| || ||||||||||  || || |||||||||| ||||||  | ||||| |||||||
Sbjct  98537   AGATCCGCCGCGAGAAGAAGAGCCCTGAGTACTGGAAGCAGCCGAGCACGCGGGACAACG  98478

Query  1922    CCGCGCGCGTGATCATCGCCGAGCTGGAGCGGACGCTGGGTAATCTCGTCACGCCGCTGC  1981
               | |||||||  |||||||||||||||||||| ||||| |   |||| ||||| || ||||
Sbjct  98477   CGGCGCGCGCTATCATCGCCGAGCTGGAGCGCACGCTCGCGCATCTGGTCACCCCACTGC  98418

Query  1982    ATCCAGAGCTGTATCCAAGTTGGCAGGACTATGCAGACGCGATCGTGCAGTTTGGTGTCG  2041
               |||| ||| |||| || ||||||||||| |  |  ||||||||    ||||| || ||||
Sbjct  98417   ATCCCGAGGTGTACCCGAGTTGGCAGGAGTTCGTCGACGCGATTTCTCAGTTCGGCGTCG  98358

Query  2042    TCGTGGAGGCCGCTCCAAGTGCAGTCGTTGGCCACGTGCGTGCAAATCTGTTTGTCGAGC  2101
               ||||||| ||||| |||   |||||| | |||||||| || |||||||||||| ||||||
Sbjct  98357   TCGTGGAAGCCGCGCCATCCGCAGTCATAGGCCACGTTCGCGCAAATCTGTTTATCGAGC  98298

Query  2102    CCAGTGGCGAGGTGCATGTCTCGTCGACGCAGGACATCCT-----CCTG----------A  2146
               | |||||||||||||| || |||||||| ||||| ||| |     || |          |
Sbjct  98297   CGAGTGGCGAGGTGCACGTGTCGTCGACCCAGGATATCATTACGACCAGCAGTAATAGCA  98238

Query  2147    GCAGCAGCGGAGGGTGCGGAGGGAAACCTGGTGGGGCGTACAGACACAAGTCGGTCGGGT  2206
               ||||||| |||||  ||| ||| |||   | ||| || ||| |   |||| ||||||| |
Sbjct  98237   GCAGCAGTGGAGGAGGCGCAGGAAAAAAAGCTGGCGCTTACCGGAGCAAGACGGTCGGCT  98178

Query  2207    ATGCGTTTCCTCAGACTGCAGCGCCGTACGAAGCCATTCG  2246
               ||||||| || ||||||||||| ||||| |||||||||||
Sbjct  98177   ATGCGTTCCCGCAGACTGCAGCACCGTATGAAGCCATTCG  98138

 Score = 694 bits (769),  Expect = 0.0
 Identities = 613/763 (80%), Gaps = 18/763 (2%)
 Strand=Plus/Minus

Query  2247   GGGTGCGTCGACCGCAATCGGAAAGCTCCTGGCTGAAGACAACGTGTTTGGCTACGCGAG  2306
              ||| || ||||| || || || |||||||| || || ||   ||||||||| ||| ||||
Sbjct  98058  GGGAGCATCGACTGCGATTGGGAAGCTCCTCGCGGACGAGTGCGTGTTTGGGTACTCGAG  97999

Query  2307   CATCGACTTTCTGGTGTTCCAGGAAGACAAGTCGCACACGGCGCGGCTCTGGGCCATGGC  2366
              ||||||||   |||| |||||||| |||||| | ||| |||||||||||||||| |||||
Sbjct  97998  CATCGACTACTTGGTCTTCCAGGAGGACAAGACCCACGCGGCGCGGCTCTGGGCGATGGC  97939

Query  2367   ACTGCGTCCGTACTTGACAGACTCGGCCGCGACCTTCACGACATTCCATTTGCTCAACCG  2426
               ||||  || ||| |||| ||||||||| |||||||| |||| ||||| || ||||||||
Sbjct  97938  GCTGCACCCATACCTGACTGACTCGGCCTCGACCTTCGCGACGTTCCACTTACTCAACCG  97879

Query  2427   CGGCGCTTTGAACACAACCTCGGGTCTGTATTACCTCCCAGCAGCCACGGTGACGTCTGC  2486
              ||||||| ||||| ||| |||||| || ||  |||||||| | |   | |   | ||| |
Sbjct  97878  CGGCGCTCTGAACGCAAGCTCGGGGCTCTACCACCTCCCACCTGTAGCAG---CATCTCC  97822

Query  2487   TTCGT--TAGTC--CAA-----CTCCAATCCAGC------AGTGCAGCCTTCGCCAGCGG  2531
               || |  | |||  |||     ||| || ||||       || || ||    || | |||
Sbjct  97821  ATCCTCGTCGTCAACAAAGTCGCTCAAACCCAGTCATTCTAGAGCTGCTGGTGCTACCGG  97762

Query  2532   GGCGTCGGCAGCAGATCTCGTGCTGCACGAGGCGACGCACTCGGGACTCGTGTCCCTCGA  2591
                | || ||||| ||||| ||| |||| |||||||||||||| ||||||||||| |||||
Sbjct  97761  CACATCCGCAGCTGATCTGGTGATGCAGGAGGCGACGCACTCCGGACTCGTGTCACTCGA  97702

Query  2592   GAAGGTTGGCGCTCAGCACACGTACGTTGTAAGCGAGTACATCTTCCACCCGAACGTGTC  2651
               |||| |||||| |||| |||||||||||| ||||||||||| |||||||||||||| ||
Sbjct  97701  AAAGGCTGGCGCGCAGCGCACGTACGTTGTCAGCGAGTACATTTTCCACCCGAACGTATC  97642

Query  2652   GACCATGCAGTACAGCGCCTTCTTCCACACCTGTCGGCTGCACGGCGTCTGCTTCGACGT  2711
               || ||||| |||||||| ||||| ||||||||||||||||||||||||||||| |||||
Sbjct  97641  CACGATGCAATACAGCGCGTTCTTTCACACCTGTCGGCTGCACGGCGTCTGCTTTGACGT  97582

Query  2712   GGAGCGCTGTGTGGGCTCGGTCTTTCTCCTTGCCGACAGCCTCACGGCCGGTGTCTTCGG  2771
               |||||||| || ||||| || || || || |||||||| ||||| ||||| ||||||||
Sbjct  97581  CGAGCGCTGCGTCGGCTCCGTGTTCCTGCTCGCCGACAGTCTCACCGCCGGGGTCTTCGG  97522

Query  2772   CCTCATGTGCTGCAGCGACACGGCGAGCGGCGCGCTGGGCTTTCTACGCACAGCGCTGGA  2831
              | ||||||||||||| ||  |||||||||| ||||| ||||| || || |||||||||||
Sbjct  97521  CATCATGTGCTGCAGTGATTCGGCGAGCGGTGCGCTCGGCTTCCTTCGAACAGCGCTGGA  97462

Query  2832   AGTGGTCGGCCGGGAGGTGGGCACCCAGGCGCTCACGGACGAGTTCACGAGCGGCGGCGA  2891
               ||| |||| || |||||||||||||||||||||| ||||||||||| | ||||||||||
Sbjct  97461  GGTGATCGGACGCGAGGTGGGCACCCAGGCGCTCATGGACGAGTTCATGGGCGGCGGCGA  97402

Query  2892   AGCGGAAACGGGCAACTTCGCGGACGTACTGGCTGCGATTCGCGCATTGACGGGCGGCAA  2951
                ||||||| || |||||||| ||||| || |||| ||| |||||  |||| || || ||
Sbjct  97401  GTCGGAAACCGGGAACTTCGCAGACGTGCTCGCTGTGATCCGCGCGCTGACTGGTGGAAA  97342

Query  2952   GTCAGCCAAGCTGGAGAAGATCCGGCGCCTGCGCAGGAACTGA  2994
               || || |||||||||||||| |||||||||||||| ||||||
Sbjct  97341  ATCCGCGAAGCTGGAGAAGATTCGGCGCCTGCGCAGAAACTGA  97299

>PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:pug:scf1117875582037:1:1414051:1 
REF
Length=1414051

 Score = 1437 bits (1593),  Expect = 0.0
 Identities = 1273/1584 (80%), Gaps = 10/1584 (1%)
 Strand=Plus/Plus

Query  571      GAGAAGGACGACGACGCGAACGCCATGGACGAGTTGCGCAAGAATGTCGAGAAGATCCGC  630
                ||| ||||||| |||||||| |||||||||||  | ||||| || ||||| |||||||||
Sbjct  1309783  GAGGAGGACGATGACGCGAATGCCATGGACGATCTTCGCAAAAACGTCGAAAAGATCCGC  1309842

Query  631      GGGTACAACGAGCTGCTGGACACGTACAGTCTCCACCAGTTCATCATCCACAAAGGCCGC  690
                || ||||| |||||  ||||||| |||||  | |||||||||||||||||||||||    
Sbjct  1309843  GGATACAATGAGCTCTTGGACACCTACAGCTTGCACCAGTTCATCATCCACAAAGGGAAG  1309902

Query  691      GCGATGCGCGAGACGCCTGAGTTTGTGTCCTTCAAGCGCGTGGCGCAGGAGGTTTGGGGC  750
                ||||||||||||||||| ||||||||||| |||||||||||||| || ||| | ||||||
Sbjct  1309903  GCGATGCGCGAGACGCCGGAGTTTGTGTCGTTCAAGCGCGTGGCACAAGAGATCTGGGGC  1309962

Query  751      AGCGTCGATGAAGTGATCAAGGCACTCGAGGCGCTGCTCACGCGCTACTTCGTGCCTCTC  810
                 ||||||| ||||||||||| || |||||| ||||  | |||||||||||||| || |||
Sbjct  1309963  GGCGTCGAAGAAGTGATCAAAGCGCTCGAGACGCTCTTGACGCGCTACTTCGTTCCACTC  1310022

Query  811      GCGTACGTCGACGGCCAGCGACTCATGACGGTCGCGGCGATGGAGATGGCGTCCTACAGC  870
                ||||| |||||||| || || || ||||| |||||| |||||||||||||||| | ||||
Sbjct  1310023  GCGTATGTCGACGGGCAACGGCTGATGACTGTCGCGTCGATGGAGATGGCGTCGTTCAGC  1310082

Query  871      AAGCGGGACCTGCTCTCGTGCATCGTCAACGAGGACCAGGTCGGGTCGCTCATCCGGCGA  930
                || | |||  |||||||||||||||| ||||| ||||| || || || ||||| ||||||
Sbjct  1310083  AAACAGGATTTGCTCTCGTGCATCGTGAACGAAGACCAAGTTGGTTCACTCATTCGGCGA  1310142

Query  931      CCGGGCCAGCGCTACAAAGGCAAGGACCGCAAGCGCCGCGCAGCCGTGACGATTCAGAAC  990
                ||||| ||||| || |||||||||||||| ||||||||||| ||  | ||||| || |||
Sbjct  1310143  CCGGGTCAGCGATATAAAGGCAAGGACCGAAAGCGCCGCGCCGCGATCACGATCCAAAAC  1310202

Query  991      TTCTTCCGCATGTGGTGGAACCAGAAGAAGTACAGTCGCTTCCGCCACCACCTCGCGAGC  1050
                 | || || ||||||| |||||| |||||||||   || | ||||| ||||||| |||||
Sbjct  1310203  GTGTTTCGAATGTGGTCGAACCAAAAGAAGTACTCGCGATACCGCCGCCACCTCTCGAGC  1310262

Query  1051     GTCGTGGCCATTCAACGCGTCTGGCGCGTGTATGCGAGCCACGATGACCTCAAGCGCAGG  1110
                |||||   ||| || |  || ||||||| ||||||||||||||| || |||| ||| | |
Sbjct  1310263  GTCGTACTCATCCAGCAAGTGTGGCGCGCGTATGCGAGCCACGAGGATCTCAGGCGTAAG  1310322

Query  1111     ATCAAGAGC-CAGCGAGATCAGCAGCACGCGCAGTGGGAAGCCAAGATGCAACGGCTCAA  1169
                 |||| ||| || ||| | ||||||||||  |||||||| ||||  ||||| || ||  |
Sbjct  1310323  CTCAA-AGCGCAACGACAGCAGCAGCACGAACAGTGGGAGGCCAGAATGCAGCGCCTGCA  1310381

Query  1170     GCGCGACTGGATACGCATCAAAGGCAACCGCCGCGTGGTCATTCACGTGCCATCCTTCTC  1229
                 ||||| |||   |||||||||| ||| ||||||||| |||| |||||||| ||  | ||
Sbjct  1310382  ACGCGAGTGGCCGCGCATCAAAGCCAATCGCCGCGTGATCATCCACGTGCCGTCGCTGTC  1310441

Query  1230     AGTTGACGAACGCTTGCGTCTCAGCGCCGACAATTTCTCGGTCAAGCAGAATCTCCAGCT  1289
                  | |||||||| || ||  || | |||||||| ||| ||||||||||||| || |||||
Sbjct  1310442  GATCGACGAACGGTTCCGCATCCGTGCCGACAACTTCGCGGTCAAGCAGAACCTGCAGCT  1310501

Query  1290     TTCGCGACTCTGCGGCCTCGTCGACTCGAACGTAGACATTGTCTATGTCTCACCCTTTGA  1349
                 ||||| ||||||||| || | ||| |||| || |||||||| || ||||| || |||||
Sbjct  1310502  CTCGCGGCTCTGCGGCATCATTGACGCGAATGTCGACATTGTGTACGTCTCGCCGTTTGA  1310561

Query  1350     GCTCACGACGGACGTGGTGCAATACTCAATGAAGCTTCTACAGCTTGGCGGCATCGCCGA  1409
                ||| ||| | || || |  || ||||  |||||||| ||||| ||||| |||||||| ||
Sbjct  1310562  GCTGACGTCCGAGGTCGGCCAGTACTTTATGAAGCTGCTACAACTTGGAGGCATCGCAGA  1310621

Query  1410     CCCCGTCGCTCGCGTGAAGCTCGTCTTTCCCGAGCATGCACCGCGGTTCCCGACACACTT  1469
                ||||||  | || || || || || ||||||||||| ||  | ||||| ||| | || ||
Sbjct  1310622  CCCCGTGACGCGAGTCAAACTGGTGTTTCCCGAGCAAGCGACTCGGTTTCCGGCGCATTT  1310681

Query  1470     CTCGCTCACGACGCTCTTGCTGTATTCCCCACACTGTCTTCGCCGTATCCAGCGGTACAT  1529
                ||||||||||||| |  ||||||| || || || ||||| ||||||||||  |||| | |
Sbjct  1310682  CTCGCTCACGACGGTGCTGCTGTACTCGCCGCATTGTCTGCGCCGTATCCGACGGTGCGT  1310741

Query  1530     CAAGAACAAGGAGGCGTACCTGGTCACGGGCATGCCCGGTCCAGAGGATAAGCGTCTCGC  1589
                ||||  ||| || ||||||||||||||||| ||||| || | ||| || || || |||||
Sbjct  1310742  CAAGGGCAAAGAAGCGTACCTGGTCACGGGGATGCCTGGCCAAGAAGACAAACGGCTCGC  1310801

Query  1590     CATGGCGCTCAATGTGCCGATCCTCGGTATGGATCCGCTCAGCG-CCCTGCCACTCATGA  1648
                 |||||||| || ||||| || || || ||||| || ||  ||| | |||||  | ||||
Sbjct  1310802  TATGGCGCTGAACGTGCCCATTCTGGGGATGGACCCACT-TGCGACACTGCCGTTGATGA  1310860

Query  1649     CCAAGTCTGGTGGCAAGCGCTTCTTCATGCGCGCCGACGTGAATGTGCCCACGGGCACGT  1708
                | ||||| ||  ||||||| ||||||||||| |||||||| |||||||||||||| ||||
Sbjct  1310861  CAAAGTCGGGCAGCAAGCGGTTCTTCATGCGGGCCGACGTCAATGTGCCCACGGGAACGT  1310920

Query  1709     ACGACATTTACGACGAGGACGAGCTCGTGTTCTCGCTCGCCAAGCTCATCGTCTCGCACA  1768
                ||||||| |||||||| ||||||||  | |||||||| |||||||||||||| || ||||
Sbjct  1310921  ACGACATCTACGACGAAGACGAGCTGATCTTCTCGCTTGCCAAGCTCATCGTATCCCACA  1310980

Query  1769     TTGAGCAGAGCGTGTGGGTGCTCAAGATCGACTATGACCCGTTCAGCACAGGCACAGCGC  1828
                ||||||| | ||||||| | || ||||||||||| ||||||||| |||| ||||| ||| 
Sbjct  1310981  TTGAGCAAAACGTGTGGCTCCTGAAGATCGACTACGACCCGTTCGGCACCGGCACGGCGA  1311040

Query  1829     TGCTTGACGTCTCAACCATGGT---GGCACTGCGTGAGATTCGACGCGAGAAGAGAAGTC  1885
                |  | || | ||   |  ||||   |||||| || ||||||||||| ||||||| |||||
Sbjct  1311041  TCGTGGATGCCT---CGGTGGTAACGGCACTTCGAGAGATTCGACGAGAGAAGAAAAGTC  1311097

Query  1886     CCGAGTACTGGAGGCAGCCTGGGACGCGAGACAACGCCGCGCGCGTGATCATCGCCGAGC  1945
                | ||||||||| ||||||||||||| || |||||||| |||||  |||||||||||||| 
Sbjct  1311098  CTGAGTACTGGCGGCAGCCTGGGACCCGCGACAACGCGGCGCGGATGATCATCGCCGAGT  1311157

Query  1946     TGGAGCGGACGCTGGGTAATCTCGTCACGCCGCTGCATCCAGAGCTGTATCCAAGTTGGC  2005
                ||||||| ||| | || ||  | |||||||||||||| |||||| | ||||| |  ||||
Sbjct  1311158  TGGAGCGAACGATTGGGAAGTTGGTCACGCCGCTGCACCCAGAGGTTTATCCGACGTGGC  1311217

Query  2006     AGGACTATGCAGACGCGATCGTGCAGTTTGGTGTCGTCGTGGAGGCCGCTCCAAGTGCAG  2065
                | || | ||||||||||||||  ||||||||||||||  | || || || ||    ||  
Sbjct  1311218  AAGAGTTTGCAGACGCGATCGCTCAGTTTGGTGTCGTGATTGAAGCTGCGCCGTCCGCGA  1311277

Query  2066     TCGTTGGCCACGTGCGTGCAAATCTGTTTGTCGAGCCCAGTGGCGAGGTGCATGTCTCGT  2125
                | || ||| || | || || ||| ||||||||||||| ||||||||||| || |||||||
Sbjct  1311278  TTGTCGGCTACATCCGCGCCAATTTGTTTGTCGAGCCAAGTGGCGAGGTCCACGTCTCGT  1311337

Query  2126     CGACGCAGGACATCCTCCTGAGCA  2149
                ||||||||||| || |||||||||
Sbjct  1311338  CGACGCAGGACGTCATCCTGAGCA  1311361

 Score = 456 bits (505),  Expect = 2e-125
 Identities = 563/767 (73%), Gaps = 26/767 (3%)
 Strand=Plus/Plus

Query  2247     GGGTGCGTCGACCGCAATCGGAAAGCTCCTGGCTGAAGACAACGTGTTTGGCTACGCGAG  2306
                ||| |||||||  || ||||||||| | ||||  || |||| ||| ||||| ||| ||||
Sbjct  1311518  GGGAGCGTCGATGGCGATCGGAAAGGTACTGGTCGACGACAGCGTCTTTGGGTACTCGAG  1311577

Query  2307     CATCGACTTTCTGGTGTTCCAGGAAGACAAGTCGCACACGGCGCGGCTCTGGGCCATGGC  2366
                | ||||||  ||||| || |  || |||||| ||||     |||||||||||||||||||
Sbjct  1311578  CGTCGACTACCTGGTCTTTCGCGAGGACAAGACGCATGTTCCGCGGCTCTGGGCCATGGC  1311637

Query  2367     ACTGCGTCCGTACTTGACAGACTCGGCCGCGACCTTCACGACATTCCATTTGCTCAACCG  2426
                 |||| ||| ||| | || ||||| ||  |||| ||  |    ||||| ||| | || ||
Sbjct  1311638  TCTGCATCCCTACCTCACGGACTCTGCGTCGACGTTTGCCGTGTTCCACTTGTTGAATCG  1311697

Query  2427     CGGCGCTTTGAACACAACCTCGGGTCTGTATTACCTCCCAGCAGC-----CA--CGGTGA  2479
                ||||||  | ||||    | |||| | |||| | || |||||| |     ||  ||| | 
Sbjct  1311698  CGGCGCGCTAAACATTCACACGGGACAGTATCATCTGCCAGCACCTGCTGCATCCGGAGT  1311757

Query  2480     --------CGTCT---GCTTCGTTAGTC-----CAACTCCAATCCAGCAGTGCAGCCTTC  2523
                        ||||    |||||||  ||      ||| |  ||| || | | | | || | 
Sbjct  1311758  GCCAAGCTCGTCAACGGCTTCGTCGGTATCGCTCAAGTTGAATGCATC-GAGTACCCGTG  1311816

Query  2524     --GCCAGCGGGGCGTCGGCAGCAGATCTCGTGCTGCACGAGGCGACGCACTCGGGACTCG  2581
                  ||| |  | ||  || ||||  |||| |||||||| || || ||||||| ||| ||||
Sbjct  1311817  CTGCCGGTAGCGCTACGTCAGCGAATCTGGTGCTGCAGGAAGCCACGCACTTGGGCCTCG  1311876

Query  2582     TGTCCCTCGAGAAGGTTGGCGCTCAGCACACGTACGTTGTAAGCGAGTACATCTTCCACC  2641
                |||| |||||||| | |||||| || | ||||||||  || | ||| |||||||||||||
Sbjct  1311877  TGTCTCTCGAGAAAGCTGGCGCGCAACGCACGTACGCCGTCAACGAATACATCTTCCACC  1311936

Query  2642     CGAACGTGTCGACCATGCAGTACAGCGCCTTCTTCCACACCTGTCGGCTGCACGGCGTCT  2701
                | |||||||||||||||||||||||| | |||||||| |||||||| ||||| || || |
Sbjct  1311937  CCAACGTGTCGACCATGCAGTACAGCTCGTTCTTCCATACCTGTCGTCTGCATGGGGTGT  1311996

Query  2702     GCTTCGACGTGGAGCGCTGTGTGGGCTCGGTCTTTCTCCTTGCCGACAGCCTCACGGCCG  2761
                | |||||||| ||||||||  | ||| |  ||||  | || || || ||||||||||| |
Sbjct  1311997  GTTTCGACGTCGAGCGCTGCTTTGGCACCATCTTCATGCTGGCAGATAGCCTCACGGCTG  1312056

Query  2762     GTGTCTTCGGCCTCATGTGCTGCAGCGACACGGCGAGCGGCGCGCTGGGCTTTCTACGCA  2821
                | ||||| ||  |||| || ||| | |||||||||||||  |||||||| ||||| || |
Sbjct  1312057  GCGTCTTTGGGATCATCTGTTGCGGAGACACGGCGAGCGCTGCGCTGGGTTTTCTTCGGA  1312116

Query  2822     CAGCGCTGGAAGTGGTCGGCCGGGAGGTGGGCACCCAGGCGCTCACGGACGAGTTCACGA  2881
                ||||||| |||||  |||| || ||||| || || |||||||||||||||||  ||| | 
Sbjct  1312117  CAGCGCTCGAAGTCATCGGACGCGAGGTTGGGACGCAGGCGCTCACGGACGATCTCAGGG  1312176

Query  2882     GCGGCGGCGAAGCGGAAACGGGCAACTTCGCGGACGTACTGGCTGCGATTCGCGCATTGA  2941
                | ||||| ||    ||  ||||||||||||| || || ||  | |   | ||| |  | |
Sbjct  1312177  GTGGCGGAGACTGCGAGTCGGGCAACTTCGCCGAGGTGCTCACCGTCGTACGCACGCTCA  1312236

Query  2942     CGGGCGGCAAGTCAGCCAAGCTGGAGAAGATCCGGCGCCTGCGCAGG  2988
                | ||||| || || |||||||| ||||||||||||||||||||||||
Sbjct  1312237  CTGGCGGGAAATCCGCCAAGCTCGAGAAGATCCGGCGCCTGCGCAGG  1312283

 Score = 251 bits (277),  Expect = 2e-63
 Identities = 236/299 (79%), Gaps = 4/299 (1%)
 Strand=Plus/Plus

Query  1        ATGGCGCAGCACGCGCGGCTTCTGCCGAGCGTCAACAAGTGCGACCCAAGCGCGCCGACG  60
                ||| | || |||||| |||| ||||| || || |||||||||||||||||||| ||| ||
Sbjct  1309195  ATGACCCACCACGCGAGGCTCCTGCCCAGTGTGAACAAGTGCGACCCAAGCGCTCCGCCG  1309254

Query  61       CCCGAGCTCTCGGAGCAGGACGCGAAGAACGGCATGCTCAGCCTCGTGAACCGGGGCTTC  120
                || ||  | |  ||||| || ||||| | ||||||| |||||||| | ||||| ||||||
Sbjct  1309255  CCGGAATTGTTCGAGCATGATGCGAAAAGCGGCATGTTCAGCCTCATCAACCGCGGCTTC  1309314

Query  121      TTGCCCGTGGGGACCGACCTCACGTCCGCGTTCGTCAACAGCCACGGAGGCATAATCCAG  180
                 |||| || ||  ||||||||||  | |||||||| |||||||||||  |||| ||| ||
Sbjct  1309315  GTGCCTGTCGGAGCCGACCTCACACCAGCGTTCGTGAACAGCCACGGCAGCATCATCAAG  1309374

Query  181      AACCACAAGACACGCATCTACGACCGCCAGGAACAGCCGATCCGGGCCGTGCCGCACACT  240
                |||  ||||||  | |||||| |||| ||||| |||||||||||  || ||||| |||| 
Sbjct  1309375  AACTCCAAGACCAGGATCTACAACCGACAGGAGCAGCCGATCCGACCCATGCCGTACACC  1309434

Query  241      AATCCGTCGGGCTTCAACATCGCGACCTTGAAGTTCGACCTCGC--CGCCACTGCCGAG  297
                || |||||||| |||| ||| ||  | |||||||| || |||||  ||||||  |||||
Sbjct  1309435  AACCCGTCGGGGTTCAGCATGGCCTCGTTGAAGTTTGATCTCGCGGCGCCAC--CCGAG  1309491

 Score = 56.3 bits (61),  Expect = 8e-05
 Identities = 54/67 (81%), Gaps = 2/67 (3%)
 Strand=Plus/Plus

Query  2188     AGACACAAGTCGGTCGGGTATGCGTTTCCTCAGACTGCAGCGCCGTACGAAGCCATTCGG  2247
                ||| | |||| ||  ||||| ||||| || |||||  |||| ||||||||||| |||| |
Sbjct  1311377  AGAGAAAAGT-GGCAGGGTACGCGTTCCCGCAGACCACAGCTCCGTACGAAGCGATTC-G  1311434

Query  2248     GGTGCGT  2254
                |||||||
Sbjct  1311435  GGTGCGT  1311441

>PHSO:scaffold_1
Length=13391543

 Score = 470 bits (520),  Expect = 1e-129
 Identities = 946/1376 (69%), Gaps = 53/1376 (4%)
 Strand=Plus/Plus

Query  569      ACGAGAAGGACGACGACGCGAACGCCATGGACGAGTTGCGCAAGAATGTCGAGAAGATCC  628
                ||||||||||||| || ||   ||  ||||| ||| || ||   || ||||| |||||||
Sbjct  2802208  ACGAGAAGGACGAGGAGGC---CGAGATGGAGGAGCTGGGCGCCAACGTCGACAAGATCC  2802264

Query  629      GCGGGTACAACGAGCTGCTGGACACGTACAGTCTCCACCAGTTCATCATCCACAAAGGCC  688
                |||| |||||||||||||||||| |||||||||| ||||||||| | |||||||| || |
Sbjct  2802265  GCGGATACAACGAGCTGCTGGACGCGTACAGTCTGCACCAGTTCTTGATCCACAAGGGAC  2802324

Query  689      GCGCGATGCGCGAGACGCCTGAGTTTGTGTCCTTCAAGCGCGTGGCGCAGGAGGTTTGGG  748
                |  | ||||| || || || ||||||||||| |||   ||||| ||||||||| ||||||
Sbjct  2802325  GAACCATGCGAGATACACCCGAGTTTGTGTCGTTCCGCCGCGTAGCGCAGGAGCTTTGGG  2802384

Query  749      GCAGCGTCGATGAAGTGATCAAGGCACTCGAGGCGCTGCTCACGCGCTACTTCGTGCCTC  808
                |||||||||| || |   |    ||  | ||| | || |||||||  ||||||||||| |
Sbjct  2802385  GCAGCGTCGAGGAGGCCCTGCGCGCGTTGGAGACTCTCCTCACGCAGTACTTCGTGCCGC  2802444

Query  809      TCGCGTACGTCGACGGCCAGCGACTCATGACGGTCGCGGCGATGGAGATGGCGTCC-TAC  867
                | |||||||  || ||||||||  |  || |  ||||  | |  | |   || ||  | |
Sbjct  2802445  TGGCGTACGCTGATGGCCAGCGCTTGTTGTCTCTCGCTTCCACCG-GCCAGCCTCGGTTC  2802503

Query  868      AGCAAGCGGGACCTGCTCTCGTGCATCGTCAACGAGGACCAGGTCGGGTCGCTCATCCGG  927
                  |||||| || ||| | || |||||||| ||||| || |||||   | || |  |||| 
Sbjct  2802504  TCCAAGCGCGAGCTGTTGTCCTGCATCGTGAACGAAGAGCAGGTAATGGCGGTGCTCCGT  2802563

Query  928      CGACCGGGCCAGCGCTACAAAGGCAAGGACCGCAAGCGCCGCGCAGCCGTGACGATTCAG  987
                ||||| || ||||| ||||||||||  |||||||||||||| || ||   ||| || || 
Sbjct  2802564  CGACCAGGACAGCGATACAAAGGCAGAGACCGCAAGCGCCGAGCTGCGACGACAATCCAA  2802623

Query  988      AACTTCTTCCGCATGTGGTGGAACCAGAAGAAGTAC---AG-TCGCTTCCGCCACCACCT  1043
                  ||   |||| |||||||  | ||       |||    || ||||   ||| | |  ||
Sbjct  2802624  GCCTGTGTCCGGATGTGGTCAATCCGCCGCCGGTATGTGAGATCGCG--CGCGAGCGACT  2802681

Query  1044     CGCGAGCGTCGTGGCCATTCAACGCGTCTGGCGCGTGTATGCGAGCCACGATGACCTCAA  1103
                   | ||| ||  |  || || | ||  |||||||  |      ||||||  |   | ||
Sbjct  2802682  TCAGCGCGACGAAG--ATCCAGCTCGCATGGCGCGCCTTCAGCTGCCACGCGGCTTTGAA  2802739

Query  1104     -GCGCAGGATCAAGAGC--CAGCGAGATCAGCAGCACGCGCAGTGGGAAGCCAAGATGCA  1160
                 || |     | |||||  | ||| || ||||   ||    | ||||||||||||||| |
Sbjct  2802740  AGCTCGACTGCGAGAGCTTCGGCGGGAGCAGCTTGACA---ACTGGGAAGCCAAGATG-A  2802795

Query  1161     ACGGC-TCAAGCGCGACTGGATACGCATCAAAGGCAACCGCCGCGTGGTCATTCACGTGC  1219
                ||| | | |||  | | |||   |  ||   |||   ||| ||||| ||| | |||||||
Sbjct  2802796  ACGACCTGAAGACCCAGTGGCATCAGATTGCAGGACGCCGACGCGTTGTCGTGCACGTGC  2802855

Query  1220     CATCCTTCTCAGTTGACGAACGCTTGCGTCTCAGCGCCGACAATTTCTCGGTCAAGCAGA  1279
                | ||||| ||  | || |||| || ||| || |||||||| || ||| | ||  ||||||
Sbjct  2802856  CGTCCTTGTCGCTGGATGAACACTCGCGCCTTAGCGCCGAGAACTTCGCAGTGCAGCAGA  2802915

Query  1280     ATCTCCAGCTTTCGCGACTCTGCG--GC--CTCGTCGACTCGAACGTAGACAT---TGTC  1332
                | ||||||||  ||||  | ||||  ||  ||| | ||||||||||| ||  |   ||| 
Sbjct  2802916  ACCTCCAGCTGACGCGGATATGCGCTGCAGCTC-TGGACTCGAACGTGGATCTGCTTGTG  2802974

Query  1333     TATGTCTCACCCTTTGAGCTCACGACGGACGTGGTGCAATACTCAATGAAGCTTCTACAG  1392
                || ||  | ||||| ||||||||  | |||||   ||| ||||   | ||||| || |||
Sbjct  2802975  TACGTGGCCCCCTTCGAGCTCACCGCTGACGTCTCGCACTACTTCCTCAAGCTGCTGCAG  2803034

Query  1393     CTTGGCGGCATCGCCGACCCCGTCG--CTCGCGTGAAGCTCGTCTTTCCCGAGCATGCAC  1450
                || |||||  | || ||    || |  | |||||||||||||| ||||| ||||| ||  
Sbjct  2803035  CTGGGCGGTCTGGCTGATA--GTAGACCGCGCGTGAAGCTCGTGTTTCCAGAGCAGGCTG  2803092

Query  1451     CGCGGTTCCCGACACACTTCTCGCTCACGACGCTCTTGCTGTATTCCCCACACTGTCTTC  1510
                | || || ||  | || ||||||||| || |  |||||||||| || || |||||||| |
Sbjct  2803093  CCCGCTTTCCAGCGCATTTCTCGCTCTCGTCAGTCTTGCTGTACTCGCCTCACTGTCTGC  2803152

Query  1511     GCCGTATCCAGCGGTACA--TCAAGAACAAGGAGGCGTACCTGGTCACGGGCATGCCCGG  1568
                | || |||| ||  ||||   || |  ||| || || ||||| || | |||  |||| ||
Sbjct  2803153  GGCGCATCCGGCACTACACGGCAGG--CAAAGACGCATACCTCGTGATGGGGTTGCCTGG  2803210

Query  1569     TCCAGAGGATAAGCGTCTCGCCATGGCGCTCAATGTGCCGATCCTCGGTATGGATCCG--  1626
                | |||| ||  |||| || || || || ||  |  |||| ||||| |||   |  |||  
Sbjct  2803211  TACAGAAGACCAGCGGCTGGCTATCGCCCTGGACTTGCCTATCCTTGGT---GCACCGCC  2803267

Query  1627     --CTCAGCGCCCTGCCACTCATGACCAAGTCTGGTGGCAAGCGCTTCTTCATGCGCGCCG  1684
                  ||||  || || ||| |  | ||    || |||||||||||  |  |||| ||||| |
Sbjct  2803268  ACCTCA-AGCACTACCATTGCTCACTCGCTCAGGTGGCAAGCGGCTGCTCATCCGCGCTG  2803326

Query  1685     ACGTGAATGTGCCCACGGGCACGTACGACATTTACGACGAGGACGAGCTCGTGTTC---T  1741
                ||||||| || ||||| ||||| |||||  | ||||||||| |||| |   |||||    
Sbjct  2803327  ACGTGAACGTCCCCACCGGCACTTACGAGCTCTACGACGAGCACGAAC---TGTTCGCAG  2803383

Query  1742     CGCTCGCCAAGCTCATCGTCTCGCACATTGAGCAGAGCGTG-TGGGTGCTCAAGATCGAC  1800
                | || ||||||||    ||| ||||||| || |||  || | ||| |||||||| |||||
Sbjct  2803384  CACTTGCCAAGCTTGCAGTCGCGCACATGGATCAG-CCGAGATGGTTGCTCAAGCTCGAC  2803442

Query  1801     TATGACCCGTTCAGCACAGGCACAGCGCTGCTTGACGTCTCAACCATGGTGGCACTGCGT  1860
                || |||||  |  |    ||   |||| || ||||  | ||    |||   ||  |||| 
Sbjct  2803443  TACGACCCCCTTGGTGTTGGTGAAGCGGTGGTTGATCTGTCGGGGATGCAAGCGATGCGC  2803502

Query  1861     GAGATTCGACGCGAGAAGAGAAGTCCCGAGTACTGGAGGCAGCCTGGGACGCGAGA  1916
                ||| | ||||| |||||||  |  |||||||| ||| | || || ||  |||| ||
Sbjct  2803503  GAGCTACGACGAGAGAAGAAGACGCCCGAGTATTGGCGCCAACCGGGACCGCGCGA  2803558

 Score = 157 bits (173),  Expect = 3e-35
 Identities = 179/237 (76%), Gaps = 4/237 (2%)
 Strand=Plus/Plus

Query  2614     TACGTTGTAAGCGAGTACATCTTCCACCCGAACGTGTCGACCATGCAGTACAGCGCCTTC  2673
                ||||| ||  ||  |||| ||||||||||| ||||| | |||||||||||||  ||||||
Sbjct  2804318  TACGTGGTGTGCTCGTACGTCTTCCACCCGCACGTGACCACCATGCAGTACACTGCCTTC  2804377

Query  2674     TTCCACACCTGTCGGCTGCACGGCGTCTGCTTCGACGTGGAGCGCTGTGTGGGCTCGGTC  2733
                |||||| |||| || ||||| || || || |||||||| ||||||    | ||  || ||
Sbjct  2804378  TTCCACGCCTGCCGACTGCATGGAGTGTGTTTCGACGTTGAGCGCACGCTAGGAACGCTC  2804437

Query  2734     TTTCTCCTTGCCGACAGCCTCACGGCCGGTGTCTTCGGCCTCATGTGC--TGCAGCGACA  2791
                || || ||  | ||||| ||||| ||||||||||||||| || || ||  ||  | ||| 
Sbjct  2804438  TTCCTGCTCACAGACAGTCTCACAGCCGGTGTCTTCGGCGTCTTGAGCGTTGGGGAGAC-  2804496

Query  2792     CGGCGAGCGGCGCGCTGGGCTTTCTACGCACAGCGCTGGAAGTGGTCGGCCGGGAGG  2848
                |  ||| ||| ||| |||  ||  | ||||| || || |||||| ||||||| ||||
Sbjct  2804497  CACCGA-CGGGGCGTTGGCGTTCATGCGCACTGCACTTGAAGTGATCGGCCGCGAGG  2804552

 Score = 78.8 bits (86),  Expect = 7e-12
 Identities = 119/166 (72%), Gaps = 9/166 (5%)
 Strand=Plus/Plus

Query  2247     GGGTGCGTCGACCGCAATCGGAAAGCTCCTGGCTGAAGAC-AACGTGTTTGGCTACGCGA  2305
                ||||||||  || ||    || ||||| || | || |||| ||||| |  ||||||| ||
Sbjct  2803975  GGGTGCGTGCACTGCTGCGGGGAAGCTGCTAG-TGGAGACCAACGTCTGGGGCTACGTGA  2804033

Query  2306     GCATCGACTTTCTGGTGTTCCAGGAAGACAAGTC-----GCACACGGCGCGGCTCTGGGC  2360
                |  | |||||  | ||||||||||| ||||||       || |||  | |||||||||||
Sbjct  2804034  GTCTGGACTTCGTCGTGTTCCAGGACGACAAGAGCGGCGGCGCAC--CACGGCTCTGGGC  2804091

Query  2361     CATGGCACTGCGTCCGTACTTGACAGACTCGGCCGCGACCTTCACG  2406
                  | ||  ||| ||||| | |||||||||| || |||| |||| ||
Sbjct  2804092  GCTCGCTGTGCATCCGTTCCTGACAGACTCTGCTGCGAGCTTCGCG  2804137

 Score = 64.4 bits (70),  Expect = 2e-07
 Identities = 79/107 (74%), Gaps = 1/107 (1%)
 Strand=Plus/Plus

Query  16       CGGCTTCTGCCGAGCGTCAACAAGTGCGACCCAAGCGCGCCGACGCCCGAGCTCTCGGAG  75
                || || |||||||| ||||||||   |||||| || ||||||||||| || ||    |||
Sbjct  2801622  CGCCTCCTGCCGAGTGTCAACAAAGTCGACCCCAGTGCGCCGACGCCTGAACTGCGAGAG  2801681

Query  76       CAGGACGCGAAGAACGGCATGCTCAGCCTCGTGA-ACCGGGGCTTCT  121
                 ||||||| ||  ||||| | || | ||| || | ||  ||| ||||
Sbjct  2801682  GAGGACGCCAAACACGGCGTACTAAACCTGGTCACACGCGGGTTTCT  2801728

>PHRA:scaffold_56
Length=334739

 Score = 349 bits (386),  Expect = 3e-93
 Identities = 936/1408 (66%), Gaps = 45/1408 (3%)
 Strand=Plus/Minus

Query  569     ACGAGAAGGACGACGACGCGAACGCCATGGACGAGTTGCGCAAGAATGTCGAGAAGATCC  628
               |||| |||||||| || ||   ||  ||||| ||| || ||   || ||||| |||||||
Sbjct  148813  ACGACAAGGACGAAGAAGC---CGAAATGGAGGAGCTGGGCGCTAACGTCGACAAGATCC  148757

Query  629     GCGGGTACAACGAGCTGCTGGACACGTACAGTCTCCACCAGTTCATCATCCACAAAGGCC  688
               | || |||||||| ||||||||  |||||||  | ||||||||  | || ||||| || |
Sbjct  148756  GTGGCTACAACGATCTGCTGGATGCGTACAGCTTGCACCAGTTTTTGATTCACAAGGGAC  148697

Query  689     GCGCGATGCGCGAGACGCCTGAGTTTGTGTCCTTCAAGCGCGTGGCGCAGGAGGTTTGGG  748
               |  | ||| | || || || ||||| ||||| |||  | | || ||||||||| | ||||
Sbjct  148696  GTTCAATGAGAGACACCCCCGAGTTCGTGTCGTTCCGGAGGGTTGCGCAGGAGCTATGGG  148637

Query  749     GCAGCGTCGATGAAGTGATCAAGGCACTCGAGGCGCTGCTCACGCGCTACTTCGTGCCTC  808
               | || || || || |   |   |||| | ||| | || |||||||  || || |||||||
Sbjct  148636  GGAGTGTTGAAGAGGCTCTACGGGCATTGGAGACACTACTCACGCAGTATTTTGTGCCTC  148577

Query  809     TCGCGTACGTCGACGGCCAGCGACTCATGACGGTCGCGGCGATGGAGATGGCGTCCTACA  868
               | || ||||| || || |||||  |  |  |  |||| || |  |    |||  |||  |
Sbjct  148576  TGGCTTACGTTGATGGGCAGCGGTTGCTATCACTCGCAGCCACAG----GGCAACCTCGA  148521

Query  869     G----CAAGCGGGACCTGCTCTCGTGCATCGTCAACGAGGACCAGGTCGGGTCGCTCATC  924
                    |||  | || |||||  | |||||||| ||||| || |||||   |||  |  | 
Sbjct  148520  TTTTCCAAAAGCGAGCTGCTAGCTTGCATCGTGAACGAAGAGCAGGTGATGTCAGTATTG  148461

Query  925     CGGCGACCGGGCCAGCGCTACAAAGGCAAGGACCGCAAGCGCCGCGCAGCCGTGACGATT  984
               || || || |||||||| || ||||| |  || ||||||||||| || |||  ||| |||
Sbjct  148460  CGTCGTCCAGGCCAGCGATATAAAGGGAGAGATCGCAAGCGCCGTGCTGCCACGACAATT  148401

Query  985     CAGAACTTCT-TCCGCATGTGGTGGAACCAGAAGAAGTACAGTCGCTTCCG--CCACC-A  1040
               || | ||| | | || |||||||  | ||    |  ||||   || |  ||  ||| | |
Sbjct  148400  CA-AGCTTGTGTGCGAATGTGGTCAATCCGCCGGCGGTACGTCCGATCGCGTGCCAGCGA  148342

Query  1041    CCTCGCGAGCGTCGTGGCCATTCAACGCGTCTGGCGCGTGTATGCGAGCCACGATGACCT  1100
               | ||  | ||  || |   ||||| |  |  ||||||   |||    |||| |  |  ||
Sbjct  148341  CATCA-GTGCTACGAGA--ATTCAGCTTGCTTGGCGCTCTTATAGTTGCCATGCAGCACT  148285

Query  1101    CAAGCGCAGGAT-CAAGAGC--CAGCGAGATCAGCAGCACGCGCAGTGGGAAGCCAAGAT  1157
               |||     |  | | ||||   |  |||||   ||||| || |  |||||||||   |||
Sbjct  148284  CAAAACTCGTTTGCGAGAGGTTCGTCGAGA---GCAGCTCGAGAGGTGGGAAGCTCGGAT  148228

Query  1158    GCAACGGCTCA-AGCGCGACTGGATACGCATCAAAGGCAACCGCCGCGTGGTCATTCACG  1216
               |||    || | | ||| | |||   |  ||   |||    || || |||||| | || |
Sbjct  148227  GCAGGACCTGAGAACGCAA-TGGCCTCAAATTGCAGGGCGTCGACGTGTGGTCGTGCATG  148169

Query  1217    TGCCATCCTTCTCAGTTGACGAACGCTTGCGTCTCAGCGCCGACAATTTCTCGGTCAAGC  1276
               |||| || || ||  | || |||| ||  || ||||| || || || ||| | ||  |||
Sbjct  148168  TGCCGTCGTTATCGCTCGATGAACACTCCCGCCTCAGTGCTGAGAACTTCGCCGTGCAGC  148109

Query  1277    AGAATCTCCAGCTTTCGCGACTCTGCG--GCCTCG-TCGACTCGAACGTAGACATT---G  1330
               |||| || || ||| ||||  | || |  ||  || | |||||| | || ||  |    |
Sbjct  148108  AGAACCTTCAACTTACGCGGATATGTGCTGCAGCGCTGGACTCGCATGTTGATCTGCTAG  148049

Query  1331    TCTATGTCTCACCCTTTGAGCTCACGACGGACGTGGTGCAATACTCAATGAAGCTTCTAC  1390
               ||||||| || || || ||||||||| | || ||   ||| ||||   | || || || |
Sbjct  148048  TCTATGTGTCTCCGTTCGAGCTCACGGCTGATGTCTCGCAGTACTTCCTCAAACTGCTTC  147989

Query  1391    AGCTTGGCGGCATCGCCGACCCCGTCG--CTCGCGTGAAGCTCGTCTTTCCCGAGCATGC  1448
               ||||||||||  | || ||  | ||||  |||| |||||||| ||||| |||||||| ||
Sbjct  147988  AGCTTGGCGGACTTGCTGA--CAGTCGGCCTCGTGTGAAGCTTGTCTTCCCCGAGCAAGC  147931

Query  1449    ACCGCGGTTCCCGACACACTTCTCGCTCACGACGCTCTTGCTGTATTCCCCACACTGTCT  1508
                 |||| ||||||   |||||||| ||  || |  |  |||| || || || ||||||||
Sbjct  147930  TGCGCGCTTCCCGGACCACTTCTCTCTGTCGTCATTGCTGCTCTACTCGCCTCACTGTCT  147871

Query  1509    TCGCCGTATCCAGCGGTACATCAAGAACAAGGAGGCGTACCTGGTCACGGGCATGCCCGG  1568
                || || || | ||  ||||       ||| || || ||||| || | |||  |||||||
Sbjct  147870  GCGGCGGATTCGGCATTACACTGCTGGCAAAGAAGCTTACCTCGTGATGGGGTTGCCCGG  147811

Query  1569    TCCAGAGGATAAGCGTCTCGCCATGGCGCTCAATGTGCCGATCCTCGGTATG-GATCCGC  1627
               | | || ||  | || || ||  | |||||  || |||||||||| |||  |  | | ||
Sbjct  147810  TGCTGAAGACCAACGACTAGCGGTTGCGCTGGATCTGCCGATCCTGGGTGCGCCACCAGC  147751

Query  1628    TCAGCGCCCTGCCACTCATGACCAAGTCTGGTGGCAAGCGCTTCTTCATGCGCGCCGACG  1687
               |||  ||||| || ||  | ||    || || |||||| |  |  | || |||||||| |
Sbjct  147750  TCA-AGCCCTACCGCTTCTCACTCGCTCCGGAGGCAAGAGGCTGCTGATACGCGCCGATG  147692

Query  1688    TGAATGTGCCCACGGGCACGTACGACATTTACGACGAGGACGAGCTCGTGTTCTCGCTCG  1747
               |||| || ||||||||||| |||||  | ||||||||| |||||||  |     ||||||
Sbjct  147691  TGAACGTTCCCACGGGCACCTACGAGCTGTACGACGAGCACGAGCTTTTTGCAGCGCTCG  147632

Query  1748    CCAAGCTCATCGTCTCGCACATTGAGCAGAGCGTGTGGGTGCTCAAGATCGACTATGACC  1807
               |||| |||   ||| | ||||| ||||||     |||| | || ||| ||||||| ||||
Sbjct  147631  CCAAACTCGCTGTCGCACACATGGAGCAGCCAAAGTGGCTACTGAAGCTCGACTACGACC  147572

Query  1808    CGTTCAGCACAGGCACAGCGCTGCTTGACGTCTCAACCATGGTGGCACTGCGTGAGATTC  1867
               |  |  | |  ||   |||  || ||||| | ||    |||   ||  |||| ||| | |
Sbjct  147571  CTCTTGGTATCGGTGAAGCTGTGGTTGACCTGTCGGGAATGCAAGCGATGCGGGAGCTAC  147512

Query  1868    GACGCGAGAAGAGAAGTCCCGAGTACTGGAGGCAGCCTGGGACGCGAGACAACGCCGC--  1925
               | ||||| ||| | |  || ||||||||| | || || ||  | || |||   |||||  
Sbjct  147511  GGCGCGAAAAGCGGACGCCAGAGTACTGGCGACAACCGGGACCTCGTGACGCTGCCGCTA  147452

Query  1926    -GCGCGTGATCATCGCCGAGCTGGAGCG  1952
                || ||||    | || |||||||||||
Sbjct  147451  AGCTCGTG---CTAGCAGAGCTGGAGCG  147427

 Score = 142 bits (157),  Expect = 7e-31
 Identities = 167/226 (74%), Gaps = 0/226 (0%)
 Strand=Plus/Minus

Query  2628    GTACATCTTCCACCCGAACGTGTCGACCATGCAGTACAGCGCCTTCTTCCACACCTGTCG  2687
               |||| | ||||||||| ||||| | || |||||||||   ||||| |||||| | || ||
Sbjct  146692  GTACGTGTTCCACCCGCACGTGACCACGATGCAGTACTCTGCCTTTTTCCACGCTTGCCG  146633

Query  2688    GCTGCACGGCGTCTGCTTCGACGTGGAGCGCTGTGTGGGCTCGGTCTTTCTCCTTGCCGA  2747
               |||||||||||| || || |||||||||||     ||||  || |||| || || |||||
Sbjct  146632  GCTGCACGGCGTGTGTTTTGACGTGGAGCGTACGTTGGGTACGCTCTTCCTGCTCGCCGA  146573

Query  2748    CAGCCTCACGGCCGGTGTCTTCGGCCTCATGTGCTGCAGCGACACGGCGAGCGGCGCGCT  2807
               ||| ||||| || || ||||||||| || || ||    |||| ||| |    || ||  |
Sbjct  146572  CAGTCTCACTGCTGGAGTCTTCGGCATCTTGAGCGTTGGCGAGACGACTGAAGGTGCATT  146513

Query  2808    GGGCTTTCTACGCACAGCGCTGGAAGTGGTCGGCCGGGAGGTGGGC  2853
               ||  || || ||||| || || || ||| | ||||| ||||| |||
Sbjct  146512  GGCGTTCCTGCGCACTGCACTCGAGGTGATTGGCCGCGAGGTCGGC  146467

>PHCA:scaffold_84 PHYCAscaffold_84
Length=182275

 Score = 339 bits (375),  Expect = 5e-90
 Identities = 892/1339 (67%), Gaps = 32/1339 (2%)
 Strand=Plus/Plus

Query  597     GGACGAGTTGCGCAAGAATGTCGAGAAGATCCGCGGGTACAACGAGCTGCTGGACACGTA  656
               ||| ||| || ||   || ||||| |||||||| || ||||| |||||| ||||  | ||
Sbjct  102603  GGAGGAGCTGGGCGCCAACGTCGACAAGATCCGGGGATACAATGAGCTGTTGGATGCTTA  102662

Query  657     CAGTCTCCACCAGTTCATCATCCACAAAGGCCGCGCGATGCGCGAGACGCCTGAGTTTGT  716
               |||  | ||||||||  | || ||||| || ||  ||||| | || || || |||||  |
Sbjct  102663  CAGCTTGCACCAGTTTTTGATTCACAAGGGACGGACGATGAGAGATACCCCCGAGTTCAT  102722

Query  717     GTCCTTCAAGCGCGTGGCGCAGGAGGTTTGGGGCAGCGTCGATGAAGTGATCAAGGCACT  776
                |||||| | || ||||| |||||| ||||||| ||||| || ||||   |    || ||
Sbjct  102723  CTCCTTCCACCGGGTGGCACAGGAGCTTTGGGGAAGCGTGGAAGAAGCCTTACGAGCTCT  102782

Query  777     CGAGGCGCTGCTCACGCGCTACTTCGTGCCTCTCGCGTACGTCGACGGCCAGCGACTCAT  836
               |||| | || ||||| | ||| || || || || |||||||| || || |||||  |  |
Sbjct  102783  CGAGACACTTCTCACTCACTATTTTGTTCCCCTGGCGTACGTGGATGGTCAGCGCTTGCT  102842

Query  837     GACGGTCGCGGCGA-TGGAGATGGCGTC-CTACAGCAAGCGGGACCTGCTCTCGTGCATC  894
                 |  | || || | |||  |   | || || |   ||||| ||  |  | || ||||||
Sbjct  102843  CTCCCTAGCAGCTACTGGTCAA--CCTCGCTTCTCGAAGCGAGAATTATTGTCCTGCATC  102900

Query  895     GTCAACGAGGACCAGGTCG-GGTCGCTCATCCGGCGACCGGGCCAGCGCTACAAAGGCAA  953
               ||||| || || |||||   || ||| | | || || || |||||||| |||||||| | 
Sbjct  102901  GTCAATGAAGAGCAGGTGATGGCCGCAC-TGCGACGTCCAGGCCAGCGATACAAAGGAAG  102959

Query  954     GGACCGCAAGCGCCGCGCAGCCGTGACGATTCAGAACTTCT-TCCGCATGTGGTGGAACC  1012
                |||||||||||||| || |||   || || || | ||| | | || ||||||  |  ||
Sbjct  102960  AGACCGCAAGCGCCGTGCTGCCACTACCATCCA-AGCTTTTGTTCGGATGTGGGCGGCCC  103018

Query  1013    AGAAGAAGTACAGTCGCTTCCG--CCACC-ACCTCGCGAGCGTCGTGGCCATTCAACGCG  1069
                      ||||  ||| |  ||  |||   || |    | || |      ||||| |  |
Sbjct  103019  GTCGCCGGTACGCTCGGTCTCGAGCCAGGGACATT---AACGCCACCAGAATTCAGCTTG  103075

Query  1070    TCTGGCGCGTGTATGCGAGCCACGATGACCTCAAGCGCAGGATCAAGAGCCAG---CGAG  1126
                 |||||||  ||     ||||||  |  || ||  ||  ||  | |||  ||   ||| 
Sbjct  103076  CTTGGCGCGCCTACAGCTGCCACGCAGCTCTTAAA-GCTCGACTACGAG--AGGTTCGAC  103132

Query  1127    ATCAGCAGCACGCGCAGTGGGAAGCCAAGATGCAACGGCTCAAGCGCGACTGGATACGCA  1186
                | |||| |  | | | ||||||||   |||||| ||  | ||   | | |||   |  |
Sbjct  103133  GTGAGCAACTGGAGAAATGGGAAGCGCGGATGCACCGCTTAAAATCCCAATGGGCTCAGA  103192

Query  1187    TCAAAGGCAACCGCCGCGTGGTCATTCACGTGCCATCCTTCTCAGTTGACGAACGCTTGC  1246
               ||  | |  |||| || || ||  | |||||||| ||||| ||  | ||||||  || ||
Sbjct  103193  TCGCAAGTCACCGGCGTGTCGTTGTCCACGTGCCGTCCTTGTCGCTCGACGAATACTCGC  103252

Query  1247    GTCTCAGCGCCGACAATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCG--G  1304
               ||||||| || || || ||  | ||   ||||||||| || ||  | ||  ||||||  |
Sbjct  103253  GTCTCAGTGCTGAAAACTTGGCAGTGCGGCAGAATCTTCAACTCACTCGGATCTGCGCTG  103312

Query  1305    CCTCGTCG-ACTCGAACGTAGACATT---GTCTATGTCTCACCCTTTGAGCTCACGACGG  1360
               |  ||| | ||||   ||| ||  ||   || || || || || || |||||||||||||
Sbjct  103313  CTGCGTTGGACTCCCGCGTGGATCTTCTAGTGTACGTGTCGCCTTTCGAGCTCACGACGG  103372

Query  1361    ACGTGGTGCAATACTCAATGAAGCTTCTACAGCTTGGCGGCATCGCCGACCCCGTCG--C  1418
               ||||    || ||||  || ||||| ||||||||||| ||| |||| ||  | ||||  |
Sbjct  103373  ACGTTTCCCAGTACTTCATCAAGCTGCTACAGCTTGGTGGCCTCGCTGA--CAGTCGACC  103430

Query  1419    TCGCGTGAAGCTCGTCTTTCCCGAGCATGCACCGCGGTTCCCGACACACTTCTCGCTCAC  1478
               ||| || || ||  | ||||||||||| ||  ||||||| ||  | || ||||||||| |
Sbjct  103431  TCGAGTCAAACTACTTTTTCCCGAGCAAGCCACGCGGTTTCCAGCGCATTTCTCGCTCTC  103490

Query  1479    GACGCTCTTGCTGTATTCCCCACACTGTCTTCGCCGTATCCAGCGGTACATCAAGAACAA  1538
               | || |  |||| || || || || ||||| || ||||| |  |  ||||        ||
Sbjct  103491  GTCGTTGCTGCTTTACTCACCGCATTGTCTACGGCGTATTCGACATTACACTGCTGGGAA  103550

Query  1539    GGAGGCGTACCTGGTCACGGGCATGCCCGGTCCAGAGGATAAGCGTCTCGCCATGGCGCT  1598
                || ||||| || |||| |||  |||| ||| | |||||| |||| || || ||| || |
Sbjct  103551  AGAAGCGTATCTCGTCATGGGACTGCCTGGTGCGGAGGATCAGCGCCTAGCGATGACGTT  103610

Query  1599    CAATGTGCCGATCCTCGGTATGGATCC-GCTCAGCGCCCTGCCACTCATGACCAAGTCTG  1657
                 |  ||||||||||||||  |   || |||||  || || || ||  | ||    || |
Sbjct  103611  GGACTTGCCGATCCTCGGTGCGCCGCCAGCTCA-AGCTCTACCGCTGCTCACGCGTTCGG  103669

Query  1658    GTGGCAAGCGCTTCTTCATGCGCGCCGACGTGAATGTGCCCACGGGCACGTACGACATTT  1717
               | |||||||| || || || || || || || ||||| ||| | || || |||||  | |
Sbjct  103670  GAGGCAAGCGGTTGTTGATTCGAGCGGATGTCAATGTCCCCGCTGGTACTTACGAGCTGT  103729

Query  1718    ACGACGAGGACGAGCTCGTGTTCTCGCTCGCCAAGCTCATCGTCTCGCACATTGAGCAGA  1777
               |||||||| |||||||| | | | | || ||||||||   |||  ||||||| || ||  
Sbjct  103730  ACGACGAGCACGAGCTCTTCTCCGCTCTGGCCAAGCTTGCCGTTGCGCACATGGATCAAC  103789

Query  1778    GCGTGTGGGTGCTCAAGATCGACTATGACCCGTTCAGCACAGGCACAGCGCTGCTTGACG  1837
                |  |||| || ||||| |||| ||||||||  |  ||   ||    ||| |  | ||  
Sbjct  103790  CCAAGTGGTTGTTCAAGCTCGATTATGACCCTCTTGGCGTGGGGGAGGCGGTCGTGGATC  103849

Query  1838    TCTCAACCATGGTGGCACTGCGTGAGATTCGACGCGAGAAGAGAAGTCCCGAGTACTGGA  1897
               | ||    |||  |||  |||||||| | ||  | || ||| |||  || ||||| ||| 
Sbjct  103850  TGTCCGGGATGCAGGCGATGCGTGAGTTACGGAGAGAAAAGCGAACGCCGGAGTATTGGC  103909

Query  1898    GGCAGCCTGGGACGCGAGA  1916
               |||| || ||| | || ||
Sbjct  103910  GGCAACCAGGGCCACGTGA  103928

 Score = 136 bits (150),  Expect = 3e-29
 Identities = 165/225 (73%), Gaps = 0/225 (0%)
 Strand=Plus/Plus

Query  2628    GTACATCTTCCACCCGAACGTGTCGACCATGCAGTACAGCGCCTTCTTCCACACCTGTCG  2687
               |||| | ||||| ||| ||||| | ||||||||||||| ||||||||||||| |||| ||
Sbjct  104696  GTACGTGTTCCATCCGCACGTGACCACCATGCAGTACACCGCCTTCTTCCACGCCTGCCG  104755

Query  2688    GCTGCACGGCGTCTGCTTCGACGTGGAGCGCTGTGTGGGCTCGGTCTTTCTCCTTGCCGA  2747
                || |||||||| ||||| ||||||||| |     ||||| |  |||| || ||||| ||
Sbjct  104756  ACTACACGGCGTGTGCTTTGACGTGGAGAGGACCTTGGGCACACTCTTCCTGCTTGCTGA  104815

Query  2748    CAGCCTCACGGCCGGTGTCTTCGGCCTCATGTGCTGCAGCGACACGGCGAGCGGCGCGCT  2807
               ||| ||||| || || || || ||| || || ||    | || ||| ||   || ||  |
Sbjct  104816  CAGTCTCACCGCTGGGGTGTTTGGCGTCTTGAGCATTGGAGAGACGACGGAAGGAGCTTT  104875

Query  2808    GGGCTTTCTACGCACAGCGCTGGAAGTGGTCGGCCGGGAGGTGGG  2852
               ||  ||  | || || || || || ||| ||||||| ||||| ||
Sbjct  104876  GGCGTTCTTGCGTACTGCACTAGAGGTGATCGGCCGTGAGGTTGG  104920

 Score = 43.7 bits (47),  Expect = 0.51
 Identities = 28/31 (90%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  2210    CGTTTCCTCAGACTGCAGCGCCGTACGAAGC  2240
               ||||||| ||||||||||||||  |||||||
Sbjct  104243  CGTTTCCACAGACTGCAGCGCCACACGAAGC  104273

>PYAR:scaffold_29 par_scaffold_29 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_29:1:42963:1 
REF
Length=42963

 Score = 327 bits (362),  Expect = 9e-87
 Identities = 342/459 (75%), Gaps = 41/459 (9%)
 Strand=Plus/Minus

Query  583    GACGCGAACGCCATGGACGAGTTGCGCAAGAATGTCGAGAAGATCCGCGGGTACAACGAG  642
              ||||| ||||||||||||||  | || || ||||| || ||||| || || |||||||||
Sbjct  14504  GACGCCAACGCCATGGACGATCTCCGTAAAAATGTGGAAAAGATTCGTGGATACAACGAG  14445

Query  643    CTGCTGGACACGTACAGTCTCCACCAGTTCATCATCCACAAAGGCCGCGCGATGCGCGAG  702
              ||||| |||||||||||||||||||||||||||||||| || || |||||||||||||||
Sbjct  14444  CTGCTCGACACGTACAGTCTCCACCAGTTCATCATCCATAAGGGTCGCGCGATGCGCGAG  14385

Query  703    ACGCCTGAGTTTGTGTCCTTCAAGCGCGTGGCGCAGGAGGTTTGGGGCAGCGTCGATGAA  762
              || || |||||   ||| |||||||||||||  || ||| ||||||||  |||||| |||
Sbjct  14384  ACCCCCGAGTTCCAGTCGTTCAAGCGCGTGGGCCAAGAGATTTGGGGCGCCGTCGACGAA  14325

Query  763    GTGATCAAGGCACTCGAGGCGCTGCTCACGCGCTACTTCGTGCCTCTCGCGTACGT----  818
              ||||||   || |||||||||||||||||||||||||| ||||| ||||| | | |    
Sbjct  14324  GTGATCCGCGCGCTCGAGGCGCTGCTCACGCGCTACTTTGTGCCGCTCGCCTTCATNNNN  14265

Query  819    ---------------------------------CGACGGCCAGCGACTCATGACGGTCGC  845
                                                  ||||||||| ||||||  ||||||
Sbjct  14264  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCCAGCGGCTCATGGTGGTCGC  14205

Query  846    GGCGATGGAGATGGCGTC--CTACAGCAAGCGGGACCTGCTCTCGTGCATCGTCAACGAG  903
               || ||||||||||||||   | |  | |||| |  |||||||||||  | ||||| || 
Sbjct  14204  AGCCATGGAGATGGCGTCGTTTCCGACCAGCGTG--CTGCTCTCGTGTGTGGTCAATGAA  14147

Query  904    GACCAGGTCGGGTCGCTCATCCGGCGACCGGGCCAGCGCTACAAAGGCAAGGACCGCAAG  963
              |||||||||| ||||||  | || || || |||||||| ||||| |||||||||||||||
Sbjct  14146  GACCAGGTCGCGTCGCTGCTGCGACGGCCCGGCCAGCGGTACAAGGGCAAGGACCGCAAG  14087

Query  964    CGCCGCGCAGCCGTGACGATTCAGAACTTCTTCCGCATG  1002
              ||||| || ||   |||| | |||   || |||||||||
Sbjct  14086  CGCCGTGCTGCAACGACGCTGCAGGCGTTTTTCCGCATG  14048

 Score = 124 bits (137),  Expect = 2e-25
 Identities = 100/121 (83%), Gaps = 0/121 (0%)
 Strand=Plus/Minus

Query  1655   CTGGTGGCAAGCGCTTCTTCATGCGCGCCGACGTGAATGTGCCCACGGGCACGTACGACA  1714
              |||| | ||||||||| ||| |    |||||||| || ||||||||||||||||||||  
Sbjct  13347  CTGGCGCCAAGCGCTTGTTCCTCAAGGCCGACGTCAACGTGCCCACGGGCACGTACGATC  13288

Query  1715   TTTACGACGAGGACGAGCTCGTGTTCTCGCTCGCCAAGCTCATCGTCTCGCACATTGAGC  1774
              | |||||||  ||||||||| ||||| ||||||||||||||||| |||||||| | || |
Sbjct  13287  TCTACGACGTCGACGAGCTCCTGTTCGCGCTCGCCAAGCTCATCATCTCGCACCTCGACC  13228

Query  1775   A  1775
              |
Sbjct  13227  A  13227

 Score = 82.4 bits (90),  Expect = 6e-13
 Identities = 123/168 (73%), Gaps = 9/168 (5%)
 Strand=Plus/Minus

Query  1201   CGCGTGGTCATTCACGTGCCATCCTTCTCAGTTGACGA--ACGCTTGCGTCTCAGCGCCG  1258
              ||||||||| | |||||||||||  | ||  | |||||  ||||  |||| || ||  ||
Sbjct  13849  CGCGTGGTCGTCCACGTGCCATCACTGTCGCTCGACGAGCACGCGCGCGTGTC-GC-TCG  13792

Query  1259   ACAATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCC-TCGTCGACTCG  1317
              || | ||  ||||  ||||||| || |||||  |||| ||  |||||| |||| ||| ||
Sbjct  13791  ACCACTTTGCGGTGCAGCAGAACCTGCAGCTCGCGCGGCT-AGCGGCCGTCGTGGACGCG  13733

Query  1318   AACGTAG---ACATTGTCTATGTCTCACCCTTTGAGCTCACGACGGAC  1362
              | ||| |   || | ||||| ||||| || ||||||||  | ||||||
Sbjct  13732  ACCGTCGAGTACGTCGTCTACGTCTCGCCGTTTGAGCTGCCCACGGAC  13685

 Score = 56.3 bits (61),  Expect = 8e-05
 Identities = 60/77 (78%), Gaps = 2/77 (3%)
 Strand=Plus/Minus

Query  2653   ACCATGCAGTACAGC-GCCTTCTTCCACACCTGTCGGCTGCACGGCGTCTGCTTCGACGT  2711
              ||||||| | || || |||||||||| | | || || |  | ||||||||||||||||||
Sbjct  12312  ACCATGCCG-ACGGCCGCCTTCTTCCTCGCGTGCCGCCGCCGCGGCGTCTGCTTCGACGT  12254

Query  2712   GGAGCGCTGTGTGGGCT  2728
              |  |||| | || ||||
Sbjct  12253  GACGCGCCGCGTCGGCT  12237

 Score = 46.4 bits (50),  Expect = 0.042
 Identities = 37/45 (82%), Gaps = 0/45 (0%)
 Strand=Plus/Minus

Query  2744   CCGACAGCCTCACGGCCGGTGTCTTCGGCCTCATGTGCTGCAGCG  2788
              ||||||||||||||||||| ||||||| | ||  | || || |||
Sbjct  12190  CCGACAGCCTCACGGCCGGCGTCTTCGCCGTCTGGAGCAGCGGCG  12146

>PYAP:scaffold_162 pag1_scaffold_162 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_162:1:52209:1 
REF
Length=52209

 Score = 270 bits (299),  Expect = 2e-69
 Identities = 310/417 (74%), Gaps = 0/417 (0%)
 Strand=Plus/Plus

Query  586    GCGAACGCCATGGACGAGTTGCGCAAGAATGTCGAGAAGATCCGCGGGTACAACGAGCTG  645
              || ||| | ||||| ||  |||| || || || |||||||| || || ||||| ||||| 
Sbjct  21848  GCAAACTCAATGGAAGATCTGCGGAACAACGTGGAGAAGATACGAGGCTACAATGAGCTA  21907

Query  646    CTGGACACGTACAGTCTCCACCAGTTCATCATCCACAAAGGCCGCGCGATGCGCGAGACG  705
              || ||  |||| || || ||||||||||||||||| ||||| |||||  |||| || || 
Sbjct  21908  CTAGATGCGTATAGCCTGCACCAGTTCATCATCCATAAAGGGCGCGCCTTGCGAGACACA  21967

Query  706    CCTGAGTTTGTGTCCTTCAAGCGCGTGGCGCAGGAGGTTTGGGGCAGCGTCGATGAAGTG  765
              || |||||   ||| |||||||| || || || ||| | ||||| ||| |||| || || 
Sbjct  21968  CCCGAGTTCCAGTCATTCAAGCGTGTTGCTCAAGAGATCTGGGGAAGCATCGAAGAGGTC  22027

Query  766    ATCAAGGCACTCGAGGCGCTGCTCACGCGCTACTTCGTGCCTCTCGCGTACGTCGACGGC  825
              ||| |||| ||||||    ||||||| |||||||| ||||| || || ||| | ||||||
Sbjct  22028  ATCCAGGCTCTCGAGATCTTGCTCACACGCTACTTTGTGCCCCTTGCTTACATTGACGGC  22087

Query  826    CAGCGACTCATGACGGTCGCGGCGATGGAGATGGCGTCCTACAGCAAGCGGGACCTGCTC  885
              || ||  | |||||  ||||  | |||||||||||      |   |   | || ||||||
Sbjct  22088  CAACGTTTAATGACTCTCGCATCCATGGAGATGGCCAAGCTCTCGACTTGTGAACTGCTC  22147

Query  886    TCGTGCATCGTCAACGAGGACCAGGTCGGGTCGCTCATCCGGCGACCGGGCCAGCGCTAC  945
               | ||| | || ||||||||||| || |  ||||| ||||| || ||||| ||||| |||
Sbjct  22148  ACTTGCGTTGTGAACGAGGACCAAGTTGCATCGCTGATCCGCCGCCCGGGGCAGCGATAC  22207

Query  946    AAAGGCAAGGACCGCAAGCGCCGCGCAGCCGTGACGATTCAGAACTTCTTCCGCATG  1002
              |||||||| |||||||| |||||||| ||   |||  | ||   ||| |||||||||
Sbjct  22208  AAAGGCAAAGACCGCAAACGCCGCGCTGCTACGACCCTCCAAGCCTTTTTCCGCATG  22264

 Score = 237 bits (262),  Expect = 1e-59
 Identities = 452/661 (68%), Gaps = 5/661 (1%)
 Strand=Plus/Plus

Query  1270   GTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCCTCGTCGACTCGAACGTAGACATT  1329
              ||||||||||| || ||||| || || |||   || ||||| ||   ||| ||||| || 
Sbjct  22532  GTCAAGCAGAACCTACAGCTGTCTCGCCTCGCAGGACTCGTGGATCAGAATGTAGAGATC  22591

Query  1330   GTCTATGTCTCACCCTTTGAGCTCACGACGGACGTGGTGCAATACTCAATGAAGCTTCTA  1389
              || || ||  | || || |||||  |||| || |||  ||||||||  || ||||| || 
Sbjct  22592  GTGTACGTGACGCCGTTCGAGCTGTCGACTGAAGTGTCGCAATACTTCATCAAGCTGCTG  22651

Query  1390   CAGCTTGGCGGCATCGCCGACCCCGTCGCTCGCGTGAAGCTCGTCTTTCCCGAGCATGCA  1449
              |||||  |||| |||||| || |     | || ||    || || ||||| ||||| |||
Sbjct  22652  CAGCTGAGCGGAATCGCCAACGCGCATACGCGAGTCCGACTAGTGTTTCCAGAGCACGCA  22711

Query  1450   CCGCGGTTCCCGACACACTTCTCGCTCACGACGCTCTTGCTGTATTCCCCACACTGTCTT  1509
               | | ||| |||   |||||||||||| |||| |   |  | || |||||| ||||  | 
Sbjct  22712  GCTCAGTTTCCGCAGCACTTCTCGCTCGCGACCCATCTCATCTACTCCCCAAACTGCATA  22771

Query  1510   CGCCGTATCCAGCG-GTACATCAAGAACAAGGAGGCGTACCTGGTCACGGGCATGCCCGG  1568
              || || ||||||||  ||   ||||  ||| || || ||| |||| | |||  | |||||
Sbjct  22772  CGTCGCATCCAGCGACTAGTCCAAG-GCAAAGAAGCCTACTTGGTGATGGGTGTACCCGG  22830

Query  1569   TCCAGAGGATAAGCGTCTCGCCATGGCGCTCAATGTGCCGATCCTCGGTATGGA--TCCG  1626
              ||| || ||| | || |||||  |||| ||  | || || ||||| ||    ||   || 
Sbjct  22831  TCCCGAAGATCAACGACTCGCAGTGGCTCTTCAAGTCCCCATCCTGGGGCCTGAAGACCC  22890

Query  1627   CTCAGC-GCCCTGCCACTCATGACCAAGTCTGGTGGCAAGCGCTTCTTCATGCGCGCCGA  1685
                || |    ||||| ||||||||    || ||  ||||||| ||||||||    || ||
Sbjct  22891  AACATCAATTCTGCCGCTCATGACTCGCTCAGGAAGCAAGCGGTTCTTCATCAAAGCGGA  22950

Query  1686   CGTGAATGTGCCCACGGGCACGTACGACATTTACGACGAGGACGAGCTCGTGTTCTCGCT  1745
               ||||||||||| || || || ||||| || || |||   ||||| ||  |||||||| |
Sbjct  22951  TGTGAATGTGCCGACAGGTACCTACGATATCTATGACATCGACGAACTGTTGTTCTCGTT  23010

Query  1746   CGCCAAGCTCATCGTCTCGCACATTGAGCAGAGCGTGTGGGTGCTCAAGATCGACTATGA  1805
               || || |||||| |||||||  |  | || | ||| ||| | || ||  | |||   ||
Sbjct  23011  AGCGAAACTCATCATCTCGCATCTGAATCAAAACGTTTGGCTCCTGAAACTGGACGCGGA  23070

Query  1806   CCCGTTCAGCACAGGCACAGCGCTGCTTGACGTCTCAACCATGGTGGCACTGCGTGAGAT  1865
               || ||  ||||||| |||||  | || ||||| ||    |||  | |  |||| || ||
Sbjct  23071  TCCCTTGGGCACAGGTACAGCAATACTCGACGTGTCGTTGATGACGACGTTGCGGGATAT  23130

Query  1866   TCGACGCGAGAAGAGAAGTCCCGAGTACTGGAGGCAGCCTGGGACGCGAGACAACGCCGC  1925
               ||||| || ||| |    || |||||||||| |||||| || |  ||||||| |  |||
Sbjct  23131  CCGACGAGAAAAGCGGCCGCCAGAGTACTGGAAGCAGCCAGGCATACGAGACACCATCGC  23190

Query  1926   G  1926
              |
Sbjct  23191  G  23191

 Score = 137 bits (151),  Expect = 3e-29
 Identities = 119/148 (80%), Gaps = 0/148 (0%)
 Strand=Plus/Plus

Query  2625   CGAGTACATCTTCCACCCGAACGTGTCGACCATGCAGTACAGCGCCTTCTTCCACACCTG  2684
              ||||||  | || ||||| || ||    | ||||  ||||| ||||||||||||||| ||
Sbjct  23830  CGAGTATGTGTTTCACCCCAATGTCAGCATCATGTCGTACAACGCCTTCTTCCACACATG  23889

Query  2685   TCGGCTGCACGGCGTCTGCTTCGACGTGGAGCGCTGTGTGGGCTCGGTCTTTCTCCTTGC  2744
               || || |||||||||||||||||||| ||||||||||| |||||||| || ||| | ||
Sbjct  23890  CCGCCTCCACGGCGTCTGCTTCGACGTTGAGCGCTGTGTTGGCTCGGTATTCCTCTTAGC  23949

Query  2745   CGACAGCCTCACGGCCGGTGTCTTCGGC  2772
               |||||||| ||||| ||  ||||||||
Sbjct  23950  AGACAGCCTGACGGCTGGGATCTTCGGC  23977

>PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_98.1_contig_1:1:103693:1 
REF
Length=103693

 Score = 247 bits (273),  Expect = 2e-62
 Identities = 501/731 (69%), Gaps = 16/731 (2%)
 Strand=Plus/Plus

Query  1197   CCGCCGCGTGGTCATTCACGTGCCATCCTTCTCAGTTGACGAACGCTTGCGTCTCAGCGC  1256
              ||| || || ||| ||||||| ||||| || ||| |||||||||  |  || ||  | ||
Sbjct  70280  CCGACGTGTCGTCGTTCACGTCCCATCATTATCACTTGACGAACATTCTCGCCTTGGAGC  70339

Query  1257   CGACAATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCG--GCCTCG-TCGA  1313
               || || ||| | ||  |||| ||||| |||||  ||||  | ||||  ||  || | ||
Sbjct  70340  TGAGAACTTCGCCGTGCAGCAAAATCTTCAGCTCACGCGGATATGCGCTGCAGCGCTGGA  70399

Query  1314   CTCGAACGTAGACAT---TGTCTATGTCTCACCCTTTGAGCTCACGACGGACGTGGTGCA  1370
              ||| ||||| ||| |   ||| ||||| || || || ||||||||| | |||||   |||
Sbjct  70400  CTCCAACGTCGACCTCCTTGTGTATGTGTCCCCTTTCGAGCTCACGGCTGACGTCTCGCA  70459

Query  1371   ATACTCAATGAAGCTTCTACAGCTTGGCGGCATCGCCGACC-CCGTCGCTCGCGTGAAGC  1429
               ||||   | ||||| || || ||||||||  | || |||  ||| | ||||||||||||
Sbjct  70460  GTACTTCCTCAAGCTGCTGCAACTTGGCGGACTTGCTGACAGCCGAC-CTCGCGTGAAGC  70518

Query  1430   TCGTCTTTCCCGAGCATGCACCGCGGTTCCCGACACACTTCTCGCTCACGACGCTCTTGC  1489
              |||| ||||| || || ||   ||| ||||| |  || ||||| ||  || | ||  |||
Sbjct  70519  TCGTGTTTCCAGAACAGGCTTTGCGTTTCCCAAGTCATTTCTCTCTATCGTCTCTGCTGC  70578

Query  1490   TGTATTCCCCACACTGTCTTCGCCGTATCC--AGCGGTACATCAAGAACAAGGAGGCGTA  1547
              ||||||| ||||||||| |  | ||||| |    |  |||| |  ||  ||||| || ||
Sbjct  70579  TGTATTCTCCACACTGTTTAAGGCGTATTCGACACTATACAGCTGGA--AAGGATGCCTA  70636

Query  1548   CCTGGTCACGGGCATGCCCGGTCCAGAGGATAAGCGTCTCGCCATGGCGCTCAATGTGCC  1607
              ||| || | |||  | || ||| | || ||| |||| || || || ||  |  || ||||
Sbjct  70637  CCTCGTGATGGGACTACCTGGTGCCGAAGATCAGCGACTAGCTATCGCATTAGATCTGCC  70696

Query  1608   GATCCTCGGTATG-GATCCGCTCAGCGCCCTGCCACTCATGACCAAGTCTGGTGGCAAGC  1666
              |||| | |||  |  | | |||||| |||||||| ||  | ||    || || || || |
Sbjct  70697  GATCTTGGGTGCGCCACCAGCTCAG-GCCCTGCCGCTACTCACACGCTCGGGAGGTAAAC  70755

Query  1667   GCTTCTTCATGCGCGCCGACGTGAATGTGCCCACGGGCACGTACGACATTTACGACGAGG  1726
              |  | || || || || || || || ||||| |||||||| |||||  ||||||||||  
Sbjct  70756  GGCTGTTAATCCGTGCTGATGTTAACGTGCCTACGGGCACCTACGAGCTTTACGACGATC  70815

Query  1727   ACGAGCTCGTGTTCTCGCTCGCCAAGCTCATCGTCTCGCACATTGAGCAGAGCGTG-TGG  1785
              | || ||| |     |||| |||||||||   ||  |||| || || || | |  | |||
Sbjct  70816  ATGAACTCTTTGCAGCGCTTGCCAAGCTCGCTGTTACGCATATGGACCA-ACCTCGATGG  70874

Query  1786   GTGCTCAAGATCGACTATGACCCGTTCAGCACAGGCACAGCGCTGCTTGACGTCTCAACC  1845
               |||||||  ||||||| |||||  |  |    ||   |||  |  ||||| | |||   
Sbjct  70875  CTGCTCAAACTCGACTACGACCCTCTTGGTGTGGGTGAAGCCATAATTGACTTATCAGGG  70934

Query  1846   ATGGTGGCACTGCGTGAGATTCGACGCGAGAAGAGAAGTCCCGAGTACTGGAGGCAGCCT  1905
              |||   ||| |||| ||| | || || |||||  ||   || ||||| ||| | ||||| 
Sbjct  70935  ATGCAAGCAATGCGAGAGCTCCGGCGGGAGAAACGAGCACCGGAGTATTGGCGCCAGCCA  70994

Query  1906   GGGACGCGAGA  1916
              ||  |||||||
Sbjct  70995  GGCCCGCGAGA  71005

 Score = 156 bits (172),  Expect = 3e-35
 Identities = 273/395 (69%), Gaps = 2/395 (1%)
 Strand=Plus/Plus

Query  613    AATGTCGAGAAGATCCGCGGGTACAACGAGCTGCTGGACACGTACAGTCTCCACCAGTTC  672
              || ||||| ||||||||||| |||||||| ||  ||||  | |||||| | || ||||| 
Sbjct  69696  AACGTCGACAAGATCCGCGGCTACAACGAACTATTGGATGCCTACAGTTTGCATCAGTTT  69755

Query  673    ATCATCCACAAAGGCCGCGCGATGCGCGAGACGCCTGAGTTTGTGTCCTTCAAGCGCGTG  732
               | || ||||| || ||| | ||||| || ||||| |||||||| || |||   || || 
Sbjct  69756  TTAATTCACAAGGGGCGCACAATGCGGGACACGCCGGAGTTTGTATCATTCCGACGGGTA  69815

Query  733    GCGCAGGAGGTTTGGGGCAGCGTCGATGAAGTGATCAAGGCACTCGAGGCGCTGCTCACG  792
              || |||||    ||||| | ||| || || |   |    ||||| |||||  | ||||||
Sbjct  69816  GCACAGGAACAGTGGGGGAACGTTGAAGATGCTTTACGTGCACTGGAGGCTTTACTCACG  69875

Query  793    CGCTACTTCGTGCCTCTCGCGTACGTCGACGGCCAGCGACTCATGACGGTCGCGGCGATG  852
              |  ||||| || ||  | |||||| |||| ||||||||| |  || |  |||| || |  
Sbjct  69876  CAGTACTTTGTTCCATTGGCGTACATCGATGGCCAGCGATTGTTGTCACTCGCAGCCACA  69935

Query  853    GAGATGGCGTCCTACAGCAAGCGGGACCTGCTCTCGTGCATCGTCAACGAGGACCAGGTC  912
              |    | |   || |   ||  |||| ||||| || || || || || || ||||| || 
Sbjct  69936  GGTCAGTCTCGCTTCTCGAAATGGGAACTGCTGTCCTGTATTGTGAATGAAGACCAAGTT  69995

Query  913    GGGTCGCTCATCCGGCGACCGGGCCAGCGCTACAAAGGCAAGGACCGCAAGCGCCGCGCA  972
                | || |  ||||||| || ||||| || ||||| || | ||| ||||| || || || 
Sbjct  69996  ACGGCGATACTCCGGCGTCCTGGCCAACGATACAAGGGAAGGGATCGCAAACGACGTGCT  70055

Query  973    GCCGTGACGATTCAGAACTTCT-TCCGCATGTGGT  1006
              ||    ||  |||| | ||||| | ||||||||||
Sbjct  70056  GCTACAACACTTCA-AGCTTCTGTGCGCATGTGGT  70089

 Score = 118 bits (130),  Expect = 8e-24
 Identities = 167/235 (71%), Gaps = 0/235 (0%)
 Strand=Plus/Plus

Query  2614   TACGTTGTAAGCGAGTACATCTTCCACCCGAACGTGTCGACCATGCAGTACAGCGCCTTC  2673
              || || ||| ||  |||  | ||||||||  ||||| | ||||||||||||||||| || 
Sbjct  71779  TATGTGGTATGCTCGTATGTGTTCCACCCACACGTGACCACCATGCAGTACAGCGCTTTT  71838

Query  2674   TTCCACACCTGTCGGCTGCACGGCGTCTGCTTCGACGTGGAGCGCTGTGTGGGCTCGGTC  2733
              || ||| |||| || || || || || ||||| ||||||||||||    | ||| |  ||
Sbjct  71839  TTTCACGCCTGCCGCCTACATGGTGTATGCTTTGACGTGGAGCGCACACTAGGCACTCTC  71898

Query  2734   TTTCTCCTTGCCGACAGCCTCACGGCCGGTGTCTTCGGCCTCATGTGCTGCAGCGACACG  2793
              ||||| ||  | || || ||||| || |||||||| ||  |  || ||    | || || 
Sbjct  71899  TTTCTGCTCACTGATAGTCTCACAGCTGGTGTCTTTGGTGTGTTGAGCGTTGGAGAAACA  71958

Query  2794   GCGAGCGGCGCGCTGGGCTTTCTACGCACAGCGCTGGAAGTGGTCGGCCGGGAGG  2848
               |   ||| ||  |||  || || || ||||| ||||||||| |||| || ||||
Sbjct  71959  ACTGACGGTGCATTGGCATTCCTGCGTACAGCACTGGAAGTGATCGGGCGCGAGG  72013

 Score = 54.5 bits (59),  Expect = 3e-04
 Identities = 58/77 (75%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  7      CAGCACGCGCGGCTTCTGCCGAGCGTCAACAAGTGCGACCCAAGCGCGCCGACGCCCGAG  66
              ||||||   || ||||| || |||||||||||   |||||| || || || || || |||
Sbjct  69042  CAGCACTGCCGTCTTCTACCTAGCGTCAACAAAGCCGACCCCAGTGCACCTACACCTGAG  69101

Query  67     CTCTCGGAGCAGGACGC  83
              ||||  ||| |||| ||
Sbjct  69102  CTCTGCGAGGAGGATGC  69118

>PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 
genomic scaffold, whole genome shotgun sequence
Length=695754

 Score = 178 bits (197),  Expect = 1e-41
 Identities = 478/720 (66%), Gaps = 12/720 (2%)
 Strand=Plus/Plus

Query  1197    CCGCCGCGTGGTCATTCACGTGCCATCCTTCTCAGTTGACGAACGCTTGCGTCTCAGCGC  1256
               ||| || || ||  | |||||||| || || ||  | || |||| ||  |||||| | ||
Sbjct  433967  CCGACGTGTTGTGGTCCACGTGCCGTCGTTATCGCTCGATGAACACTCACGTCTCGGTGC  434026

Query  1257    CGACAATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCCTCG---TCGA  1313
                || || ||  |  |  | ||||| ||||||||  ||||  | |||| |   |   | ||
Sbjct  434027  TGAGAACTTTGCCATACAACAGAACCTCCAGCTGACGCGGGTATGCGCCGCTGCACTGGA  434086

Query  1314    CTCGAACGTAGACAT--TG-TCTATGTCTCACCCTTTGAGCTCACGACGGACGTGGTGCA  1370
               ||| ||||| ||  |  || | ||||| || || || ||||||||  |||| ||    ||
Sbjct  434087  CTCTAACGTGGAACTGCTGCTTTATGTGTCGCCTTTCGAGCTCACATCGGATGTTTCTCA  434146

Query  1371    ATACTCAATGAAGCTTCTACAGCTTGGCGGCATCGCCGACCCCGTCGCTCGCGTGAAGCT  1430
                ||||   | || || || || ||||||||  | |  |||  |    ||||||| ||| |
Sbjct  434147  GTACTTCCTCAAACTGCTGCAACTTGGCGGTCTTGTTGACAGCAGACCTCGCGTCAAGTT  434206

Query  1431    CGTCTTTCCCGAGCATGCACCGCGGTTCCCGACACACTTCTCGCTCACGACGCTCTTGCT  1490
                || |||||||||||  |  |||| || ||  | || ||||||||  |  || | || ||
Sbjct  434207  AGTGTTTCCCGAGCAAACCACGCGCTTTCCAGCCCATTTCTCGCTGTCATCGTTGTTACT  434266

Query  1491    GTATTCCCCACACTGTCTTCGCCGTATCCAGCGGTACATCAAGAACAAGGAGGCGTACCT  1550
                || || || || ||||| || || ||||  |  ||||  |    ||| ||||| |||||
Sbjct  434267  CTACTCGCCTCATTGTCTGCGGCGCATCCGACACTACACTACTGGCAAAGAGGCTTACCT  434326

Query  1551    GGTCACGGGCATGCCCGGTCCAGAGGATAAGCGTCTCGCCATGGCGCTCAATGTGCCGAT  1610
                || | |||  | || ||  | |||||| | || || || |||||| |  || |||| ||
Sbjct  434327  TGTGATGGGGCTACCTGGAGCTGAGGATCAACGACTAGCGATGGCGTTGGATCTGCCAAT  434386

Query  1611    CCTCGGTATGGATCC-GCTCAGCGCCCTGCCACTCATGACCAAGTCTGGTGGCAAGCGCT  1669
               |||||||  |   || |||||  || ||||| ||  | ||    || ||||||||||| |
Sbjct  434387  CCTCGGTGCGCCGCCAGCTCA-AGCTCTGCCGCTGCTCACTCGCTCGGGTGGCAAGCGGT  434445

Query  1670    TCTTCATGCGCGCCGACGTGAATGTGCCCACGGGCACGTACGACATTTACGACGAGGACG  1729
               | || || || || || || ||||| ||||  || || |||||  | ||||| ||  | |
Sbjct  434446  TGTTGATCCGAGCTGATGTAAATGTCCCCAATGGTACTTACGAGCTGTACGATGAACATG  434505

Query  1730    AGCTCGTGTTC-TCGCTCGCCAAGCTCATCGTCTCGCACATTGAGCAGAGCG-TGTGGGT  1787
               |  || ||| |  |||||||||||||     || | ||||| || || | ||  |||| |
Sbjct  434506  AAGTC-TGTGCAGCGCTCGCCAAGCTTGCTATCGCTCACATGGATCA-ACCGAGGTGGTT  434563

Query  1788    GCTCAAGATCGACTATGACCCGTTCAGCACAGGCACAGCGCTGCTTGACGTCTCAACCAT  1847
                 | ||| | ||||| || ||  |       |||  |||| |  ||||| | |||| |||
Sbjct  434564  AATTAAGCTGGACTACGATCCTCTTGATGTGGGCGAAGCGGTCGTTGACCTGTCAAACAT  434623

Query  1848    GGTGGCACTGCGTGAGATTCGACGCGAGAAGAGAAGTCCCGAGTACTGGAGGCAGCCTGG  1907
               |   ||  |||||||| | || || |||||| | |  |||||||| ||| | || || ||
Sbjct  434624  GCAAGCGATGCGTGAGCTGCGTCGAGAGAAGCGGACGCCCGAGTATTGGCGCCAACCAGG  434683

 Score = 135 bits (149),  Expect = 1e-28
 Identities = 188/263 (71%), Gaps = 3/263 (1%)
 Strand=Plus/Plus

Query  571     GAGAAGGACGACGACGCGAACGCCATGGACGAGTTGCGCAAGAATGTCGAGAAGATCCGC  630
               || ||||||||  ||||   ||  |||||  | ||| |    |||||||| || || || 
Sbjct  433344  GACAAGGACGAATACGC---CGAGATGGAGAAATTGGGGGCAAATGTCGATAAAATTCGT  433400

Query  631     GGGTACAACGAGCTGCTGGACACGTACAGTCTCCACCAGTTCATCATCCACAAAGGCCGC  690
               || |||||||| ||||||||   ||| ||| | ||||||||  | || |||||||| || 
Sbjct  433401  GGTTACAACGAACTGCTGGATGTGTATAGTTTGCACCAGTTTCTGATTCACAAAGGACGG  433460

Query  691     GCGATGCGCGAGACGCCTGAGTTTGTGTCCTTCAAGCGCGTGGCGCAGGAGGTTTGGGGC  750
                | ||| | || || || |||||||| || |||   |||||  | |||||| ||||||||
Sbjct  433461  ACCATGAGAGACACACCCGAGTTTGTTTCGTTCCGTCGCGTTACACAGGAGCTTTGGGGC  433520

Query  751     AGCGTCGATGAAGTGATCAAGGCACTCGAGGCGCTGCTCACGCGCTACTTCGTGCCTCTC  810
               || || || || |   |    || || ||| | |||||| |||  || || || ||||| 
Sbjct  433521  AGTGTAGAAGAGGCTCTGCGAGCGCTGGAGACTCTGCTCGCGCAGTATTTTGTACCTCTG  433580

Query  811     GCGTACGTCGACGGCCAGCGACT  833
               || ||||| || |||||||||||
Sbjct  433581  GCTTACGTTGATGGCCAGCGACT  433603

 Score = 49.1 bits (53),  Expect = 0.012
 Identities = 46/59 (78%), Gaps = 0/59 (0%)
 Strand=Plus/Plus

Query  2075    ACGTGCGTGCAAATCTGTTTGTCGAGCCCAGTGGCGAGGTGCATGTCTCGTCGACGCAG  2133
               ||||||| || ||||||||||| || ||   ||||   || ||  ||||||||||||||
Sbjct  434896  ACGTGCGCGCGAATCTGTTTGTAGACCCGGATGGCTCCGTACACATCTCGTCGACGCAG  434954

>PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.63, whole genome shotgun 
sequence
Length=342508

 Score = 172 bits (190),  Expect = 4e-40
 Identities = 481/729 (66%), Gaps = 12/729 (2%)
 Strand=Plus/Plus

Query  1197    CCGCCGCGTGGTCATTCACGTGCCATCCTTCTCAGTTGACGAACGCTTGCGTCTCAGCGC  1256
               ||| || || ||  |||||||||| || || ||  |||| || |  |  ||||| || ||
Sbjct  253948  CCGGCGTGTTGTGGTTCACGTGCCGTCGTTATCCCTTGATGAGCATTATCGTCTAAGTGC  254007

Query  1257    CGACAATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCCTCG---TCGA  1313
                || |||||  | ||  |||||||||| || ||| | ||| | ||||   | |   | ||
Sbjct  254008  TGAGAATTTTGCCGTACAGCAGAATCTTCAACTTACTCGAGTGTGCGCTGTTGCACTGGA  254067

Query  1314    CTCGAACGTAGACATT---GTCTATGTCTCACCCTTTGAGCTCACGACGGACGTGGTGCA  1370
               ||||||||| ||| |    || ||||| || || || ||||||||  |||| ||  | ||
Sbjct  254068  CTCGAACGTGGACCTGCTAGTGTATGTGTCGCCGTTCGAGCTCACAGCGGATGTTTTACA  254127

Query  1371    ATACTCAATGAAGCTTCTACAGCTTGGCGGCATCGCCGACCCCGTCGCTCGCGTGAAGCT  1430
                || |   | || || || || ||||| ||  | |  |||  ||   |||| || ||| |
Sbjct  254128  GTATTTCCTCAAACTGCTGCAACTTGGTGGTCTTGTGGACAGCGGACCTCGTGTCAAGTT  254187

Query  1431    CGTCTTTCCCGAGCATGCACCGCGGTTCCCGACACACTTCTCGCTCACGACGCTCTTGCT  1490
               ||| ||||| |||||  |  | || || ||  | || ||||||||| || || |  | ||
Sbjct  254188  CGTTTTTCCAGAGCAATCCACACGTTTTCCAGCGCATTTCTCGCTCTCGTCGTTGCTTCT  254247

Query  1491    GTATTCCCCACACTGTCTTCGCCGTATCCAGCGGTACATCAAGAACAAGGAGGCGTACCT  1550
                || || || || ||| | || || ||||  |  ||||  |    ||| || || |||||
Sbjct  254248  CTACTCGCCTCATTGTTTGCGACGAATCCGACACTACACTACTGGCAAAGAAGCTTACCT  254307

Query  1551    GGTCACGGGCATGCCCGGTCCAGAGGATAAGCGTCTCGCCATGGCGCTCAATGTGCCGAT  1610
                || | |||  | || ||| | || ||| | || || || || || ||  || |||||||
Sbjct  254308  TGTGATGGGGCTACCTGGTGCTGAAGATCAACGACTGGCGATTGCTCTGGATCTGCCGAT  254367

Query  1611    CCTCGGT-ATGGATCCGCTCAGCGCCCTGCCACTCATGACCAAGTCTGGTGGCAAGCGCT  1669
               |||||||     | | |||||  || |||||  |  | ||    || |||||||||||  
Sbjct  254368  CCTCGGTGCCCCACCAGCTCA-AGCTCTGCCGTTGCTCACTCGCTCGGGTGGCAAGCGGC  254426

Query  1670    TCTTCATGCGCGCCGACGTGAATGTGCCCACGGGCACGTACGACATTTACGACGAGGACG  1729
               | || || || || || || ||||| ||||  ||||| |||||  | ||||| ||  |||
Sbjct  254427  TATTGATCCGAGCTGATGTAAATGTCCCCAATGGCACCTACGAGTTGTACGATGAACACG  254486

Query  1730    AGCTCGTGTTC-TCGCTCGCCAAGCTCATCGTCTCGCACATTGAGCAGAGCG-TGTGGGT  1787
               | ||| ||  |  |||| || || ||     || | ||||| || || | ||  |||| |
Sbjct  254487  AACTC-TGCGCAGCGCTTGCTAAACTGGCTATCGCTCACATGGATCA-ACCGAAGTGGCT  254544

Query  1788    GCTCAAGATCGACTATGACCCGTTCAGCACAGGCACAGCGCTGCTTGACGTCTCAACCAT  1847
               | ||||| | |||||||| ||  |  |    |||  |||  |  ||||  | |||| |||
Sbjct  254545  GATCAAGCTTGACTATGATCCTCTTGGAGTGGGCGAAGCAGTCGTTGATCTGTCAAACAT  254604

Query  1848    GGTGGCACTGCGTGAGATTCGACGCGAGAAGAGAAGTCCCGAGTACTGGAGGCAGCCTGG  1907
                   ||  |||| ||| | || || |||||| | |  |||||||| ||| | || || ||
Sbjct  254605  TCAAGCGATGCGAGAGTTGCGTCGAGAGAAGCGGACACCCGAGTATTGGCGCCAACCGGG  254664

Query  1908    GACGCGAGA  1916
               | | || ||
Sbjct  254665  GCCTCGTGA  254673

 Score = 139 bits (153),  Expect = 9e-30
 Identities = 276/403 (68%), Gaps = 7/403 (2%)
 Strand=Plus/Plus

Query  574     AAGGACGACGACGCGAACGCCATGGACGAGTTGCGCAAGAATGTCGAGAAGATCCGCGGG  633
               |||||||| |||||  |    ||||| ||  || ||   |||||||| || ||||| || 
Sbjct  253328  AAGGACGAAGACGCTGAG---ATGGAGGAACTGGGCGCAAATGTCGATAAAATCCGTGGT  253384

Query  634     TACAACGAGCTGCTGGACACGTACAGTCTCCACCAGTTCATCATCCACAAAGGCCGCGCG  693
               |||||||||||| ||||  |||| ||  | || |||||  | || ||||| || ||  | 
Sbjct  253385  TACAACGAGCTGTTGGATGCGTATAGCTTACATCAGTTTTTGATTCACAAGGGACGAACC  253444

Query  694     ATGCGCGAGACGCCTGAGTTTGTGTCCTTCAAGCGCGTGGCGCAGGAGGTTTGGGGCAGC  753
               ||||| || || || |||||| | || |||   |||||||| || ||  ||||||| || 
Sbjct  253445  ATGCGAGACACACCCGAGTTTATTTCGTTCCGCCGCGTGGCACAAGAACTTTGGGGTAGT  253504

Query  754     GTCGATGAAGTGATCAAG-GCACTCGAGGCGCTGCTCACGCGCTACTTCGTGCCTCTCGC  812
               ||||| ||||  || | | || || ||||| ||||| || |  || |||||||| || ||
Sbjct  253505  GTCGAAGAAG-CATTACGAGCGCTGGAGGCTCTGCTGACCCAGTATTTCGTGCCACTGGC  253563

Query  813     GTACGTCGACGGCCAGCGACTCATGACGGTCGCGGCGATGGAGATGGCGTC-CTACAGCA  871
                || || || || || ||| |  |  |  |||| |  |  | |   || ||  | |  ||
Sbjct  253564  TTATGTTGATGGTCAACGATTGCTAGCACTCGCAGGTACCG-GTCAGCCTCGATTCTCCA  253622

Query  872     AGCGGGACCTGCTCTCGTGCATCGTCAACGAGGACCAGGTCGGGTCGCTCATCCGGCGAC  931
               | || || ||  | || |||||||| || || |||||| |   |||  |  | || || |
Sbjct  253623  AACGTGAACTTTTATCCTGCATCGTGAATGAAGACCAGATTATGTCAGTGTTGCGACGTC  253682

Query  932     CGGGCCAGCGCTACAAAGGCAAGGACCGCAAGCGCCGCGCAGC  974
               | |||||||| || ||||| |  || || || ||||| || ||
Sbjct  253683  CAGGCCAGCGGTATAAAGGGAGAGATCGTAAACGCCGTGCTGC  253725

 Score = 123 bits (136),  Expect = 2e-25
 Identities = 162/221 (73%), Gaps = 4/221 (2%)
 Strand=Plus/Plus

Query  2628    GTACATCTTCCACCCGAACGTGTCGACCATGCAGTACAGCGCCTTCTTCCACACCTGTCG  2687
               |||| | ||||| ||| ||||| | |||||||||||||  || ||||||||| ||||| |
Sbjct  255442  GTACGTGTTCCATCCGCACGTGACCACCATGCAGTACACAGCTTTCTTCCACGCCTGTAG  255501

Query  2688    GCTGCACGGCGTCTGCTTCGACGTGGAGCGCTGTGTGGGCTCGGTCTTTCTCCTTGCCGA  2747
               | | || ||||| ||||||||||||||| |     | ||| |  |||| || || || ||
Sbjct  255502  GTTACATGGCGTGTGCTTCGACGTGGAGAGAACACTAGGCACACTCTTCCTGCTCGCAGA  255561

Query  2748    CAGCCTCACGGCCGGTGTCTTCGGCCTCATGTGC--TGCAGCGACACGGCGAGCGGCGCG  2805
                || ||||| || || ||||||||| || || ||  || || |||   | ||  || || 
Sbjct  255562  TAGTCTCACAGCAGGCGTCTTCGGCGTCTTGAGCATTGGAGAGACTATG-GA-AGGAGCT  255619

Query  2806    CTGGGCTTTCTACGCACAGCGCTGGAAGTGGTCGGCCGGGA  2846
               ||||  || || || ||||| ||||||||  |||| || ||
Sbjct  255620  CTGGCGTTCCTGCGTACAGCACTGGAAGTTATCGGTCGAGA  255660

 Score = 44.6 bits (48),  Expect = 0.15
 Identities = 45/59 (76%), Gaps = 0/59 (0%)
 Strand=Plus/Plus

Query  2075    ACGTGCGTGCAAATCTGTTTGTCGAGCCCAGTGGCGAGGTGCATGTCTCGTCGACGCAG  2133
               |||| ||||||||  ||||||| || ||   ||||   || || ||| |||||||||||
Sbjct  254877  ACGTACGTGCAAACTTGTTTGTTGATCCGGATGGCTCCGTACACGTCACGTCGACGCAG  254935

 Score = 44.6 bits (48),  Expect = 0.15
 Identities = 38/46 (83%), Gaps = 1/46 (2%)
 Strand=Plus/Plus

Query  2210    CGTTTCCTCAGACTGCAGCGCCGTACGAAGCCATTCGGGGTGCGTC  2255
               ||||||||||||||||||| ||| | || || |||   ||||||||
Sbjct  254988  CGTTTCCTCAGACTGCAGCACCGCATGAGGCGATT-AAGGTGCGTC  255032

>PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2956, whole genome shotgun sequence
Length=1921269

 Score = 121 bits (133),  Expect = 2e-24
 Identities = 440/682 (65%), Gaps = 14/682 (2%)
 Strand=Plus/Minus

Query  1246     CGTCTCAGCGCCGACAATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACT-----CT  1300
                |||||||  || || |||||| | ||  |||||||||| || ||| | ||  |     ||
Sbjct  1842424  CGTCTCAATGCTGAAAATTTCGCAGTACAGCAGAATCTTCAACTTACCCGGATATGTGCT  1842365

Query  1301     GCGGCCTCGTCGACTCGAACGTAGACATTGTC---TATGTCTCACCCTTTGAGCTCACGA  1357
                || |||| |  || | | | || ||  |  ||   ||||| ||||| |  ||||||||  
Sbjct  1842364  GCTGCCTTG--GATTTGCAAGTGGATCTGCTCGTATATGTTTCACCTTACGAGCTCACAG  1842307

Query  1358     CGGACGTGGTGCAATACTCAATGAAGCTTCTACAGCTTGGCGGCATCGCCGACC-CCGTC  1416
                | || ||    || ||||     || ||  |||| ||| | ||    || |||  ||| |
Sbjct  1842306  CAGATGTTTCCCAGTACTTTCACAAACTGTTACAACTTAGTGGTCCTGCTGACAGCCGAC  1842247

Query  1417     GCTCGCGTGAAGCTCGTCTTTCCCGAGCATGCACCGCGGTTCCCGACACACTTCTCGCTC  1476
                 | ||||||||| | || | ||| ||||| ||  ||||||| ||  | || || || |||
Sbjct  1842246  -CACGCGTGAAGTTTGTGTATCCGGAGCAAGCTGCGCGGTTTCCAGCTCATTTTTCACTC  1842188

Query  1477     ACGACGCTCTTGCTGTATTCCCCACACTGTCTTCGCCGTATCCAGCGGTACATCAAGAAC  1536
                 |  || |  | || || || ||  | |||||||| || ||||  |  ||||        
Sbjct  1842187  TCATCGTTAATACTCTACTCGCCCTATTGTCTTCGACGGATCCGACACTACACTGCTGGT  1842128

Query  1537     AAGGAGGCGTACCTGGTCACGGGCATGCCCGGTCCAGAGGATAAGCGTCTCGCCATGGCG  1596
                || ||||||||||| || | |||  |||| ||||| || ||| | || || |||||  ||
Sbjct  1842127  AACGAGGCGTACCTTGTAATGGGATTGCCTGGTCCTGAAGATCAACGGCTAGCCATAACG  1842068

Query  1597     CTCAATGTGCCGATCCTCGGTATGGATCCG-CTCAGCGCCCTGCCACTCATGACCAAGTC  1655
                ||  |  | ||||| || |||  |   ||| ||||  || |||||| |  | ||    ||
Sbjct  1842067  CTAGACCTTCCGATACTTGGTGCGCTACCGTCTCAA-GCTCTGCCATTGCTCACACGATC  1842009

Query  1656     TGGTGGCAAGCGCTTCTTCATGCGCGCCGACGTGAATGTGCCCACGGGCACGTACGACAT  1715
                 ||||||||||| || || || |  |||||| | ||||| ||||| ||||| || ||  |
Sbjct  1842008  AGGTGGCAAGCGATTATTGATCCAAGCCGACATAAATGTCCCCACTGGCACTTATGAGTT  1841949

Query  1716     TTACGACGAGGACGAGCTCGTGTTCTCGCTCGCCAAGCTCATCGTCTCGCACATTGAGCA  1775
                 ||||| ||  | ||  ||    |  | || ||||| ||    ||| | || || || ||
Sbjct  1841948  GTACGATGAACATGAAATCTCTGTAGCACTTGCCAAACTTGCTGTCGCTCATATCGACCA  1841889

Query  1776     GAGCGTGTGGGTGCTCAAGATCGACTATGACCCGTTCAGCACAGGCACAGCGCTGCTTGA  1835
                |      ||| |  ||||| | ||||| || ||  || |   ||||  |||| |  ||||
Sbjct  1841888  GTCGAAATGGCTTATCAAGCTTGACTACGATCCTCTCGGTGTAGGCGAAGCGGTCGTTGA  1841829

Query  1836     CGTCTCAACCATGGTGGCACTGCGTGAGATTCGACGCGAGAAGAGAAGTCCCGAGTACTG  1895
                | | |||| ||||   ||  |||||||  | |  || || ||| | |  || || || ||
Sbjct  1841828  CCTTTCAAGCATGCAAGCGATGCGTGAATTGCACCGTGAAAAGCGTACACCAGAATATTG  1841769

Query  1896     GAGGCAGCCTGGGACGCGAGAC  1917
                | | || ||||| || || |||
Sbjct  1841768  GCGACAACCTGGTACTCGGGAC  1841747

>SAPA:scaffold_24 supercont2.24 dna:supercontig supercontig:ASM15154v2:supercont2.24:1:471063:1 
REF
Length=471063

 Score = 115 bits (127),  Expect = 1e-22
 Identities = 299/452 (66%), Gaps = 13/452 (3%)
 Strand=Plus/Plus

Query  1189    AAAGGCAACCGCCGCGTGGTCATTCACGTGCCATCCTTCTCAGTTGACGAACGCTTGCGT  1248
               ||| ||||| || | || ||| | |||||||| |||||||| |  || || |||  ||| 
Sbjct  427720  AAATGCAACGGCGG-GTCGTCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCGCGCGG  427778

Query  1249    CTCAGCGCCGACAATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCCTC  1308
               |||| |   ||||| ||  || |    |||||||| ||| |  |||| |||||||   ||
Sbjct  427779  CTCAACATGGACAACTTTGCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCGCGATC  427838

Query  1309    GTCGACTCGAACGTAGACATTGTCTATGTCTCACCCTTTGAGCTCACGACGGACGTGGTG  1368
               |  ||  | ||||| ||| |  ||||  |||| || || |||||| ||   ||| |    
Sbjct  427839  GCGGATCCCAACGTCGACGTCATCTACATCTCGCCGTTCGAGCTCTCGGTCGACATT---  427895

Query  1369    CAATACTCAATGAAGC---TTCTACAGCTTGGCGGCATCGCCGACCCCGTCGCTCGCGT-  1424
               ||| | |  |||| ||   | || ||||| |||||| |||| |||||   | | ||||| 
Sbjct  427896  CAAAAGTACATGATGCGCCTGCTGCAGCTGGGCGGCGTCGCGGACCCGCACTCGCGCGTC  427955

Query  1425    --GAAGCTCGTCTTTCCCGAGCATGCACCGCGGTTCCCGACACACTTCTCGCTCACGACG  1482
                 || |||   |   || ||| | ||   ||| |||||    ||||| |||||  |||||
Sbjct  427956  CGGATGCTGCAC---CCGGAGAACGCCGAGCGCTTCCCCGAGCACTTTTCGCTGGCGACG  428012

Query  1483    CTCTTGCTGTATTCCCCACACTGTCTTCGCCGTATCCAGCGGTACATCAAGAACAAGGAG  1542
                || | || || || || ||||||||       ||| | || ||| ||     |||||||
Sbjct  428013  ATCCTCCTCTACTCGCCGCACTGTCTCAAGAAGATCAAACGCTACGTCCGCGGCAAGGAG  428072

Query  1543    GCGTACCTGGTCACGGGCATGCCCGGTCCAGAGGATAAGCGTCTCGCCATGGCGCTCAAT  1602
               |||||| | ||| | |||| |   ||||| || || ||||| ||||| ||    ||  | 
Sbjct  428073  GCGTACATCGTCGCAGGCACGGTGGGTCCCGAAGACAAGCGGCTCGCGATCCGACTGCAG  428132

Query  1603    GTGCCGATCCTCGGTATGGATCCGCTCAGCGC  1634
                ||||| | || || ||||| |||  | ||||
Sbjct  428133  CTGCCGCTGCTGGGCATGGACCCGGACCGCGC  428164

 Score = 75.2 bits (82),  Expect = 9e-11
 Identities = 71/91 (78%), Gaps = 0/91 (0%)
 Strand=Plus/Plus

Query  2625    CGAGTACATCTTCCACCCGAACGTGTCGACCATGCAGTACAGCGCCTTCTTCCACACCTG  2684
               |||||||||||||||||||||| || | ||  | ||||||  || ||||||| |||  ||
Sbjct  429345  CGAGTACATCTTCCACCCGAACATGGCCACGCTCCAGTACGCCGTCTTCTTCAACATGTG  429404

Query  2685    TCGGCTGCACGGCGTCTGCTTCGACGTGGAG  2715
                ||  ||||||||||  |||| ||| || ||
Sbjct  429405  CCGCGTGCACGGCGTGAGCTTTGACCTGCAG  429435

 Score = 71.6 bits (78),  Expect = 1e-09
 Identities = 51/59 (86%), Gaps = 0/59 (0%)
 Strand=Plus/Plus

Query  601     GAGTTGCGCAAGAATGTCGAGAAGATCCGCGGGTACAACGAGCTGCTGGACACGTACAG  659
               ||||||||||| || ||||||||||| ||||| |||||||| || || ||||| |||||
Sbjct  427038  GAGTTGCGCAACAACGTCGAGAAGATTCGCGGCTACAACGACCTCCTCGACACCTACAG  427096

 Score = 71.6 bits (78),  Expect = 1e-09
 Identities = 197/299 (66%), Gaps = 10/299 (3%)
 Strand=Plus/Plus

Query  658     AGTCTCCACCAGTTCATCATCCACAAAGGCCGCGCGATGCGCGAGACGCCTGAGTTTGTG  717
               || || || ||||| ||||| |  || ||||   || |   ||||||||| || ||  | 
Sbjct  427147  AGCCTGCATCAGTTTATCATTCGGAAGGGCCAAACGCTTTCCGAGACGCCGGAATTCATC  427206

Query  718     TCCTTCAAGCGCGTGGCGCAGGAGGTTTGGGGCAGCG--TCGATGAAGTGATCAAGGCAC  775
               || ||||||||| |  |  | ||  ||||||||||||  ||||||  | ||||   |  |
Sbjct  427207  TCGTTCAAGCGCATCACTGAAGACCTTTGGGGCAGCGTCTCGATG--GCGATCCGCGAGC  427264

Query  776     TCGAGGCGCTGCTCACGCGCTACTTCGTGCCTCTCGCGTACGTCGACGGCC---AGCGAC  832
               ||||| ||||  |    | |||||  ||||| ||||| ||| | || || |   |||  |
Sbjct  427265  TCGAGACGCTCTTGGTCCACTACTCGGTGCCGCTCGCCTACATTGATGGTCAAAAGCTGC  427324

Query  833     TCATGACGGTCGCGGCGATGGAGATGGCGTCCTACAGCAAGCGGGACCTGCTCTCGTGCA  892
               |||  |   |||| || |||||   || |||   |  ||||  ||| |||||| | ||  
Sbjct  427325  TCAAAA---TCGCAGCCATGGACGCGGTGTCACGCTCCAAGTCGGAGCTGCTCACATGTG  427381

Query  893     TCGTCAACGAGGACCAGGTCGGGTCGCTCATCCGGCGACCGGGCCAGCGCTACAAAGGC  951
               |  ||||||  ||| ||||   | |  | ||   ||| || |||||||||| ||| |||
Sbjct  427382  TGCTCAACGTCGACGAGGTTACGACCTTTATGGCGCGGCCAGGCCAGCGCTTCAAGGGC  427440

 Score = 50.0 bits (54),  Expect = 0.003
 Identities = 60/82 (73%), Gaps = 0/82 (0%)
 Strand=Plus/Plus

Query  1652    AGTCTGGTGGCAAGCGCTTCTTCATGCGCGCCGACGTGAATGTGCCCACGGGCACGTACG  1711
               |||| ||||  |||||  | || | ||  |||||||| ||  | ||    ||| |  |||
Sbjct  428222  AGTCGGGTGCGAAGCGGCTTTTTACGCAAGCCGACGTCAACATTCCGTACGGCGCCCACG  428281

Query  1712    ACATTTACGACGAGGACGAGCT  1733
               ||||||||||||| ||||||||
Sbjct  428282  ACATTTACGACGAAGACGAGCT  428303

 Score = 45.5 bits (49),  Expect = 0.15
 Identities = 38/47 (81%), Gaps = 0/47 (0%)
 Strand=Plus/Plus

Query  2294    TTGGCTACGCGAGCATCGACTTTCTGGTGTTCCAGGAAGACAAGTCG  2340
               ||||||||||||||||||||| | ||| ||| |  || | |||| ||
Sbjct  429023  TTGGCTACGCGAGCATCGACTATGTGGCGTTTCTCGACGTCAAGACG  429069

 Score = 45.5 bits (49),  Expect = 0.15
 Identities = 29/32 (91%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  2743    GCCGACAGCCTCACGGCCGGTGTCTTCGGCCT  2774
               |||||||||||||||||||| ||| |||| ||
Sbjct  429513  GCCGACAGCCTCACGGCCGGCGTCGTCGGGCT  429544

>APAS:scaffold_12 supercont1.12 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.12:1:1206637:1 
REF
Length=1206637

 Score = 113 bits (125),  Expect = 3e-22
 Identities = 203/294 (69%), Gaps = 2/294 (1%)
 Strand=Plus/Plus

Query  658     AGTCTCCACCAGTTCATCATCCACAAAGGCCGCGCGATGCGCGAGACGCCTGAGTTTGTG  717
               ||| | || ||||| ||||||| |||||||    |  ||  ||| ||||| |||||| | 
Sbjct  729478  AGTTTGCATCAGTTTATCATCCGCAAAGGCAAGACACTGTCCGACACGCCCGAGTTTATT  729537

Query  718     TCCTTCAAGCGCGTGGCGCAGGAGGTTTGGGGCAGCGTCGATGAAGTG-ATCAAGGCACT  776
               || ||  ||||   | |  | ||  | ||||||||||| |  || ||  ||  | |   |
Sbjct  729538  TCGTTTCAGCGGACGACAGAAGACTTGTGGGGCAGCGT-GTCGACGTCCATACAAGAGTT  729596

Query  777     CGAGGCGCTGCTCACGCGCTACTTCGTGCCTCTCGCGTACGTCGACGGCCAGCGACTCAT  836
                ||| |  |||||||| |||| | |||||| || |||||||| |||||||||   || ||
Sbjct  729597  GGAGACCATGCTCACGAGCTATTCCGTGCCGCTGGCGTACGTTGACGGCCAGAAGCTGAT  729656

Query  837     GACGGTCGCGGCGATGGAGATGGCGTCCTACAGCAAGCGGGACCTGCTCTCGTGCATCGT  896
               || | |||| ||||||||   | |  |   | ||| |   || ||  | ||||||||| |
Sbjct  729657  GAAGATCGCCGCGATGGACGCGACAACGCGCGGCACGACCGAGCTCTTGTCGTGCATCCT  729716

Query  897     CAACGAGGACCAGGTCGGGTCGCTCATCCGGCGACCGGGCCAGCGCTACAAAGG  950
               ||||  |||| | ||  | |||||||| || || || || ||||||||||| ||
Sbjct  729717  CAACATGGACGAAGTGAGTTCGCTCATGCGACGGCCTGGACAGCGCTACAAGGG  729770

 Score = 73.4 bits (80),  Expect = 3e-10
 Identities = 104/144 (72%), Gaps = 2/144 (1%)
 Strand=Plus/Plus

Query  1652    AGTCTGGTGGCAAGCGCTTCTTCATGCGCGCCGACGTGAATGTGCCCACGGGCACGTACG  1711
               |||| || ||||| ||| ||||||||   || ||||| ||  | |||| |||  || |||
Sbjct  730596  AGTCGGGGGGCAAACGCATCTTCATGGCGGCAGACGTCAACATTCCCATGGGAGCGCACG  730655

Query  1712    ACATTTACGACGAGGACGAGCTCGTGTTCTCGCTCG-CCAAGCTCATCGTCTCGCACATT  1770
               | ||||||||||| ||||||||| | |    ||| |  |||| | || | | || || ||
Sbjct  730656  ATATTTACGACGAAGACGAGCTCAT-TCAAAGCTTGAGCAAGTTGATTGCCGCGGACGTT  730714

Query  1771    GAGCAGAGCGTGTGGGTGCTCAAG  1794
               || |||| || |||| |  |||||
Sbjct  730715  GACCAGAACGAGTGGCTTGTCAAG  730738

 Score = 57.2 bits (62),  Expect = 2e-05
 Identities = 46/56 (82%), Gaps = 0/56 (0%)
 Strand=Plus/Plus

Query  604     TTGCGCAAGAATGTCGAGAAGATCCGCGGGTACAACGAGCTGCTGGACACGTACAG  659
               ||||||   || |||||||| || || || |||||||| ||||| |||||||||||
Sbjct  729334  TTGCGCCGAAACGTCGAGAAAATACGTGGCTACAACGAACTGCTTGACACGTACAG  729389

 Score = 51.8 bits (56),  Expect = 0.001
 Identities = 43/53 (81%), Gaps = 0/53 (0%)
 Strand=Plus/Plus

Query  227     CCGTGCCGCACACTAATCCGTCGGGCTTCAACATCGCGACCTTGAAGTTCGAC  279
               || ||||| |||| || ||||||||||||||||| ||| |  | ||||| |||
Sbjct  729019  CCATGCCGTACACCAACCCGTCGGGCTTCAACATGGCGTCGCTCAAGTTTGAC  729071

>APIN:scaffold_20 supercont1.20 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.20:1:1003253:1 
REF
Length=1003253

 Score = 107 bits (118),  Expect = 1e-20
 Identities = 204/298 (68%), Gaps = 2/298 (1%)
 Strand=Plus/Minus

Query  658     AGTCTCCACCAGTTCATCATCCACAAAGGCCGCGCGATGCGCGAGACGCCTGAGTTTGTG  717
               ||| | |||||||||||||||| |||||||    || ||  ||| ||||| || ||| | 
Sbjct  379400  AGTTTGCACCAGTTCATCATCCGCAAAGGCAAGACGCTGGCCGACACGCCCGAATTTATT  379341

Query  718     TCCTTCAAGCGCGTGGCGCAGGAGGTTTGGGGCAGCGTCGATGAAGT-GATCAAGGCACT  776
               || ||| | ||     |  | ||  | ||||||||||| |  ||| | |||| ||| |||
Sbjct  379340  TCGTTCCAACGGACTACCGAAGACTTGTGGGGCAGCGT-GTCGAAATCGATCCAGGAACT  379282

Query  777     CGAGGCGCTGCTCACGCGCTACTTCGTGCCTCTCGCGTACGTCGACGGCCAGCGACTCAT  836
                || ||| |||| ||   |||||  || ||  | || ||||| || || ||    || ||
Sbjct  379281  GGAAGCGATGCTGACAAACTACTCGGTTCCGTTGGCTTACGTGGATGGTCAAAAGCTGAT  379222

Query  837     GACGGTCGCGGCGATGGAGATGGCGTCCTACAGCAAGCGGGACCTGCTCTCGTGCATCGT  896
               || | | || ||||||||   | || |   | | | |  ||| || || ||||||||  |
Sbjct  379221  GAAGATTGCCGCGATGGACGGGACGGCTCGCGGAACGATGGAACTTCTGTCGTGCATTCT  379162

Query  897     CAACGAGGACCAGGTCGGGTCGCTCATCCGGCGACCGGGCCAGCGCTACAAAGGCAAG  954
               ||||  |||| | ||  | || ||||| || || ||||| ||||||| ||| ||||||
Sbjct  379161  CAACATGGACGAAGTGAGCTCACTCATGCGACGGCCGGGTCAGCGCTTCAAGGGCAAG  379104

 Score = 83.3 bits (91),  Expect = 6e-13
 Identities = 68/83 (82%), Gaps = 0/83 (0%)
 Strand=Plus/Minus

Query  1652    AGTCTGGTGGCAAGCGCTTCTTCATGCGCGCCGACGTGAATGTGCCCACGGGCACGTACG  1711
               |||| || ||||||||| | ||||||   || ||||||||| | |||| |||  || |||
Sbjct  378309  AGTCGGGCGGCAAGCGCATTTTCATGGCGGCAGACGTGAATATTCCCATGGGGGCGCACG  378250

Query  1712    ACATTTACGACGAGGACGAGCTC  1734
               ||||||||||||| |||||||||
Sbjct  378249  ACATTTACGACGAAGACGAGCTC  378227

 Score = 59.0 bits (64),  Expect = 7e-06
 Identities = 41/47 (87%), Gaps = 0/47 (0%)
 Strand=Plus/Minus

Query  613     AATGTCGAGAAGATCCGCGGGTACAACGAGCTGCTGGACACGTACAG  659
               || || || ||||| || |||||||||||||| ||||||||||||||
Sbjct  379497  AACGTGGAAAAGATTCGGGGGTACAACGAGCTCCTGGACACGTACAG  379451

 Score = 53.6 bits (58),  Expect = 3e-04
 Identities = 62/84 (74%), Gaps = 0/84 (0%)
 Strand=Plus/Minus

Query  196     ATCTACGACCGCCAGGAACAGCCGATCCGGGCCGTGCCGCACACTAATCCGTCGGGCTTC  255
               || ||||||||   |   |||||  ||  | || ||||| |||| || ||||||||||||
Sbjct  379898  ATATACGACCGAGCGTCCCAGCCCGTCAAGTCCATGCCGTACACGAACCCGTCGGGCTTC  379839

Query  256     AACATCGCGACCTTGAAGTTCGAC  279
               ||||| ||| |  | ||||| |||
Sbjct  379838  AACATGGCGTCACTCAAGTTTGAC  379815

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 35/44 (80%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  2738    TCCTTGCCGACAGCCTCACGGCCGGTGTCTTCGGCCTCATGTGC  2781
               |||| || ||||||||||| || || ||| | || ||||| |||
Sbjct  376989  TCCTGGCAGACAGCCTCACAGCAGGCGTCGTTGGTCTCATATGC  376946

>PYVX:scaffold_1323 pve_scaffold_1323 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1323:1:4715:1 
REF
Length=4715

 Score = 95.1 bits (104),  Expect = 9e-17
 Identities = 86/106 (81%), Gaps = 2/106 (2%)
 Strand=Plus/Plus

Query  2668  GCCTTCTTCCACACCTGTCGGCTGCACGGCGTCTGCTTCGACGTGGAGCGCTGTGTG-GG  2726
             || |||||||| ||||| || ||||||||||| ||| ||||||||| | || | | | ||
Sbjct  276   GCTTTCTTCCAGACCTGCCGCCTGCACGGCGTGTGCCTCGACGTGGCG-GCGGCGCGCGG  334

Query  2727  CTCGGTCTTTCTCCTTGCCGACAGCCTCACGGCCGGTGTCTTCGGC  2772
             ||||||||| || ||  ||||||||||| |||||||||   |||||
Sbjct  335   CTCGGTCTTCCTGCTGCCCGACAGCCTCGCGGCCGGTGCAATCGGC  380

>SADI:scaffold_4 supercont1.4 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.4:1:1391842:1 
REF
Length=1391842

 Score = 79.7 bits (87),  Expect = 7e-12
 Identities = 72/91 (79%), Gaps = 0/91 (0%)
 Strand=Plus/Minus

Query  2625    CGAGTACATCTTCCACCCGAACGTGTCGACCATGCAGTACAGCGCCTTCTTCCACACCTG  2684
               ||||||||||||||| |||||| || ||||  | ||||||  || ||||||| |||  ||
Sbjct  173660  CGAGTACATCTTCCATCCGAACATGGCGACGCTCCAGTACGCCGTCTTCTTCAACATGTG  173601

Query  2685    TCGGCTGCACGGCGTCTGCTTCGACGTGGAG  2715
                ||  ||||||||||  |||||||| || ||
Sbjct  173600  CCGCGTGCACGGCGTGAGCTTCGACCTGCAG  173570

 Score = 65.3 bits (71),  Expect = 2e-07
 Identities = 54/65 (83%), Gaps = 1/65 (2%)
 Strand=Plus/Minus

Query  601     GAGTTGCGCAAGAATGTCGAGAAGATCCGCGGGTACAACGAGCTGCTGGACACGTACA-G  659
               || |||||||| || ||||||||||| || || |||||||| || || ||||| |||| |
Sbjct  175964  GAATTGCGCAACAACGTCGAGAAGATTCGAGGCTACAACGACCTCCTCGACACCTACAGG  175905

Query  660     TCTCC  664
               |||||
Sbjct  175904  TCTCC  175900

 Score = 50.9 bits (55),  Expect = 0.003
 Identities = 359/585 (61%), Gaps = 55/585 (9%)
 Strand=Plus/Minus

Query  1198    CGCCGCGTGGTCATTCACGTGCCATCCTTCTCAGTTGACGAACGCTTGCGTCTCAGCGCC  1257
               || || || ||| | |||||||| |||||||| |  || || |||  ||| ||||     
Sbjct  175285  CGGCGGGTCGTCGTGCACGTGCCGTCCTTCTCGGCCGAAGAGCGCACGCGGCTCAATATG  175226

Query  1258    GACAATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCCTCGTCGACTCG  1317
               ||||| ||  |  |    |||||| | ||  |  |||| |||||||   |||  ||  ||
Sbjct  175225  GACAACTTTGCAATTCGCCAGAATTTGCAAATGGCGCGTCTCTGCGCGATCGCAGATCCG  175166

Query  1318    AACGTAGACATTGTCTATGTCTCACCCTTTGAGCTCACGACGGACGTGGTGCAATACTCA  1377
               ||||| ||| |  ||||  | || || || |||||| || | ||| |    ||| | |  
Sbjct  175165  AACGTCGACGTCATCTACATTTCGCCGTTCGAGCTCTCGGCTGACATT---CAAAAGTAC  175109

Query  1378    ATGAAGC---TTCTACAGCTTGGCGGCATCGCCGACCCCGTCGCTCGCGT--GAA-GCTC  1431
               |||| ||   | || ||||| |||||| |||| |||||   | | |||||  ||| ||| 
Sbjct  175108  ATGATGCGACTGCTGCAGCTCGGCGGCGTCGCGGACCCGCACTCGCGCGTCCGAATGCTG  175049

Query  1432    GTCTTTCCCGAGCATGCACCGCGGTTCCCGACACACTTCTCGCTCACGACGCTCTTGCTG  1491
                 |   || ||| | ||   ||| |||||    ||||| ||| |  ||||| || | || 
Sbjct  175048  CAC---CCGGAGAACGCCGAGCGCTTCCCCGAGCACTTTTCGTTGGCGACGATCCTCCTC  174992

Query  1492    TATTCCCCACACTGTCTTCGCCGTATCCAGCGGTACATCAAGAACAAGGAGGCGTACCTG  1551
               || || || ||||| ||       ||| |||| ||| ||      || ||||||||| | 
Sbjct  174991  TACTCGCCGCACTGCCTCAAGAAGATCAAGCGCTACGTCCGCGGGAAAGAGGCGTACATC  174932

Query  1552    GTCACGGGCATGCCCGGTCCAGAGGATAAGCGTCTCGCCATGGCGCTCAATGTGCCGATC  1611
               ||| ||||||     || || || || ||||| ||||| ||    ||  |  ||||| | 
Sbjct  174931  GTCGCGGGCACCGTGGGGCCCGAAGACAAGCGGCTCGCGATCCGACTGCAGCTGCCGCTA  174872

Query  1612    CTCGGTATGGATCCGCTCAGCGCCCTGC--------------------------------  1639
               || || ||||| |||  | |||| ||||                                
Sbjct  174871  CTGGGCATGGACCCGGACCGCGCGCTGCTCTACGGCACACGTGTACGCTGTATTGGCATC  174812

Query  1640    ---CA----CTCATG----ACCAAGTCTGGTGGCAAGCGCTTCTTCATGCGCGCCGACGT  1688
                  ||    ||||||    | | |||| |||| ||||||  | || |  |  ||||||||
Sbjct  174811  AGACAGTGTCTCATGCGGGATCTAGTCGGGTGCCAAGCGGCTATTTACTCAAGCCGACGT  174752

Query  1689    GAATGTGCCCACGGGCACGTACGACATTTACGACGAGGACGAGCT  1733
                ||  | ||    ||| |  | |||||||||||||||||||| ||
Sbjct  174751  CAACATTCCGTTTGGCGCCCATGACATTTACGACGAGGACGAACT  174707

>ALLA:FR824104 dna:supercontig supercontig:ENA1:FR824104:1:105594:1 
REF
Length=105594

 Score = 64.4 bits (70),  Expect = 2e-07
 Identities = 128/190 (67%), Gaps = 0/190 (0%)
 Strand=Plus/Minus

Query  1271  TCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCCTCGTCGACTCGAACGTAGACATTG  1330
             || |||| ||||||||| |   |||  | |||| | |  |||||  ||| || ||  |  
Sbjct  9328  TCCAGCAAAATCTCCAGTTGCAGCGTTTGTGCGCCTTAATCGACGAGAATGTCGAACTCA  9269

Query  1331  TCTATGTCTCACCCTTTGAGCTCACGACGGACGTGGTGCAATACTCAATGAAGCTTCTAC  1390
             | ||| | |  || ||||||||||||   ||| | || |||||||  ||||| ||||| |
Sbjct  9268  TATATATTTGCCCTTTTGAGCTCACGGACGACATCGTACAATACTACATGAAACTTCTCC  9209

Query  1391  AGCTTGGCGGCATCGCCGACCCCGTCGCTCGCGTGAAGCTCGTCTTTCCCGAGCATGCAC  1450
             |||| | ||| ||  | ||| | |  || ||  | ||| |  | |  |||||  ||||| 
Sbjct  9208  AGCTCGCCGGGATATCAGACGCTGCTGCCCGTATCAAGTTGATGTGCCCCGAAAATGCAT  9149

Query  1451  CGCGGTTCCC  1460
             |||| || ||
Sbjct  9148  CGCGTTTTCC  9139

>ALCA:scaffold_90 AcNc2_CONTIG_90_length_79489 dna:supercontig 
supercontig:ASM107853v1:AcNc2_CONTIG_90_length_79489:1:79489:1 
REF
Length=79489

 Score = 62.6 bits (68),  Expect = 5e-07
 Identities = 143/213 (67%), Gaps = 2/213 (1%)
 Strand=Plus/Minus

Query  1264  TTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCCTCGTCGACTCGAACGTA  1323
             |||||  || |||| ||||| ||  |   |||  | |||| | |  |||||  ||| || 
Sbjct  6668  TTCTCCATCCAGCAAAATCTTCAATTACAGCGTTTATGCGCCGTAATCGACGAGAATGTT  6609

Query  1324  GACATTGTCTATGTCTCACCCTTTGAGCTCAC-GACGGACGTGGTGCAATACTCAATGAA  1382
             ||  |  | ||  |||  || ||||||||||| ||| ||| | || |||||||  |||||
Sbjct  6608  GAGCTGATATACATCTGTCCTTTTGAGCTCACAGAC-GACATCGTACAATACTACATGAA  6550

Query  1383  GCTTCTACAGCTTGGCGGCATCGCCGACCCCGTCGCTCGCGTGAAGCTCGTCTTTCCCGA  1442
             |||  | ||||| || || ||  | ||| | |  || ||  | ||| |  ||| ||| ||
Sbjct  6549  GCTGTTGCAGCTCGGTGGAATATCGGACGCTGCTGCACGTATTAAGTTGATCTGTCCTGA  6490

Query  1443  GCATGCACCGCGGTTCCCGACACACTTCTCGCT  1475
               ||||| | || |||||  | || || |||||
Sbjct  6489  AAATGCATCTCGTTTCCCATCTCATTTTTCGCT  6457

>PHSO:scaffold_2
Length=11587142

 Score = 49.1 bits (53),  Expect = 0.012
 Identities = 31/34 (91%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  1709   ACGACATTTACGACGAGGACGAGCTCGTGTTCTC  1742
              ||||||||||| |||||||||| ||||||| |||
Sbjct  81925  ACGACATTTACAACGAGGACGACCTCGTGTCCTC  81892

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  2632     ATCTTCCACCCGAACGTGTCG  2652
                |||||||||||||||||||||
Sbjct  8730468  ATCTTCCACCCGAACGTGTCG  8730488

>PYIR:scaffold_163 pir_scaffold_163 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_163:1:46809:1 
REF
Length=46809

 Score = 48.2 bits (52),  Expect = 0.012
 Identities = 83/120 (69%), Gaps = 7/120 (6%)
 Strand=Plus/Minus

Query  532    AGCCCCGAGACGAATGTGGACGAAGACCTCATGTACGACGAGAAGGACGACGACGCGAAC  591
              ||| |||  |||| || |||| | |||   | | | || ||| | ||||| ||  ||| |
Sbjct  29598  AGCGCCGTCACGACTG-GGACAAGGACGATAAGGAAGAAGAGGACGACGAAGAGCCGATC  29540

Query  592    GCCATGGACGAGTTGCGCAAGAAT------GTCGAGAAGATCCGCGGGTACAACGAGCTG  645
              | | |||||| || |||||||||       | | ||||||||||||   |||||||| ||
Sbjct  29539  GACCTGGACGTGTCGCGCAAGAAGAAGAAGGCCAAGAAGATCCGCGTAGACAACGAGGTG  29480

>PYIW:scaffold_2449 piw_scaffold_2449 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_2449:1:4984:1 
REF
Length=4984

 Score = 47.3 bits (51),  Expect = 0.042
 Identities = 32/35 (91%), Gaps = 1/35 (3%)
 Strand=Plus/Minus

Query  2227  GCGCCGTA-CGAAGCCATTCGGGGTGCGTCGACCG  2260
             |||||||| ||||||||||| ||| ||||||||||
Sbjct  3423  GCGCCGTATCGAAGCCATTCTGGGCGCGTCGACCG  3389

>PYUU:scaffold_2014 scf1117875582014 dna:supercontig supercontig:pug:scf1117875582014:1:494327:1 
REF
Length=494327

 Score = 45.5 bits (49),  Expect = 0.15
 Identities = 32/37 (86%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  1516    ATCCAGCGGTACATCAAGAACAAGGAGGCGTACCTGG  1552
               ||||||  ||||||||||||||  ||| |||||||||
Sbjct  358281  ATCCAGACGTACATCAAGAACATCGAGACGTACCTGG  358245

>SADI:scaffold_17 supercont1.17 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.17:1:803178:1 
REF
Length=803178

 Score = 44.6 bits (48),  Expect = 0.15
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  574     AAGGACGACGACGCGAACGCCATGGACGA  602
               |||||||| |||| |||||||||||||||
Sbjct  368840  AAGGACGAGGACGAGAACGCCATGGACGA  368812

>SAPA:scaffold_54 supercont2.54 dna:supercontig supercontig:ASM15154v2:supercont2.54:1:242776:1 
REF
Length=242776

 Score = 43.7 bits (47),  Expect = 0.51
 Identities = 34/41 (83%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  1658    GTGGCAAGCGCTTCTTCATGCGCGCCGACGTGAATGTGCCC  1698
               ||||||||||| |  ||||||||| |||| | || ||||||
Sbjct  154181  GTGGCAAGCGCGTGCTCATGCGCGTCGACTTCAACGTGCCC  154221

>PYIW:scaffold_526 piw_scaffold_526 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_526:1:17088:1 
REF
Length=17088

 Score = 43.7 bits (47),  Expect = 0.51
 Identities = 28/31 (90%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  256    AACATCGCGACCTTGAAGTTCGACCTCGCCG  286
              ||||||||||| ||  |||||||||||||||
Sbjct  14189  AACATCGCGACGTTCGAGTTCGACCTCGCCG  14219

>PYAR:scaffold_708 par_scaffold_708 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_708:1:14153:1 
REF
Length=14153

 Score = 43.7 bits (47),  Expect = 0.51
 Identities = 28/31 (90%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  635   ACAACGAGCTGCTGGACACGTACAGTCTCCA  665
             |||||||||||||||||| |||||| || ||
Sbjct  8911  ACAACGAGCTGCTGGACAAGTACAGCCTGCA  8941

>SADI:scaffold_101 supercont1.101 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.101:1:174381:1 
REF
Length=174381

 Score = 42.8 bits (46),  Expect = 0.51
 Identities = 23/23 (100%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  1725   GGACGAGCTCGTGTTCTCGCTCG  1747
              |||||||||||||||||||||||
Sbjct  97295  GGACGAGCTCGTGTTCTCGCTCG  97273

>SADI:scaffold_57 supercont1.57 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.57:1:355175:1 
REF
Length=355175

 Score = 42.8 bits (46),  Expect = 0.51
 Identities = 26/28 (93%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  711    GTTTGTGTCCTTCAAGCGCGTGGCGCAG  738
              ||||| |||| |||||||||||||||||
Sbjct  78330  GTTTGGGTCCCTCAAGCGCGTGGCGCAG  78357

>SADI:scaffold_25 supercont1.25 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.25:1:683613:1 
REF
Length=683613

 Score = 42.8 bits (46),  Expect = 0.51
 Identities = 35/43 (81%), Gaps = 0/43 (0%)
 Strand=Plus/Minus

Query  550     GACGAAGACCTCATGTACGACGAGAAGGACGACGACGCGAACG  592
               ||||| |||  |||| |||| || | ||||||||||||| |||
Sbjct  191835  GACGACGACGACATGGACGAAGACATGGACGACGACGCGGACG  191793

>SADI:scaffold_1 supercont1.1 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.1:1:1813439:1 
REF
Length=1813439

 Score = 42.8 bits (46),  Expect = 0.51
 Identities = 28/30 (93%), Gaps = 1/30 (3%)
 Strand=Plus/Plus

Query  2014    GCAGACGCGATCGTGCAGTTTGGTGTCGTC  2043
               |||| ||||| |||||||||||||||||||
Sbjct  429077  GCAG-CGCGAACGTGCAGTTTGGTGTCGTC  429105

>PYIW:scaffold_271 piw_scaffold_271 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_271:1:22380:1 
REF
Length=22380

 Score = 42.8 bits (46),  Expect = 0.51
 Identities = 31/35 (89%), Gaps = 1/35 (3%)
 Strand=Plus/Plus

Query  1093  GATGACCTCAAGCGCAGGATCAAGAG-CCAGCGAG  1126
             || ||||||||||||||||||||| | ||| ||||
Sbjct  9608  GACGACCTCAAGCGCAGGATCAAGTGTCCACCGAG  9642

>PYIW:scaffold_15 piw_scaffold_15 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_15:1:50877:1 
REF
Length=50877

 Score = 42.8 bits (46),  Expect = 0.51
 Identities = 44/57 (77%), Gaps = 2/57 (4%)
 Strand=Plus/Minus

Query  1265  TCTCGG--TCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCCTCGTCGACTCGAA  1319
             ||||||  || || | || |||||||   ||||  | ||||||||||||| ||||||
Sbjct  5268  TCTCGGGCTCGAGGACAAACTCCAGCGCACGCGCGTGTGCGGCCTCGTCGTCTCGAA  5212

>PHSO:scaffold_4
Length=7609242

 Score = 42.8 bits (46),  Expect = 0.51
 Identities = 32/37 (86%), Gaps = 2/37 (5%)
 Strand=Plus/Minus

Query  507      CGCGTCAGCGA--ACCAGGAGGCCGAGAGCCCCGAGA  541
                |||| | ||||  | ||||||||||||||||||||||
Sbjct  1613828  CGCGCCCGCGAGGAGCAGGAGGCCGAGAGCCCCGAGA  1613792

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  1711     GACATTTACGACGAGGACGAGCTCGTG  1737
                |||||| ||||||||||||||| ||||
Sbjct  6024593  GACATTGACGACGAGGACGAGCGCGTG  6024619

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  1711     GACATTTACGACGAGGACGAGCTCGTG  1737
                |||||| ||||||||||||||| ||||
Sbjct  6063357  GACATTGACGACGAGGACGAGCGCGTG  6063331

>PHPA:scaffold_11 NW_008648997.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.11, whole genome shotgun 
sequence
Length=1562868

 Score = 42.8 bits (46),  Expect = 0.51
 Identities = 33/37 (89%), Gaps = 2/37 (5%)
 Strand=Plus/Minus

Query  2012     ATGCAGA-CGCGATCGTGCAGTTTGGTGTCGTCGTGG  2047
                ||||||| |||||||||||||| ||||| ||| ||||
Sbjct  1488287  ATGCAGATCGCGATCGTGCAGTATGGTG-CGTTGTGG  1488252

>APAS:scaffold_15 supercont1.15 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.15:1:1122121:1 
REF
Length=1122121

 Score = 42.8 bits (46),  Expect = 0.51
 Identities = 35/43 (81%), Gaps = 0/43 (0%)
 Strand=Plus/Minus

Query  546     TGTGGACGAAGACCTCATGTACGACGAGAAGGACGACGACGCG  588
               || ||| | ||||||||||| |||| | |||| | ||||||||
Sbjct  164287  TGGGGATGCAGACCTCATGTGCGACTACAAGGGCAACGACGCG  164245

>SAPA:scaffold_21 supercont2.21 dna:supercontig supercontig:ASM15154v2:supercont2.21:1:505868:1 
REF
Length=505868

 Score = 41.9 bits (45),  Expect = 1.8
 Identities = 34/41 (83%), Gaps = 3/41 (7%)
 Strand=Plus/Plus

Query  562     ATGTACGACGAGAAGGACGACGACGCGAACGCCATGGACGA  602
               ||| |||||||| | ||| |||||||   ||||||||||||
Sbjct  437919  ATGGACGACGAGTACGACCACGACGC---CGCCATGGACGA  437956

>SADI:scaffold_10 supercont1.10 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.10:1:1089536:1 
REF
Length=1089536

 Score = 41.9 bits (45),  Expect = 1.8
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  567      CGACGAGAAGGACGACGACGCGAACGCCATGGACG  601
                ||||||  |||||||||||| | ||| ||||||||
Sbjct  1038048  CGACGACGAGGACGACGACGAGTACGACATGGACG  1038014

>PYVX:scaffold_580 pve_scaffold_580 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_580:1:18951:1 
REF
Length=18951

 Score = 41.9 bits (45),  Expect = 1.8
 Identities = 32/37 (86%), Gaps = 1/37 (3%)
 Strand=Plus/Minus

Query  912   CGGGTCGCTCATCCGGCGACCGGGCCAGCGCTACAAA  948
             ||||||| ||| || || |||||||||||||| ||||
Sbjct  9236  CGGGTCGGTCAGCCAGC-ACCGGGCCAGCGCTTCAAA  9201

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  620    AGAAGATCCGCGGGTACAACGAGCTG  645
              |||||||||||| ||||||| |||||
Sbjct  17338  AGAAGATCCGCGTGTACAACAAGCTG  17363

>PYVX:scaffold_125 pve_scaffold_125 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_125:1:48753:1 
REF
Length=48753

 Score = 41.9 bits (45),  Expect = 1.8
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  564    GTACGACGAGAAGGACGACGACGCG  588
              |||||||||| ||||||||||||||
Sbjct  12975  GTACGACGAGGAGGACGACGACGCG  12999

>PHSO:scaffold_5
Length=6830280

 Score = 41.9 bits (45),  Expect = 1.8
 Identities = 33/40 (83%), Gaps = 0/40 (0%)
 Strand=Plus/Plus

Query  559      CTCATGTACGACGAGAAGGACGACGACGCGAACGCCATGG  598
                |||||||||| ||||| |||||    || |||||||||||
Sbjct  3897163  CTCATGTACGCCGAGACGGACGCGTCCGTGAACGCCATGG  3897202

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 33/40 (83%), Gaps = 3/40 (8%)
 Strand=Plus/Minus

Query  1720    GACGAGGACGAGCTCGTGTTCTCGCTCGCCAAGCTCATCG  1759
               |||| |||||||||||    | ||||||||||||||| ||
Sbjct  834523  GACGTGGACGAGCTCGA---CGCGCTCGCCAAGCTCAACG  834487

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 33/40 (83%), Gaps = 3/40 (8%)
 Strand=Plus/Plus

Query  1720    GACGAGGACGAGCTCGTGTTCTCGCTCGCCAAGCTCATCG  1759
               |||| |||||||||||    | ||||||||||||||| ||
Sbjct  859038  GACGTGGACGAGCTCGA---CGCGCTCGCCAAGCTCAACG  859074

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  564      GTACGACGAGAAGGACGACGACGC  587
                |||||||||| |||||||||||||
Sbjct  4055832  GTACGACGAGGAGGACGACGACGC  4055809

>SADI:scaffold_52 supercont1.52 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.52:1:383575:1 
REF
Length=383575

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  566     ACGACGAGAAGGACGACGACGCGAACGCCATGGACGA  602
               |||||||| |||||||||||| | |||||   |||||
Sbjct  251543  ACGACGAGTAGGACGACGACGAGTACGCCGACGACGA  251579

>SADI:scaffold_13 supercont1.13 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.13:1:908568:1 
REF
Length=908568

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  550     GACGAAGACCTCATGTACGACGAGAAGGACGACGACG  586
               ||||| ||||  | | ||||||| |||||||||||||
Sbjct  105615  GACGACGACCAGAAGGACGACGACAAGGACGACGACG  105579

>SADI:scaffold_12 supercont1.12 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.12:1:915569:1 
REF
Length=915569

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  1738    TTCTCGCTCGCCAAGCTCATCGTCTCG  1764
               ||||||||||||||||||  |||||||
Sbjct  473437  TTCTCGCTCGCCAAGCTCGCCGTCTCG  473463

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  1033    CGCCACCACCTCGCGAGCGTCGTGGCC  1059
               |||||||| ||||||||||| ||||||
Sbjct  599098  CGCCACCAGCTCGCGAGCGTGGTGGCC  599072

>PYVX:scaffold_9 pve_scaffold_9 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_9:1:115815:1 
REF
Length=115815

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  1733   TCGTGTTCTCGCTCGCCAAGCTCATCGTCTCG  1764
              |||||| |||| |||||||||||| |||| ||
Sbjct  36912  TCGTGTGCTCGGTCGCCAAGCTCAGCGTCGCG  36943

>PYUU:scaffold_2025 scf1117875582025 dna:supercontig supercontig:pug:scf1117875582025:1:692778:1 
REF
Length=692778

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 22/22 (100%), Gaps = 0/22 (0%)
 Strand=Plus/Minus

Query  1301    GCGGCCTCGTCGACTCGAACGT  1322
               ||||||||||||||||||||||
Sbjct  558990  GCGGCCTCGTCGACTCGAACGT  558969

>PYUU:scaffold_1239 scf1117875581239 dna:supercontig supercontig:pug:scf1117875581239:1:719819:1 
REF
Length=719819

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  1718    ACGACGAGGACGAGCTCGTGTTCTCGC  1744
               ||||||| ||||||||||||||| |||
Sbjct  662125  ACGACGATGACGAGCTCGTGTTCGCGC  662151

>PYAR:scaffold_2714 par_scaffold_2714 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_2714:1:4453:1 
REF
Length=4453

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  747   GGGCAGCGTCGATGAAGTGATCAAGGC  773
             ||||| |||||||||||| ||||||||
Sbjct  3542  GGGCATCGTCGATGAAGTCATCAAGGC  3516

>PYAR:scaffold_445 par_scaffold_445 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_445:1:18501:1 
REF
Length=18501

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 46/59 (78%), Gaps = 6/59 (10%)
 Strand=Plus/Plus

Query  537   CGAGACGAATGTGGACGAAGACCTCATGTACGACGAGAAGGACGACGACGCGAACGCCA  595
             || || |||||  |||||||||   ||| | || ||||||||||||||||   ||||||
Sbjct  7700  CGTGAAGAATGGAGACGAAGACG--ATGAA-GAGGAGAAGGACGACGACG---ACGCCA  7752

>PYAR:scaffold_169 par_scaffold_169 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_169:1:27332:1 
REF
Length=27332

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  587    CGAACGCCATGGACGAGTTGCGCAAGAATGTCGAGAA  623
              |||||||||||||||  | ||||||   |||||||||
Sbjct  25422  CGAACGCCATGGACGGCTGGCGCAACTTTGTCGAGAA  25386

>APAS:scaffold_91 supercont1.91 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.91:1:302683:1 
REF
Length=302683

 Score = 41.0 bits (44),  Expect = 1.8
 Identities = 22/22 (100%), Gaps = 0/22 (0%)
 Strand=Plus/Plus

Query  567    CGACGAGAAGGACGACGACGCG  588
              ||||||||||||||||||||||
Sbjct  34181  CGACGAGAAGGACGACGACGCG  34202

>SAPA:scaffold_7 supercont2.7 dna:supercontig supercontig:ASM15154v2:supercont2.7:1:943373:1 
REF
Length=943373

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 55/73 (75%), Gaps = 7/73 (10%)
 Strand=Plus/Plus

Query  193     CGCATCTACGACCGCCAGGAACAGCCGATCCGGGCCGTGCCG--CACACTAATCCGTCGG  250
               ||||| | ||| |||| || ||  ||   ||||||||| |||  ||||| |   ||||||
Sbjct  694859  CGCAT-TGCGAGCGCCGGGGACGTCC---CCGGGCCGTTCCGAGCACACCATATCGTCGG  694914

Query  251     GCTTCAA-CATCG  262
               ||||||| |||||
Sbjct  694915  GCTTCAATCATCG  694927

>SADI:scaffold_185 supercont1.185 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.185:1:43012:1 
REF
Length=43012

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  566    ACGACGAGAAGGACGACGACGCGA  589
              ||||||||||||||||||| ||||
Sbjct  29492  ACGACGAGAAGGACGACGAGGCGA  29469

>SADI:scaffold_77 supercont1.77 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.77:1:267713:1 
REF
Length=267713

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  74      AGCAGGACGCGAAGAACGGCATGCTCAGC  102
               |||||||| |||||||||||| |||| ||
Sbjct  196914  AGCAGGACACGAAGAACGGCAAGCTCCGC  196886

>PYVX:scaffold_672 pve_scaffold_672 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_672:1:16221:1 
REF
Length=16221

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  621   GAAGATCCGCGGGTACAACGAGCTGCTGGACACG  654
             |||||||||||||| ||||||  ||| | |||||
Sbjct  6345  GAAGATCCGCGGGTTCAACGAAGTGCAGAACACG  6312

>PYVX:scaffold_10 pve_scaffold_10 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_10:1:111035:1 
REF
Length=111035

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  55     CCGACGCCCGAGCTCTCGGAGCAGGACGC  83
              ||| ||| ||||||||||||||| |||||
Sbjct  60840  CCGCCGCTCGAGCTCTCGGAGCACGACGC  60812

>PYUU:scaffold_2011 scf1117875582011 dna:supercontig supercontig:pug:scf1117875582011:1:418791:1 
REF
Length=418791

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  74      AGCAGGACGCGAAGAACGGCATGCTCAGC  102
               |||||||| |||||||||||| |||| ||
Sbjct  168723  AGCAGGACACGAAGAACGGCAAGCTCCGC  168695

>PYIW:scaffold_1318 piw_scaffold_1318 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1318:1:9635:1 
REF
Length=9635

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 39/50 (78%), Gaps = 3/50 (6%)
 Strand=Plus/Minus

Query  566   ACGACGAGAAGGACG---ACGACGCGAACGCCATGGACGAGTTGCGCAAG  612
             ||||||  ||||||    ||| ||||||||||||  ||||| ||||| ||
Sbjct  9462  ACGACGCAAAGGACTTTAACGGCGCGAACGCCATCAACGAGATGCGCGAG  9413

>PYAR:scaffold_3248 par_scaffold_3248 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_3248:1:3560:1 
REF
Length=3560

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 25/26 (96%), Gaps = 1/26 (4%)
 Strand=Plus/Plus

Query  51   CGCGCCGACGCCCGAGCTCTCGGAGC  76
            |||||||||||||||||||| |||||
Sbjct  625  CGCGCCGACGCCCGAGCTCT-GGAGC  649

>PYAR:scaffold_1209 par_scaffold_1209 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1209:1:9677:1 
REF
Length=9677

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  1718  ACGACGAGGACGAGCTCGTGTTCTCGCTC  1746
             ||| || ||||||| ||||||||||||||
Sbjct  6585  ACGCCGCGGACGAGGTCGTGTTCTCGCTC  6613

>PYAR:scaffold_1050 par_scaffold_1050 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1050:1:10778:1 
REF
Length=10778

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  761   AAGTGATCAAGGCACTCGAGGCGC  784
             ||| ||||||||||||||||||||
Sbjct  9654  AAGAGATCAAGGCACTCGAGGCGC  9677

>PYAR:scaffold_633 par_scaffold_633 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_633:1:15275:1 
REF
Length=15275

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 37/46 (80%), Gaps = 1/46 (2%)
 Strand=Plus/Plus

Query  1653   GTCTG-GTGGCAAGCGCTTCTTCATGCGCGCCGACGTGAATGTGCC  1697
              ||||| | ||||||||| |  || ||||||||||| | || |||||
Sbjct  13808  GTCTGCGCGGCAAGCGCGTGCTCGTGCGCGCCGACCTCAACGTGCC  13853

>PYAR:scaffold_150 par_scaffold_150 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_150:1:28724:1 
REF
Length=28724

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 28/31 (90%), Gaps = 1/31 (3%)
 Strand=Plus/Minus

Query  2545   GATCTCGTGCTGCACGAG-GCGACGCACTCG  2574
              ||||||||||||||  || ||||||||||||
Sbjct  12614  GATCTCGTGCTGCAAAAGAGCGACGCACTCG  12584

>PHSO:scaffold_3
Length=10773376

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 35/44 (80%), Gaps = 0/44 (0%)
 Strand=Plus/Plus

Query  2847    GGTGGGCACCCAGGCGCTCACGGACGAGTTCACGAGCGGCGGCG  2890
               || || || | |||||||||||| || | ||||| || ||||||
Sbjct  836250  GGCGGTCATCAAGGCGCTCACGGGCGTGATCACGCGCAGCGGCG  836293

>PHPA:scaffold_60 NW_008649046.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.60, whole genome shotgun 
sequence
Length=386225

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  473     CAGCACAGCAGCAGCATTCTGGAA  496
               ||||||||||||||||||||| ||
Sbjct  184957  CAGCACAGCAGCAGCATTCTGAAA  184934

>PHKE:scaffold_19 scf_22126_19.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_19.1:1:212425:1 
REF
Length=212425

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 34/41 (83%), Gaps = 1/41 (2%)
 Strand=Plus/Plus

Query  395     GTGCTCGTGGCCCAAATGTACTCACTGTGAGCTTCCAAGGC  435
               |||| |||| ||| ||  |||||| ||||||||||||| ||
Sbjct  101084  GTGC-CGTGTCCCCAAAATACTCATTGTGAGCTTCCAATGC  101123

>APIN:scaffold_247 supercont1.247 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.247:1:17409:1 
REF
Length=17409

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  2861   CGCTCACGGACGAGTTCACGAGCG  2884
              ||||||||||||||| ||||||||
Sbjct  14909  CGCTCACGGACGAGTACACGAGCG  14886

>APAS:scaffold_57 supercont1.57 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.57:1:359478:1 
REF
Length=359478

 Score = 40.1 bits (43),  Expect = 6.3
 Identities = 39/48 (81%), Gaps = 2/48 (4%)
 Strand=Plus/Minus

Query  588     GAACGCCATGGACGAGTTGCGCAAGAATGTCGAGAA-GATCCG-CGGG  633
               |||||| | | |||||||||||||||  | || ||| |||||| ||||
Sbjct  208834  GAACGCGAAGAACGAGTTGCGCAAGAGAGACGCGAACGATCCGTCGGG  208787

>SAPA:scaffold_14 supercont2.14 dna:supercontig supercontig:ASM15154v2:supercont2.14:1:615410:1 
REF
Length=615410

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 30/35 (86%), Gaps = 2/35 (6%)
 Strand=Plus/Minus

Query  570     CGAGAAGGACGACGACGCGAACGCCATGGACGAGT  604
               ||||||||||||||||| | ||| |  ||||||||
Sbjct  166204  CGAGAAGGACGACGACGAGGACGTC--GGACGAGT  166172

>SAPA:scaffold_8 supercont2.8 dna:supercontig supercontig:ASM15154v2:supercont2.8:1:845095:1 
REF
Length=845095

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 29/33 (88%), Gaps = 1/33 (3%)
 Strand=Plus/Minus

Query  51      CGCGCCGACGCCCGAGCTCTCGGAGCAGGACGC  83
               |||||||||||||||||| | |||||| | |||
Sbjct  487984  CGCGCCGACGCCCGAGCTGT-GGAGCAAGGCGC  487953

>SAPA:scaffold_4 supercont2.4 dna:supercontig supercontig:ASM15154v2:supercont2.4:1:1210272:1 
REF
Length=1210272

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  2734    TTTCTCCTTGCCGACAGCCTC  2754
               |||||||||||||||||||||
Sbjct  788033  TTTCTCCTTGCCGACAGCCTC  788053

>SADI:scaffold_29 supercont1.29 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.29:1:692626:1 
REF
Length=692626

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  2586    CCTCGAGAAGGTTGGCGCTCAGCACA  2611
               ||||||| ||||||||||| ||||||
Sbjct  359157  CCTCGAGGAGGTTGGCGCTAAGCACA  359132

>SADI:scaffold_23 supercont1.23 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.23:1:702007:1 
REF
Length=702007

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 34/42 (81%), Gaps = 3/42 (7%)
 Strand=Plus/Plus

Query  561     CATGTACGACGAGAAGGACGACGACGCGAACG---CCATGGA  599
               |||| |||||||  |||||||||||| | |||   |||||||
Sbjct  157288  CATGGACGACGACGAGGACGACGACGAGGACGTGCCCATGGA  157329

>SADI:scaffold_16 supercont1.16 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.16:1:806927:1 
REF
Length=806927

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  566     ACGACGAGAAGGACGACGACG  586
               |||||||||||||||||||||
Sbjct  106202  ACGACGAGAAGGACGACGACG  106182

>SADI:scaffold_2 supercont1.2 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.2:1:1527201:1 
REF
Length=1527201

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  2780    GCTGCAGCGACACGGCGAGCGGCGCG  2805
               || |||||||||||||||||||| ||
Sbjct  712786  GCGGCAGCGACACGGCGAGCGGCTCG  712761

>PYVX:scaffold_626 pve_scaffold_626 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_626:1:17731:1 
REF
Length=17731

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 29/33 (88%), Gaps = 1/33 (3%)
 Strand=Plus/Minus

Query  1722  CGAGGACGAGCTCGTGTT-CTCGCTCGCCAAGC  1753
             |||||||||||||| ||| ||| | ||||||||
Sbjct  6257  CGAGGACGAGCTCGAGTTCCTCACGCGCCAAGC  6225

>PYVX:scaffold_14 pve_scaffold_14 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_14:1:104156:1 
REF
Length=104156

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 30/35 (86%), Gaps = 2/35 (6%)
 Strand=Plus/Plus

Query  813    GTACGTCGACGGCCAGC--GACTCATGACGGTCGC  845
              || ||||||||||| ||  ||| ||||||||||||
Sbjct  39827  GTCCGTCGACGGCCGGCGAGACACATGACGGTCGC  39861

>PYUU:scaffold_2023 scf1117875582023 dna:supercontig supercontig:pug:scf1117875582023:1:1683196:1 
REF
Length=1683196

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 39/48 (81%), Gaps = 6/48 (13%)
 Strand=Plus/Minus

Query  51       CGCGCCGACGCC--CGAGCTCTCGGAGCAGGA-CGCGAAGAACGGCAT  95
                |||| |||||||  ||||| |   ||||| || |||||||||||||||
Sbjct  1012611  CGCGACGACGCCGCCGAGCAC---GAGCACGAGCGCGAAGAACGGCAT  1012567

>PYIW:scaffold_7169 piw_scaffold_7169 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_7169:1:723:1 
REF
Length=723

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  2094  TGTCGAGCCCAGTGGCGAGGTGCATGTCTCG  2124
             ||||||| |||||||||||  ||| ||||||
Sbjct  153   TGTCGAGACCAGTGGCGAGCAGCAGGTCTCG  183

>PYIW:scaffold_1941 piw_scaffold_1941 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1941:1:6593:1 
REF
Length=6593

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  610   AAGAATGTCGAGAAGATCCGCGGGTACAACGAGCTG  645
             ||||| | | |||||||||||| | |||||||| ||
Sbjct  5602  AAGAAGGCCAAGAAGATCCGCGTGGACAACGAGGTG  5567

>PYIW:scaffold_605 piw_scaffold_605 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_605:1:16167:1 
REF
Length=16167

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  2960   AGCTGGAGAAGATCCGGCGCCTGCGC  2985
              |||| | |||||||||||||||||||
Sbjct  12427  AGCTTGGGAAGATCCGGCGCCTGCGC  12452

>PYIW:scaffold_227 piw_scaffold_227 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_227:1:23993:1 
REF
Length=23993

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  786    GCTCACGCGCTACTTCGTGCCTCTCG  811
              ||||||||||| ||||||||| ||||
Sbjct  20886  GCTCACGCGCTGCTTCGTGCCGCTCG  20861

>PYIR:scaffold_413 pir_scaffold_413 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_413:1:26624:1 
REF
Length=26624

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  1521   GCGGTACATCAAGAACAAGGAGGCGTACCTG  1551
              ||||||| | ||||||  |||||||||||||
Sbjct  11905  GCGGTACCTGAAGAACCTGGAGGCGTACCTG  11875

>PYIR:scaffold_230 pir_scaffold_230 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_230:1:38797:1 
REF
Length=38797

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  786   GCTCACGCGCTACTTCGTGCCTCTCG  811
             ||||||||||| ||||||||| ||||
Sbjct  7688  GCTCACGCGCTGCTTCGTGCCACTCG  7663

>PYIR:scaffold_202 pir_scaffold_202 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_202:1:42067:1 
REF
Length=42067

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 33/41 (80%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  880    CTGCTCTCGTGCATCGTCAACGAGGACCAGGTCGGGTCGCT  920
              |||||||||||||||  || || ||  | ||||||| ||||
Sbjct  39765  CTGCTCTCGTGCATCAGCACCGCGGCGCTGGTCGGGACGCT  39725

>PYIR:scaffold_199 pir_scaffold_199 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_199:1:42436:1 
REF
Length=42436

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  617    TCGAGAAGATCCGCGGGTACAACGAGCTGCT  647
              ||||||||||||||||  | ||||| |||||
Sbjct  36571  TCGAGAAGATCCGCGGCAAGAACGACCTGCT  36541

>PYAR:scaffold_468 par_scaffold_468 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_468:1:17874:1 
REF
Length=17874

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  2780  GCTGCAGCGACACGGCGAGCGGCGCG  2805
             ||||||||| || |||||||||||||
Sbjct  7694  GCTGCAGCGCCAGGGCGAGCGGCGCG  7669

>PHSO:scaffold_8
Length=3549547

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 41/53 (77%), Gaps = 1/53 (2%)
 Strand=Plus/Minus

Query  1302   CGGCCTCGTCGACTCGAACGTAGACATTGTCTATGTCTCACCCTTTGAGCTCA  1354
              ||||| ||||| |  || |  ||  |||| ||||| |||| ||||||||||||
Sbjct  13945  CGGCCACGTCGGCGAGATCCAAGCGATTG-CTATGCCTCAACCTTTGAGCTCA  13894

>PHRA:scaffold_4
Length=963095

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  756     CGATGAAGTGATCAAGGCACTCGAGGCGCTG  786
               |||||||||| | || | |||||||||||||
Sbjct  490350  CGATGAAGTGGTTAAAGGACTCGAGGCGCTG  490380

>APAS:scaffold_13 supercont1.13 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.13:1:1183921:1 
REF
Length=1183921

 Score = 39.2 bits (42),  Expect = 6.3
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  788      TCACGCGCTACTTCGTGCCTCTCGCGTACGT  818
                |||| |||| |||| || |||||||||||||
Sbjct  1086863  TCACACGCTTCTTCTTGTCTCTCGCGTACGT  1086893

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 3835795681431

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2