Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
PYIR:scaffold_81013741018424699380.0
PYIW:scaffold_96311006114084035063e-126
PYVX:scaffold_275154922186973742e-90
PYUU:scaffold_2037130792613083434543492e-83
PYAR:scaffold_2916050165505262933e-68
PYAP:scaffold_16220105206185382556e-58
PHSO:scaffold_1280040528007533622287e-51
PHCA:scaffold_841005821012626962013e-43
PHRA:scaffold_561502511509547181981e-42
PHPA:scaffold_632511742518677171691e-34
PHIF:NW_003303697.14312194319007051455e-28
PHKE:scaffold_9867454681407051303e-24
ALLA:FR8241041130811603318936e-14
PLHA:NW_020189861.118444191844548131849e-12
ALCA:scaffold_908589866375706e-08
SADI:scaffold_420429020435061520.004
PYVX:scaffold_5184911494131520.004
APAS:scaffold_1159742759745428510.015
PYAR:scaffold_17833902392625500.015
PYVX:scaffold_334111251115329480.052
PYVX:scaffold_77213952141824480.052
PYIW:scaffold_4141102114140480.052
PHIF:NW_003303753.12262594226262229480.052
SAPA:scaffold_2439495239499241470.18
PYUU:scaffold_138125391225395948470.18
PHSO:scaffold_72634794263482633460.18
PHRA:scaffold_1216013616016833460.18
APAS:scaffold_41703887041023460.18
PYAP:scaffold_55312323126130450.63
PHSO:scaffold_42255327225535125450.63
PHRA:scaffold_1550671850676245450.63
PYVX:scaffold_704151441518643440.63
PYVX:scaffold_424200692011547440.63
PYUU:scaffold_1880595685960034440.63
PYIW:scaffold_34722087212438440.63
PHSO:scaffold_31433925143395329440.63
PHSO:scaffold_276217476220229440.63
SAPA:scaffold_21178898117893134432.2
SADI:scaffold_79198201985334432.2
SADI:scaffold_339595039598334432.2
PYVX:scaffold_12611098112124432.2
PYVX:scaffold_99338743246432.2
PYVX:scaffold_258181021815150432.2
PYIW:scaffold_308204292045729432.2
PYIR:scaffold_750129631298624432.2
PYAR:scaffold_37511320135436432.2
PYAR:scaffold_11242077210529432.2
PYAR:scaffold_1061471149929432.2
PHPA:scaffold_42694871269492969432.2
PHCA:scaffold_3825459825462124432.2
HYAP:scaffold_14631925195329432.2
SAPA:scaffold_6716421316423826422.2
SADI:scaffold_1815918815921326422.2
PYVX:scaffold_417164001642021422.2
PYVX:scaffold_158238722389726422.2
PYVX:scaffold_137417124175241422.2
PYUU:scaffold_204176839876842933422.2
PYIW:scaffold_130677480936422.2
PYIW:scaffold_92294282946137422.2
PYAR:scaffold_862264166626422.2
PHSO:scaffold_423902392726422.2
PHSO:scaffold_91659849165986921422.2
PHSO:scaffold_82219399221942426422.2
PHRA:scaffold_121657796584984422.2
PHRA:scaffold_796738675821422.2
PHRA:scaffold_45606466067126422.2
PHCA:scaffold_68321153214026422.2
PHCA:scaffold_6327268627271126422.2
HYAP:scaffold_33689856902743422.2
APIN:scaffold_131300125130014521422.2
APAS:scaffold_21277250127729345422.2
SAPA:scaffold_29535455358341417.7
SADI:scaffold_6311851011853223417.7
SADI:scaffold_4024168624172542417.7
PYVX:scaffold_117157860528417.7
PYVX:scaffold_4148143818644417.7
PYVX:scaffold_2594448447225417.7
PYVX:scaffold_41422114226859417.7
PYVX:scaffold_372308234033417.7
PYVX:scaffold_9572235724523417.7
PYUU:scaffold_201812447112451040417.7
PYIW:scaffold_473845647823417.7
PYIW:scaffold_143138642338417.7
PYIW:scaffold_4522535228533417.7
PYIR:scaffold_4793897134417.7
PYAP:scaffold_16791033105523417.7
PLHA:NW_020187567.12136604213665249417.7
PHRA:scaffold_128276492767628417.7
PHRA:scaffold_6626897626900328417.7
PHKE:scaffold_251351243515128417.7
PHKE:scaffold_79708067083935417.7
PHIF:NW_003303745.11643786164382338417.7
PHIF:NW_003303741.12149297214933135417.7
PHIF:NW_003303730.139429639432328417.7
PHCA:scaffold_4925553025555728417.7
PHCA:scaffold_42237992382123417.7
APAS:scaffold_8323145723151054417.7
APAS:scaffold_464151264153423417.7
ALLA:FR824372211062113430417.7
SAPA:scaffold_274127701280637407.7
SAPA:scaffold_157424254247147407.7
SADI:scaffold_66531765320025407.7
SADI:scaffold_3748457448460835407.7
PYVX:scaffold_98792595935407.7
PYVX:scaffold_7607205723531407.7
PYVX:scaffold_7453694371320407.7
PYVX:scaffold_7249081911030407.7
PYVX:scaffold_512212332126735407.7
PYUU:scaffold_136810690510692420407.7
PYUU:scaffold_201115512815514720407.7
PYUU:scaffold_202630970730974135407.7
PYUU:scaffold_202813743413745825407.7
PYUU:scaffold_20291128425112844420407.7
PYIW:scaffold_562591593420407.7
PYIW:scaffold_495642144020407.7
PYIW:scaffold_460013917537407.7
PYIW:scaffold_12739728975225407.7
PYIW:scaffold_11442016205948407.7
PYIW:scaffold_5485514857525407.7
PYIR:scaffold_3614115415746407.7
PYIR:scaffold_162227302276435407.7
PYAR:scaffold_2807056708025407.7
PYAP:scaffold_229310233106442407.7
PYAP:scaffold_106448264485530407.7
PYAP:scaffold_20530915314152407.7
PHSO:scaffold_55672657567268732407.7
PHRA:scaffold_123297582978730407.7
PHRA:scaffold_5330181230183625407.7
PHRA:scaffold_2239129939132830407.7
PHRA:scaffold_1629746629750137407.7
PHRA:scaffold_3496204964930407.7
PHPA:scaffold_4416577016580843407.7
PHKE:scaffold_493989102335407.7
PHIF:NW_003303749.11043819104384325407.7
PHIF:NW_003303738.11541160154119435407.7
PHIF:NW_003303737.12074551207457929407.7
PHIF:NW_003303562.111312711315125407.7
APIN:scaffold_1926195826198730407.7
APAS:scaffold_1214231614233520407.7
BLASTN 2.9.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= PYIR_13451

Length=1080
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_sc...  847        0.0   
PYIW:scaffold_963 piw_scaffold_963 dna:supercontig supercontig:pi...  457        3e-126
PYVX:scaffold_275 pve_scaffold_275 dna:supercontig supercontig:pv...  338        2e-90 
PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:p...  315        2e-83 
PYAR:scaffold_29 par_scaffold_29 dna:supercontig supercontig:par_...  265        3e-68 
PYAP:scaffold_162 pag1_scaffold_162 dna:supercontig supercontig:p...  231        6e-58 
PHSO:scaffold_1                                                       206        7e-51 
PHCA:scaffold_84 PHYCAscaffold_84                                     182        3e-43 
PHRA:scaffold_56                                                      179        1e-42 
PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 ...  153        1e-34 
PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 ge...  132        5e-28 
PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercon...  118        3e-24 
ALLA:FR824104 dna:supercontig supercontig:ENA1:FR824104:1:105594:...  85.1       6e-14 
PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig:...  77.0       9e-12 
ALCA:scaffold_90 AcNc2_CONTIG_90_length_79489 dna:supercontig sup...  64.4       6e-08 
SADI:scaffold_4 supercont1.4 dna:supercontig supercontig:Sap_dicl...  48.2       0.004 
PYVX:scaffold_518 pve_scaffold_518 dna:supercontig supercontig:pv...  48.2       0.004 
APAS:scaffold_11 supercont1.11 dna:supercontig supercontig:Apha_a...  47.3       0.015 
PYAR:scaffold_1783 par_scaffold_1783 dna:supercontig supercontig:...  46.4       0.015 
PYVX:scaffold_334 pve_scaffold_334 dna:supercontig supercontig:pv...  44.6       0.052 
PYVX:scaffold_77 pve_scaffold_77 dna:supercontig supercontig:pve_...  44.6       0.052 
PYIW:scaffold_414 piw_scaffold_414 dna:supercontig supercontig:pi...  44.6       0.052 
PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 gen...  44.6       0.052 
SAPA:scaffold_24 supercont2.24 dna:supercontig supercontig:ASM151...  43.7       0.18  
PYUU:scaffold_1381 scf1117875581381 dna:supercontig supercontig:p...  43.7       0.18  
PHSO:scaffold_7                                                       42.8       0.18  
PHRA:scaffold_12                                                      42.8       0.18  
APAS:scaffold_41 supercont1.41 dna:supercontig supercontig:Apha_a...  42.8       0.18  
PYAP:scaffold_55 pag1_scaffold_55 dna:supercontig supercontig:pag...  41.9       0.63  
PHSO:scaffold_4                                                       41.9       0.63  
PHRA:scaffold_15                                                      41.9       0.63  
PYVX:scaffold_704 pve_scaffold_704 dna:supercontig supercontig:pv...  41.0       0.63  
PYVX:scaffold_424 pve_scaffold_424 dna:supercontig supercontig:pv...  41.0       0.63  
PYUU:scaffold_1880 scf1117875581880 dna:supercontig supercontig:p...  41.0       0.63  
PYIW:scaffold_3472 piw_scaffold_3472 dna:supercontig supercontig:...  41.0       0.63  
PHSO:scaffold_3                                                       41.0       0.63  
PHSO:scaffold_2                                                       41.0       0.63  
SAPA:scaffold_2 supercont2.2 dna:supercontig supercontig:ASM15154...  40.1       2.2   
SADI:scaffold_79 supercont1.79 dna:supercontig supercontig:Sap_di...  40.1       2.2   
SADI:scaffold_3 supercont1.3 dna:supercontig supercontig:Sap_dicl...  40.1       2.2   
PYVX:scaffold_1261 pve_scaffold_1261 dna:supercontig supercontig:...  40.1       2.2   
PYVX:scaffold_993 pve_scaffold_993 dna:supercontig supercontig:pv...  40.1       2.2   
PYVX:scaffold_258 pve_scaffold_258 dna:supercontig supercontig:pv...  40.1       2.2   
PYIW:scaffold_308 piw_scaffold_308 dna:supercontig supercontig:pi...  40.1       2.2   
PYIR:scaffold_750 pir_scaffold_750 dna:supercontig supercontig:pi...  40.1       2.2   
PYAR:scaffold_3751 par_scaffold_3751 dna:supercontig supercontig:...  40.1       2.2   
PYAR:scaffold_1124 par_scaffold_1124 dna:supercontig supercontig:...  40.1       2.2   
PYAR:scaffold_106 par_scaffold_106 dna:supercontig supercontig:pa...  40.1       2.2   
PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 u...  40.1       2.2   
PHCA:scaffold_38 PHYCAscaffold_38                                     40.1       2.2   
HYAP:scaffold_1463 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold...  40.1       2.2   
SAPA:scaffold_67 supercont2.67 dna:supercontig supercontig:ASM151...  39.2       2.2   
SADI:scaffold_18 supercont1.18 dna:supercontig supercontig:Sap_di...  39.2       2.2   
PYVX:scaffold_417 pve_scaffold_417 dna:supercontig supercontig:pv...  39.2       2.2   
PYVX:scaffold_158 pve_scaffold_158 dna:supercontig supercontig:pv...  39.2       2.2   
PYVX:scaffold_137 pve_scaffold_137 dna:supercontig supercontig:pv...  39.2       2.2   
PYUU:scaffold_2041 scf1117875582041 dna:supercontig supercontig:p...  39.2       2.2   
PYIW:scaffold_1306 piw_scaffold_1306 dna:supercontig supercontig:...  39.2       2.2   
PYIW:scaffold_92 piw_scaffold_92 dna:supercontig supercontig:piw_...  39.2       2.2   
PYAR:scaffold_8622 par_scaffold_8622 dna:supercontig supercontig:...  39.2       2.2   
PHSO:scaffold_42                                                      39.2       2.2   
PHSO:scaffold_9                                                       39.2       2.2   
PHSO:scaffold_8                                                       39.2       2.2   
PHRA:scaffold_121                                                     39.2       2.2   
PHRA:scaffold_79                                                      39.2       2.2   
PHRA:scaffold_45                                                      39.2       2.2   
PHCA:scaffold_68 PHYCAscaffold_68                                     39.2       2.2   
PHCA:scaffold_63 PHYCAscaffold_63                                     39.2       2.2   
HYAP:scaffold_33 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_3...  39.2       2.2   
APIN:scaffold_13 supercont1.13 dna:supercontig supercontig:Apha_i...  39.2       2.2   
APAS:scaffold_2 supercont1.2 dna:supercontig supercontig:Apha_ast...  39.2       2.2   
SAPA:scaffold_29 supercont2.29 dna:supercontig supercontig:ASM151...  38.3       7.7   
SADI:scaffold_63 supercont1.63 dna:supercontig supercontig:Sap_di...  38.3       7.7   
SADI:scaffold_40 supercont1.40 dna:supercontig supercontig:Sap_di...  38.3       7.7   
PYVX:scaffold_1171 pve_scaffold_1171 dna:supercontig supercontig:...  38.3       7.7   
PYVX:scaffold_414 pve_scaffold_414 dna:supercontig supercontig:pv...  38.3       7.7   
PYVX:scaffold_259 pve_scaffold_259 dna:supercontig supercontig:pv...  38.3       7.7   
PYVX:scaffold_41 pve_scaffold_41 dna:supercontig supercontig:pve_...  38.3       7.7   
PYVX:scaffold_37 pve_scaffold_37 dna:supercontig supercontig:pve_...  38.3       7.7   
PYVX:scaffold_9 pve_scaffold_9 dna:supercontig supercontig:pve_sc...  38.3       7.7   
PYUU:scaffold_2018 scf1117875582018 dna:supercontig supercontig:p...  38.3       7.7   
PYIW:scaffold_4738 piw_scaffold_4738 dna:supercontig supercontig:...  38.3       7.7   
PYIW:scaffold_1431 piw_scaffold_1431 dna:supercontig supercontig:...  38.3       7.7   
PYIW:scaffold_4 piw_scaffold_4 dna:supercontig supercontig:piw_sc...  38.3       7.7   
PYIR:scaffold_47 pir_scaffold_47 dna:supercontig supercontig:pir_...  38.3       7.7   
PYAP:scaffold_1679 pag1_scaffold_1679 dna:supercontig supercontig...  38.3       7.7   
PLHA:NW_020187567.1 Plasmopara halstedii genome assembly, contig:...  38.3       7.7   
PHRA:scaffold_128                                                     38.3       7.7   
PHRA:scaffold_66                                                      38.3       7.7   
PHKE:scaffold_251 scf_22126_251.1 dna:supercontig supercontig:Phy...  38.3       7.7   
PHKE:scaffold_79 scf_22126_79.1_contig_1 dna:supercontig supercon...  38.3       7.7   
PHIF:NW_003303745.1 Phytophthora infestans T30-4 supercont1.14 ge...  38.3       7.7   
PHIF:NW_003303741.1 Phytophthora infestans T30-4 supercont1.18 ge...  38.3       7.7   
PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 ge...  38.3       7.7   
PHCA:scaffold_49 PHYCAscaffold_49                                     38.3       7.7   
PHCA:scaffold_42 PHYCAscaffold_42                                     38.3       7.7   
APAS:scaffold_83 supercont1.83 dna:supercontig supercontig:Apha_a...  38.3       7.7   
APAS:scaffold_4 supercont1.4 dna:supercontig supercontig:Apha_ast...  38.3       7.7   
ALLA:FR824372 dna:supercontig supercontig:ENA1:FR824372:1:28325:1...  38.3       7.7   
SAPA:scaffold_274 supercont2.274 dna:supercontig supercontig:ASM1...  37.4       7.7   
SAPA:scaffold_157 supercont2.157 dna:supercontig supercontig:ASM1...  37.4       7.7   
SADI:scaffold_66 supercont1.66 dna:supercontig supercontig:Sap_di...  37.4       7.7   
SADI:scaffold_37 supercont1.37 dna:supercontig supercontig:Sap_di...  37.4       7.7   
PYVX:scaffold_987 pve_scaffold_987 dna:supercontig supercontig:pv...  37.4       7.7   
PYVX:scaffold_760 pve_scaffold_760 dna:supercontig supercontig:pv...  37.4       7.7   
PYVX:scaffold_745 pve_scaffold_745 dna:supercontig supercontig:pv...  37.4       7.7   
PYVX:scaffold_724 pve_scaffold_724 dna:supercontig supercontig:pv...  37.4       7.7   
PYVX:scaffold_512 pve_scaffold_512 dna:supercontig supercontig:pv...  37.4       7.7   
PYUU:scaffold_1368 scf1117875581368 dna:supercontig supercontig:p...  37.4       7.7   
PYUU:scaffold_2011 scf1117875582011 dna:supercontig supercontig:p...  37.4       7.7   
PYUU:scaffold_2026 scf1117875582026 dna:supercontig supercontig:p...  37.4       7.7   
PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:p...  37.4       7.7   
PYUU:scaffold_2029 scf1117875582029 dna:supercontig supercontig:p...  37.4       7.7   
PYIW:scaffold_5625 piw_scaffold_5625 dna:supercontig supercontig:...  37.4       7.7   
PYIW:scaffold_4956 piw_scaffold_4956 dna:supercontig supercontig:...  37.4       7.7   
PYIW:scaffold_4600 piw_scaffold_4600 dna:supercontig supercontig:...  37.4       7.7   
PYIW:scaffold_1273 piw_scaffold_1273 dna:supercontig supercontig:...  37.4       7.7   
PYIW:scaffold_1144 piw_scaffold_1144 dna:supercontig supercontig:...  37.4       7.7   
PYIW:scaffold_5 piw_scaffold_5 dna:supercontig supercontig:piw_sc...  37.4       7.7   
PYIR:scaffold_361 pir_scaffold_361 dna:supercontig supercontig:pi...  37.4       7.7   
PYIR:scaffold_162 pir_scaffold_162 dna:supercontig supercontig:pi...  37.4       7.7   
PYAR:scaffold_280 par_scaffold_280 dna:supercontig supercontig:pa...  37.4       7.7   
PYAP:scaffold_229 pag1_scaffold_229 dna:supercontig supercontig:p...  37.4       7.7   
PYAP:scaffold_106 pag1_scaffold_106 dna:supercontig supercontig:p...  37.4       7.7   
PYAP:scaffold_20 pag1_scaffold_20 dna:supercontig supercontig:pag...  37.4       7.7   
PHSO:scaffold_5                                                       37.4       7.7   
PHRA:scaffold_123                                                     37.4       7.7   
PHRA:scaffold_53                                                      37.4       7.7   
PHRA:scaffold_22                                                      37.4       7.7   
PHRA:scaffold_16                                                      37.4       7.7   
PHRA:scaffold_3                                                       37.4       7.7   
PHPA:scaffold_44 NW_008649030.1 Phytophthora parasitica INRA-310 ...  37.4       7.7   
PHKE:scaffold_493 scf_22126_493.1_contig_1 dna:supercontig superc...  37.4       7.7   
PHIF:NW_003303749.1 Phytophthora infestans T30-4 supercont1.10 ge...  37.4       7.7   
PHIF:NW_003303738.1 Phytophthora infestans T30-4 supercont1.21 ge...  37.4       7.7   
PHIF:NW_003303737.1 Phytophthora infestans T30-4 supercont1.22 ge...  37.4       7.7   
PHIF:NW_003303562.1 Phytophthora infestans T30-4 supercont1.197 g...  37.4       7.7   
APIN:scaffold_19 supercont1.19 dna:supercontig supercontig:Apha_i...  37.4       7.7   
APAS:scaffold_12 supercont1.12 dna:supercontig supercontig:Apha_a...  37.4       7.7   

>PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_8:1:111390:1 
REF
Length=111390

 Score = 847 bits (938),  Expect = 0.0
 Identities = 469/469 (100%), Gaps = 0/469 (0%)
 Strand=Plus/Plus

Query  1       ATGAACATCCTGCGCGTGCCGGACGCCAAGCTCGCGACGTCAGGCAGTAATGGTGGCGCT  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  101374  ATGAACATCCTGCGCGTGCCGGACGCCAAGCTCGCGACGTCAGGCAGTAATGGTGGCGCT  101433

Query  61      GGTGATAAGTTCAAGCCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGC  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  101434  GGTGATAAGTTCAAGCCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGC  101493

Query  121     AAGTCCTGGCGCGTGCGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACTAC  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  101494  AAGTCCTGGCGCGTGCGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACTAC  101553

Query  181     GAGAGCCGCGACGCCAGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGTACCGGTGCCC  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  101554  GAGAGCCGCGACGCCAGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGTACCGGTGCCC  101613

Query  241     AAAGGCAGCTTTTACGTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGTCATGGGC  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  101614  AAAGGCAGCTTTTACGTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGTCATGGGC  101673

Query  301     GGCCGCGAGAAGCCTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATC  360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  101674  GGCCGCGAGAAGCCTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATC  101733

Query  361     GAGCTCGACATCTTTGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGTGCAG  420
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  101734  GAGCTCGACATCTTTGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGTGCAG  101793

Query  421     AACGCGCTGGACGCCGCCAAGAAGCGCAGTCGCACTGGTGGATTCCAAG  469
               |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  101794  AACGCGCTGGACGCCGCCAAGAAGCGCAGTCGCACTGGTGGATTCCAAG  101842

 Score = 798 bits (884),  Expect = 0.0
 Identities = 442/442 (100%), Gaps = 0/442 (0%)
 Strand=Plus/Plus

Query  639     AGAGAAACTGGACATGGTCGAGAGCGACTTGGGCAAGGTCGAGGGCGATCTCGACCACGC  698
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  102209  AGAGAAACTGGACATGGTCGAGAGCGACTTGGGCAAGGTCGAGGGCGATCTCGACCACGC  102268

Query  699     GGACAAGCTACTGCGCCACATGAAGCGGCCAATGCTGCACCTGTTCTCGGGTGACGAGCG  758
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  102269  GGACAAGCTACTGCGCCACATGAAGCGGCCAATGCTGCACCTGTTCTCGGGTGACGAGCG  102328

Query  759     TGTCAAGCAGAGTCCGCATACTGGTGGCGCTTCTGGTCACACTGACCGCGCGAGTCATGG  818
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  102329  TGTCAAGCAGAGTCCGCATACTGGTGGCGCTTCTGGTCACACTGACCGCGCGAGTCATGG  102388

Query  819     TCAGACACCTGGTACTACTAATGGCGGTACCGCAGGCGGACAGCAGATTCATGGACAACG  878
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  102389  TCAGACACCTGGTACTACTAATGGCGGTACCGCAGGCGGACAGCAGATTCATGGACAACG  102448

Query  879     CAATGACGCGCTGAGCGACCTCGAGAAGCTGGCGCTGGCGCTGGGCGAGCTGGAGGAGCA  938
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  102449  CAATGACGCGCTGAGCGACCTCGAGAAGCTGGCGCTGGCGCTGGGCGAGCTGGAGGAGCA  102508

Query  939     GGCGAACCTCATGAACGCCGAGGCCGTGAAGAGCACGGAGCAGATCGCCCGCGTCGAGCA  998
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  102509  GGCGAACCTCATGAACGCCGAGGCCGTGAAGAGCACGGAGCAGATCGCCCGCGTCGAGCA  102568

Query  999     GCGCCTCACCGCTGTGAACGACCGCGTGCAAACGCAGACCAAAAAGGCGAACGCCACGAT  1058
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  102569  GCGCCTCACCGCTGTGAACGACCGCGTGCAAACGCAGACCAAAAAGGCGAACGCCACGAT  102628

Query  1059    GAAAGCCGGCAACCTGTTCTGA  1080
               ||||||||||||||||||||||
Sbjct  102629  GAAAGCCGGCAACCTGTTCTGA  102650

 Score = 313 bits (346),  Expect = 7e-83
 Identities = 173/173 (100%), Gaps = 0/173 (0%)
 Strand=Plus/Plus

Query  468     AGACAACTCGACGACCAAGACGATGTTTGGCTTCAGCGCGTCGGCGTCGCCGCAGCTGCA  527
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  101941  AGACAACTCGACGACCAAGACGATGTTTGGCTTCAGCGCGTCGGCGTCGCCGCAGCTGCA  102000

Query  528     GGTGAAGAAGCTCGCGGCCACGAAAGAGGATCTGCTCAGGGATGCGCTGCGCGAGATCGA  587
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  102001  GGTGAAGAAGCTCGCGGCCACGAAAGAGGATCTGCTCAGGGATGCGCTGCGCGAGATCGA  102060

Query  588     AGGCGCGAAGCTCATTGGACGCGAAGCGGTCAACGAGATCGTCGTCCAGGGAG  640
               |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  102061  AGGCGCGAAGCTCATTGGACGCGAAGCGGTCAACGAGATCGTCGTCCAGGGAG  102113

>PYIW:scaffold_963 piw_scaffold_963 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_963:1:12226:1 
REF
Length=12226

 Score = 457 bits (506),  Expect = 3e-126
 Identities = 343/403 (85%), Gaps = 0/403 (0%)
 Strand=Plus/Minus

Query  238    CCCAAAGGCAGCTTTTACGTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGTCATG  297
              || || |||||||| | ||| || ||||| ||||||||||| ||||||||||||||||||
Sbjct  11408  CCGAAGGGCAGCTTCTTCGTCTCAAGCGTCGAGAAGCACGAGTACTGGGTCGGCGTCATG  11349

Query  298    GGCGGCCGCGAGAAGCCTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTAC  357
              |||||||| |||||||| || || || ||||| |||||||||||||| ||||||||||||
Sbjct  11348  GGCGGCCGTGAGAAGCCCTTTGGGTTTAAGCTCGTGGGCCACGCGCCCAAGAAAGGCTAC  11289

Query  358    ATCGAGCTCGACATCTTTGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGTG  417
              |||||||||||||||||||||||  | ||||| ||||||||||||||||| ||||| |||
Sbjct  11288  ATCGAGCTCGACATCTTTGTCGAGACACTCGGCGACCTCAACAAGTGGGTCGAGGTCGTG  11229

Query  418    CAGAACGCGCTGGACGCCGCCAAGAAGCGCAGTCGCACTGGTGGATTCCAAGACAACTCG  477
              ||||||||||||||||| |||||||||| ||  || ||   |||   |  ||||| ||||
Sbjct  11228  CAGAACGCGCTGGACGCTGCCAAGAAGCACACACGAACGCCTGGGGCCGCAGACAGCTCG  11169

Query  478    ACGACCAAGACGATGTTTGGCTTCAGCGCGTCGGCGTCGCCGCAGCTGCAGGTGAAGAAG  537
              ||||||||||  |||||||||||||||||| ||| ||| || ||||||||||| ||||||
Sbjct  11168  ACGACCAAGAACATGTTTGGCTTCAGCGCGACGGTGTCACCTCAGCTGCAGGTCAAGAAG  11109

Query  538    CTCGCGGCCACGAAAGAGGATCTGCTCAGGGATGCGCTGCGCGAGATCGAAGGCGCGAAG  597
              ||||| ||||| || || || ||||||||||| ||||||||||||||||||||||| |||
Sbjct  11108  CTCGCTGCCACCAAGGAAGAGCTGCTCAGGGACGCGCTGCGCGAGATCGAAGGCGCCAAG  11049

Query  598    CTCATTGGACGCGAAGCGGTCAACGAGATCGTCGTCCAGGGAG  640
              ||||| || ||||| || |||| ||| ||    | ||||||||
Sbjct  11048  CTCATCGGGCGCGAGGCAGTCAGCGACATAAAAGGCCAGGGAG  11006

 Score = 247 bits (273),  Expect = 8e-63
 Identities = 168/189 (89%), Gaps = 0/189 (0%)
 Strand=Plus/Minus

Query  890    TGAGCGACCTCGAGAAGCTGGCGCTGGCGCTGGGCGAGCTGGAGGAGCAGGCGAACCTCA  949
              |||||||||| |||   |||| ||||||||||||||||||||| |||||||||| |  ||
Sbjct  10669  TGAGCGACCTGGAGCGACTGGTGCTGGCGCTGGGCGAGCTGGAAGAGCAGGCGACCGCCA  10610

Query  950    TGAACGCCGAGGCCGTGAAGAGCACGGAGCAGATCGCCCGCGTCGAGCAGCGCCTCACCG  1009
              ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
Sbjct  10609  TGAACGCCGAGGCCGTGAAGAGCACGGAGCAGATCGCGCGCGTCGAGCAGCGCCTCACTG  10550

Query  1010   CTGTGAACGACCGCGTGCAAACGCAGACCAAAAAGGCGAACGCCACGATGAAAGCCGGCA  1069
              | || ||||||||||||||  | |||||||| ||||||| ||| |||||||| |||||||
Sbjct  10549  CCGTCAACGACCGCGTGCAGGCACAGACCAAGAAGGCGACCGCAACGATGAAGGCCGGCA  10490

Query  1070   ACCTGTTCT  1078
              | |||||||
Sbjct  10489  ATCTGTTCT  10481

 Score = 196 bits (217),  Expect = 1e-47
 Identities = 151/178 (85%), Gaps = 6/178 (3%)
 Strand=Plus/Minus

Query  1      ATGAACATCCTGCGCGTGCCGGACGCCAAGCTCGCGACGTCAGGCAGTAATGGTGGCGCT  60
              |||||||| |||||||||||||||   |||||||| |||||  |||    |||  |||  
Sbjct  11802  ATGAACATTCTGCGCGTGCCGGACATGAAGCTCGCAACGTC--GCA----TGGCAGCGGC  11749

Query  61     GGTGATAAGTTCAAGCCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGC  120
              || || ||||||||  |||||||||||||||||||||||||||||||||| |||||||||
Sbjct  11748  GGCGACAAGTTCAAAGCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGCCACTTTCGC  11689

Query  121    AAGTCCTGGCGCGTGCGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACT  178
              |||||||||||||| |||||||| || |||||||||||  | ||||||| ||||||||
Sbjct  11688  AAGTCCTGGCGCGTACGCTACCTGGTCTTCAATGGCGCAGACCTGCAGGCGGCGTACT  11631

 Score = 98.7 bits (108),  Expect = 3e-18
 Identities = 84/104 (81%), Gaps = 0/104 (0%)
 Strand=Plus/Minus

Query  643    AAACTGGACATGGTCGAGAGCGACTTGGGCAAGGTCGAGGGCGATCTCGACCACGCGGAC  702
              || ||| ||||| |||||  |||| ||||||| |||||| ||||||| ||||| | ||  
Sbjct  10925  AAGCTGAACATGATCGAGGACGACCTGGGCAAAGTCGAGAGCGATCTGGACCATGGGGGA  10866

Query  703    AAGCTACTGCGCCACATGAAGCGGCCAATGCTGCACCTGTTCTC  746
              ||||| ||   ||||||||||||||| ||||| ||||| |||||
Sbjct  10865  AAGCTGCTAAACCACATGAAGCGGCCGATGCTTCACCTCTTCTC  10822

>PYVX:scaffold_275 pve_scaffold_275 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_275:1:32274:1 
REF
Length=32274

 Score = 338 bits (374),  Expect = 2e-90
 Identities = 497/697 (71%), Gaps = 45/697 (6%)
 Strand=Plus/Plus

Query  75    GCCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGCAAGTCCTGGCGCGT  134
             ||| || || ||||| |||||||||||||||||||| ||||| |||||||||||||||||
Sbjct  1549  GCCGACATCGTGCGAGGGGTACGTGACCAAGCGCGGACACTTCCGCAAGTCCTGGCGCGT  1608

Query  135   GCGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACTACGAGAGCCGCGACGC  194
             ||||||||||||| |  | |||||| | ||||  ||||| |||| |||||||   |||| 
Sbjct  1609  GCGCTACCTCGTGCTGGACGGCGCCGACCTGCGCGTGGCCTACTTCGAGAGCAA-GACGG  1667

Query  195   CAGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGTACCGGTGCC--CAAAGGCAGCTTT  252
             |             ||||        | || ||||  |||   ||  ||| |||   || 
Sbjct  1668  C-------------CTTCCA------GAAC-GGCG--CCG---CCAGCAAGGGCGAGTTC  1702

Query  253   TACGTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGTCATGGG------CGGC-CG  305
             ||| | |||||  | || |||||||  |||  || ||||| ||||||      |||  ||
Sbjct  1703  TACCTCTCGAGTATCGACAAGCACGCGTACGTGGCCGGCGGCATGGGGGCGGTCGGTGCG  1762

Query  306   C--GAGAAGCCTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATCGAG  363
             |  |||||||| |||||||||||| | |||||||||||||| ||||| |||||||  |||
Sbjct  1763  CAGGAGAAGCCCTTCGGCTTCAAGATGGTGGGCCACGCGCCGAAGAAGGGCTACACGGAG  1822

Query  364   CTCGACATCTTTGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGTGCAGAAC  423
             ||||||||||| |||||  ||||||  ||||||| ||||||| | |||||||  || |||
Sbjct  1823  CTCGACATCTTCGTCGAGACGCTCGCGGACCTCACCAAGTGGCTCGAGGTGGCCCACAAC  1882

Query  424   GCGCTGGAC------GCCGCCAAGAAGCGCA-GTCGCACTGGTGGATTCCAAGACAACTC  476
             ||||| ||       || |||| |  ||||| | ||  | || |    |   | |  | |
Sbjct  1883  GCGCTTGAGAGCGCGGCAGCCATGTCGCGCAAGGCGG-CGGGCGACGGCGGCGGCTCCGC  1941

Query  477   GACGACCAAGACGATGTTTGGCTTCAGCGCGTCGGCGTCGCCGCAGCTGCAGGTGAAGAA  536
             ||| |||||| || | || || |||||| || || |||||||||||| |||| | |||  
Sbjct  1942  GACCACCAAGTCGCTCTTCGGGTTCAGCACGACGACGTCGCCGCAGCAGCAGCTCAAGGC  2001

Query  537   GCTCGCGGCCACGAAAGAGGATCTGCTCAGGGATGCGCTGCGCGAGATCGAAGGCGCGAA  596
               |    | ||  || || || ||||||| ||| |||||||||||| |||| || || ||
Sbjct  2002  CATGAGCGTCAGCAAGGACGAGCTGCTCAAGGACGCGCTGCGCGAGCTCGAGGGGGCCAA  2061

Query  597   GCTCATTGGACGCGAAGCGGTCAACGAGATCGTCGTCCAGGGAGAGAAACTGGACATGGT  656
             |||||| || ||||| ||   || |||||| ||||| ||||| ||||| || |||    |
Sbjct  2062  GCTCATCGGCCGCGAGGCCTGCACCGAGATGGTCGTGCAGGGCGAGAAGCTCGACGGCAT  2121

Query  657   CGAGAGCGACTTGGGCAAGGTCGAGGGCGATCTCGACCACGCGGACAAGCTACTGCGCCA  716
             ||||  | || | |||    ||||| |||| |||||| |||  |||||||| ||||||| 
Sbjct  2122  CGAGGCCAACCTCGGCGGCATCGAGAGCGACCTCGACTACGGCGACAAGCTGCTGCGCCG  2181

Query  717   CATGAAGCGGCCAATGCTGCACCTGTTCTCGGGTGAC  753
               | ||| | ||  |||||||| || || || | |||
Sbjct  2182  GCTCAAGAGCCCCGTGCTGCACTTGCTCGCGCGCGAC  2218

 Score = 113 bits (125),  Expect = 1e-22
 Identities = 100/125 (80%), Gaps = 0/125 (0%)
 Strand=Plus/Plus

Query  922   GGCGAGCTGGAGGAGCAGGCGAACCTCATGAACGCCGAGGCCGTGAAGAGCACGGAGCAG  981
             |||||||| |||| |||||| |  ||  |||||| ||||||||||   |||||| |||||
Sbjct  2415  GGCGAGCTCGAGGCGCAGGCCACGCTGCTGAACGGCGAGGCCGTGCGCAGCACGCAGCAG  2474

Query  982   ATCGCCCGCGTCGAGCAGCGCCTCACCGCTGTGAACGACCGCGTGCAAACGCAGACCAAA  1041
             ||||| ||| ||||| |||| |||||  | || ||||||||||||||   ||||||||| 
Sbjct  2475  ATCGCGCGCATCGAGGAGCGGCTCACGACCGTCAACGACCGCGTGCAGCGGCAGACCAAG  2534

Query  1042  AAGGC  1046
              ||||
Sbjct  2535  CAGGC  2539

>PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:pug:scf1117875582037:1:1414051:1 
REF
Length=1414051

 Score = 315 bits (349),  Expect = 2e-83
 Identities = 341/454 (75%), Gaps = 36/454 (8%)
 Strand=Plus/Minus

Query  1        ATGAACATCCTGCGCGTGCCGGACGCCAAGCTCGCGACGTCAGGCAGTAATGGTGGCGCT  60
                ||||||||||||||||| || ||||||||  | || |  || ||         || ||  
Sbjct  1308343  ATGAACATCCTGCGCGTACCCGACGCCAAATTGGCCATCTCGGG---------TGCCGAA  1308293

Query  61       GGTGATAAGTTCAAGCCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGC  120
                |    || |  ||| |||||||||||||| || ||||||||||||||||| || || |||
Sbjct  1308292  G----TATG--CAAACCCACGTCCTGCGAGGGCTACGTGACCAAGCGCGGCCATTTCCGC  1308239

Query  121      AAGTCCTGGCGCGTGCGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACTAC  180
                || ||||||||||||||||||||||||||||| |||||| | ||||| ||  | |||| |
Sbjct  1308238  AAATCCTGGCGCGTGCGCTACCTCGTGTTCAACGGCGCCGACCTGCAAGTCTCATACTTC  1308179

Query  181      GAGAGCCGCGACGCCAGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGTACCGGTGCCC  240
                ||||| || ||||| |||    || | |           || ||||         |||| 
Sbjct  1308178  GAGAGTCGAGACGC-AGCCCACGCACCT-----------GGCACTG---------TGCCA  1308140

Query  241      AAAGGCAGCTTTTACGTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGTCATGGGC  300
                || |||||||| ||||||||||| || ||||||||||| |||||| |||| |||||||||
Sbjct  1308139  AAGGGCAGCTTCTACGTGTCGAGTGTCGAGAAGCACGAGTACTGGATCGGTGTCATGGGC  1308080

Query  301      GGCCGCGAGAAGCCTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATC  360
                |||   |||||||| || ||||||||  | || ||||| || || |  ||||| ||||| 
Sbjct  1308079  GGCAAGGAGAAGCCATTTGGCTTCAAATTGGTTGGCCATGCACCCAGTAAAGGGTACATT  1308020

Query  361      GAGCTCGACATCTTTGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGTGCAG  420
                |||||||||||||||||||| |||||   |||| ||||||||||| | || || ||||| 
Sbjct  1308019  GAGCTCGACATCTTTGTCGAGTCGCTTCCTGACGTCAACAAGTGGCTCGAAGTCGTGCAA  1307960

Query  421      AACGCGCTGGACGCCGCCAAGAAGCGCAGTCGCA  454
                || ||||| |||||||| ||||||| ||  ||||
Sbjct  1307959  AATGCGCTCGACGCCGCGAAGAAGCTCACGCGCA  1307926

 Score = 200 bits (221),  Expect = 1e-48
 Identities = 315/446 (71%), Gaps = 14/446 (3%)
 Strand=Plus/Minus

Query  639      AGAGAAACTGGACATGGTCGAGAGCGACTTGGGCAAGGTCGAGGGCGATCTCGACCACGC  698
                ||| |||||||||  ||| || | |||| ||||| | |||||||| || |||||||||||
Sbjct  1307595  AGAAAAACTGGACCAGGTAGAAAACGACCTGGGCCATGTCGAGGGTGACCTCGACCACGC  1307536

Query  699      GGACAAGCTACTGCGCCACATGAAGCGGCCAATGCTGCACCTGTTCTCGGGTGACGAGCG  758
                |||||||||  |||||||| ||||  | ||  |||||||| ||||||||   ||| | ||
Sbjct  1307535  GGACAAGCTCTTGCGCCACTTGAAAAGCCCCGTGCTGCACGTGTTCTCGAACGACAACCG  1307476

Query  759      TGTCAAGCAGAGTCCGCATACTGGTGGCGCTTCTGGTCACA-CTGACCGCGCGAGTCATG  817
                    ||| |  |  | | |||||  | | || |  | | || | |   | || |||    
Sbjct  1307475  GCAGAAGAAAGGCGCTCCTACTGCAGCCACTGCAAG-CGCATCAGGTGGAGCAAGTGCGA  1307417

Query  818      GTCAGACACCTGGTACTACTAATGGCGGT--ACCGCAGGCGGACAGCAGATTCA-TGGAC  874
                 |  | ||||||  | |   |  |  ||   || ||| ||      || | ||| |||  
Sbjct  1307416  CTACGTCACCTGTCAGTGGAACCGAGGGACAACTGCATGC------CAAAATCACTGGTG  1307363

Query  875      AACGCAATGACGCGCTGAGCGACCTCGAGAAGCTGGCGCTGGCGCTGGGCGAGCTGGAGG  934
                   ||  ||   |  ||| |||||| |||| ||| |||||||||||| |||||||||| |
Sbjct  1307362  ---GCGGTGGTACCTTGAACGACCTGGAGATGCTTGCGCTGGCGCTGAGCGAGCTGGAAG  1307306

Query  935      AGCAGGCGAACCTCATGAACGCCGAGGCCGTGAAGAGCACGGAGCAGATCGCCCGCGTCG  994
                |||| ||||| |||||||||||||| || | ||  |||||||||||||| || ||| |||
Sbjct  1307305  AGCAAGCGAATCTCATGAACGCCGAAGCGGCGAGAAGCACGGAGCAGATTGCGCGCATCG  1307246

Query  995      AGCAGCGCCTCACCGCTGTGAACGACCGCGTGCAAACGCAGACCAAAAAGGCGAACGCCA  1054
                || |||| |||||    || ||||| ||||||||    |||||||| |||||||  || |
Sbjct  1307245  AGGAGCGGCTCACAAGCGTCAACGATCGCGTGCAGCATCAGACCAAGAAGGCGACAGCGA  1307186

Query  1055     CGATGAAAGCCGGCAACCTGTTCTGA  1080
                |||||||||| || || |||||||||
Sbjct  1307185  CGATGAAAGCTGGGAATCTGTTCTGA  1307160

 Score = 136 bits (150),  Expect = 1e-29
 Identities = 126/160 (79%), Gaps = 0/160 (0%)
 Strand=Plus/Minus

Query  481      ACCAAGACGATGTTTGGCTTCAGCGCGTCGGCGTCGCCGCAGCTGCAGGTGAAGAAGCTC  540
                |||||||  |||||||||||  |||| ||    ||||| ||||| || || |||||||| 
Sbjct  1307825  ACCAAGAGTATGTTTGGCTTTGGCGCTTCCATCTCGCCTCAGCTCCAAGTCAAGAAGCTT  1307766

Query  541      GCGGCCACGAAAGAGGATCTGCTCAGGGATGCGCTGCGCGAGATCGAAGGCGCGAAGCTC  600
                || || || |||||||| |||||| | || || ||| | |||||||||||||| ||||| 
Sbjct  1307765  GCCGCGACCAAAGAGGAGCTGCTCCGAGAGGCCCTGAGGGAGATCGAAGGCGCAAAGCTG  1307706

Query  601      ATTGGACGCGAAGCGGTCAACGAGATCGTCGTCCAGGGAG  640
                || || || ||||| ||||| |||||||||   |||||||
Sbjct  1307705  ATCGGCCGGGAAGCTGTCAATGAGATCGTCTCGCAGGGAG  1307666

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  502      AGCGCGTCGGCGTCGCCGCAGCTGCAGGTGA  532
                ||||||||||||||| ||| |||| || |||
Sbjct  1308732  AGCGCGTCGGCGTCGTCGCTGCTGTAGTTGA  1308702

>PYAR:scaffold_29 par_scaffold_29 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_29:1:42963:1 
REF
Length=42963

 Score = 265 bits (293),  Expect = 3e-68
 Identities = 376/526 (71%), Gaps = 26/526 (5%)
 Strand=Plus/Plus

Query  114    CTTTCGCAAGTCCTGGCGCGTGCGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGC  173
              ||| |||||||| ||||||||||| ||||||||| |||| |||||| | ||    ||  |
Sbjct  16050  CTTCCGCAAGTCGTGGCGCGTGCGATACCTCGTGCTCAACGGCGCCGACCTTTGCGTCTC  16109

Query  174    GTACTACGAGAGCCGCGACGCCAGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGTACC  233
              ||||| ||| |||   |||| |     | || |     |  | || |       ||| ||
Sbjct  16110  GTACTTCGACAGCAAGGACGTC-----GCGCGCA----CACCGGGCG-------CGTCCC  16153

Query  234    GGTGCCCAAAGGCAGCTTTTACGTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGT  293
                   |||| |||||||| ||| | |||||||| |||||||| || |||   || |||||
Sbjct  16154  -----CCAAGGGCAGCTTCTACCTCTCGAGCGTCGAGAAGCATGAGTACGTCGTGGGCGT  16208

Query  294    CATGGGCGGCCGCGAGAAGCCTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGG  353
                |||||| ||   | ||||| || ||||||||| | || ||||| |||||    || ||
Sbjct  16209  TTTGGGCGCCCAGAAAAAGCCCTTTGGCTTCAAGATGGTCGGCCATGCGCCGCGCAAGGG  16268

Query  354    CTACATCGAGCTCGACATCTTTGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGT  413
              |||| |||||||||||||||||||||| |||| ||| ||||||  ||||||| | || ||
Sbjct  16269  CTACGTCGAGCTCGACATCTTTGTCGAGTCGCGCGGCGACCTCGCCAAGTGGCTCGAAGT  16328

Query  414    GGTGCAGAACGCGCTGGACGCCGCCAAGAAGCGCAGTCGCACTGGTGGATTCCAAGACAA  473
                  ||| ||||||| |  ||||||||||||| ||  ||||   | ||  ||   |||  
Sbjct  16329  CTGCCAGCACGCGCTCGCGGCCGCCAAGAAGCTCACACGCA---GCGGTCTCTCGGACGC  16385

Query  474    CTCGACGACCAAGACGATGTTTGGC-TTCAGCGCGTCGGCGTCGCCGCAGCTGCAGGTGA  532
                || | || ||| || | |||||| ||  || || || |||||||||||  |||| |  
Sbjct  16386  AGCGTCCACGAAGTCGCTCTTTGGCTTTTCGCCCG-CGACGTCGCCGCAGAAGCAGATCC  16444

Query  533    AGAAGCTCGCGGCCACGAAAGAGGATCTGCTCAGGGATGCGCTGCGCGAGATCGAAGGCG  592
              | |||||| ||||  |||||||||| ||||||| | | ||| |   |||||||||| |||
Sbjct  16445  AAAAGCTCTCGGCGTCGAAAGAGGAGCTGCTCAAGCAGGCGATCGACGAGATCGAAAGCG  16504

Query  593    CGAAGCTCATTGGACGCGAAGCGGTCAACGAGATCGTCGTCCAGGG  638
              | |||||||| || ||||| |||  | | ||||| || ||||||||
Sbjct  16505  CCAAGCTCATGGGGCGCGAGGCGTGCCAGGAGATTGTGGTCCAGGG  16550

 Score = 77.9 bits (85),  Expect = 9e-12
 Identities = 116/161 (72%), Gaps = 3/161 (2%)
 Strand=Plus/Plus

Query  890    TGAGCGACCTCGAGAAGCTGGCGCTGGCGCTGGGCGAGCTGGAGGAGCAGGCGAACCTCA  949
              |||||||| | |||  ||||||| ||  ||||||||||||||||| |||||| |  ||  
Sbjct  16858  TGAGCGACATGGAGCGGCTGGCGTTGCTGCTGGGCGAGCTGGAGGCGCAGGCCACGCTGC  16917

Query  950    TGAACGCCGAGGCCGTGAAGAGCACGGAGCAGATCGCCCGCGTCGAGCAGCGC-CTCACC  1008
              |||| |  ||||| |||    |||||  |||| | |  ||||| | ||  ||| ||| | 
Sbjct  16918  TGAATGAAGAGGCGGTGCGCGGCACGACGCAGGTGGAGCGCGT-GGGCGACGCGCTCGCG  16976

Query  1009   GCTGTGAACGACCGCGTGCAAACGCAGACCAA-AAAGGCGA  1048
                  | ||||| |||||||| |  |||||||| |||| |||
Sbjct  16977  CACATCAACGAGCGCGTGCAGAATCAGACCAAGAAAGCCGA  17017

 Score = 56.3 bits (61),  Expect = 3e-05
 Identities = 98/143 (69%), Gaps = 0/143 (0%)
 Strand=Plus/Plus

Query  632    TCCAGGGAGAGAAACTGGACATGGTCGAGAGCGACTTGGGCAAGGTCGAGGGCGATCTCG  691
              |||| | |||||||||||||    | || |||||  ||      || || | ||| || |
Sbjct  16615  TCCATGCAGAGAAACTGGACCACATTGAAAGCGAGCTGCAGCGCGTGGACGCCGACCTGG  16674

Query  692    ACCACGCGGACAAGCTACTGCGCCACATGAAGCGGCCAATGCTGCACCTGTTCTCGGGTG  751
              || | |  |||||||| ||| ||||| ||||| | ||  ||||  | || |||||  | |
Sbjct  16675  ACTATGGCGACAAGCTGCTGAGCCACCTGAAGAGCCCGCTGCTCTATCTCTTCTCCAGCG  16734

Query  752    ACGAGCGTGTCAAGCAGAGTCCG  774
              ||| ||| | |||| | ||| ||
Sbjct  16735  ACGCGCGCGACAAGAACAGTGCG  16757

>PYAP:scaffold_162 pag1_scaffold_162 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_162:1:52209:1 
REF
Length=52209

 Score = 231 bits (255),  Expect = 6e-58
 Identities = 375/538 (70%), Gaps = 24/538 (4%)
 Strand=Plus/Minus

Query  71     TCAAGCCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGCAAGTCCTGGC  130
              ||||||| || || || || || |||||||||||||| |||||||| || ||||| ||||
Sbjct  20618  TCAAGCCAACTTCATGTGAGGGCTACGTGACCAAGCGTGGGCACTTCCGAAAGTCTTGGC  20559

Query  131    GCGTGCGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACTACGAGAGCCGCG  190
              | ||||| |  |||||| ||||||| ||| |  | |  ||  |||||||||| |||   |
Sbjct  20558  GTGTGCGGTTTCTCGTGCTCAATGGAGCCGACTTACTTGTCTCGTACTACGACAGCAAGG  20499

Query  191    ACGCCAGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGTACCGGTGCCCAAAGGCAGCT  250
              | | | ||| |  ||         | |||| |            ||||| ||||||||||
Sbjct  20498  AGGTC-GCACGCACTG--------CAGGTGCT------------GTGCCGAAAGGCAGCT  20460

Query  251    TTTACGTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGTCATGGGCGGCCGCGAGA  310
              | ||| |||| || || |||||||| || ||||  || || ||| |||| | ||  ||||
Sbjct  20459  TCTACCTGTCCAGTGTGGAGAAGCATGAGTACTATGTAGGGGTCTTGGGAGCCCAAGAGA  20400

Query  311    AGCCTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATCGAGCTCGACA  370
              |||| || || |||||| | || |||||||||||    || |||||| | ||||||||||
Sbjct  20399  AGCCATTTGGGTTCAAGATGGTCGGCCACGCGCCGCGCAAGGGCTACGTAGAGCTCGACA  20340

Query  371    TCTTTGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGTGCAGAACGCGCTGG  430
              ||||||| ||  || | || ||  | || |||||| | || ||    |||||||| || |
Sbjct  20339  TCTTTGTGGAGACGTTGGGAGATTTGAATAAGTGGCTTGAAGTCTGTCAGAACGCACTTG  20280

Query  431    ACGCCGCCAAGAAGCGCAGTCGCACTGGTGGATTCCAAGACAACTCGACGACCAAGACGA  490
              ||||||| ||||| | ||  ||||| ||   |  |  || |  || | |  ||||| || 
Sbjct  20279  ACGCCGCTAAGAAACTCACGCGCAC-GGGCCAGCCTGAGGC-GCTAG-CACCCAAGTCGC  20223

Query  491    TGTTTGGCTTCAGCGCGTCGGCGTCGCCGCAGCTGCAGGTGAAGAAGCTCGCGGCCACGA  550
              | || ||||||    || || | || || |||| |||| |||||||| |  |||| || |
Sbjct  20222  TCTTCGGCTTCTCGCCGGCGACATCACCACAGCAGCAGATGAAGAAGATGACGGCAACCA  20163

Query  551    AAGAGGATCTGCTCAGGGATGCGCTGCGCGAGATCGAAGGCGCGAAGCTCATTGGACG  608
              ||||| |  |||| | | | ||  |    ||||||||| |||| |||||||| || ||
Sbjct  20162  AAGAGCAGATGCTGAAGCAGGCCATTGAGGAGATCGAAAGCGCCAAGCTCATCGGTCG  20105

>PHSO:scaffold_1
Length=13391543

 Score = 206 bits (228),  Expect = 7e-51
 Identities = 265/362 (73%), Gaps = 14/362 (4%)
 Strand=Plus/Minus

Query  75       GCCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGCAAGTCCTGGCGCGT  134
                |||||| || ||||| || |||||||||||| | || ||||| |||||||||||||||||
Sbjct  2800753  GCCCACCTCGTGCGAGGGATACGTGACCAAGAGAGGCCACTTCCGCAAGTCCTGGCGCGT  2800694

Query  135      GCGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACTACGAGAGCCGCGACGC  194
                 || | ||||||| |  ||||  | || ||| | ||| ||||||| || |||||||  ||
Sbjct  2800693  CCGGTTCCTCGTGCTGGATGGGTCGAACCTGAACGTGTCGTACTATGAAAGCCGCGCGGC  2800634

Query  195      CAGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGTACCGGTGCCCAAAGGCAGCTTTTA  254
                  || |        |  || | || |     | |||  | |  |||||||| ||||| ||
Sbjct  2800633  GTGCCACC------CACCGACCGGCGA----GCCGT--CTGCACCCAAAGGGAGCTTCTA  2800586

Query  255      CGTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGTCATGGGCGGCCGC-GAGAAGC  313
                | |||||||| | |||  ||||||||||   || ||||||||||| |||||| ||||| |
Sbjct  2800585  CTTGTCGAGCATCGAGCCGCACGAATACGTCGTAGGCGTCATGGG-GGCCGCCGAGAAAC  2800527

Query  314      CTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATCGAGCTCGACATCT  373
                |||||||||||||| | ||||||||||| || | ||| || ||| | || || ||| | |
Sbjct  2800526  CTTTCGGCTTCAAGATGGTGGGCCACGCCCCCAGGAAGGGATACGTGGAACTGGACGTGT  2800467

Query  374      TTGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGTGCAGAACGCGCTGGACG  433
                | |||||  | |||   |||| |||||||||| | || || | ||  || ||||||  ||
Sbjct  2800466  TCGTCGAGACACTCAACGACCGCAACAAGTGGCTCGAAGTCGCGCGCAATGCGCTGAGCG  2800407

Query  434      CC  435
                ||
Sbjct  2800406  CC  2800405

 Score = 72.5 bits (79),  Expect = 4e-10
 Identities = 131/192 (68%), Gaps = 0/192 (0%)
 Strand=Plus/Minus

Query  568      GATGCGCTGCGCGAGATCGAAGGCGCGAAGCTCATTGGACGCGAAGCGGTCAACGAGATC  627
                || ||||||||||| || ||||  || || |   | || ||||| ||   ||| ||||||
Sbjct  2800251  GACGCGCTGCGCGACATTGAAGCGGCTAAACAGGTCGGCCGCGAGGCTTGCAATGAGATC  2800192

Query  628      GTCGTCCAGGGAGAGAAACTGGACATGGTCGAGAGCGACTTGGGCAAGGTCGAGGGCGAT  687
                ||   |||||| ||||| || |||    |||||   ||| || |     ||||  |||| 
Sbjct  2800191  GTGACCCAGGGCGAGAAGCTCGACGCCATCGAGCAGGACCTGAGTGCCATCGACCGCGAC  2800132

Query  688      CTCGACCACGCGGACAAGCTACTGCGCCACATGAAGCGGCCAATGCTGCACCTGTTCTCG  747
                || ||   || ||||||||| ||||| | | | ||| | || |  ||||| || ||||||
Sbjct  2800131  CTGGATTTCGGGGACAAGCTGCTGCGTCGCCTCAAGAGCCCCACTCTGCATCTCTTCTCG  2800072

Query  748      GGTGACGAGCGT  759
                |  |||  ||||
Sbjct  2800071  GACGACTCGCGT  2800060

 Score = 41.0 bits (44),  Expect = 0.63
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  987       CCGCGTCGAGCAGCGCC-TCACCGCTGTG  1014
                 ||||||||||||||||| ||||||| |||
Sbjct  11651900  CCGCGTCGAGCAGCGCCGTCACCGCCGTG  11651928

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 29/34 (85%), Gaps = 4/34 (12%)
 Strand=Plus/Minus

Query  625       ATCGTCGTCCAGGGAGAGAAACTGGACATGGTCG  658
                 ||||||||||||||||||||    |||||| |||
Sbjct  11376017  ATCGTCGTCCAGGGAGAGAA----GACATGCTCG  11375988

>PHCA:scaffold_84 PHYCAscaffold_84
Length=182275

 Score = 182 bits (201),  Expect = 3e-43
 Identities = 461/696 (66%), Gaps = 39/696 (6%)
 Strand=Plus/Minus

Query  76      CCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGCAAGTCCTGGCGCGTG  135
               || || || ||||| || ||||| |||||||| || || || |||||||| ||||| |||
Sbjct  101262  CCGACTTCGTGCGAGGGATACGTCACCAAGCGAGGCCATTTCCGCAAGTCTTGGCGTGTG  101203

Query  136     CGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACTACGAGAGCCGCGACGCC  195
               || | ||||||  || ||||| |||| ||||| ||  |||||||||| || || |  || 
Sbjct  101202  CGATTCCTCGTCCTCGATGGCTCCAACCTGCAAGTCACGTACTACGAAAGTCGAGCTGCT  101143

Query  196     AGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGT-ACCGGTGCCCAAAGGCAGCTTTTA  254
                |  |   | |  || ||   || |     ||||| |||    |||||||| ||||| ||
Sbjct  101142  TGTCA---CCCAACTACG---GGCGA----GGCGTCACCA---CCCAAAGGGAGCTTCTA  101096

Query  255     CGTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGTCATGGGCGGCCGCGAG-AAGC  313
               | |||| ||  | |||   ||||| |||   |||||||||||||| | | ||  | || |
Sbjct  101095  CCTGTCAAGTATCGAGCCACACGAGTACGTCGTCGGCGTCATGGGAG-CTGCTGGTAAAC  101037

Query  314     CTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATCGAGCTCGACATCT  373
               | |||||||||||  | || || || || || ||||| || ||| | ||||| ||| | |
Sbjct  101036  CGTTCGGCTTCAAAATGGTCGGACATGCCCCTAAGAAGGGGTACGTGGAGCTGGACGTGT  100977

Query  374     TTGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGTGCAGAACGCGCTGGACG  433
               | || ||  || | || |||| |||||||||| | || || |  | ||||||||||   |
Sbjct  100976  TCGTGGAGACGGTGGGCGACCGCAACAAGTGGCTTGAAGTCGCTCGGAACGCGCTGAGTG  100917

Query  434     CCGCCAAGAAGCGCAGTCGCACTGGTGGATTCCAAGA----CAACTCGACGACCAAGACG  489
               ||     | ||| || ||| || ||    |  | |||     | | | |  |  ||||  
Sbjct  100916  CCAAACGGCAGCTCACTCG-ACAGGCTATTGACCAGAGTGTGAGCCCCAACAAGAAGAAC  100858

Query  490     ATGTTTGGCTTCAG-----------CGCGTCGGC-------GTCGCCGCAGCTGCAGGTG  531
                | || ||||||||           | |  | ||       ||| || |||  |||| ||
Sbjct  100857  CTCTTCGGCTTCAGTGTCTCCTTATCTCCCCAGCCAGCACTGTCACCCCAGAAGCAGATG  100798

Query  532     AAGAAGCTCGCGGCCACGAAAGAGGATCTGCTCAGGGATGCGCTGCGCGAGATCGAAGGC  591
                |||  ||  ||   |  || || || ||||||   || || |||||||| ||||||| |
Sbjct  100797  CAGACTCTGACGAAGAACAAGGATGACCTGCTCTCCGACGCTCTGCGCGATATCGAAGCC  100738

Query  592     GCGAAGCTCATTGGACGCGAAGCGGTCAACGAGATCGTCGTCCAGGGAGAGAAACTGGAC  651
               || || |  |||||||| |||||   ||||||||||||| | ||||||||||| ||||||
Sbjct  100737  GCCAAACAGATTGGACGAGAAGCATGCAACGAGATCGTCATTCAGGGAGAGAAGCTGGAC  100678

Query  652     ATGGTCGAGAGCGACTTGGGCAAGGTCGAGGGCGATCTCGACCACGCGGACAAGCTACTG  711
                   |||||   ||  || ||    ||||  | ||  | |||  ||  || ||||| |||
Sbjct  100677  GCAATCGAGCAGGATCTGAGCGCAATCGACCGAGACTTGGACTTCGGAGATAAGCTGCTG  100618

Query  712     CGCCACATGAAGCGGCCAATGCTGCACCTGTTCTCG  747
               || |   | ||  | |||| ||||||| ||||||||
Sbjct  100617  CGTCGACTCAAAAGCCCAACGCTGCACATGTTCTCG  100582

>PHRA:scaffold_56
Length=334739

 Score = 179 bits (198),  Expect = 1e-42
 Identities = 478/718 (67%), Gaps = 37/718 (5%)
 Strand=Plus/Plus

Query  59      CTGGTGATAAGT-TCAAGCCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTT  117
               |||| ||||||  || | ||||| || ||||| || ||||| |||||||| || || || 
Sbjct  150251  CTGGAGATAAGGCTCGA-CCCACATCATGCGAGGGCTACGTCACCAAGCGAGGCCATTTC  150309

Query  118     CGCAAGTCCTGGCGCGTGCGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTAC  177
               || ||||| ||||||||||| | ||| ||  || | ||  | ||||||||| |  |||||
Sbjct  150310  CGGAAGTCTTGGCGCGTGCGGTTCCTTGTTCTCGAGGGGTCGAATCTGCAGATCTCGTAC  150369

Query  178     TACGAGAGCCGCGACGCCAGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGTACCGGTG  237
               || || |||||||  ||  || |      | || |  | | ||   |  ||| |||    
Sbjct  150370  TATGAAAGCCGCGCGGCGTGCCA------TCCTCCCGCCGCTGAACCGAGCGCACC----  150419

Query  238     CCCAAAGGCAGCTTTTACGTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGTCATG  297
                 |||||| || || ||| |||| ||| |||||  |||||| |||   || ||||| |||
Sbjct  150420  --CAAAGGTAGTTTCTACCTGTCCAGCATTGAGCCGCACGAGTACGTCGTAGGCGTGATG  150477

Query  298     GGCGGCCGCGAGAAG-CCTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTA  356
               || ||| ||  |||  || |||||||| ||| |  | ||||| || || ||||| || ||
Sbjct  150478  GG-GGCAGCTGGAAAACCATTCGGCTTTAAGATGATCGGCCATGCCCCGAAGAAGGGGTA  150536

Query  357     CATCGAGCTCGACATCTTTGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGT  416
               | | ||||| ||| | || || ||  |||  || || | |||||||||| | || || | 
Sbjct  150537  CGTTGAGCTGGACGTGTTCGTGGAGACGCAGGGCGATCGCAACAAGTGGCTCGAAGTCGC  150596

Query  417     GCAGAACGCGCTGGACGC----CGCCAA--GAAGCG-CAG----TCGCACTG---GTGGA  462
                |  ||||| |||   ||    |||||   ||  || |||    |||  | |   |||  
Sbjct  150597  CCGCAACGCACTGAGTGCTAAGCGCCAGCTGACCCGTCAGGCCATCGACCAGAGTGTGAG  150656

Query  463     TTCCAA---GACAA--CTCGACGACCAAGACGA-TGTTTGGCTTCAGCGCG-TCGGCGTC  515
                |||||   || ||  |||  || |   | ||  |  ||| |  ||  ||  | |  | |
Sbjct  150657  CTCCAACAAGAAAAACCTCTTCGGCTTCGGCGTCTCGTTGTCCCCACAGCCATTGATGAC  150716

Query  516     GCCGCAGCTGCAGGTGAAGAAGCTCGCGGCCACGAAAGAGGATCTGCTCAGGGATGCGCT  575
                ||||||  |||  || |||  ||  |    |  ||||| || ||||||  ||  || ||
Sbjct  150717  ACCGCAGAAGCAAATGCAGACTCTGACACAAAACAAAGACGAACTGCTCTCGGGAGCCCT  150776

Query  576     GCGCGAGATCGAAGGCGCGAAGCTCATTGGACGCGAAGCGGTCAACGAGATCGTCGTCCA  635
               |||||| ||||||| ||| |||||| | || || || ||   ||||||||||||| ||||
Sbjct  150777  GCGCGACATCGAAGCCGCCAAGCTCGTCGGTCGAGAGGCCTGCAACGAGATCGTCATCCA  150836

Query  636     GGGAGAGAAACTGGACATGGTCGAGAGCGACTTGGGCAAGGTCGAGGGCGATCTCGACCA  695
               ||| ||||| ||||||    ||||    ||| |||||  | ||||  | || || |||  
Sbjct  150837  GGGCGAGAAGCTGGACGCAATCGAACAGGACCTGGGCGCGATCGATCGAGACCTAGACTT  150896

Query  696     CGCGGACAAGCTACTGCGCCACATGAAGCGGCCAATGCTGCACCTGTTCTCGGGTGAC  753
               ||  |||||||| |||||||   | ||| | || |   ||||||| ||||| | ||||
Sbjct  150897  CGGCGACAAGCTGCTGCGCCGACTCAAGAGCCCCACCTTGCACCTCTTCTCTGATGAC  150954

 Score = 75.2 bits (82),  Expect = 3e-11
 Identities = 123/177 (69%), Gaps = 3/177 (2%)
 Strand=Plus/Plus

Query  907     CTGGCGCTGGCGCTGGGCGAGCTGGAGGAGCAGGCGAACCTCATGAACGCCGAGGCCGTG  966
               || || | |||| |||| |||||||||| ||||||| |  |  |||||| ||| || |  
Sbjct  151084  CTAGCACAGGCGTTGGGGGAGCTGGAGGTGCAGGCGGAGATACTGAACGGCGAAGCTGGT  151143

Query  967     AAGAGCACGGAGCAGATCGCCCGCGTCGAGCAGCGCCTCACCGCTGTGAACGACCGCGTG  1026
                  |||||| ||||||| |  ||||||||||| |  ||| |    || |  |  ||||| 
Sbjct  151144  CGCAGCACGCAGCAGATTGAGCGCGTCGAGCATCAGCTCTCGAACGTCACTGCTCGCGTC  151203

Query  1027    CAAACGCAGACCAAAAAGGCGAACGCCACGATGAAAGCCGGC---AACCTGTTCTGA  1080
                | | |||||||||| ||||    |||||| ||   ||||||   || || ||||||
Sbjct  151204  GAGAAGCAGACCAAACAGGCTTCTGCCACGCTGCGTGCCGGCCCAAAACTCTTCTGA  151260

>PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.63, whole genome shotgun 
sequence
Length=342508

 Score = 153 bits (169),  Expect = 1e-34
 Identities = 467/717 (65%), Gaps = 55/717 (8%)
 Strand=Plus/Minus

Query  75      GCCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGCAAGTCCTGGCGCGT  134
               ||| || || ||||| || ||||| ||||| || || || || || ||||| ||||||||
Sbjct  251867  GCCAACATCATGCGAGGGTTACGTAACCAAACGAGGTCATTTCCGAAAGTCTTGGCGCGT  251808

Query  135     GCGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACTACGAGAGCCGCGACGC  194
                || | ||| ||  |  ||||  |||| ||||| ||  |||||||||| || ||||  ||
Sbjct  251807  TCGATTCCTGGTTGTGGATGGATCCAACCTGCAAGTCTCGTACTACGAAAGTCGCGCTGC  251748

Query  195     CAGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGTACCGGTGCCCAAAGGCAGCTTTTA  254
                 || |        |  || | ||||  ||   ||| |  | |||||| || || || ||
Sbjct  251747  TTGCCACC------CACCGACGGGTGA-AC---CGTCC--GCGCCCAAGGGGAGTTTCTA  251700

Query  255     CGTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGTCATGGGCGGCCGC-GAGAAGC  313
               | |||||||  ||||    ||||| ||    |||||||||||||| | | || || || |
Sbjct  251699  CCTGTCGAGTATTGAACCACACGAGTATGTTGTCGGCGTCATGGGAG-CTGCTGACAAAC  251641

Query  314     CTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATCGAGCTCGACATCT  373
               |||||||||| ||  | || || || || || |||||||| ||| | ||||| ||| | |
Sbjct  251640  CTTTCGGCTTTAAAATGGTCGGACATGCCCCCAAGAAAGGATACGTTGAGCTGGACGTGT  251581

Query  374     TTGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGTGCAGAACGCGCTGGACG  433
               | || ||  | || | ||| |  ||||||||| ||||||| |  |  || || ||    |
Sbjct  251580  TCGTGGACACACTGGCTGATCGTAACAAGTGGCTGGAGGTCGCTCGCAATGCACTAAGTG  251521

Query  434     CCG--------CCAAGAAGCGCAG---TCGCACTG-GTG-GATTCCAAGACAACTCGACG  480
                |         | || | ||  ||   |||  | | ||| || ||||| ||||       
Sbjct  251520  TCAAGCGTCAACTAACACGCCAAGCCATCGACCAGAGTGTGAGTCCAA-ACAAA------  251468

Query  481     ACCAAGACGATGTTTGGCTTCAGCGC---------------GTCGGC---GTCGCCGCAG  522
                  |||||  |||| ||||||||||                | | ||   |||||| |||
Sbjct  251467  ---AAGACTCTGTTCGGCTTCAGCGTCGCATTGTCTCCACAGCCAGCAATGTCGCCCCAG  251411

Query  523     CTGCAGGTGAAGAAGCTCGCGGCCACGAAAGAGGATCTGCTCAGGGATGCGCTGCGCGAG  582
                 |||| || |||  || ||    |  ||||| || ||||||  ||| || || || |||
Sbjct  251410  AAGCAGATGCAGACACTGGCCAAAAGCAAAGATGAGCTGCTCTCGGAAGCTCTACGTGAG  251351

Query  583     ATCGAAGGCGCGAAGCTCATTGGACGCGAAGCGGTCAACGAGATCGTCGTCCAGGGAGAG  642
                ||||||  || |||||| | || || |||||   ||||||||||||| |||| ||||||
Sbjct  251350  CTCGAAGCTGCAAAGCTCGTCGGTCGTGAAGCCTGCAACGAGATCGTCATCCAAGGAGAG  251291

Query  643     AAACTGGACATGGTCGAGAGCGACTTGGGCAAGGTCGAGGGCGATCTCGACCACGCGGAC  702
               || |||||||   ||||    ||  |  ||    | ||  |||||||||||  ||  || 
Sbjct  251290  AAGCTGGACACCATCGAACAGGATCTCAGCGCCATTGATCGCGATCTCGACTTCGGTGAT  251231

Query  703     AAGCTACTGCGCCACATGAAGCGGCCAATGCTGCACCTGTTCTCGGGTGACGAGCGT  759
               || || ||||| |   | ||| | || | | |||| || |||||||  |||  ||||
Sbjct  251230  AAACTCCTGCGTCGTCTCAAGAGCCCCACGTTGCATCTCTTCTCGGACGACTCGCGT  251174

>PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 
genomic scaffold, whole genome shotgun sequence
Length=695754

 Score = 132 bits (145),  Expect = 5e-28
 Identities = 453/705 (64%), Gaps = 55/705 (8%)
 Strand=Plus/Minus

Query  76      CCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGCAAGTCCTGGCGCGTG  135
               ||||| ||||| || || || ||||| || || || || || || ||||| ||||| |||
Sbjct  431900  CCCACTTCCTGTGAGGGTTATGTGACGAAACGAGGTCATTTCCGAAAGTCTTGGCGTGTG  431841

Query  136     CGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACTACGAGAGCCGCGACGCC  195
               || | ||| ||  |  ||||  |||| ||||| ||  ||||||| || || ||||  || 
Sbjct  431840  CGATTCCTTGTCGTGGATGGATCCAACCTGCAAGTCTCGTACTATGAAAGTCGCGCTGCT  431781

Query  196     AGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGTACCGGTGCCCAAAGGCAGCTTTTAC  255
                |          ||  |  | | | |  |   | |  | |  |||||||| |  || |||
Sbjct  431780  TG----------TCACCCACCGATAGGTCAACCAT--CTGCACCCAAAGGGATTTTCTAC  431733

Query  256     GTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGTCATGGGCGGCCGC-GAGAAGCC  314
                |||| ||| |||||   ||||| ||    || || |||||||| | | || || || ||
Sbjct  431732  CTGTCCAGCATTGAGCCACACGAGTATGTCGTAGGAGTCATGGGAG-CTGCTGATAAACC  431674

Query  315     TTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATCGAGCTCGACATCTT  374
                |||||||||||  | || || ||||| || |||||||| ||| | ||||| ||| | ||
Sbjct  431673  ATTCGGCTTCAAAATGGTCGGACACGCTCCGAAGAAAGGGTACGTTGAGCTAGACGTGTT  431614

Query  375     TGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGTGCAGAACGCGCTGGACGC  434
               ||| ||  | || |  || | |||||||||| |||| || |  |  ||||| || |  ||
Sbjct  431613  TGTAGACACCCTGGCCGATCGCAACAAGTGGCTGGAAGTCGCTCGCAACGCTCTAGGTGC  431554

Query  435     CG--------CCAAGAAGCGCAG---TCGCACTG-GTG-GATTCCAAGACAACTCGACGA  481
               |         | || | ||  ||   |||  | | ||| || |||| | |||        
Sbjct  431553  CAAGCGTCAACTAACACGCCAAGCCATCGACCAGAGTGTGAGTCCAGG-CAAG-------  431502

Query  482     CCAAGACGATGTTTGGCTTCAGCGCGTCG---------------GC---GTCGCCGCAGC  523
                 ||||   |||| ||||||||||  ||                ||   ||| |||||| 
Sbjct  431501  --AAGAATCTGTTCGGCTTCAGCGTCTCTTTGTCCCCACAACCAGCAATGTCACCGCAGA  431444

Query  524     TGCAGGTGAAGAAGCTCGCGGCCACGAAAGAGGATCTGCTCAGGGATGCGCTGCGCGAGA  583
                |||| |  |||  ||  |    |  ||||| || ||||||  | | || || |||||| 
Sbjct  431443  AGCAGATACAGACACTGTCCAAAAGCAAAGATGAACTGCTCTCGCAAGCTCTACGCGAGC  431384

Query  584     TCGAAGGCGCGAAGCTCATTGGACGCGAAGCGGTCAACGAGATCGTCGTCCAGGGAGAGA  643
               | |||| ||| |||||| | || || |||||   ||||||||||||||||||||||||||
Sbjct  431383  TAGAAGCCGCAAAGCTCGTCGGCCGAGAAGCTTGCAACGAGATCGTCGTCCAGGGAGAGA  431324

Query  644     AACTGGACATGGTCGAGAGCGACTTGGGCAAGGTCGAGGGCGATCTCGACCACGCGGACA  703
               | || |||    ||||    ||  |  ||    ||||  |||||||||||   |  ||||
Sbjct  431323  AGCTCGACGCCATCGAACAAGATCTCAGCGCCATCGACCGCGATCTCGACTTTGGCGACA  431264

Query  704     AGCTACTGCGCCACATGAAGCGGCCAATGCTGCACCTGTTCTCGG  748
               | || ||||| |   | ||| | || | |||||| || |||||||
Sbjct  431263  AACTGCTGCGTCGTCTTAAGAGTCCCACGCTGCATCTCTTCTCGG  431219

>PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_98.1_contig_1:1:103693:1 
REF
Length=103693

 Score = 118 bits (130),  Expect = 3e-24
 Identities = 453/705 (64%), Gaps = 45/705 (6%)
 Strand=Plus/Minus

Query  76     CCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGCAAGTCCTGGCGCGTG  135
              ||||| || ||||| || ||||| || || || || || || || ||||| ||||| |||
Sbjct  68140  CCCACATCGTGCGAGGGCTACGTAACTAAACGAGGCCATTTCCGTAAGTCGTGGCGAGTG  68081

Query  136    CGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACTACGAGAGCCGCGACGCC  195
              || | ||| ||| |  | ||  |  ||||||||||  ||||||  || || ||      |
Sbjct  68080  CGATTCCTTGTGCTGGACGGATCTGATCTGCAGGTCTCGTACTTTGAAAGTCGTA----C  68025

Query  196    AGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGTACCGGTGCCCAAAGGCAGCTTTTAC  255
              |||| |    |  |  |    || |  ||       || | || |||||| ||||| |||
Sbjct  68024  AGCATGCCACCCACCACAC--GGCGAGACG------CCAGCGCACAAAGGAAGCTTCTAC  67973

Query  256    GTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGGCGTCATGGGCGGCCGCGAGAAGCCT  315
               |||| | | |||     || || |||   || ||||| ||||| |    ||| || || 
Sbjct  67972  TTGTCCAACATTGCACCCCATGAGTACGTCGTAGGCGTTATGGGAGCAGCCGACAAACCG  67913

Query  316    TTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATCGAGCTCGACATCTTT  375
              || ||||||||| | || || |||||||||   ||||||||  | ||||| ||| | |||
Sbjct  67912  TTTGGCTTCAAGATGGTTGGTCACGCGCCACGAAAAGGCTATGTTGAGCTGGACGTATTT  67853

Query  376    GTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGTGCAGAACGCGCTGGACGCC  435
              |||||  ||||  |||||| |||||||||| | ||||| | ||  || || ||||  |||
Sbjct  67852  GTCGAGACGCTTAGTGACCGCAACAAGTGGCTCGAGGTTGCGCGCAATGCACTGGGTGCC  67793

Query  436    GCCAAGAAGCGCAGTC-GCACTGGTGGATTCCAAGACAACTCGA---CGACCAAGACG--  489
                 |||  ||  | |  || |  |   || | |  | | |  ||   | |||||||    
Sbjct  67792  ---AAGCGGCAGATTATGCGCCAGGCCAT-CGACCAGAGCGTGAGTCCCACCAAGAAAGG  67737

Query  490    -ATGTTTGGCTTCAGCGCGTCGGCGTCGCCGCAGCTGCAGGTG---------AAG-----  534
               |||||||| ||| ||   |||  ||| || |||| |  ||||         |||     
Sbjct  67736  CATGTTTGGTTTCGGCCTCTCGTTGTCTCCACAGCCGTTGGTGCCACCGCAGAAGCAGAT  67677

Query  535    --AAGCTCGCGGCCACGA--AAGAGGATCTGCTCAGGGATGCGCTGCGCGAGATCGAAGG  590
                |||||| |  |||  |  |||||||  ||||    || || ||||| ||| |||||| 
Sbjct  67676  ACAAGCTCTCACCCATAACAAAGAGGAATTGCTTGCTGAAGCACTGCGGGAGCTCGAAGC  67617

Query  591    CGCGAAGCTCATTGGACGCGAAGCGGTCAACGAGATCGTCGTCCAGGGAGAGAAACTGGA  650
              ||| ||| |  | || || || ||   ||| |||||||||||||| || |||||| ||||
Sbjct  67616  CGCAAAGATGGTCGGCCGTGAGGCCTGCAATGAGATCGTCGTCCAAGGCGAGAAATTGGA  67557

Query  651    CATGGTCGAGAGCGACTTGGGCAAG--GTCGAGGGCGATCTCGACCACGCGGACAAGCTA  708
              |   || |||  |||| |  ||| |   | ||  | || || |||   |  ||||| || 
Sbjct  67556  CTCAGTTGAGCACGACCT--GCATGCCATTGACCGTGACCTAGACTTTGGTGACAAACTG  67499

Query  709    CTGCGCCACATGAAGCGGCCAATGCTGCACCTGTTCTCGGGTGAC  753
              || |||| | | |||   || |   ||||| |||| |||| ||||
Sbjct  67498  CTACGCCGCCTCAAGAACCCCACCTTGCACTTGTTTTCGGATGAC  67454

>ALLA:FR824104 dna:supercontig supercontig:ENA1:FR824104:1:105594:1 
REF
Length=105594

 Score = 85.1 bits (93),  Expect = 6e-14
 Identities = 210/318 (66%), Gaps = 32/318 (10%)
 Strand=Plus/Plus

Query  76     CCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGCAAGTCCTGGCGCGTG  135
              ||||| || || |||||||| || |||||||| || || ||||||||||| ||||| || 
Sbjct  11308  CCCACTTCATGTGAAGGGTATGTCACCAAGCGAGGACATTTTCGCAAGTCTTGGCGTGTT  11367

Query  136    CGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACTACGAGAGCCGCGACGCC  195
              || ||| | ||| ||| ||| |  ||  |||| ||| | ||||| ||             
Sbjct  11368  CGGTACTTAGTGATCAGTGGAGTGAACATGCAAGTGTCATACTATGA------------A  11415

Query  196    AGCAAGGGCTCTTCTTCGTCTGGTGGTACTGGCGTACCGGTGCCCAAAGGCAGCTTTTA-  254
              ||||| | ||||      ||     | |     | | ||    |||||||   |||| | 
Sbjct  11416  AGCAAAGACTCT------TCCAAAAGCAAAAATGCAACG----CCAAAGGGTTCTTTCAT  11465

Query  255    CGTGTCGAGCGTTGAGAAGCACGAATACTGGGTCGG------CGTCA-TGG--GCGGCCG  305
                ||  ||||| ||| ||||||||||||||| || |       |||| |||  ||| |  
Sbjct  11466  TCTGCAGAGCGCTGAAAAGCACGAATACTGGATCAGTCAAATGGTCACTGGTAGCGTCAA  11525

Query  306    CGAGAAGCCTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATCGAGCT  365
               ||||| || || || || ||| | || || ||||| |||||| |||| || || || ||
Sbjct  11526  AGAGAAACCGTTTGGTTTTAAGATGGTTGGACACGCACCAAAGCAAGGTTATATTGAACT  11585

Query  366    CGACATCTTTGTCGAATC  383
               ||| |||||||||| ||
Sbjct  11586  AGACGTCTTTGTCGATTC  11603

>PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2956, whole genome shotgun sequence
Length=1921269

 Score = 77.0 bits (84),  Expect = 9e-12
 Identities = 97/131 (74%), Gaps = 2/131 (2%)
 Strand=Plus/Plus

Query  61       GGTGATAA-GTTCAAGCCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCG  119
                |||||||| |  ||| || || || || || || |||||||| || || |||||||||||
Sbjct  1844419  GGTGATAAAGCACAA-CCTACCTCGTGTGAGGGCTACGTGACTAAACGAGGGCACTTTCG  1844477

Query  120      CAAGTCCTGGCGCGTGCGCTACCTCGTGTTCAATGGCGCCAATCTGCAGGTGGCGTACTA  179
                 ||||| ||||| || || |  || ||  |  ||||| |||| || || || || |||||
Sbjct  1844478  AAAGTCGTGGCGTGTACGATTTCTGGTTCTGGATGGCTCCAACCTTCAAGTCGCATACTA  1844537

Query  180      CGAGAGCCGCG  190
                 || || ||||
Sbjct  1844538  TGAAAGTCGCG  1844548

>ALCA:scaffold_90 AcNc2_CONTIG_90_length_79489 dna:supercontig 
supercontig:ASM107853v1:AcNc2_CONTIG_90_length_79489:1:79489:1 
REF
Length=79489

 Score = 64.4 bits (70),  Expect = 6e-08
 Identities = 59/75 (79%), Gaps = 0/75 (0%)
 Strand=Plus/Plus

Query  76    CCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGGGCACTTTCGCAAGTCCTGGCGCGTG  135
             ||||| || || |||||||| || ||||||||||| || || ||||| || ||||| || 
Sbjct  8589  CCCACATCGTGTGAAGGGTATGTTACCAAGCGCGGTCATTTCCGCAAATCTTGGCGTGTT  8648

Query  136   CGCTACCTCGTGTTC  150
             || ||| | ||| ||
Sbjct  8649  CGTTACTTAGTGATC  8663

 Score = 50.9 bits (55),  Expect = 0.001
 Identities = 92/132 (70%), Gaps = 11/132 (8%)
 Strand=Plus/Plus

Query  265   GTTGAGAAGCACGAATACTGGGTC-GGCGTCATGGGC---GGCCGC------GAGAAGCC  314
             ||||| ||||||||||||||| || | ||| |||| |   ||| ||      ||||  ||
Sbjct  8757  GTTGAAAAGCACGAATACTGGATCAGTCGT-ATGGTCACTGGCAGCGTCAAAGAGAGACC  8815

Query  315   TTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATCGAGCTCGACATCTT  374
              || || || ||| | || || || || || ||| |||| ||  | ||  | ||| ||||
Sbjct  8816  GTTTGGTTTTAAGATGGTTGGGCATGCACCTAAGCAAGGTTATGTTGAATTAGACGTCTT  8875

Query  375   TGTCGAATCGCT  386
             |||||| || ||
Sbjct  8876  TGTCGATTCCCT  8887

>SADI:scaffold_4 supercont1.4 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.4:1:1391842:1 
REF
Length=1391842

 Score = 48.2 bits (52),  Expect = 0.004
 Identities = 47/61 (77%), Gaps = 0/61 (0%)
 Strand=Plus/Plus

Query  298     GGCGGCCGCGAGAAGCCTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTAC  357
               |||||| |||  ||||| |  ||||||||||| |||||||| || ||   | | ||||||
Sbjct  204290  GGCGGCGGCGTCAAGCCGTATGGCTTCAAGCTCGTGGGCCATGCTCCGGGGCACGGCTAC  204349

Query  358     A  358
               |
Sbjct  204350  A  204350

 Score = 43.7 bits (47),  Expect = 0.18
 Identities = 34/41 (83%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  70      TTCAAGCCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGG  110
               |||||||  ||||| ||||| || || ||||||||||| ||
Sbjct  204040  TTCAAGCAGACGTCGTGCGAGGGCTATGTGACCAAGCGAGG  204080

>PYVX:scaffold_518 pve_scaffold_518 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_518:1:21302:1 
REF
Length=21302

 Score = 48.2 bits (52),  Expect = 0.004
 Identities = 29/31 (94%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  84    CTGCGAAGGGTACGTGACCAAGCGCGGGCAC  114
             ||||||||||||| ||||||||||||| |||
Sbjct  4911  CTGCGAAGGGTACCTGACCAAGCGCGGCCAC  4941

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  85    TGCGAAGGGTACGTGACCAAGCGCGGGCAC  114
             ||||| |||||| | || ||||||||||||
Sbjct  4624  TGCGAGGGGTACCTCACGAAGCGCGGGCAC  4653

>APAS:scaffold_11 supercont1.11 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.11:1:1267871:1 
REF
Length=1267871

 Score = 47.3 bits (51),  Expect = 0.015
 Identities = 27/28 (96%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  900     CGAGAAGCTGGCGCTGGCGCTGGGCGAG  927
               |||| |||||||||||||||||||||||
Sbjct  597454  CGAGCAGCTGGCGCTGGCGCTGGGCGAG  597427

>PYAR:scaffold_1783 par_scaffold_1783 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1783:1:7001:1 
REF
Length=7001

 Score = 46.4 bits (50),  Expect = 0.015
 Identities = 25/25 (100%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  423   CGCGCTGGACGCCGCCAAGAAGCGC  447
             |||||||||||||||||||||||||
Sbjct  3926  CGCGCTGGACGCCGCCAAGAAGCGC  3902

>PYVX:scaffold_334 pve_scaffold_334 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_334:1:29577:1 
REF
Length=29577

 Score = 44.6 bits (48),  Expect = 0.052
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  408    GGAGGTGGTGCAGAACGCGCTGGACGCCG  436
              |||| ||||| ||||||||||||||||||
Sbjct  11153  GGAGCTGGTGGAGAACGCGCTGGACGCCG  11125

>PYVX:scaffold_77 pve_scaffold_77 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_77:1:61779:1 
REF
Length=61779

 Score = 44.6 bits (48),  Expect = 0.052
 Identities = 24/24 (100%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  916    GCGCTGGGCGAGCTGGAGGAGCAG  939
              ||||||||||||||||||||||||
Sbjct  21395  GCGCTGGGCGAGCTGGAGGAGCAG  21418

>PYIW:scaffold_414 piw_scaffold_414 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_414:1:19082:1 
REF
Length=19082

 Score = 44.6 bits (48),  Expect = 0.052
 Identities = 34/40 (85%), Gaps = 3/40 (8%)
 Strand=Plus/Plus

Query  949   ATGAACGCCGAGGCCG---TGAAGAGCACGGAGCAGATCG  985
             ||||||||||||||||   ||||| ||| ||||| |||||
Sbjct  1102  ATGAACGCCGAGGCCGACCTGAAGCGCAAGGAGCTGATCG  1141

>PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 
genomic scaffold, whole genome shotgun sequence
Length=4722445

 Score = 44.6 bits (48),  Expect = 0.052
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  417      GCAGAACGCGCTGGACGCCGCCAAGAAGC  445
                |||||| |||||||| |||||||||||||
Sbjct  2262622  GCAGAAGGCGCTGGAGGCCGCCAAGAAGC  2262594

>SAPA:scaffold_24 supercont2.24 dna:supercontig supercontig:ASM15154v2:supercont2.24:1:471063:1 
REF
Length=471063

 Score = 43.7 bits (47),  Expect = 0.18
 Identities = 34/41 (83%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  70      TTCAAGCCCACGTCCTGCGAAGGGTACGTGACCAAGCGCGG  110
               |||||||  ||||| ||||| || || ||||||||||| ||
Sbjct  394992  TTCAAGCAGACGTCATGCGAGGGCTATGTGACCAAGCGAGG  394952

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 80/119 (67%), Gaps = 0/119 (0%)
 Strand=Plus/Minus

Query  310     AAGCCTTTCGGCTTCAAGCTTGTGGGCCACGCGCCAAAGAAAGGCTACATCGAGCTCGAC  369
               ||||| |  ||||||||||| || || || || ||   | | |||||||  ||| |   |
Sbjct  394730  AAGCCGTATGGCTTCAAGCTCGTAGGTCATGCACCGGGGCACGGCTACAAGGAGTTTTGC  394671

Query  370     ATCTTTGTCGAATCGCTCGGTGACCTCAACAAGTGGGTGGAGGTGGTGCAGAACGCGCT  428
                ||| ||||||  ||  |   ||||  |   ||||| | || |||| ||| || |||||
Sbjct  394670  GTCTATGTCGAGACGGCCAAGGACCAAACGCAGTGGCTTGAAGTGGCGCACAATGCGCT  394612

>PYUU:scaffold_1381 scf1117875581381 dna:supercontig supercontig:pug:scf1117875581381:1:502691:1 
REF
Length=502691

 Score = 43.7 bits (47),  Expect = 0.18
 Identities = 39/48 (81%), Gaps = 1/48 (2%)
 Strand=Plus/Plus

Query  412     GTGGTGCAGAACGCGCTGGACGCCGCCAAGAAGCG-CAGTCGCACTGG  458
               |||||| |  ||||  |||||||||||||| || | |||| |||||||
Sbjct  253912  GTGGTGAACGACGCCGTGGACGCCGCCAAGGAGGGCCAGTTGCACTGG  253959

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  180     CGAGAGCCGCGACGCCAGCA  199
               ||||||||||||||||||||
Sbjct  412656  CGAGAGCCGCGACGCCAGCA  412675

>PHSO:scaffold_7
Length=4006126

 Score = 42.8 bits (46),  Expect = 0.18
 Identities = 29/33 (88%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  412      GTGGTGCAGAACGCGCTGGACGCCGCCAAGAAG  444
                ||||||||| ||  ||||||||||||||| |||
Sbjct  2634794  GTGGTGCAGTACAAGCTGGACGCCGCCAACAAG  2634826

>PHRA:scaffold_12
Length=689251

 Score = 42.8 bits (46),  Expect = 0.18
 Identities = 29/33 (88%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  900     CGAGAAGCTGGCGCTGGCGCTGGGCGAGCTGGA  932
               ||||  ||||||||||||||||| | |||||||
Sbjct  160136  CGAGCTGCTGGCGCTGGCGCTGGCCCAGCTGGA  160168

>APAS:scaffold_41 supercont1.41 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.41:1:515451:1 
REF
Length=515451

 Score = 42.8 bits (46),  Expect = 0.18
 Identities = 23/23 (100%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  505    GCGTCGGCGTCGCCGCAGCTGCA  527
              |||||||||||||||||||||||
Sbjct  70410  GCGTCGGCGTCGCCGCAGCTGCA  70388

>PYAP:scaffold_55 pag1_scaffold_55 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_55:1:81842:1 
REF
Length=81842

 Score = 41.9 bits (45),  Expect = 0.63
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  506    CGTCGGCGTCGCCGCAGCTGCAGGTGAAGA  535
              ||||||||||||| | ||||||||| ||||
Sbjct  31232  CGTCGGCGTCGCCTCTGCTGCAGGTCAAGA  31261

>PHSO:scaffold_4
Length=7609242

 Score = 41.9 bits (45),  Expect = 0.63
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  900      CGAGAAGCTGGCGCTGGCGCTGGGC  924
                |||||||| ||||||||||||||||
Sbjct  2255327  CGAGAAGCAGGCGCTGGCGCTGGGC  2255351

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  895      GACCTCGAGAAGCTGGCGCTGGCGC  919
                |||| ||||||||||||||||| ||
Sbjct  3156862  GACCCCGAGAAGCTGGCGCTGGTGC  3156838

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  908      TGGCGCTGGCGCTGGGCGAGCTGGAGGAGC  937
                ||| | |||||||||||||  |||||||||
Sbjct  3817364  TGGAGATGGCGCTGGGCGACTTGGAGGAGC  3817393

>PHRA:scaffold_15
Length=655381

 Score = 41.9 bits (45),  Expect = 0.63
 Identities = 36/45 (80%), Gaps = 0/45 (0%)
 Strand=Plus/Minus

Query  692     ACCACGCGGACAAGCTACTGCGCCACATGAAGCGGCCAATGCTGC  736
               || |||||||||   | |||||||||||| ||| ||  |||||||
Sbjct  506762  ACTACGCGGACAGTTTCCTGCGCCACATGGAGCCGCAGATGCTGC  506718

>PYVX:scaffold_704 pve_scaffold_704 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_704:1:15375:1 
REF
Length=15375

 Score = 41.0 bits (44),  Expect = 0.63
 Identities = 35/43 (81%), Gaps = 3/43 (7%)
 Strand=Plus/Plus

Query  883    GACGCGCTGAGCGACCTCGAGAA---GCTGGCGCTGGCGCTGG  922
              |||| || |||||||| ||||     |||||||||||||||||
Sbjct  15144  GACGAGCAGAGCGACCGCGAGCGCGTGCTGGCGCTGGCGCTGG  15186

>PYVX:scaffold_424 pve_scaffold_424 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_424:1:25437:1 
REF
Length=25437

 Score = 41.0 bits (44),  Expect = 0.63
 Identities = 37/47 (79%), Gaps = 0/47 (0%)
 Strand=Plus/Minus

Query  504    CGCGTCGGCGTCGCCGCAGCTGCAGGTGAAGAAGCTCGCGGCCACGA  550
              ||| ||||||||||||||| ||  | |||||  |  ||||||| |||
Sbjct  20115  CGCTTCGGCGTCGCCGCAGTTGTCGATGAAGGCGAGCGCGGCCTCGA  20069

>PYUU:scaffold_1880 scf1117875581880 dna:supercontig supercontig:pug:scf1117875581880:1:568974:1 
REF
Length=568974

 Score = 41.0 bits (44),  Expect = 0.63
 Identities = 30/34 (88%), Gaps = 1/34 (3%)
 Strand=Plus/Minus

Query  498    CTTCAGCGCGTCGGCGTCGCCGCAGCTGCAGGTG  531
              ||||||||||||||||||| || ||| |||| ||
Sbjct  59600  CTTCAGCGCGTCGGCGTCGTCGGAGC-GCAGTTG  59568

>PYIW:scaffold_3472 piw_scaffold_3472 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_3472:1:3080:1 
REF
Length=3080

 Score = 41.0 bits (44),  Expect = 0.63
 Identities = 33/38 (87%), Gaps = 3/38 (8%)
 Strand=Plus/Minus

Query  899   TCGAGAAGCTGGCGCTGGCGCTGG-GC--GAGCTGGAG  933
             |||||||||||| ||||| ||||| ||  |||||||||
Sbjct  2124  TCGAGAAGCTGGAGCTGGAGCTGGAGCTGGAGCTGGAG  2087

>PHSO:scaffold_3
Length=10773376

 Score = 41.0 bits (44),  Expect = 0.63
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  987      CCGCGTCGAGCAGCGCC-TCACCGCTGTG  1014
                ||||||||||||||||| ||||||| |||
Sbjct  1433925  CCGCGTCGAGCAGCGCCGTCACCGCCGTG  1433953

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  909      GGCGCTGGCGCTGGGCGAGCTGGAGGAG  936
                |||||||||||||| | |||||| ||||
Sbjct  4553354  GGCGCTGGCGCTGGCCAAGCTGGCGGAG  4553327

>PHSO:scaffold_2
Length=11587142

 Score = 41.0 bits (44),  Expect = 0.63
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  987     CCGCGTCGAGCAGCGCC-TCACCGCTGTG  1014
               ||||||||||||||||| ||||||| |||
Sbjct  762174  CCGCGTCGAGCAGCGCCGTCACCGCCGTG  762202

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  403      TGGGTGGAGGTGGTGCAGAACGCGCTGGACG  433
                |||||  |||  |||||||||||||||||||
Sbjct  4935130  TGGGTCAAGGCCGTGCAGAACGCGCTGGACG  4935100

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  883      GACGCGCTGAGCGACCTCGAGAAGCTGGCGCTGGC  917
                |||| ||| ||||||||||||| || | || ||||
Sbjct  2182067  GACGAGCTCAGCGACCTCGAGATGCAGCCGATGGC  2182101

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  926      AGCTGGAGGAGCAGGCGAACCTCAT  950
                ||||||||||||||| ||| |||||
Sbjct  7539351  AGCTGGAGGAGCAGGAGAAACTCAT  7539327

>SAPA:scaffold_2 supercont2.2 dna:supercontig supercontig:ASM15154v2:supercont2.2:1:1567649:1 
REF
Length=1567649

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  895      GACCTCGAGAAGCTGGCGCTGGCGCTGGGCGAGC  928
                |||||||||||||| ||||| ||||| | | |||
Sbjct  1178931  GACCTCGAGAAGCTCGCGCTCGCGCTCGACAAGC  1178898

>SADI:scaffold_79 supercont1.79 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.79:1:234383:1 
REF
Length=234383

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  1025   TGCAAACGCAGACCAAAAAGGCGAACGCCACGAT  1058
              |||||||||||| ||| ||| ||| ||||| |||
Sbjct  19820  TGCAAACGCAGATCAAGAAGACGATCGCCATGAT  19853

>SADI:scaffold_3 supercont1.3 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.3:1:1523884:1 
REF
Length=1523884

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  895     GACCTCGAGAAGCTGGCGCTGGCGCTGGGCGAGC  928
               |||||||||||||| ||||| ||||| | | |||
Sbjct  395950  GACCTCGAGAAGCTTGCGCTCGCGCTCGACAAGC  395983

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  8       TCCTGCGCGTGCCGGACGCCAAGCTCGCGA  37
               ||| |||||  | |||||||||||||||||
Sbjct  704557  TCCAGCGCGCACTGGACGCCAAGCTCGCGA  704586

>PYVX:scaffold_1261 pve_scaffold_1261 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1261:1:5287:1 
REF
Length=5287

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  900   CGAGAAGCTGGCGCTGGCGCTGGG  923
             |||| |||||||||||||||||||
Sbjct  1098  CGAGGAGCTGGCGCTGGCGCTGGG  1121

>PYVX:scaffold_993 pve_scaffold_993 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_993:1:8755:1 
REF
Length=8755

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 37/46 (80%), Gaps = 6/46 (13%)
 Strand=Plus/Plus

Query  948  CATGAACGCCGAGGCCGTG---AAGAGCACGGA---GCAGATCGCC  987
            ||||| |||||||||||||   ||| ||| |||   ||||||||||
Sbjct  387  CATGAGCGCCGAGGCCGTGCTAAAGCGCAAGGAGCGGCAGATCGCC  432

>PYVX:scaffold_258 pve_scaffold_258 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_258:1:33197:1 
REF
Length=33197

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 39/50 (78%), Gaps = 3/50 (6%)
 Strand=Plus/Plus

Query  905    AGCTGGCGCTGGCGCTGGGCGAGCTGGA---GGAGCAGGCGAACCTCATG  951
              |||||||||||  | | |||||||||||   |||||| ||| | ||| ||
Sbjct  18102  AGCTGGCGCTGCAGGTCGGCGAGCTGGATGTGGAGCATGCGGATCTCCTG  18151

>PYIW:scaffold_308 piw_scaffold_308 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_308:1:21315:1 
REF
Length=21315

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  408    GGAGGTGGTGCAGAACGCGCTGGACGCCG  436
              |||| ||||  ||||||||||||||||||
Sbjct  20457  GGAGATGGTCGAGAACGCGCTGGACGCCG  20429

>PYIR:scaffold_750 pir_scaffold_750 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_750:1:16519:1 
REF
Length=16519

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  413    TGGTGCAGAACGCGCTGGACGCCG  436
              ||||||||||| ||||||||||||
Sbjct  12963  TGGTGCAGAACCCGCTGGACGCCG  12986

>PYAR:scaffold_3751 par_scaffold_3751 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_3751:1:2906:1 
REF
Length=2906

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 31/36 (86%), Gaps = 1/36 (3%)
 Strand=Plus/Plus

Query  646   CTGGACATGGTCGAGAGCGACTTGGGCAAGGTCGAG  681
             ||| ||||  |||||||||||||||||  |||||||
Sbjct  1320  CTGTACATTCTCGAGAGCGACTTGGGC-TGGTCGAG  1354

>PYAR:scaffold_1124 par_scaffold_1124 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1124:1:10220:1 
REF
Length=10220

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  85    TGCGAAGGGTACGTGACCAAGCGCGGGCA  113
             || ||||| ||||||||||||||||| ||
Sbjct  2105  TGGGAAGGCTACGTGACCAAGCGCGGCCA  2077

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  501   CAGCGCGTCGGCGTCGCCGC  520
             ||||||||||||||||||||
Sbjct  7016  CAGCGCGTCGGCGTCGCCGC  7035

>PYAR:scaffold_106 par_scaffold_106 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_106:1:32415:1 
REF
Length=32415

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  536   AGCTCGCGGCCACGAAAGAGGATCTGCTC  564
             ||||| ||| |||||||||||||| ||||
Sbjct  1471  AGCTCACGGACACGAAAGAGGATCAGCTC  1499

>PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.4, whole genome shotgun 
sequence
Length=2787191

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 51/69 (74%), Gaps = 10/69 (14%)
 Strand=Plus/Minus

Query  890      TGAGCGACCTCGAGAAGCTGGCGCTGGCGCTGGGCGAGCTGGAGGAGCAGGCGAACCTCA  949
                |||||| | |||||||||||||| ||| | |   |||||| ||||| | ||      |||
Sbjct  2694929  TGAGCG-CTTCGAGAAGCTGGCGATGGAGAT---CGAGCTTGAGGATCCGG------TCA  2694880

Query  950      TGAACGCCG  958
                 ||||||||
Sbjct  2694879  AGAACGCCG  2694871

>PHCA:scaffold_38 PHYCAscaffold_38
Length=550336

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  151     AATGGCGCCAATCTGCAGGTGGCG  174
               ||||||||||||||||||||| ||
Sbjct  254621  AATGGCGCCAATCTGCAGGTGCCG  254598

>HYAP:scaffold_1463 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_1463:1:2881:1 
REF
Length=2881

 Score = 40.1 bits (43),  Expect = 2.2
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  408   GGAGGTGGTGCAGAACGCGCTGGACGCCG  436
             |||| | ||| ||||||||||||||||||
Sbjct  1925  GGAGCTCGTGGAGAACGCGCTGGACGCCG  1953

>SAPA:scaffold_67 supercont2.67 dna:supercontig supercontig:ASM15154v2:supercont2.67:1:182362:1 
REF
Length=182362

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  422     ACGCGCTGGACGCCGCCAAGAAGCGC  447
               |||||||||||||||||||  |||||
Sbjct  164213  ACGCGCTGGACGCCGCCAACGAGCGC  164238

>SADI:scaffold_18 supercont1.18 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.18:1:789572:1 
REF
Length=789572

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  422     ACGCGCTGGACGCCGCCAAGAAGCGC  447
               |||||||||||||||||||  |||||
Sbjct  159188  ACGCGCTGGACGCCGCCAACGAGCGC  159213

>PYVX:scaffold_417 pve_scaffold_417 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_417:1:25588:1 
REF
Length=25588

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  424    GCGCTGGACGCCGCCAAGAAG  444
              |||||||||||||||||||||
Sbjct  16420  GCGCTGGACGCCGCCAAGAAG  16400

>PYVX:scaffold_158 pve_scaffold_158 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_158:1:42935:1 
REF
Length=42935

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  81     GTCCTGCGAAGGGTACGTGACCAAGC  106
              || |||||||||| ||||||||||||
Sbjct  23897  GTACTGCGAAGGGGACGTGACCAAGC  23872

>PYVX:scaffold_137 pve_scaffold_137 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_137:1:46246:1 
REF
Length=46246

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 33/41 (80%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  910    GCGCTGGCGCTGGGCGAGCTGGAGGAGCAGGCGAACCTCAT  950
              |||| |||| |  ||||||||||||||  || || ||||||
Sbjct  41712  GCGCAGGCGATCCGCGAGCTGGAGGAGTCGGGGATCCTCAT  41752

>PYUU:scaffold_2041 scf1117875582041 dna:supercontig supercontig:pug:scf1117875582041:1:1261388:1 
REF
Length=1261388

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 29/33 (88%), Gaps = 1/33 (3%)
 Strand=Plus/Plus

Query  487     ACGATGTTTGGCTTCAGCGCGTCGGCGTCGCCG  519
               |||| ||||||||||| ||||||||| ||| ||
Sbjct  768398  ACGA-GTTTGGCTTCAACGCGTCGGCCTCGTCG  768429

>PYIW:scaffold_1306 piw_scaffold_1306 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1306:1:9733:1 
REF
Length=9733

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  419  AGAACGCGCTGGACGCCGCCAAGAAGCGCAGTCGCA  454
            |||| || | ||| |||||||||||| ||||| |||
Sbjct  774  AGAAGGCCCAGGATGCCGCCAAGAAGAGCAGTAGCA  809

>PYIW:scaffold_92 piw_scaffold_92 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_92:1:32024:1 
REF
Length=32024

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 31/37 (84%), Gaps = 3/37 (8%)
 Strand=Plus/Plus

Query  925    GAGCTGGAGGAGCAGGCGAACCTCATGAACGCCGAGG  961
              |||| |||||||||||||   | ||| ||||||||||
Sbjct  29428  GAGCAGGAGGAGCAGGCG---CGCATCAACGCCGAGG  29461

>PYAR:scaffold_8622 par_scaffold_8622 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_8622:1:730:1 
REF
Length=730

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  544  GCCACGAAAGAGGATCTGCTCAGGGA  569
            || ||||||||||||||||||| |||
Sbjct  666  GCGACGAAAGAGGATCTGCTCAAGGA  641

>PHSO:scaffold_42
Length=18681

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  917   CGCTGGGCGAGCTGGAGGAGCAGGCG  942
             ||||||  ||||||||||||||||||
Sbjct  3927  CGCTGGAGGAGCTGGAGGAGCAGGCG  3902

>PHSO:scaffold_9
Length=3285870

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  905      AGCTGGCGCTGGCGCTGGGCG  925
                |||||||||||||||||||||
Sbjct  1659849  AGCTGGCGCTGGCGCTGGGCG  1659869

>PHSO:scaffold_8
Length=3549547

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  917      CGCTGGGCGAGCTGGAGGAGCAGGCG  942
                ||||||  ||||||||||||||||||
Sbjct  2219424  CGCTGGAGGAGCTGGAGGAGCAGGCG  2219399

>PHRA:scaffold_121
Length=121071

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 62/84 (74%), Gaps = 14/84 (17%)
 Strand=Plus/Minus

Query  890    TGAGCGACCTCGAGAAGCTGGCGCTGGCGCTGGGCGAGCTGGAGGAGCAGGCGAACCTCA  949
              |||||| | |||| ||||||||||||| | |    ||||||||||| |   |||   |||
Sbjct  65849  TGAGCG-CTTCGAAAAGCTGGCGCTGGAGAT---TGAGCTGGAGGACC---CGA---TCA  65800

Query  950    TGAACGCCGAGGCCGT-GAAGAGC  972
               ||||||   |||| | |||||||
Sbjct  65799  AGAACGC---GGCCCTGGAAGAGC  65779

>PHRA:scaffold_79
Length=220511

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  717   CATGAAGCGGCCAATGCTGCA  737
             |||||||||||||||||||||
Sbjct  6738  CATGAAGCGGCCAATGCTGCA  6758

>PHRA:scaffold_45
Length=402062

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  507    GTCGGCGTCGCCGCAGCTGCAGGTGA  532
              |||| ||||||||| |||||||||||
Sbjct  60646  GTCGCCGTCGCCGCCGCTGCAGGTGA  60671

>PHCA:scaffold_68 PHYCAscaffold_68
Length=334182

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  1004   TCACCGCTGTGAACGACCGCGTGCAA  1029
              ||| | ||||||||||||||||||||
Sbjct  32115  TCAACACTGTGAACGACCGCGTGCAA  32140

>PHCA:scaffold_63 PHYCAscaffold_63
Length=355987

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  1004    TCACCGCTGTGAACGACCGCGTGCAA  1029
               ||| | ||||||||||||||||||||
Sbjct  272711  TCAACACTGTGAACGACCGCGTGCAA  272686

>HYAP:scaffold_33 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_33:1:475050:1 
REF
Length=475050

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 35/43 (81%), Gaps = 1/43 (2%)
 Strand=Plus/Plus

Query  901    GAGAAGCTGGCGCTGGCGCTGGGCGAGCTGGAGGA-GCAGGCG  942
              |||| ||||||||||| ||||  || |||| |||| | |||||
Sbjct  68985  GAGATGCTGGCGCTGGTGCTGCACGTGCTGAAGGACGAAGGCG  69027

>APIN:scaffold_13 supercont1.13 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.13:1:1515874:1 
REF
Length=1515874

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  660      GAGCGACTTGGGCAAGGTCGA  680
                |||||||||||||||||||||
Sbjct  1300125  GAGCGACTTGGGCAAGGTCGA  1300145

>APAS:scaffold_2 supercont1.2 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.2:1:2059303:1 
REF
Length=2059303

 Score = 39.2 bits (42),  Expect = 2.2
 Identities = 37/45 (82%), Gaps = 2/45 (4%)
 Strand=Plus/Plus

Query  883      GACGCGCTGAGCGA-CCTCGAGAAGCTGGCGCTGGCGCTGGGCGA  926
                ||||| ||  |||| |||||||||||||| || || | |||||||
Sbjct  1277250  GACGCCCTC-GCGAGCCTCGAGAAGCTGGGGCAGGTGGTGGGCGA  1277293

>SAPA:scaffold_29 supercont2.29 dna:supercontig supercontig:ASM15154v2:supercont2.29:1:422699:1 
REF
Length=422699

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 34/41 (83%), Gaps = 4/41 (10%)
 Strand=Plus/Plus

Query  891    GAGCGACCTCGAGAAGC--TGGCGCTGGCGCTGGGCGAGCT  929
              ||||||||||  |||||  |||||| ||||||| ||| |||
Sbjct  53545  GAGCGACCTC--GAAGCCTTGGCGCCGGCGCTGCGCGCGCT  53583

>SADI:scaffold_63 supercont1.63 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.63:1:313317:1 
REF
Length=313317

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  285     GGTCGGCGTCATGGGCGGCCGCG  307
               |||||||||||||||||| ||||
Sbjct  118510  GGTCGGCGTCATGGGCGGGCGCG  118532

>SADI:scaffold_40 supercont1.40 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.40:1:552398:1 
REF
Length=552398

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 34/42 (81%), Gaps = 2/42 (5%)
 Strand=Plus/Minus

Query  504     CGCGTCGGCGTCGCCGCAGCTGCAGGTGAAGAAGCTCGCGGC  545
               |||| ||||  ||| ||  ||| ||||||||||||| |||||
Sbjct  241725  CGCGCCGGC--CGCGGCGACTGGAGGTGAAGAAGCTGGCGGC  241686

>PYVX:scaffold_1171 pve_scaffold_1171 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1171:1:6190:1 
REF
Length=6190

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  512  CGTCGCCGCAGCTGCAGGTGAAGAAGCT  539
            |||||| ||||||||||| |||||| ||
Sbjct  605  CGTCGCTGCAGCTGCAGGAGAAGAAACT  578

>PYVX:scaffold_414 pve_scaffold_414 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_414:1:25839:1 
REF
Length=25839

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 35/44 (80%), Gaps = 3/44 (7%)
 Strand=Plus/Plus

Query  897   CCTCGAGAAGCTGGCGCTGGCGCT---GGGCGAGCTGGAGGAGC  937
             ||||||||||| |||||||  |||   | |||||| ||| ||||
Sbjct  8143  CCTCGAGAAGCAGGCGCTGCAGCTCGAGCGCGAGCAGGACGAGC  8186

>PYVX:scaffold_259 pve_scaffold_259 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_259:1:33197:1 
REF
Length=33197

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 24/25 (96%), Gaps = 1/25 (4%)
 Strand=Plus/Plus

Query  893   GCGAC-CTCGAGAAGCTGGCGCTGG  916
             ||||| |||||||||||||||||||
Sbjct  4448  GCGACGCTCGAGAAGCTGGCGCTGG  4472

>PYVX:scaffold_41 pve_scaffold_41 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_41:1:76009:1 
REF
Length=76009

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 46/59 (78%), Gaps = 3/59 (5%)
 Strand=Plus/Minus

Query  906    GCTGGCGCTGGCGCTGG-GCGAGCTGGAGGAGCAG-GCGAACCTCATGAACGCCGAGGC  962
              |||||||||||| |||| ||||||| || | || | ||  ||| || |||||  |||||
Sbjct  42268  GCTGGCGCTGGCACTGGCGCGAGCTTGAAG-GCGGCGCCGACCGCAAGAACGGGGAGGC  42211

>PYVX:scaffold_37 pve_scaffold_37 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_37:1:76970:1 
REF
Length=76970

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  895   GACCTCGAGAAGCTGGCGCTGGCGCTGGGCGAG  927
             ||||||||||||||||| |  ||||||  ||||
Sbjct  2308  GACCTCGAGAAGCTGGCTCAAGCGCTGCTCGAG  2340

>PYVX:scaffold_9 pve_scaffold_9 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_9:1:115815:1 
REF
Length=115815

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  409    GAGGTGGTGCAGAACGCGCTGGA  431
              |||||||||||||||||||| ||
Sbjct  57223  GAGGTGGTGCAGAACGCGCTCGA  57245

>PYUU:scaffold_2018 scf1117875582018 dna:supercontig supercontig:pug:scf1117875582018:1:689162:1 
REF
Length=689162

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 33/40 (83%), Gaps = 1/40 (3%)
 Strand=Plus/Minus

Query  953     ACGCCGA-GGCCGTGAAGAGCACGGAGCAGATCGCCCGCG  991
               ||||||| ||  | || |||||||||||||||| | ||||
Sbjct  124510  ACGCCGACGGGAGGGATGAGCACGGAGCAGATCACGCGCG  124471

>PYIW:scaffold_4738 piw_scaffold_4738 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_4738:1:1804:1 
REF
Length=1804

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  912  GCTGGCGCTGGGCGAGCTGGAGG  934
            ||||||||||||||| |||||||
Sbjct  478  GCTGGCGCTGGGCGATCTGGAGG  456

>PYIW:scaffold_1431 piw_scaffold_1431 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1431:1:8996:1 
REF
Length=8996

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  890  TGAGCGACCTCGAGAAGCTGGCGCTGGCGCTGGGCGAG  927
            ||||||||  ||| |||   ||||||||||||| ||||
Sbjct  423  TGAGCGACGGCGACAAGAGCGCGCTGGCGCTGGCCGAG  386

>PYIW:scaffold_4 piw_scaffold_4 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_4:1:82745:1 
REF
Length=82745

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  85     TGCGAAGGGTACGTGACCAAGCGCGGGCACTTT  117
              || || ||||||||||| |||||||| ||| ||
Sbjct  52253  TGGGAGGGGTACGTGACGAAGCGCGGCCACCTT  52285

>PYIR:scaffold_47 pir_scaffold_47 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_47:1:69492:1 
REF
Length=69492

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 30/34 (88%), Gaps = 3/34 (9%)
 Strand=Plus/Plus

Query  128  GGCGCGTGCG-CTACCTCGTGTTCA--ATGGCGC  158
            |||||| ||| ||||||||||||||  |||||||
Sbjct  938  GGCGCGGGCGTCTACCTCGTGTTCATCATGGCGC  971

>PYAP:scaffold_1679 pag1_scaffold_1679 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_1679:1:2431:1 
REF
Length=2431

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  890   TGAGCGACCTCGAGAAGCTGGCG  912
             ||| |||||||||||||||||||
Sbjct  1033  TGACCGACCTCGAGAAGCTGGCG  1055

>PLHA:NW_020187567.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_650, whole genome shotgun sequence
Length=2891727

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 38/49 (78%), Gaps = 3/49 (6%)
 Strand=Plus/Minus

Query  895      GACCTCGAGAAGCTGGCGCTGGCG---CTGGGCGAGCTGGAGGAGCAGG  940
                || || ||| |||||| ||||| |   ||||  ||||||||||||| ||
Sbjct  2136652  GAGCTGGAGGAGCTGGAGCTGGAGGAGCTGGAGGAGCTGGAGGAGCTGG  2136604

>PHRA:scaffold_128
Length=107829

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  405    GGTGGAGGTGGTGCAGAACGCGCTGGAC  432
              ||||||||||||| || ||| |||||||
Sbjct  27649  GGTGGAGGTGGTGGAGGACGTGCTGGAC  27676

>PHRA:scaffold_66
Length=301783

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  909     GGCGCTGGCGCTGGGCGAGCTGGAGGAG  936
               |||||||||||||| | |||||| ||||
Sbjct  269003  GGCGCTGGCGCTGGCCAAGCTGGCGGAG  268976

>PHKE:scaffold_251 scf_22126_251.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_251.1:1:51454:1 
REF
Length=51454

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  712    CGCCACATGAAGCGGCCAATGCTGCACC  739
              ||||||||||||||||||  || |||||
Sbjct  35124  CGCCACATGAAGCGGCCACCGCGGCACC  35151

>PHKE:scaffold_79 scf_22126_79.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_79.1_contig_1:1:112414:1 
REF
Length=112414

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 30/35 (86%), Gaps = 1/35 (3%)
 Strand=Plus/Plus

Query  471    CAACTCGACGACCAAGACGATGTTTGGCTTCAGCG  505
              ||||||  |||||| ||||||||||| |||| |||
Sbjct  70806  CAACTCATCGACCA-GACGATGTTTGCCTTCTGCG  70839

>PHIF:NW_003303745.1 Phytophthora infestans T30-4 supercont1.14 
genomic scaffold, whole genome shotgun sequence
Length=3113719

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  508      TCGGCGTCGCCGCAGCTGCAGGTGAAGAAGCTCGCGGC  545
                |||||||||||| || ||| | |||| | |||||| ||
Sbjct  1643786  TCGGCGTCGCCGAAGATGCCGCTGAACACGCTCGCTGC  1643823

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 37/46 (80%), Gaps = 4/46 (9%)
 Strand=Plus/Minus

Query  890      TGAGCGACCTCGAGAAGCTGGCGCTGGCGCTGGGCGAGCTGGAGGA  935
                |||||| | |||||||||||||| ||| | |   |||||| |||||
Sbjct  3068297  TGAGCG-CTTCGAGAAGCTGGCGATGGAGAT---CGAGCTCGAGGA  3068256

>PHIF:NW_003303741.1 Phytophthora infestans T30-4 supercont1.18 
genomic scaffold, whole genome shotgun sequence
Length=2518706

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 30/35 (86%), Gaps = 1/35 (3%)
 Strand=Plus/Plus

Query  194      CCAGCAAGGGCTCTTC-TTCGTCTGGTGGTACTGG  227
                |||||||| | ||||  |||||| |||||||||||
Sbjct  2149297  CCAGCAAGTGGTCTTTATTCGTCAGGTGGTACTGG  2149331

>PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 
genomic scaffold, whole genome shotgun sequence
Length=2113949

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  411     GGTGGTGCAGAACGCGCTGGACGCCGCC  438
               || ||||||||||||||||| || ||||
Sbjct  394323  GGCGGTGCAGAACGCGCTGGGCGACGCC  394296

>PHCA:scaffold_49 PHYCAscaffold_49
Length=508508

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  894     CGACCTCGAGAAGCTGGCGCTGGCGCTG  921
               |||||| ||||||||||||  |||||||
Sbjct  255557  CGACCTGGAGAAGCTGGCGAAGGCGCTG  255530

>PHCA:scaffold_42 PHYCAscaffold_42
Length=526029

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  887    CGCTGAGCGACCTCGAGAAGCTG  909
              |||||||||| ||||||||||||
Sbjct  23799  CGCTGAGCGAGCTCGAGAAGCTG  23821

>APAS:scaffold_83 supercont1.83 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.83:1:302471:1 
REF
Length=302471

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 41/54 (76%), Gaps = 3/54 (6%)
 Strand=Plus/Minus

Query  643     AAACTGGACATGGTCGAGAG---CGACTTGGGCAAGGTCGAGGGCGATCTCGAC  693
               || ||| |||||||||||||   ||||| |  |||||||| |  | | ||||||
Sbjct  231510  AACCTGTACATGGTCGAGAGCGTCGACTCGATCAAGGTCGCGTCCAAGCTCGAC  231457

>APAS:scaffold_4 supercont1.4 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.4:1:1887962:1 
REF
Length=1887962

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  910     GCGCTGGCGCTGGGCGAGCTGGA  932
               ||||||||||||| |||||||||
Sbjct  641534  GCGCTGGCGCTGGTCGAGCTGGA  641512

>ALLA:FR824372 dna:supercontig supercontig:ENA1:FR824372:1:28325:1 
REF
Length=28325

 Score = 38.3 bits (41),  Expect = 7.7
 Identities = 27/30 (90%), Gaps = 1/30 (3%)
 Strand=Plus/Minus

Query  197    GCAAGGGCTCTTCTTCGTCTGGTGGTACTG  226
              |||| |||| ||||| ||||||||||||||
Sbjct  21134  GCAAAGGCT-TTCTTGGTCTGGTGGTACTG  21106

>SAPA:scaffold_274 supercont2.274 dna:supercontig supercontig:ASM15154v2:supercont2.274:1:15715:1 
REF
Length=15715

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 31/37 (84%), Gaps = 1/37 (3%)
 Strand=Plus/Minus

Query  406    GTGGAGGTGGTGCAGAACGCGCTGGACGCCGC-CAAG  441
              |||||||||||||||||  ||  |||||| || ||||
Sbjct  12806  GTGGAGGTGGTGCAGAATACGAAGGACGCGGCGCAAG  12770

>SAPA:scaffold_157 supercont2.157 dna:supercontig supercontig:ASM15154v2:supercont2.157:1:55913:1 
REF
Length=55913

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 37/47 (79%), Gaps = 1/47 (2%)
 Strand=Plus/Minus

Query  496    GGCTTCAGC-GCGTCGGCGTCGCCGCAGCTGCAGGTGAAGAAGCTCG  541
              ||||||||  ||||||  | ||| || || |||  ||||||||||||
Sbjct  42471  GGCTTCAGTAGCGTCGTAGCCGCGGCGGCAGCACTTGAAGAAGCTCG  42425

>SADI:scaffold_66 supercont1.66 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.66:1:301975:1 
REF
Length=301975

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  898    CTCGAGAAGCTGGCGCTGGCGCTGG  922
              || |||||||||| |||||||||||
Sbjct  53200  CTGGAGAAGCTGGAGCTGGCGCTGG  53176

>SADI:scaffold_37 supercont1.37 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.37:1:550224:1 
REF
Length=550224

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  421     AACGCGCTGGACGCCGCCAAGAAGCGCAGTCGCAC  455
               ||||||   |||||| ||| ||||||||||| |||
Sbjct  484574  AACGCGGCCGACGCCACCATGAAGCGCAGTCTCAC  484608

>PYVX:scaffold_987 pve_scaffold_987 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_987:1:8829:1 
REF
Length=8829

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  553  GAGGATCTGCTCAGGGATGCGCTGCGCGAGATCGA  587
            ||||||||||||||  |  ||||||| ||| ||||
Sbjct  925  GAGGATCTGCTCAGCAAGTCGCTGCGGGAGCTCGA  959

>PYVX:scaffold_760 pve_scaffold_760 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_760:1:13853:1 
REF
Length=13853

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 27/31 (87%), Gaps = 3/31 (10%)
 Strand=Plus/Plus

Query  900   CGAGAAGCTG---GCGCTGGCGCTGGGCGAG  927
             ||||||||||   ||||||||||||| ||||
Sbjct  7205  CGAGAAGCTGCAGGCGCTGGCGCTGGCCGAG  7235

>PYVX:scaffold_745 pve_scaffold_745 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_745:1:14285:1 
REF
Length=14285

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  906   GCTGGCGCTGGCGCTGGGCG  925
             ||||||||||||||||||||
Sbjct  3694  GCTGGCGCTGGCGCTGGGCG  3713

>PYVX:scaffold_724 pve_scaffold_724 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_724:1:14788:1 
REF
Length=14788

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  897   CCTCGAGAAGCTGGCGCTGGCGCTGGGCGA  926
             ||||||| || | | |||||||||||||||
Sbjct  9081  CCTCGAGCAGGTCGTGCTGGCGCTGGGCGA  9110

>PYVX:scaffold_512 pve_scaffold_512 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_512:1:21535:1 
REF
Length=21535

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  886    GCGCTGAGCGACCTCGAGAAGCTGGCGCTGGCGCT  920
              |||||  |||  |||||| |||| |||||||||||
Sbjct  21233  GCGCTCGGCGCGCTCGAGCAGCTCGCGCTGGCGCT  21267

>PYUU:scaffold_1368 scf1117875581368 dna:supercontig supercontig:pug:scf1117875581368:1:308540:1 
REF
Length=308540

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  647     TGGACATGGTCGAGAGCGAC  666
               ||||||||||||||||||||
Sbjct  106924  TGGACATGGTCGAGAGCGAC  106905

>PYUU:scaffold_2011 scf1117875582011 dna:supercontig supercontig:pug:scf1117875582011:1:418791:1 
REF
Length=418791

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  647     TGGACATGGTCGAGAGCGAC  666
               ||||||||||||||||||||
Sbjct  155128  TGGACATGGTCGAGAGCGAC  155147

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  647     TGGACATGGTCGAGAGCGAC  666
               ||||||||||||||||||||
Sbjct  158968  TGGACATGGTCGAGAGCGAC  158949

>PYUU:scaffold_2026 scf1117875582026 dna:supercontig supercontig:pug:scf1117875582026:1:637279:1 
REF
Length=637279

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  914     TGGCGCTGGGCGAGCTGGAGGAGCAGGCGAACCTC  948
               || ||| || |||||| |||||||||||| | |||
Sbjct  309707  TGACGCAGGCCGAGCTCGAGGAGCAGGCGCAGCTC  309741

>PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:pug:scf1117875582028:1:960197:1 
REF
Length=960197

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  546     CACGAAAGAGGATCTGCTCAGGGAT  570
               || ||||||||||||||||| ||||
Sbjct  137458  CAAGAAAGAGGATCTGCTCACGGAT  137434

>PYUU:scaffold_2029 scf1117875582029 dna:supercontig supercontig:pug:scf1117875582029:1:1550222:1 
REF
Length=1550222

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  647      TGGACATGGTCGAGAGCGAC  666
                ||||||||||||||||||||
Sbjct  1128444  TGGACATGGTCGAGAGCGAC  1128425

>PYIW:scaffold_5625 piw_scaffold_5625 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_5625:1:1280:1 
REF
Length=1280

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  116  TTCGCAAGTCCTGGCGCGTG  135
            ||||||||||||||||||||
Sbjct  934  TTCGCAAGTCCTGGCGCGTG  915

>PYIW:scaffold_4956 piw_scaffold_4956 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_4956:1:1671:1 
REF
Length=1671

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  750  TGACGAGCGTGTCAAGCAGA  769
            ||||||||||||||||||||
Sbjct  421  TGACGAGCGTGTCAAGCAGA  440

>PYIW:scaffold_4600 piw_scaffold_4600 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_4600:1:1902:1 
REF
Length=1902

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 31/37 (84%), Gaps = 1/37 (3%)
 Strand=Plus/Minus

Query  423  CGCGCTGGACGCCGCCAAGAAGCGCAGTCGC-ACTGG  458
            ||||||  ||||||||||||||  ||||| | |||||
Sbjct  175  CGCGCTCTACGCCGCCAAGAAGTACAGTCTCGACTGG  139

>PYIW:scaffold_1273 piw_scaffold_1273 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1273:1:9934:1 
REF
Length=9934

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  660   GAGCGACTTGGGCAAGGTCGAGGGC  684
             ||||||| || ||||||||||||||
Sbjct  9728  GAGCGACCTGCGCAAGGTCGAGGGC  9752

>PYIW:scaffold_1144 piw_scaffold_1144 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1144:1:10768:1 
REF
Length=10768

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 38/48 (79%), Gaps = 4/48 (8%)
 Strand=Plus/Minus

Query  954   CGCCGAGGCCGTGAAGAGCACGGAGCAGATCGCCCGCGTCGAGCAGCG  1001
             |||||||||||||||||  |||  ||||  || ||| |||||  ||||
Sbjct  2059  CGCCGAGGCCGTGAAGA--ACG--GCAGCGCGACCGAGTCGATGAGCG  2016

>PYIW:scaffold_5 piw_scaffold_5 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_5:1:63716:1 
REF
Length=63716

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  361    GAGCTCGACATCTTTGTCGAATCGC  385
              ||||||| ||||||||||| |||||
Sbjct  48551  GAGCTCGCCATCTTTGTCGCATCGC  48575

>PYIR:scaffold_361 pir_scaffold_361 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_361:1:29811:1 
REF
Length=29811

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 36/46 (78%), Gaps = 3/46 (7%)
 Strand=Plus/Minus

Query  925   GAGCTGGAGGAGCAGGCGAACCTCATGAACGCCGAGGCCGTGAAGA  970
             |||| |||||||||||||   | |||  |||||||||  | |||||
Sbjct  4157  GAGCAGGAGGAGCAGGCG---CGCATCCACGCCGAGGAAGAGAAGA  4115

>PYIR:scaffold_162 pir_scaffold_162 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_162:1:46812:1 
REF
Length=46812

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  568    GATGCGCTGCGCGAGATCGAAGGCGCGAAGCTCAT  602
              || |||||||||||||||||  ||  | |||||||
Sbjct  22764  GACGCGCTGCGCGAGATCGACCGCCAGCAGCTCAT  22730

>PYAR:scaffold_280 par_scaffold_280 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_280:1:22591:1 
REF
Length=22591

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  188   GCGACGCCAGCAAGGGCTCTTCTTC  212
             |||||||||||| |||| |||||||
Sbjct  7080  GCGACGCCAGCACGGGCACTTCTTC  7056

>PYAP:scaffold_229 pag1_scaffold_229 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_229:1:43027:1 
REF
Length=43027

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 34/42 (81%), Gaps = 1/42 (2%)
 Strand=Plus/Plus

Query  422    ACGCGCTGGACGCCGCCAAGAAGCGCAGTCG-CACTGGTGGA  462
              |||||||||||| || ||||  |||  |||| ||| ||||||
Sbjct  31023  ACGCGCTGGACGGCGACAAGTGGCGTCGTCGCCACGGGTGGA  31064

>PYAP:scaffold_106 pag1_scaffold_106 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_106:1:66683:1 
REF
Length=66683

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  908    TGGCGCTGGCGCTGGGCGAGCTGGAGGAGC  937
              |||||||||||||||  ||| |||||| ||
Sbjct  44826  TGGCGCTGGCGCTGGATGAGATGGAGGCGC  44855

>PYAP:scaffold_20 pag1_scaffold_20 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_20:1:113297:1 
REF
Length=113297

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 40/52 (77%), Gaps = 1/52 (2%)
 Strand=Plus/Plus

Query  939    GGCGAACCTCATGAACGCCGAGGCCGTGAAGAGCACGGAGCAGATCGCCCGC  990
              |||| ||||| |||| ||  ||  |  ||||  |||||||||||||| ||||
Sbjct  53091  GGCGTACCTCTTGAAGGCGCAGTGCTCGAAGT-CACGGAGCAGATCGTCCGC  53141

>PHSO:scaffold_5
Length=6830280

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 28/32 (88%), Gaps = 1/32 (3%)
 Strand=Plus/Plus

Query  196      AGCAAGGGCTCTTCTTCGTCTGGTGGTACTGG  227
                ||||||| |||| |||||||||||| ||| ||
Sbjct  5672657  AGCAAGG-CTCTGCTTCGTCTGGTGATACCGG  5672687

>PHRA:scaffold_123
Length=117378

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  916    GCGCTGGGCGAGCTGGAGGAGCAGGCGAAC  945
              ||| | ||||||| ||||||||||||| ||
Sbjct  29787  GCGGTCGGCGAGCAGGAGGAGCAGGCGGAC  29758

>PHRA:scaffold_53
Length=347111

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  916     GCGCTGGGCGAGCTGGAGGAGCAGG  940
               ||||||||| ||||||||||| |||
Sbjct  301812  GCGCTGGGCAAGCTGGAGGAGAAGG  301836

>PHRA:scaffold_22
Length=569032

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  189     CGACGCCAGCAAGGGCTCTTCTTCGTCTGG  218
               ||||| |||||||||||||||| |  ||||
Sbjct  391299  CGACGACAGCAAGGGCTCTTCTACTGCTGG  391328

>PHRA:scaffold_16
Length=604796

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 31/37 (84%), Gaps = 1/37 (3%)
 Strand=Plus/Plus

Query  346     AAGAAAGGCTACATCGAGCTCGACATCTTTGTCGAAT  382
               ||| | ||||||||||||| ||| | |||| ||||||
Sbjct  297466  AAGGATGGCTACATCGAGCGCGAAACCTTT-TCGAAT  297501

>PHRA:scaffold_3
Length=946144

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  163    CTGCAGGTGGCGTACTACGAGAGCCGCGAC  192
              |||| |||| |||||||||||||| || ||
Sbjct  49649  CTGCTGGTGACGTACTACGAGAGCGGCCAC  49620

>PHPA:scaffold_44 NW_008649030.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.44, whole genome shotgun 
sequence
Length=537161

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 34/43 (79%), Gaps = 4/43 (9%)
 Strand=Plus/Minus

Query  492     GTTTGGCTTCAGCGCGTCGGCGTCGCCGCAGCTGCAGGTGAAG  534
               ||||||| ||  |||||||||||||| ||    ||| ||||||
Sbjct  165808  GTTTGGCATCCCCGCGTCGGCGTCGCGGC----GCACGTGAAG  165770

>PHKE:scaffold_493 scf_22126_493.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_493.1_contig_1:1:23713:1 
REF
Length=23713

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  410   AGGTGGTGCAGAACGCGCTGGACGCCGCCAAGAAG  444
             ||||||||||| || | ||||| || ||||| |||
Sbjct  989   AGGTGGTGCAGTACACACTGGATGCAGCCAACAAG  1023

>PHIF:NW_003303749.1 Phytophthora infestans T30-4 supercont1.10 
genomic scaffold, whole genome shotgun sequence
Length=3761764

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  688      CTCGACCACGCGGACAAGCTACTGC  712
                ||||||||||||||||||  |||||
Sbjct  1043843  CTCGACCACGCGGACAAGGGACTGC  1043819

>PHIF:NW_003303738.1 Phytophthora infestans T30-4 supercont1.21 
genomic scaffold, whole genome shotgun sequence
Length=2319577

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  516      GCCGCAGCTGCAGGTGAAGAAGCTCGCGGCCACGA  550
                ||||  |||||||||| ||||   |||||||||||
Sbjct  1541160  GCCGGCGCTGCAGGTGGAGAACGACGCGGCCACGA  1541194

>PHIF:NW_003303737.1 Phytophthora infestans T30-4 supercont1.22 
genomic scaffold, whole genome shotgun sequence
Length=2337630

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 26/29 (90%), Gaps = 2/29 (7%)
 Strand=Plus/Minus

Query  428      TGGACGCCGCCA--AGAAGCGCAGTCGCA  454
                |||||||||| |  |||||||||||||||
Sbjct  2074579  TGGACGCCGCGATGAGAAGCGCAGTCGCA  2074551

>PHIF:NW_003303562.1 Phytophthora infestans T30-4 supercont1.197 
genomic scaffold, whole genome shotgun sequence
Length=159521

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  688     CTCGACCACGCGGACAAGCTACTGC  712
               ||||||||||||||||||  |||||
Sbjct  113151  CTCGACCACGCGGACAAGGGACTGC  113127

>APIN:scaffold_19 supercont1.19 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.19:1:1079871:1 
REF
Length=1079871

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  489     GATGTTTGGCTTCAGCGCGTCGGCGTCGCC  518
               ||||| | |||| |||||||||||| ||||
Sbjct  261958  GATGTCTTGCTTGAGCGCGTCGGCGCCGCC  261987

>APAS:scaffold_12 supercont1.12 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.12:1:1206637:1 
REF
Length=1206637

 Score = 37.4 bits (40),  Expect = 7.7
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  507     GTCGGCGTCGCCGCAGCTGC  526
               ||||||||||||||||||||
Sbjct  142335  GTCGGCGTCGCCGCAGCTGC  142316

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 1357687680576

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2