Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
PYAR:scaffold_34591999268268413680.0
PYAP:scaffold_56012519130655475841e-147
PYIR:scaffold_2249144318354101883e-40
PYIR:scaffold_48282606233691782e-37
PYUU:scaffold_2037129810412985014181699e-35
PYIR:scaffold_81105401109444181663e-34
PHIF:NW_003303730.16970016973984111594e-32
PYVX:scaffold_275754280675421555e-31
PYIR:scaffold_50242326224071555e-31
PHSO:scaffold_148188188192314261478e-29
PHSO:scaffold_3518134185474261421e-27
PHSO:scaffold_56819876824004261421e-27
PHCA:scaffold_79043979048014201325e-25
PHIF:NW_003303626.12672932675392561296e-24
PHSO:scaffold_6437961383133681272e-23
PHRA:scaffold_10612932132733551272e-23
PHKE:scaffold_622347538163551272e-23
PHRA:scaffold_267947998203561262e-23
PHSO:scaffold_1279057927908272561258e-23
PHPA:scaffold_226866376870404241248e-23
PYIW:scaffold_711522956694571209e-22
PHSO:scaffold_4436508143653612931161e-20
PHCA:scaffold_8493744940913651121e-19
PHRA:scaffold_561626191630254321105e-19
PHKE:scaffold_9857684579803051052e-17
PHPA:scaffold_632422242424712571012e-16
PYAP:scaffold_18218221939118862e-12
PHSO:scaffold_12167083167517456855e-12
PHKE:scaffold_761389663287822e-11
PHIF:NW_003303697.1358683358785107822e-11
PHRA:scaffold_33370820371066259817e-11
PHCA:scaffold_6722053422060673817e-11
PHPA:scaffold_3915026415034484792e-10
PHSO:scaffold_1120224712022799369743e-09
PYIR:scaffold_13195662571857691e-07
PHRA:scaffold_28921516159886635e-06
PHRA:scaffold_4948152823486635e-06
PYUU:scaffold_1402159639159769137612e-05
PYIW:scaffold_182214282147548612e-05
PYIR:scaffold_57355645716159602e-05
PHKE:scaffold_3541445714640189602e-05
PHIF:NW_003303747.12748577274864367596e-05
PYIR:scaffold_454379183949586e-05
PHSO:scaffold_1652201152206454586e-05
PYAR:scaffold_8839384044113572e-04
PYAR:scaffold_18542372241443562e-04
PYAR:scaffold_5931577715892118558e-04
PHRA:scaffold_792567525784115558e-04
PHIF:NW_003303391.1802508030960558e-04
PYAP:scaffold_216346313468757548e-04
PYAP:scaffold_2092665271349530.003
PLHA:NW_020189073.13498735093108530.003
PHRA:scaffold_4235218235360149530.003
PHPA:scaffold_66162764162997241530.003
PHPA:scaffold_4636253858241530.003
PYUU:scaffold_203671322771327145500.009
PYIW:scaffold_371780219140500.009
PYIW:scaffold_35421424146845500.009
PHPA:scaffold_46056161555500.009
PHPA:scaffold_20363956364065115500.009
PHIF:NW_003303752.12065173206522755500.009
PYAP:scaffold_7471275847490.032
PHIF:NW_003303753.13736479373653153490.032
PYIR:scaffold_572184691850234480.032
PYVX:scaffold_50423504241163470.11
PYIR:scaffold_15525462688147470.11
PYAR:scaffold_48023227241470.11
PHPA:scaffold_51018748101881064470.11
APAS:scaffold_995356995360638470.11
PYVX:scaffold_415106071063933460.11
PHSO:scaffold_1338289238293140460.11
APAS:scaffold_2316710516716460460.11
PYVX:scaffold_89435138535450.39
PYVX:scaffold_121273302738455450.39
PYIW:scaffold_15353096315055450.39
PYIW:scaffold_14835565558925450.39
PYIW:scaffold_3602810285445450.39
PYIR:scaffold_4073239326325450.39
PYAR:scaffold_1708796884046450.39
PYAP:scaffold_187102921034655450.39
PHSO:scaffold_25336538533656730450.39
PHRA:scaffold_2338485738489135450.39
PHCA:scaffold_2417093117096535450.39
PYVX:scaffold_6152006204240440.39
PYVX:scaffold_878998902427440.39
PYUU:scaffold_202946516046519132440.39
PYAR:scaffold_2315368540238440.39
PHRA:scaffold_5210258010260627440.39
PHCA:scaffold_1456221156224232440.39
SADI:scaffold_5713128113130424431.4
SADI:scaffold_38853068534439431.4
SADI:scaffold_617828117830929431.4
PYVX:scaffold_866103601039839431.4
PYIW:scaffold_69134813285431.4
PYIR:scaffold_8415216524429431.4
PYAP:scaffold_23107961084550431.4
PLHA:NW_020187034.1951339517139431.4
PHSO:scaffold_36431031643107949431.4
PHRA:scaffold_12342589264254431.4
PHRA:scaffold_8912304012309354431.4
PHPA:scaffold_449210749213024431.4
HYAP:scaffold_10311418011420829431.4
APIN:scaffold_151250421125045031431.4
SADI:scaffold_2345398545400521421.4
PYVX:scaffold_10674248426821421.4
PYUU:scaffold_2013597465977126421.4
PYIR:scaffold_21222032206435421.4
PYAR:scaffold_2855959598426421.4
PHRA:scaffold_123248132485846421.4
PHPA:scaffold_16489135489261130421.4
PHIF:NW_003303741.11575475157556591421.4
PHCA:scaffold_436517236520231421.4
PHCA:scaffold_327407327410938421.4
SAPA:scaffold_563154163157838414.8
SADI:scaffold_738806938809628414.8
PYVX:scaffold_88533436939414.8
PYVX:scaffold_689128461289351414.8
PYVX:scaffold_3022406243833414.8
PYVX:scaffold_48426184267053414.8
PYVX:scaffold_21234822350928414.8
PYUU:scaffold_1381596705969223414.8
PYUU:scaffold_201842754242756928414.8
PYUU:scaffold_203559412659415328414.8
PYIR:scaffold_7851807187269414.8
PYAR:scaffold_120815217928414.8
PHSO:scaffold_781316134833414.8
PHRA:scaffold_2945347145350333414.8
SAPA:scaffold_3528435286725404.8
SADI:scaffold_107522655228925404.8
SADI:scaffold_438452038454425404.8
PYVX:scaffold_12282917294125404.8
PYVX:scaffold_11842111213525404.8
PYVX:scaffold_5373885392037404.8
PYVX:scaffold_130141021412625404.8
PYVX:scaffold_98486934872230404.8
PYVX:scaffold_12655516557020404.8
PYUU:scaffold_178969852569857450404.8
PYUU:scaffold_203150935950938830404.8
PYIW:scaffold_87822124525404.8
PYIW:scaffold_75320503207930404.8
PYIR:scaffold_9766912694130404.8
PYIR:scaffold_92213015930404.8
PYAR:scaffold_13623107312620404.8
PYAP:scaffold_33217482177225404.8
PHRA:scaffold_266239832400725404.8
PHRA:scaffold_6228664228667130404.8
PHIF:NW_003303506.12169220335404.8
PHCA:scaffold_882390782395650404.8
HYAP:scaffold_5916163116171080404.8
HYAP:scaffold_551078451080825404.8
APIN:scaffold_234186401867032404.8
APIN:scaffold_19161891621325404.8
BLASTN 2.9.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= PYAR_24096

Length=684
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

PYAR:scaffold_3459 par_scaffold_3459 dna:supercontig supercontig:...  1234       0.0   
PYAP:scaffold_560 pag1_scaffold_560 dna:supercontig supercontig:p...  527        1e-147
PYIR:scaffold_2249 pir_scaffold_2249 dna:supercontig supercontig:...  170        3e-40 
PYIR:scaffold_4828 pir_scaffold_4828 dna:supercontig supercontig:...  161        2e-37 
PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:p...  153        9e-35 
PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_sc...  150        3e-34 
PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 ge...  144        4e-32 
PYVX:scaffold_275 pve_scaffold_275 dna:supercontig supercontig:pv...  141        5e-31 
PYIR:scaffold_5024 pir_scaffold_5024 dna:supercontig supercontig:...  141        5e-31 
PHSO:scaffold_14                                                      133        8e-29 
PHSO:scaffold_35                                                      129        1e-27 
PHSO:scaffold_5                                                       129        1e-27 
PHCA:scaffold_7 PHYCAscaffold_7                                       120        5e-25 
PHIF:NW_003303626.1 Phytophthora infestans T30-4 supercont1.133 g...  117        6e-24 
PHSO:scaffold_64                                                      115        2e-23 
PHRA:scaffold_106                                                     115        2e-23 
PHKE:scaffold_622 scf_22126_622.1 dna:supercontig supercontig:Phy...  115        2e-23 
PHRA:scaffold_267                                                     114        2e-23 
PHSO:scaffold_1                                                       113        8e-23 
PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 ...  113        8e-23 
PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:pi...  109        9e-22 
PHSO:scaffold_4                                                       105        1e-20 
PHCA:scaffold_84 PHYCAscaffold_84                                     102        1e-19 
PHRA:scaffold_56                                                      100        5e-19 
PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercon...  96.0       2e-17 
PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 ...  92.4       2e-16 
PYAP:scaffold_182 pag1_scaffold_182 dna:supercontig supercontig:p...  78.8       2e-12 
PHSO:scaffold_12                                                      77.9       5e-12 
PHKE:scaffold_761 scf_22126_761.1_contig_1 dna:supercontig superc...  75.2       2e-11 
PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 ge...  75.2       2e-11 
PHRA:scaffold_33                                                      74.3       7e-11 
PHCA:scaffold_67 PHYCAscaffold_67                                     74.3       7e-11 
PHPA:scaffold_39 NW_008649025.1 Phytophthora parasitica INRA-310 ...  72.5       2e-10 
PHSO:scaffold_11                                                      68.0       3e-09 
PYIR:scaffold_1319 pir_scaffold_1319 dna:supercontig supercontig:...  63.5       1e-07 
PHRA:scaffold_2892                                                    58.1       5e-06 
PHRA:scaffold_494                                                     58.1       5e-06 
PYUU:scaffold_1402 scf1117875581402 dna:supercontig supercontig:p...  56.3       2e-05 
PYIW:scaffold_182 piw_scaffold_182 dna:supercontig supercontig:pi...  56.3       2e-05 
PYIR:scaffold_573 pir_scaffold_573 dna:supercontig supercontig:pi...  55.4       2e-05 
PHKE:scaffold_354 scf_22126_354.1_contig_1 dna:supercontig superc...  55.4       2e-05 
PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 ge...  54.5       6e-05 
PYIR:scaffold_4543 pir_scaffold_4543 dna:supercontig supercontig:...  53.6       6e-05 
PHSO:scaffold_16                                                      53.6       6e-05 
PYAR:scaffold_88 par_scaffold_88 dna:supercontig supercontig:par_...  52.7       2e-04 
PYAR:scaffold_1854 par_scaffold_1854 dna:supercontig supercontig:...  51.8       2e-04 
PYAR:scaffold_593 par_scaffold_593 dna:supercontig supercontig:pa...  50.9       8e-04 
PHRA:scaffold_79                                                      50.9       8e-04 
PHIF:NW_003303391.1 Phytophthora infestans T30-4 supercont1.368 g...  50.9       8e-04 
PYAP:scaffold_216 pag1_scaffold_216 dna:supercontig supercontig:p...  50.0       8e-04 
PYAP:scaffold_209 pag1_scaffold_209 dna:supercontig supercontig:p...  49.1       0.003 
PLHA:NW_020189073.1 Plasmopara halstedii genome assembly, contig:...  49.1       0.003 
PHRA:scaffold_4                                                       49.1       0.003 
PHPA:scaffold_66 NW_008649052.1 Phytophthora parasitica INRA-310 ...  49.1       0.003 
PHPA:scaffold_46 NW_008649032.1 Phytophthora parasitica INRA-310 ...  49.1       0.003 
PYUU:scaffold_2036 scf1117875582036 dna:supercontig supercontig:p...  46.4       0.009 
PYIW:scaffold_3717 piw_scaffold_3717 dna:supercontig supercontig:...  46.4       0.009 
PYIW:scaffold_3542 piw_scaffold_3542 dna:supercontig supercontig:...  46.4       0.009 
PHPA:scaffold_460 NW_008649446.1 Phytophthora parasitica INRA-310...  46.4       0.009 
PHPA:scaffold_20 NW_008649006.1 Phytophthora parasitica INRA-310 ...  46.4       0.009 
PHIF:NW_003303752.1 Phytophthora infestans T30-4 supercont1.7 gen...  46.4       0.009 
PYAP:scaffold_74 pag1_scaffold_74 dna:supercontig supercontig:pag...  45.5       0.032 
PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 gen...  45.5       0.032 
PYIR:scaffold_572 pir_scaffold_572 dna:supercontig supercontig:pi...  44.6       0.032 
PYVX:scaffold_50 pve_scaffold_50 dna:supercontig supercontig:pve_...  43.7       0.11  
PYIR:scaffold_155 pir_scaffold_155 dna:supercontig supercontig:pi...  43.7       0.11  
PYAR:scaffold_480 par_scaffold_480 dna:supercontig supercontig:pa...  43.7       0.11  
PHPA:scaffold_5 NW_008648991.1 Phytophthora parasitica INRA-310 u...  43.7       0.11  
APAS:scaffold_9 supercont1.9 dna:supercontig supercontig:Apha_ast...  43.7       0.11  
PYVX:scaffold_415 pve_scaffold_415 dna:supercontig supercontig:pv...  42.8       0.11  
PHSO:scaffold_13                                                      42.8       0.11  
APAS:scaffold_23 supercont1.23 dna:supercontig supercontig:Apha_a...  42.8       0.11  
PYVX:scaffold_894 pve_scaffold_894 dna:supercontig supercontig:pv...  41.9       0.39  
PYVX:scaffold_121 pve_scaffold_121 dna:supercontig supercontig:pv...  41.9       0.39  
PYIW:scaffold_1535 piw_scaffold_1535 dna:supercontig supercontig:...  41.9       0.39  
PYIW:scaffold_1483 piw_scaffold_1483 dna:supercontig supercontig:...  41.9       0.39  
PYIW:scaffold_360 piw_scaffold_360 dna:supercontig supercontig:pi...  41.9       0.39  
PYIR:scaffold_407 pir_scaffold_407 dna:supercontig supercontig:pi...  41.9       0.39  
PYAR:scaffold_170 par_scaffold_170 dna:supercontig supercontig:pa...  41.9       0.39  
PYAP:scaffold_187 pag1_scaffold_187 dna:supercontig supercontig:p...  41.9       0.39  
PHSO:scaffold_2                                                       41.9       0.39  
PHRA:scaffold_23                                                      41.9       0.39  
PHCA:scaffold_24 PHYCAscaffold_24                                     41.9       0.39  
PYVX:scaffold_615 pve_scaffold_615 dna:supercontig supercontig:pv...  41.0       0.39  
PYVX:scaffold_87 pve_scaffold_87 dna:supercontig supercontig:pve_...  41.0       0.39  
PYUU:scaffold_2029 scf1117875582029 dna:supercontig supercontig:p...  41.0       0.39  
PYAR:scaffold_231 par_scaffold_231 dna:supercontig supercontig:pa...  41.0       0.39  
PHRA:scaffold_52                                                      41.0       0.39  
PHCA:scaffold_14 PHYCAscaffold_14                                     41.0       0.39  
SADI:scaffold_57 supercont1.57 dna:supercontig supercontig:Sap_di...  40.1       1.4   
SADI:scaffold_38 supercont1.38 dna:supercontig supercontig:Sap_di...  40.1       1.4   
SADI:scaffold_6 supercont1.6 dna:supercontig supercontig:Sap_dicl...  40.1       1.4   
PYVX:scaffold_866 pve_scaffold_866 dna:supercontig supercontig:pv...  40.1       1.4   
PYIW:scaffold_6913 piw_scaffold_6913 dna:supercontig supercontig:...  40.1       1.4   
PYIR:scaffold_841 pir_scaffold_841 dna:supercontig supercontig:pi...  40.1       1.4   
PYAP:scaffold_23 pag1_scaffold_23 dna:supercontig supercontig:pag...  40.1       1.4   
PLHA:NW_020187034.1 Plasmopara halstedii genome assembly, contig:...  40.1       1.4   
PHSO:scaffold_3                                                       40.1       1.4   
PHRA:scaffold_1234                                                    40.1       1.4   
PHRA:scaffold_89                                                      40.1       1.4   
PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 u...  40.1       1.4   
HYAP:scaffold_103 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  40.1       1.4   
APIN:scaffold_15 supercont1.15 dna:supercontig supercontig:Apha_i...  40.1       1.4   
SADI:scaffold_23 supercont1.23 dna:supercontig supercontig:Sap_di...  39.2       1.4   
PYVX:scaffold_1067 pve_scaffold_1067 dna:supercontig supercontig:...  39.2       1.4   
PYUU:scaffold_2013 scf1117875582013 dna:supercontig supercontig:p...  39.2       1.4   
PYIR:scaffold_2122 pir_scaffold_2122 dna:supercontig supercontig:...  39.2       1.4   
PYAR:scaffold_285 par_scaffold_285 dna:supercontig supercontig:pa...  39.2       1.4   
PHRA:scaffold_123                                                     39.2       1.4   
PHPA:scaffold_16 NW_008649002.1 Phytophthora parasitica INRA-310 ...  39.2       1.4   
PHIF:NW_003303741.1 Phytophthora infestans T30-4 supercont1.18 ge...  39.2       1.4   
PHCA:scaffold_4 PHYCAscaffold_4                                       39.2       1.4   
PHCA:scaffold_3 PHYCAscaffold_3                                       39.2       1.4   
SAPA:scaffold_5 supercont2.5 dna:supercontig supercontig:ASM15154...  38.3       4.8   
SADI:scaffold_7 supercont1.7 dna:supercontig supercontig:Sap_dicl...  38.3       4.8   
PYVX:scaffold_885 pve_scaffold_885 dna:supercontig supercontig:pv...  38.3       4.8   
PYVX:scaffold_689 pve_scaffold_689 dna:supercontig supercontig:pv...  38.3       4.8   
PYVX:scaffold_302 pve_scaffold_302 dna:supercontig supercontig:pv...  38.3       4.8   
PYVX:scaffold_48 pve_scaffold_48 dna:supercontig supercontig:pve_...  38.3       4.8   
PYVX:scaffold_21 pve_scaffold_21 dna:supercontig supercontig:pve_...  38.3       4.8   
PYUU:scaffold_1381 scf1117875581381 dna:supercontig supercontig:p...  38.3       4.8   
PYUU:scaffold_2018 scf1117875582018 dna:supercontig supercontig:p...  38.3       4.8   
PYUU:scaffold_2035 scf1117875582035 dna:supercontig supercontig:p...  38.3       4.8   
PYIR:scaffold_785 pir_scaffold_785 dna:supercontig supercontig:pi...  38.3       4.8   
PYAR:scaffold_1208 par_scaffold_1208 dna:supercontig supercontig:...  38.3       4.8   
PHSO:scaffold_78                                                      38.3       4.8   
PHRA:scaffold_29                                                      38.3       4.8   
SAPA:scaffold_3 supercont2.3 dna:supercontig supercontig:ASM15154...  37.4       4.8   
SADI:scaffold_107 supercont1.107 dna:supercontig supercontig:Sap_...  37.4       4.8   
SADI:scaffold_4 supercont1.4 dna:supercontig supercontig:Sap_dicl...  37.4       4.8   
PYVX:scaffold_1228 pve_scaffold_1228 dna:supercontig supercontig:...  37.4       4.8   
PYVX:scaffold_1184 pve_scaffold_1184 dna:supercontig supercontig:...  37.4       4.8   
PYVX:scaffold_537 pve_scaffold_537 dna:supercontig supercontig:pv...  37.4       4.8   
PYVX:scaffold_130 pve_scaffold_130 dna:supercontig supercontig:pv...  37.4       4.8   
PYVX:scaffold_98 pve_scaffold_98 dna:supercontig supercontig:pve_...  37.4       4.8   
PYVX:scaffold_12 pve_scaffold_12 dna:supercontig supercontig:pve_...  37.4       4.8   
PYUU:scaffold_1789 scf1117875581789 dna:supercontig supercontig:p...  37.4       4.8   
PYUU:scaffold_2031 scf1117875582031 dna:supercontig supercontig:p...  37.4       4.8   
PYIW:scaffold_878 piw_scaffold_878 dna:supercontig supercontig:pi...  37.4       4.8   
PYIW:scaffold_75 piw_scaffold_75 dna:supercontig supercontig:piw_...  37.4       4.8   
PYIR:scaffold_976 pir_scaffold_976 dna:supercontig supercontig:pi...  37.4       4.8   
PYIR:scaffold_922 pir_scaffold_922 dna:supercontig supercontig:pi...  37.4       4.8   
PYAR:scaffold_1362 par_scaffold_1362 dna:supercontig supercontig:...  37.4       4.8   
PYAP:scaffold_33 pag1_scaffold_33 dna:supercontig supercontig:pag...  37.4       4.8   
PHRA:scaffold_266                                                     37.4       4.8   
PHRA:scaffold_62                                                      37.4       4.8   
PHIF:NW_003303506.1 Phytophthora infestans T30-4 supercont1.253 g...  37.4       4.8   
PHCA:scaffold_8 PHYCAscaffold_8                                       37.4       4.8   
HYAP:scaffold_59 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_5...  37.4       4.8   
HYAP:scaffold_5 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_5:...  37.4       4.8   
APIN:scaffold_234 supercont1.234 dna:supercontig supercontig:Apha...  37.4       4.8   
APIN:scaffold_19 supercont1.19 dna:supercontig supercontig:Apha_i...  37.4       4.8   

>PYAR:scaffold_3459 par_scaffold_3459 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_3459:1:3265:1 
REF
Length=3265

 Score = 1234 bits (1368),  Expect = 0.0
 Identities = 684/684 (100%), Gaps = 0/684 (0%)
 Strand=Plus/Plus

Query  1     ATGTCCCTTCACTCTGTCGCCGTTCTCGGCGCCGTCGCTGTCGCGGCGCTCGCGGCGCCC  60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1999  ATGTCCCTTCACTCTGTCGCCGTTCTCGGCGCCGTCGCTGTCGCGGCGCTCGCGGCGCCC  2058

Query  61    ACCGCGCTAGTGGAGGCCCACCAGCGCGTCTTCTTGCCCGACGTCGTGTACACGGTCGCG  120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2059  ACCGCGCTAGTGGAGGCCCACCAGCGCGTCTTCTTGCCCGACGTCGTGTACACGGTCGCG  2118

Query  121   AACCGCAACACGAACTGGGGCCCGCAGGCCAAGCTCGAGAAGCAGGGCTACAAGACCACG  180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2119  AACCGCAACACGAACTGGGGCCCGCAGGCCAAGCTCGAGAAGCAGGGCTACAAGACCACG  2178

Query  181   GCTGACTTTAACGCGTACCTTAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGAC  240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2179  GCTGACTTTAACGCGTACCTTAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGAC  2238

Query  241   AAGCCGGGTGCGTACAAGCCCAACAGCGGCGCAACCTTCGAATGCGGCTTCACGGACCCA  300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2239  AAGCCGGGTGCGTACAAGCCCAACAGCGGCGCAACCTTCGAATGCGGCTTCACGGACCCA  2298

Query  301   AAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCAT  360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2299  AAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCAT  2358

Query  361   GAAGGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCAC  420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2359  GAAGGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCAC  2418

Query  421   TTCGACATTTCGGAGACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACG  480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2419  TTCGACATTTCGGAGACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACG  2478

Query  481   TGCATGCTCAAGTGGTACTGGCTGGGCATCCGCCCGACGGGCAAGAGCTACTCGTGGCAG  540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2479  TGCATGCTCAAGTGGTACTGGCTGGGCATCCGCCCGACGGGCAAGAGCTACTCGTGGCAG  2538

Query  541   ATCTACAAGGCCTGCATCCCGCTCTCGGCCAACGGTGGCGGCGCTGCTGCGGCACCGAAC  600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2539  ATCTACAAGGCCTGCATCCCGCTCTCGGCCAACGGTGGCGGCGCTGCTGCGGCACCGAAC  2598

Query  601   ACAACCACAGCAGCTCCGGCCGTGGCAGAGAAGCCCGTCGCGGGCGAGGCCAGTTCGAAA  660
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  2599  ACAACCACAGCAGCTCCGGCCGTGGCAGAGAAGCCCGTCGCGGGCGAGGCCAGTTCGAAA  2658

Query  661   GGCTGCAGGCGTCTTCTCGACTAG  684
             ||||||||||||||||||||||||
Sbjct  2659  GGCTGCAGGCGTCTTCTCGACTAG  2682

>PYAP:scaffold_560 pag1_scaffold_560 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_560:1:21458:1 
REF
Length=21458

 Score = 527 bits (584),  Expect = 1e-147
 Identities = 445/547 (81%), Gaps = 0/547 (0%)
 Strand=Plus/Plus

Query  17     TCGCCGTTCTCGGCGCCGTCGCTGTCGCGGCGCTCGCGGCGCCCACCGCGCTAGTGGAGG  76
              |||| |||||||| |||  |||  |||| || ||| |||| || | ||  || |||||||
Sbjct  12519  TCGCTGTTCTCGGTGCCACCGCCATCGCTGCCCTCACGGCCCCAAGCGTCCTCGTGGAGG  12578

Query  77     CCCACCAGCGCGTCTTCTTGCCCGACGTCGTGTACACGGTCGCGAACCGCAACACGAACT  136
              | |||||||| |||| ||| || || ||||| |||||| ||||| | || || || ||||
Sbjct  12579  CTCACCAGCGTGTCTACTTCCCTGAGGTCGTCTACACGCTCGCGGATCGAAAGACCAACT  12638

Query  137    GGGGCCCGCAGGCCAAGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGT  196
              |||| || ||||||||||||||||| |||||||||||||||||    ||||| |||||||
Sbjct  12639  GGGGTCCACAGGCCAAGCTCGAGAACCAGGGCTACAAGACCACCAAGGACTTCAACGCGT  12698

Query  197    ACCTTAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACA  256
              ||||   |||||||  ||||||||| ||||| || |||||||||||||| ||||| ||||
Sbjct  12699  ACCTCTCGGCCAACGGCTACAAGACGCTCCGTGACTTCATGGACAAGCCTGGTGCCTACA  12758

Query  257    AGCCCAACAGCGGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGC  316
              || | ||||  || || ||  |||| || || | |||||| || || |||||  ||||||
Sbjct  12759  AGGCTAACAAGGGTGCGACTGTCGAGTGTGGTTACACGGATCCGAACGCGCCACCGCAGC  12818

Query  317    CGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGA  376
              |||| || | | |||||| ||||||||| || || |||||||| |||||||| |||||||
Sbjct  12819  CGATCCCAACGAACGGCGAGTTCCGCACATCGGGATACACGCACGAAGGCCCGTGCGAGA  12878

Query  377    TCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGA  436
              ||||||| ||||| || | |||||||  |||| | || || |||| |||||| |||||||
Sbjct  12879  TCTGGATCGACGATGTGATGGTCAAGAGCGGCAAGAACTGTCACTACGACATCTCGGAGA  12938

Query  437    CCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGT  496
                ||||||||||||||||||||||||   || |||||||||| |||||||||||||||||
Sbjct  12939  AGGCGTTCACTGACAAGATTGACTACAGTGCATGCAAGGGCAAGTGCATGCTCAAGTGGT  12998

Query  497    ACTGGCTGGGCATCCGCCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCA  556
              ||||||| |||||||| || | ||||||||  || || ||||||||||||||||||||||
Sbjct  12999  ACTGGCTCGGCATCCGTCCAATGGGCAAGAAGTATTCATGGCAGATCTACAAGGCCTGCA  13058

Query  557    TCCCGCT  563
              | || ||
Sbjct  13059  TACCACT  13065

 Score = 128 bits (141),  Expect = 3e-27
 Identities = 244/354 (69%), Gaps = 18/354 (5%)
 Strand=Plus/Minus

Query  216   CAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACA---GCGGCGC  272
             |||||| ||||| || | |||||||||   ||     ||||||  | |     | || ||
Sbjct  8425  CAAGACGCTCCGTGACTACATGGACAACAAGGCCAACTACAAGATCGAGGCGCGTGGTGC  8366

Query  273   AACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGG  332
              | |||||| || |||| |||  ||||||| |   ||   ||||| ||||||||| ||||
Sbjct  8365  GAGCTTCGAGTGTGGCTACACCAACCCAAACGGTGCGCGCCAGCCTATTCCGAAGAACGG  8306

Query  333   CGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGT  392
             |  | | ||  || | || |||||||| || |||||||| ||| ||||| | ||| ||  
Sbjct  8305  CATGATGCGTTCGACCGGCTACACGCACGACGGCCCATGTGAGGTCTGGCTCGACAACAC  8246

Query  393   CAGGGTCAAGCACGGCG---ACAATTGCCACTTCGACA----TTTCGGAGACC--GCGTT  443
               | ||   || ||||    ||| | || ||| | |||    | ||||| ||   ||  |
Sbjct  8245  GCGCGT---GCTCGGCAGCTACACTGGCAACTGCCACAGGGATGTCGGAAACAAGGCTGT  8189

Query  444   CACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCT  503
              |   ||||||| |||| |||   |||||||||||  |||||||||   |||||||||||
Sbjct  8188  GAGCTACAAGATCGACTTCTCCAAGTGCAAGGGCAACTGCATGCTCCGTTGGTACTGGCT  8129

Query  504   GGGCATCCGCC-CGACG--GGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTG  554
              ||||  |||| |  ||  |||||||  |  |||||||||||||||||||| ||
Sbjct  8128  CGGCAAGCGCCTCATCGGTGGCAAGAAGTGGTCGTGGCAGATCTACAAGGCGTG  8075

 Score = 61.7 bits (67),  Expect = 4e-07
 Identities = 74/101 (73%), Gaps = 0/101 (0%)
 Strand=Plus/Minus

Query  449    ACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCA  508
              ||||||| || | |||   |||||||||||  |||||||||   |||||||||||||  |
Sbjct  10927  ACAAGATCGATTTCTCCAAGTGCAAGGGCAACTGCATGCTCCGTTGGTACTGGCTGGCGA  10868

Query  509    TCCGCCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAG  549
                |||  ||  ||||  |  |  ||||||||| | ||||||
Sbjct  10867  AGCGCAAGATTGGCAGCAAGTGGTCGTGGCAGGTGTACAAG  10827

>PYIR:scaffold_2249 pir_scaffold_2249 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_2249:1:3349:1 
REF
Length=3349

 Score = 170 bits (188),  Expect = 3e-40
 Identities = 286/410 (70%), Gaps = 28/410 (7%)
 Strand=Plus/Minus

Query  157   GAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAACTAC  216
             ||||| ||||||| |||||||||||| |||||  |||| |||   ||||||||   ||||
Sbjct  1835  GAGAACCAGGGCTTCAAGACCACGGCGGACTTCGACGCCTACTACAAGGCCAAGGGCTAC  1776

Query  217   AAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACAGCGGCGCAACC  276
             ||||||||||| | |||||||||| |   | | |||||||||  |  |   |||||   |
Sbjct  1775  AAGACCCTCCGTGCGTTCATGGACGACAAGAGCGCGTACAAGGTCGCCGATGGCGCGGAC  1716

Query  277   TTCGAATGCGGCTTCACGGACCCAAAAGCGCCGG-----CGCAGCCGATTCCGAAGGACG  331
             || ||||||||||    ||| ||||   ||||||     |||||||||| |||   | | 
Sbjct  1715  TTTGAATGCGGCT----GGA-CCAAGCTCGCCGGCACGCCGCAGCCGATCCCGTCAGCCA  1661

Query  332   GCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACG  391
             || || | ||| |  |||| ||||| || || || || |||||| ||||| | ||| |  
Sbjct  1660  GCACGGTGCGCTCCACAGGCTACACCCACGACGGTCCGTGCGAGGTCTGGCTCGACAAGA  1601

Query  392   TCAG---GGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTG  448
              | |   | |||||   |||  ||| |||||||  ||  |  |||  ||  | ||     
Sbjct  1600  CCCGTGTGCTCAAG---GGCACCAACTGCCACTCGGAGTTCCCGGGCACGACCTT-----  1549

Query  449   ACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCA  508
              |||||| ||||| ||| | ||||||||  ||||| ||||    ||||||||| ||||||
Sbjct  1548  -CAAGATCGACTATTCGTCTTGCAAGGGTTCGTGCGTGCTGCGCTGGTACTGGATGGGCA  1490

Query  509   TCCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGC  555
             ||||   ||  | |||| ||   ||||| |||||| | ||||||  ||||
Sbjct  1489  TCCGCTTCCTTAAGGGCCAG---TACTCATGGCAGGTGTACAAGAACTGC  1443

>PYIR:scaffold_4828 pir_scaffold_4828 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_4828:1:781:1 
REF
Length=781

 Score = 161 bits (178),  Expect = 2e-37
 Identities = 263/369 (71%), Gaps = 10/369 (3%)
 Strand=Plus/Plus

Query  216  CAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCG-TACAAGCCCAACAGCGGCGCAA  274
            ||||||| | ||||||||||||||||| |     ||  |||   ||    |||| |||  
Sbjct  260  CAAGACCATGCGCGAGTTCATGGACAA-CGACAAGCTATACCGTCCTGTGAGCGACGCCG  318

Query  275  CCTTCGAATGCGGCTTCACGGACC-CAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
             |||| | ||||| | |||| | | | |  |||  | ||||||| ||||||||| ||| |
Sbjct  319  ACTTCAAGTGCGGATACACGAAGCTCGATGGCGA-GCCGCAGCCCATTCCGAAGAACGAC  377

Query  334  GCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTC  393
              | |||||||  | || |||||||| ||||| || |||||||||||| | |||||||||
Sbjct  378  CAGATCCGCACCACTGGATACACGCACGAAGGGCCGTGCGAGATCTGGCTGGACGACGTC  437

Query  394  AGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACT--GACA  451
            | |||     ||||| | || ||||||| ||||   | | |  | || |  |||   | |
Sbjct  438  AAGGTGTTCTACGGCAAGAACTGCCACTACGAC--GTGGCATCCGGCATGAACTTCCAGA  495

Query  452  AGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCC  511
            || | |||| |    | |||  ||||| |||||   |  | ||||||||| |||||||||
Sbjct  496  AGCTCGACTTCAGCTCATGCGTGGGCAAGTGCACCATGTACTGGTACTGGATGGGCATCC  555

Query  512  GCCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT-CTCGGCC  570
            ||   |  |||||||||  ||||||||| ||||||||||  |||||||||||  |||| |
Sbjct  556  GCGGTAGTGGCAAGAGCGTCTCGTGGCAAATCTACAAGGAGTGCATCCCGCTGATCGGTC  615

Query  571  AACGGTGGC  579
             ||||||||
Sbjct  616  -ACGGTGGC  623

>PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:pug:scf1117875582037:1:1414051:1 
REF
Length=1414051

 Score = 153 bits (169),  Expect = 9e-35
 Identities = 289/418 (69%), Gaps = 28/418 (7%)
 Strand=Plus/Plus

Query  154      CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  213
                |||||||| ||||||||||||||||| || ||||| ||||| |||   ||| ||||   |
Sbjct  1298104  CTCGAGAACCAGGGCTACAAGACCACCGCCGACTTCAACGCCTACTACAAGTCCAAGGGC  1298163

Query  214      TACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACAGCGGCGCA  273
                |||||| | || |||| |||||||||| |   |   |||||||||  ||||     ||| 
Sbjct  1298164  TACAAGTCGCTGCGCGCGTTCATGGACGACAAGAAGGCGTACAAGGTCAACTCGAACGCC  1298223

Query  274      ACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCG-GCG-CAGCCGATTCCGAAGGACG  331
                  |||||| ||||||| |||  |  ||| | || || ||| || ||||| |||      |
Sbjct  1298224  GACTTCGAGTGCGGCTACACCAA--CAAGAACGGCGCGCGCCAACCGATCCCG------G  1298275

Query  332      GCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACG  391
                 |   ||||||||  | ||||||||||| || || || |||||| | ||| | ||| || 
Sbjct  1298276  CCAACTTCCGCACCACGGGGTACACGCACGACGGTCCGTGCGAGGTGTGGCTCGACAACA  1298335

Query  392      TCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGG---AGACCGCGTTCACTG  448
                 || ||||  |   ||   ||| || |||   ||| |  | |   |||||     ||| |
Sbjct  1298336  CCAAGGTCTTGTCGGGTTCCAACTGTCACAAGGACTTCCCCGGCAAGACC-----CAC-G  1298389

Query  449      ACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCA  508
                 || ||    |||| |||||||||||||| |||||| | |    ||||||||| ||||||
Sbjct  1298390  CCATGA---GCTACGCGGCGTGCAAGGGCTCGTGCACGTTGCGCTGGTACTGGATGGGCA  1298446

Query  509      TCCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
                ||||   ||  | |||||||    ||||||||||  | |||||||  ||| | |||||
Sbjct  1298447  TCCGCTTCCTCAAGGGCAAG---CACTCGTGGCAAGTGTACAAGGAGTGCGTGCCGCT  1298501

 Score = 141 bits (155),  Expect = 5e-31
 Identities = 281/415 (68%), Gaps = 25/415 (6%)
 Strand=Plus/Plus

Query  154      CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  213
                || ||||| |||||||||||||| ||||  ||||| |||||||||   ||||||||   |
Sbjct  1294433  CTTGAGAACCAGGGCTACAAGACGACGGTCGACTTCAACGCGTACTACAAGGCCAAGGGC  1294492

Query  214      TACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACAGCGGCGCA  273
                ||||||||||| || |  ||||||||  | |||   |||||||||     |   || || 
Sbjct  1294493  TACAAGACCCTGCGTGCCTTCATGGATGACCCGAAGGCGTACAAGGTTGCCGCTGGTGCC  1294552

Query  274      ACCTTCGAATGCGGCTTCACGGACCCA-----AAAGCGCCGGCGCAGCCGATTCCGAAGG  328
                   ||| | || || |  ||| | |       ||||||||     ||||||||||    |
Sbjct  1294553  GATTTCCAGTGTGGATGGACGAAACTCGATGGAAAGCGCC-----AGCCGATTCCA---G  1294604

Query  329      ACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACG  388
                  ||| || ||||  || | || ||||| || || || ||||||||| | ||| | ||  
Sbjct  1294605  CTGGCACGATCCGTTCGACTGGTTACACCCACGACGGTCCATGCGAGGTGTGGCTCGATA  1294664

Query  389      ACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTG  448
                 |    | || | | | ||| |||| |||||||  ||  |  | |  ||  | ||||   
Sbjct  1294665  GCACGCGCGTGATGAAGGGCAACAACTGCCACTCGGAGTTCCCAGGCACGACCTTCA---  1294721

Query  449      ACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCA  508
                   | || ||||||||| ||||||||||| |||||| |||    ||||||||| |||| |
Sbjct  1294722  ---AAATCGACTACTCGTCGTGCAAGGGCTCGTGCACGCTGCGCTGGTACTGGATGGGTA  1294778

Query  509      TCCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCC  560
                | ||   ||  | |||||||   |||||||||||| | ||||||  |||| ||||
Sbjct  1294779  TTCGCTTCCTCAAGGGCAAG---TACTCGTGGCAGGTGTACAAGAACTGCGTCCC  1294830

 Score = 121 bits (133),  Expect = 5e-25
 Identities = 310/457 (68%), Gaps = 24/457 (5%)
 Strand=Plus/Plus

Query  129      CACGAACTGGGGCCCGCAGGCCAAGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTT  188
                |||| |||||| ||||| | |    ||||||||| | ||   |||||| |  ||   | |
Sbjct  1301048  CACGTACTGGGCCCCGCTGTCGTTCCTCGAGAAGAACGGTGTCAAGACAAGCGCGAGCGT  1301107

Query  189      TAACGCGTACCTTAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGG  248
                 || |  | | | ||||  ||    ||||| || ||||||||  |||||||| | || | 
Sbjct  1301108  CAATGGCTTCATGAAGGAGAAGGGGTACAACACGCTCCGCGATCTCATGGACGA-CCAGA  1301166

Query  249      TGCG-TACAAGCCCAAC---AGCGGCGCAACCTTCGAATGCGGCTTCACGGACCCAA--A  302
                 ||  ||||||  ||||   | || ||  | |||    ||||||| ||||||||| |  |
Sbjct  1301167  AGCTCTACAAGGTCAACTCGAACGCCGATAACTTTCTCTGCGGCTACACGGACCCGACCA  1301226

Query  303      AGCGCCGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGA  362
                || ||   |||||||||| || || ||| || |  | |||||| | || ||||| || | 
Sbjct  1301227  AGGGCT--CGCAGCCGATCCCCAAAGACAGCACCATGCGCACGACCGGATACACCCACGT  1301284

Query  363      AGGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAA-GCACGGCGACAATTGCCACT  421
                 ||||| || ||  ||||||| |||||||||| |||||  ||| |||||||| |||||| 
Sbjct  1301285  GGGCCCGTGTGAAGTCTGGATCGACGACGTCAAGGTCATCGCA-GGCGACAACTGCCACG  1301343

Query  422      TCGACATTTCGGAG-ACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACG  480
                   |||  |  ||| | | |   |||   |||| | ||||||      |||||||||| |
Sbjct  1301344  A--ACAAGT--GAGCAACAC---CAC---CAAGGTGGACTACAGCAACTGCAAGGGCAAG  1301393

Query  481      TGCATGCTCAAGTGGTACTGGCTGGGCATCCGC-CCGACGGGCAAGAGCTACTCGTGGCA  539
                |||| | |  | ||||||||||| ||  | |||  |  |  | ||||  |  ||||||||
Sbjct  1301394  TGCACGATGCACTGGTACTGGCTCGGATTGCGCTTCCTCAAG-AAGAAGTGGTCGTGGCA  1301452

Query  540      GATCTACAAGGCCTGCATCCCGCTCTCGGCCAACGGT  576
                  | ||||||  ||||||| ||||| |||   |||||
Sbjct  1301453  AGTGTACAAGAACTGCATCGCGCTCACGGGTGACGGT  1301489

 Score = 113 bits (124),  Expect = 8e-23
 Identities = 279/416 (67%), Gaps = 27/416 (6%)
 Strand=Plus/Plus

Query  154      CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  213
                || ||||| ||||||| |||||| || || ||||| |||||||||   ||||||||   |
Sbjct  1288709  CTTGAGAACCAGGGCTTCAAGACGACCGCCGACTTCAACGCGTACTACAAGGCCAAGGGC  1288768

Query  214      TACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACAGC-GGCGC  272
                |||||| | || || |  ||||||||| |   |   || ||||||     | || || ||
Sbjct  1288769  TACAAGTCGCTGCGTGCCTTCATGGACGACAAGAAAGCATACAAGGTTG-CTGCTGGTGC  1288827

Query  273      AACCTTCGAATGCGGCTTCACGGACCCA-----AAAGCGCCGGCGCAGCCGATTCCGAAG  327
                    ||| | || || |  ||| | |       ||||||||     ||||||||||    
Sbjct  1288828  CGATTTCCAGTGTGGATGGACGAAACTCGATGGAAAGCGCC-----AGCCGATTCCA---  1288879

Query  328      GACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGAC  387
                |  ||| || ||||  || | || ||||| || || || ||||||||| | ||| | |||
Sbjct  1288880  GCTGGCACGATCCGTTCGACTGGTTACACCCACGACGGTCCATGCGAGGTGTGGCTCGAC  1288939

Query  388      GACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACT  447
                 ||  |   || | | | ||| |||| |||||||  ||   |||  || |  ||   || 
Sbjct  1288940  AACACCCTTGTGATGAAGGGCAACAACTGCCACTCGGAG--TTCCCAGGCA-CG---ACG  1288993

Query  448      GACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGC  507
                 |||||||    ||| |  ||||||||||| |||||| |||    ||||||||| |||| 
Sbjct  1288994  CACAAGATCAGTTACGCTTCGTGCAAGGGCTCGTGCACGCTGCGCTGGTACTGGATGGGT  1289053

Query  508      ATCCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCC  560
                || ||   ||  | |||||||   |||||||||||| | ||||||  |||| ||||
Sbjct  1289054  ATTCGCTTCCTCAAGGGCAAG---TACTCGTGGCAGGTGTACAAGAACTGCGTCCC  1289106

 Score = 106 bits (117),  Expect = 1e-20
 Identities = 273/411 (66%), Gaps = 15/411 (4%)
 Strand=Plus/Plus

Query  154      CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  213
                || ||||| || || | | |||| ||||| ||||| |||||||||   ||||||||   |
Sbjct  1295970  CTTGAGAACCAAGGATTCGAGACGACGGCCGACTTCAACGCGTACTACAAGGCCAAGGGC  1296029

Query  214      TACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACAGCGGCGCA  273
                ||||||||||| || |  ||||||||| |   |   |||||||    |  |   || || 
Sbjct  1296030  TACAAGACCCTGCGTGCCTTCATGGACGACAAGAAGGCGTACACAGTCGCCTCTGGAGCT  1296089

Query  274      ACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
                  ||| |||||||| |  ||| | |   | |   ||   ||  | || ||    |  |||
Sbjct  1296090  GACTTTGAATGCGGATGGACGAAACTCGATGGTACGCGTCAATCCATCCCA---GCTGGC  1296146

Query  334      GCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTC  393
                 || ||||  || | || ||||| || || || ||||||||| | ||| | |||  |   
Sbjct  1296147  ACGATCCGTTCGACTGGTTACACCCACGACGGTCCATGCGAGGTGTGGCTCGACAGCACG  1296206

Query  394      AGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAAG  453
                 | || | | | ||| |||| ||||||  |||  |  | |  ||  ||  |||  |||| 
Sbjct  1296207  CGCGTGATGAAGGGCAACAACTGCCACACCGAGTTCACTGGAACGACG--CAC--ACAA-  1296261

Query  454      ATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCG-  512
                 | ||||||||| ||||||||||| |||||| |||    ||||||||| |||| || || 
Sbjct  1296262  -TCGACTACTCGTCGTGCAAGGGCTCGTGCACGCTGCGCTGGTACTGGATGGGTATTCGC  1296320

Query  513      --CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCG  561
                  ||  | |||| ||   |||||||||||| | |||||   |||| | |||
Sbjct  1296321  TTCCTCAAGGGCGAG---TACTCGTGGCAGGTGTACAAAAACTGCGTGCCG  1296368

 Score = 96.0 bits (105),  Expect = 2e-17
 Identities = 209/308 (68%), Gaps = 24/308 (8%)
 Strand=Plus/Plus

Query  276      CTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGC  335
                ||| || ||||| | |||||||||||       | |||| ||||| || | |   ||  |
Sbjct  1299690  CTTTGAGTGCGGGTACACGGACCCAACGTACGAGTCGCAACCGATCCCCACGACGGGAAC  1299749

Query  336      GTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCAG  395
                  | ||| || | |||||||| || || || || || ||  | ||| | || ||||||| 
Sbjct  1299750  CATTCGCTCGACGGGGTACACCCACGATGGGCCGTGTGAAGTGTGGCTCGATGACGTCAA  1299809

Query  396      GGTCAAGCACGGCGACAATTGCCACTTCGACAT-TTC---GG--AGACCGCGTTCACTGA  449
                ||||| |   |||||||| ||||||   ||||  |||   ||  |||||   ||| |   
Sbjct  1299810  GGTCATGTCGGGCGACAACTGCCAC---GACAAGTTCCCAGGCAAGACC---TTCCC---  1299860

Query  450      CAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCAT  509
                   | | ||||||    ||||||||||  | |||| |||   |||||||||||| ||| |
Sbjct  1299861  ---GCTCGACTACAGCTCGTGCAAGGGTTCATGCACGCTGCGGTGGTACTGGCTCGGCGT  1299917

Query  510      CCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTCTC  566
                 ||   || || |   ||| | |||||||||||||| |||||||  ||| || |||| ||
Sbjct  1299918  GCGCTACCTGAAG---AAGCGATACTCGTGGCAGATTTACAAGGAGTGCGTCTCGCTTTC  1299974

Query  567      GGCCAACG  574
                 | |||||
Sbjct  1299975  AGACAACG  1299982

 Score = 79.7 bits (87),  Expect = 2e-12
 Identities = 73/90 (81%), Gaps = 2/90 (2%)
 Strand=Plus/Minus

Query  467      CGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCC-GCCCGACGGGCAAG  525
                ||||||||||  ||||||||||   |||||||||||| ||||||| |||||  |  | ||
Sbjct  1302712  CGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGT-GAACGAG  1302654

Query  526      AGCTACTCGTGGCAGATCTACAAGGCCTGC  555
                |  |||||||||||| | ||||||| ||||
Sbjct  1302653  ACGTACTCGTGGCAGGTGTACAAGGTCTGC  1302624

>PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_8:1:111390:1 
REF
Length=111390

 Score = 150 bits (166),  Expect = 3e-34
 Identities = 289/418 (69%), Gaps = 20/418 (5%)
 Strand=Plus/Plus

Query  154     CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  213
               || ||| | ||| ||| |  |||||| || ||||| ||||||||||| |  || ||||| 
Sbjct  110540  CTGGAGGACCAGAGCTTCCCGACCACCGCCGACTTCAACGCGTACCTGACAGCGAACAAG  110599

Query  214     TACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACAGCG-GCGC  272
               |||| | | || || | ||||||| ||||  ||      |||| |  |||| ||| ||||
Sbjct  110600  TACACGTCGCTGCGTGCGTTCATGAACAACTCGACGCTCTACACGGTCAAC-GCGAGCGC  110658

Query  273     AACCTTCGAATGCGGCTTCACGGA-CCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACG  331
                | ||| |  || ||||| ||| | | | |  |||  |  |||||| || |||| | |||
Sbjct  110659  GAACTTTGGGTGTGGCTTTACGAAGCTCGACGGCG-AGCGGCAGCCAATCCCGACGAACG  110717

Query  332     GCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACG  391
               ||  | | |||  | | |||||||| || || || || ||||||| ||||||  ||||  
Sbjct  110718  GCCAGATGCGCTTGACCGGGTACACCCACGACGGTCCGTGCGAGACCTGGATGAACGATA  110777

Query  392     TCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACT----  447
                || |||      |||||| || ||||||          ||||| | ||  ||| |    
Sbjct  110778  CCAAGGTGTTTGCCGGCGAGAACTGCCAC---------ACGGAG-CTGCCCTCAATTAGC  110827

Query  448     GACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGC  507
                |||  || ||||||||||||||||||||| ||||||| ||     |||||||| |||||
Sbjct  110828  TACAGCATGGACTACTCGGCGTGCAAGGGCTCGTGCATACTGCGCCGGTACTGGATGGGC  110887

Query  508     ATCCGC-CCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTC  564
               ||||||  || |  | | ||| |||||||||||| | |||||||| ||||  || |||
Sbjct  110888  ATCCGCTACGTCAAGAACGAG-TACTCGTGGCAGGTGTACAAGGCGTGCACTCCTCTC  110944

>PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 
genomic scaffold, whole genome shotgun sequence
Length=2113949

 Score = 144 bits (159),  Expect = 4e-32
 Identities = 284/411 (69%), Gaps = 17/411 (4%)
 Strand=Plus/Plus

Query  157     GAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAACTAC  216
               ||||| |||||||  |||||   |   || || || || |  | | | |  |||  ||||
Sbjct  697001  GAGAACCAGGGCTTTAAGACGCAGCAGGATTTCAAGGCCTGGCGTGATGAAAACGGCTAC  697060

Query  217     AAGACCCTCCGCGAGTTCATGGACA-AGCCGGGTGCGTACAAGCCCAACAGCGGCGCAAC  275
               ||  | || || || |||||||||| ||||  || || ||  | |||   |||||||   
Sbjct  697061  AAATCGCTTCGTGACTTCATGGACAGAGCCAAGTACG-ACGTGACCA---GCGGCGCCGA  697116

Query  276     CTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGC  335
               ||||   ||||| || |||||||| || | | || ||||||| ||||||  ||  |||||
Sbjct  697117  CTTCTCGTGCGGTTTTACGGACCCGAAGGGGACGCCGCAGCCTATTCCGGCGGGTGGCGC  697176

Query  336     GTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCAG  395
                 | ||  || | || |||||||| || || || |||||  | ||| ||||||||   | 
Sbjct  697177  CATGCGATCGACTGGTTACACGCACGACGGACCGTGCGAAGTGTGGCTTGACGACAAGAT  697236

Query  396     GGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAAGAT  455
               |||   | | |||||||| || |||   || | |||  || |   |   ||| |||   |
Sbjct  697237  GGTGCTGGATGGCGACAACTGTCACGA-GA-AGTTCCCAGGCAAGG---ACT-ACACTGT  697290

Query  456     TGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCGCCC  515
                ||||||||| | |||||||||||||||| |||    ||||||||||||||| | |||  
Sbjct  697291  GGACTACTCGTCATGCAAGGGCACGTGCACGCTGCGCTGGTACTGGCTGGGCGTGCGCTT  697350

Query  516     GACGGGCAAGAGC---TACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
                  |   |||| |   |||||||||||| | |||||||||||||| |||||
Sbjct  697351  CTTG---AAGAACTCGTACTCGTGGCAGGTGTACAAGGCCTGCATTCCGCT  697398

 Score = 117 bits (129),  Expect = 6e-24
 Identities = 183/256 (71%), Gaps = 12/256 (5%)
 Strand=Plus/Plus

Query  308     CGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCC  367
               || ||||||| ||||||  ||  | |||  | ||  || | || |||||||| || || |
Sbjct  673442  CGCCGCAGCCTATTCCGGCGGGTGACGCCATGCGATCGACTGGTTACACGCACGACGGAC  673501

Query  368     CATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACA  427
               | |||||| | ||| | ||||||   | |||   | | |||||||| || |||   || |
Sbjct  673502  CGTGCGAGGTGTGGCTCGACGACAAGATGGTGCTGGATGGCGACAACTGTCACGA-GA-A  673559

Query  428     TTTCGGAGACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGC  487
                |||  || |   |   ||| |||   | ||||||||| | |||||||||||||||| ||
Sbjct  673560  GTTCCCAGGCAAGG---ACT-ACACTGTGGACTACTCGTCATGCAAGGGCACGTGCACGC  673615

Query  488     TCAAGTGGTACTGGCTGGGCATCCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCT  544
               |    ||||||||||||||||||||   || || |  ||||   |||||||||||| | |
Sbjct  673616  TGCGCTGGTACTGGCTGGGCATCCGCTTCCTGAAGAACAAG---TACTCGTGGCAGGTGT  673672

Query  545     ACAAGGCCTGCATCCC  560
               | ||||||||||||||
Sbjct  673673  ATAAGGCCTGCATCCC  673688

>PYVX:scaffold_275 pve_scaffold_275 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_275:1:32274:1 
REF
Length=32274

 Score = 141 bits (155),  Expect = 5e-31
 Identities = 367/542 (68%), Gaps = 26/542 (5%)
 Strand=Plus/Plus

Query  35    TCGCTGTCGCGGCGCTCGCGGCGCCCACCGCGCT--AGTGGA-GGCCCACCAGCGCGTCT  91
             |||||| ||| ||  |||  ||| ||| |||||   ||  || ||| ||||||| |||  
Sbjct  7542  TCGCTGCCGCCGCCTTCGTCGCGACCAACGCGCCGCAGGCGATGGCGCACCAGCTCGTGA  7601

Query  92    TCTTGCCCGACGTCGT-GTACACGGTCGCG---AACCGCAACACGAACTGGGGCCCGCAG  147
             || |||| | || |   ||||||||||| |   ||   |||| ||  ||||   ||||  
Sbjct  7602  TCCTGCCGG-CGCCAACGTACACGGTCGAGGGCAAGGACAAC-CG--CTGGAAGCCGCTC  7657

Query  148   GCCAAGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCC  207
             |||   ||||||   |||  || |  |||||| |  |||||   ||  ||| |  | |||
Sbjct  7658  GCCTTCCTCGAGGGCCAGAACTTCTCGACCACCGACGACTTCGTCGGCTACTTGGACGCC  7717

Query  208   AACAACTACAAGACCCTCCGCGAGTTCATGGACAA-GCCGGGTGCGTACAAGCCCAACAG  266
             |||  || | |  | |||||||  ||||||||| | | |  |  | |||  |   ||| |
Sbjct  7718  AACGGCTTCGACTCGCTCCGCGCCTTCATGGACGACGACTCGCTC-TACTCGGTGAAC-G  7775

Query  267   CGGC-GCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGA  325
             || | ||   ||||  ||||||||||||||||||  | ||  || ||||||| || ||  
Sbjct  7776  CGTCCGCGGACTTCCGATGCGGCTTCACGGACCCGGACGCCGCGCCGCAGCCCATCCCC-  7834

Query  326   AGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTG  385
               ||||||    | ||| |  | ||||||||||| || ||||| |||||| ||||| | |
Sbjct  7835  --GACGGCATTATGCGCTCCACGGGGTACACGCACGACGGCCCGTGCGAGGTCTGGCTCG  7892

Query  386   ACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCA  445
             |||||    | ||   |||   |||||| |||||    | ||| || |  |   | | | 
Sbjct  7893  ACGACACGCGTGTGCTGCAGCACGACAACTGCCATGAGGTCATCTCCGGCAAAACCTAC-  7951

Query  446   CTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
               |||    ||||||||||||||||||| ||| |||||| |||  | ||||||||||| |
Sbjct  7952  --GACC---TTGACTACTCGGCGTGCAACGGCTCGTGCACGCTGTACTGGTACTGGCTCG  8006

Query  506   GCATCCGC-CCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTC  564
             || | |||  |  |  |||||  ||||||||||||| | |||||||||||| | ||| ||
Sbjct  8007  GCGTGCGCTACCTCAAGCAAG-TCTACTCGTGGCAGGTGTACAAGGCCTGCGTGCCGATC  8065

Query  565   TC  566
             ||
Sbjct  8066  TC  8067

 Score = 96.9 bits (106),  Expect = 6e-18
 Identities = 183/267 (69%), Gaps = 17/267 (6%)
 Strand=Plus/Minus

Query  308    CGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCC  367
              |||||||| || ||||    |||||||   | ||| |  | ||||||||||| |  || |
Sbjct  14696  CGGCGCAGGCGCTTCCC---GACGGCGTCATGCGCTCCACGGGGTACACGCACGTCGGTC  14640

Query  368    CATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACA  427
              | |||||| ||||| | ||||||   | |||   |||   |||||| ||||||  |   |
Sbjct  14639  CGTGCGAGGTCTGGCTCGACGACACGATGGTGCTGCAGTACGACAACTGCCACGACTCAA  14580

Query  428    TTTCGG---AGACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCA  484
              | || |   |||||          || |  | ||||||||| | |||| |  ||||||||
Sbjct  14579  TCTCTGGCAAGACCT---------ACGACCTCGACTACTCGTCCTGCACGTCCACGTGCA  14529

Query  485    TGCTCAAGTGGTACTGGCTGGGCATCCGCCCGACGGGCAA-GAGCTACTCGTGGCAGATC  543
               |||| | |||| |||| ||||| |||||        ||| ||| |||||||||||| | 
Sbjct  14528  CGCTCTACTGGTTCTGGATGGGCGTCCGCTACCTCAACAACGAG-TACTCGTGGCAGGTG  14470

Query  544    TACAAGGCCTGCATCCCGCTCTCGGCC  570
              ||||||  |||| | ||||||||||||
Sbjct  14469  TACAAGAACTGCGTACCGCTCTCGGCC  14443

 Score = 79.7 bits (87),  Expect = 2e-12
 Identities = 196/288 (68%), Gaps = 16/288 (6%)
 Strand=Plus/Plus

Query  276   CTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGC  335
             |||||| |||||  | ||   ||| ||  ||  | |||||||||| ||||   ||||| |
Sbjct  6679  CTTCGACTGCGGACTTACCTTCCCGAACACGGAGACGCAGCCGATCCCGACCAACGGCTC  6738

Query  336   GTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGAC-GTCA  394
             ||||  ||| || || |||||||  || || || |||||||||||||| ||| ||   | 
Sbjct  6739  GTTCATCACATCCGGCTACACGCTGGACGGGCCGTGCGAGATCTGGATCGACAACACGCT  6798

Query  395   GGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAAGA  454
             ||  |  ||  |||  ||| ||||||   ||  |  |||||     |  |||  ||| ||
Sbjct  6799  GGCGCTGGC-GGGCCGCAACTGCCACACGGAGTTCCCGGAG-----GGCCAC-CACACGA  6851

Query  455   TTGACTACTCGGCGT---GCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATC-  510
             | ||||||   | ||   || || ||    || || ||  ||||| |||||| |||||| 
Sbjct  6852  TCGACTACAGCGTGTGCGGCGAGAGCTGCCGCGTG-TC--GTGGTTCTGGCTCGGCATCA  6908

Query  511   CGCCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATC  558
              |  | | |||| || |||||||||||||| ||| ||||  |||||||
Sbjct  6909  AGTACCA-GGGCGAGCGCTACTCGTGGCAGGTCTTCAAGAACTGCATC  6955

 Score = 76.1 bits (83),  Expect = 2e-11
 Identities = 117/163 (72%), Gaps = 12/163 (7%)
 Strand=Plus/Plus

Query  408    CGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAAGATTGACTACTCGGC  467
              |||||| ||||||  || ||||||||  |  |    ||| | ||   | ||||||||| |
Sbjct  12675  CGACAACTGCCACGCCGCCATTTCGGGCAAGGA---CACGGCCA---TCGACTACTCGTC  12728

Query  468    GTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCG---CCCGACGGGCAA  524
              |||||||||| |||||| |||  | ||||||||| ||||  | ||   || || |||  |
Sbjct  12729  GTGCAAGGGCTCGTGCACGCTGTACTGGTACTGGATGGGTGTGCGCTACCTGAAGGG--A  12786

Query  525    GAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTCTCG  567
              | | |||||||||||  | ||||||  |||  | || ||||||
Sbjct  12787  GCG-TACTCGTGGCAAGTGTACAAGAACTGTGTGCCACTCTCG  12828

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 85/114 (75%), Gaps = 6/114 (5%)
 Strand=Plus/Minus

Query  457   GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCGC---  513
             ||||||||| ||||||  ||| |||||| |||  | |||| |||| ||||  | |||   
Sbjct  8970  GACTACTCGTCGTGCAGCGGCTCGTGCACGCTGTACTGGTTCTGGATGGGTGTGCGCTAC  8911

Query  514   CCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTCTCG  567
             | || |||  || | |||||||||||  | ||||||  |||| | |||||||||
Sbjct  8910  CTGAAGGG--AGCG-TACTCGTGGCAAGTGTACAAGAACTGCGTGCCGCTCTCG  8860

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 46/63 (73%), Gaps = 0/63 (0%)
 Strand=Plus/Minus

Query  358   CATGAAGGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGC  417
             || || || || |||||||||||| | ||||||    |  ||   || |||||||| |||
Sbjct  9063  CACGACGGTCCGTGCGAGATCTGGCTCGACGACACTCGCATCTTCCAGGGCGACAACTGC  9004

Query  418   CAC  420
             |||
Sbjct  9003  CAC  9001

>PYIR:scaffold_5024 pir_scaffold_5024 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_5024:1:718:1 
REF
Length=718

 Score = 141 bits (155),  Expect = 5e-31
 Identities = 280/407 (69%), Gaps = 26/407 (6%)
 Strand=Plus/Plus

Query  154  CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  213
            |||||||| ||||||||||||||||| || ||||| ||||  ||| | ||| ||||   |
Sbjct  232  CTCGAGAACCAGGGCTACAAGACCACCGCAGACTTCAACGGCTACATCAAGTCCAAGGGC  291

Query  214  TACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAA--CAGC-GGC  270
            ||||||||||| || | |||||||||| |   |   || ||||||  | |  | || |||
Sbjct  292  TACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCGGGC  351

Query  271  GCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCG-CAGCCGATTCCGAAGGA  329
            || | ||| || ||||||| |||  ||   || | ||  ||| |||||||| ||    | 
Sbjct  352  GCCAACTTTGAGTGCGGCTACACCAACATCAACG-GCAAGCGCCAGCCGATCCC---AGC  407

Query  330  CGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGA  389
             ||| |  ||||| |  |||| ||||| || || || || |||||| ||||| ||||| |
Sbjct  408  GGGCACAATCCGCTCCACAGGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTGACAA  467

Query  390  CGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGG---AGACCGCGTTCAC  446
            |  || ||||| |   |||  ||| ||| ||   ||| |  |||   |||||     |||
Sbjct  468  CACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCCGGGAAAGACC-----CAC  522

Query  447  TGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGG  506
            |     |||   |||| || ||||||||||  |||||| |||    ||||||||| ||||
Sbjct  523  T----CGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGG  578

Query  507  CATCCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGG  550
            | | ||   ||  | |  ||||   |  ||||||||| | |||||||
Sbjct  579  CCTTCGCTTCCTCAAGAACAAG---TGGTCGTGGCAGGTGTACAAGG  622

>PHSO:scaffold_14
Length=1806347

 Score = 133 bits (147),  Expect = 8e-29
 Identities = 287/426 (67%), Gaps = 15/426 (4%)
 Strand=Plus/Minus

Query  141     CCCGCAGGCCAAGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCT  200
               |||||  |||   || || || ||||| | |||||||  ||  ||||| | ||| |  | 
Sbjct  819231  CCCGCTCGCCTTCCTTGAAAACCAGGGTTTCAAGACCCAGGAGGACTTCACCGCCTGGCG  819172

Query  201     TAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCC  260
                ||||  |||  ||||||| | || || || |||||||||| | |      |||| |   
Sbjct  819171  CAAGGAGAACGGCTACAAGTCGCTGCGTGATTTCATGGACAGGGCCAA---GTACGACGT  819115

Query  261     CAACAGCGGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGAT  320
               || |||||||||   ||||   || |||||||| ||||| || |   |  | ||||| ||
Sbjct  819114  CACCAGCGGCGCCGACTTCTCCTGTGGCTTCACCGACCCCAAGGGCACCCCTCAGCCCAT  819055

Query  321     TCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTG  380
               |||| | |    |  | | ||| |  | || ||||| || || ||||| |||||| | ||
Sbjct  819054  TCCGGAAGGTAACAAGATGCGCTCTACCGGCTACACCCACGACGGCCCGTGCGAGGTGTG  818995

Query  381     GATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGC  440
               | | ||||||   | |||   | | |||||||| ||||||    |  |  |||  |  | 
Sbjct  818994  GCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAGAAGTTCCCGGGCAAGG-  818936

Query  441     GTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTG  500
                   ||| ||| | | ||||||||  |||||||||||||||||| |||    ||||||||
Sbjct  818935  ----ACT-ACACGGTGGACTACTCATCGTGCAAGGGCACGTGCACGCTTCGCTGGTACTG  818881

Query  501     GCTGGGCATCCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCAT  557
               ||||||  | ||   |  || |   ||   ||||||||||||| | |||||||| |||||
Sbjct  818880  GCTGGGAGTGCGTTTCTTGAAG---AATGACTACTCGTGGCAGGTGTACAAGGCTTGCAT  818824

Query  558     CCCGCT  563
               ||||||
Sbjct  818823  CCCGCT  818818

 Score = 89.7 bits (98),  Expect = 9e-16
 Identities = 188/280 (67%), Gaps = 3/280 (1%)
 Strand=Plus/Plus

Query  141     CCCGCAGGCCAAGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCT  200
               ||||  ||||   |||||||| ||||||| | ||||   ||  |||||   | |||  | 
Sbjct  814023  CCCGTTGGCCTTCCTCGAGAACCAGGGCTTCGAGACGCAGGAGGACTTCGCCTCGTGGCG  814082

Query  201     TAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCC  260
               | |    |||  ||||||| | || || || |||||||||||| |   |  |||||    
Sbjct  814083  TGACAAGAACGGCTACAAGTCGCTGCGTGACTTCATGGACAAGGC---TAAGTACACAGT  814139

Query  261     CAACAGCGGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGAT  320
                |  || || ||   ||||   ||||||||||| ||||| || |   |  | ||||| ||
Sbjct  814140  GACGAGTGGAGCCGACTTCTCCTGCGGCTTCACCGACCCCAAGGGTACCCCTCAGCCCAT  814199

Query  321     TCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTG  380
               ||||  || || |||  | ||  || | || |||||||| || ||||| |||||| | ||
Sbjct  814200  TCCGGCGGGCGACGCCATGCGTTCGACGGGTTACACGCACGACGGCCCGTGCGAGGTGTG  814259

Query  381     GATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCAC  420
               | | ||||||   | |||   | | |||||||| ||||||
Sbjct  814260  GCTCGACGACACGAAGGTGCTGGAGGGCGACAACTGCCAC  814299

 Score = 84.2 bits (92),  Expect = 4e-14
 Identities = 276/426 (65%), Gaps = 30/426 (7%)
 Strand=Plus/Minus

Query  141     CCCGCAGGCCAAGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCT  200
               |||||  |||   || || || ||||| | |||||||  ||  |||||    || |  | 
Sbjct  815750  CCCGCTCGCCTTCCTTGAAAACCAGGGTTTCAAGACCCAGGAGGACTTCGCTGCCTGGCG  815691

Query  201     TAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCC  260
                ||||  |||  |||| |||| || || || |||||||||||   ||    |||| |   
Sbjct  815690  CAAGGAGAACGGCTACCAGACGCTGCGTGACTTCATGGACAA---GGCCAAGTACGACGT  815634

Query  261     CAACAGCGGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGAT  320
               || |||||||||   ||||   ||||||||||| ||||| || |   |  | ||||| ||
Sbjct  815633  CACCAGCGGCGCCGACTTCTCCTGCGGCTTCACCGACCCCAAGGGCACCCCTCAGCCCAT  815574

Query  321     TCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTG  380
               |||| | |    |  | | ||| |  | || ||||| || || ||           | ||
Sbjct  815573  TCCGGAAGGTAACAAGATGCGCTCCACGGGATACACCCACGACGG-----------TGTG  815525

Query  381     GATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGC  440
               | | ||||||   | |||   | | |||||||| ||||||   ||  || | |     ||
Sbjct  815524  GCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCAC-GAGAAGTTCCCG----GGC  815470

Query  441     GTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTG  500
                   ||| ||| | | ||||||||| |||| |||||| |||||| |||    ||||||||
Sbjct  815469  AAGGACT-ACACGGTCGACTACTCGTCGTGTAAGGGCTCGTGCACGCTTCGCTGGTACTG  815411

Query  501     GCTGGGCATCCGCCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCC  560
               | |||| ||      || |   ||    ||||||||| || | |||||||||||||||||
Sbjct  815410  GATGGG-AT------GAAG---AACTCGTACTCGTGGAAGGTGTACAAGGCCTGCATCCC  815361

Query  561     GCTCTC  566
               ||| ||
Sbjct  815360  GCTGTC  815355

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  529     TACTCGTGGCAGATCTACAAGGCCTGCATCCC  560
               |||||||||||| | |||||||  ||||||||
Sbjct  814328  TACTCGTGGCAGGTGTACAAGGAGTGCATCCC  814359

>PHSO:scaffold_35
Length=32414

 Score = 129 bits (142),  Expect = 1e-27
 Identities = 286/426 (67%), Gaps = 15/426 (4%)
 Strand=Plus/Minus

Query  141    CCCGCAGGCCAAGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCT  200
              ||||| |||    ||||||||  |||| |  | ||||  ||  ||||| | ||| |  | 
Sbjct  18547  CCCGCTGGCTTTCCTCGAGAATGAGGGATTTACGACCCAGGAGGACTTCACCGCCTGGCG  18488

Query  201    TAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCC  260
               ||||  |||  ||||||| | || || || |||||||||| | |      |||| |   
Sbjct  18487  CAAGGAGAACGGCTACAAGTCGCTGCGTGATTTCATGGACAGGGCCAA---GTACGACGT  18431

Query  261    CAACAGCGGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGAT  320
              || |||||||||   ||||   || |||||||| ||||| || |   |  | ||||| ||
Sbjct  18430  CACCAGCGGCGCCGACTTCTCCTGTGGCTTCACCGACCCCAAGGGCACCCCTCAGCCCAT  18371

Query  321    TCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTG  380
              |||| | |    |  | | ||| |  | || ||||| || || ||||| |||||| | ||
Sbjct  18370  TCCGGAAGGTAACAAGATGCGCTCTACCGGCTACACCCACGACGGCCCGTGCGAGGTGTG  18311

Query  381    GATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGC  440
              | | ||||||   | |||   | | |||||||| ||||||    |  |  |||  |  | 
Sbjct  18310  GCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAGAAGTTCCCGGGCAAGG-  18252

Query  441    GTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTG  500
                  ||| ||| | | ||||||||  |||||||||||||||||| |||    ||||||||
Sbjct  18251  ----ACT-ACACGGTGGACTACTCATCGTGCAAGGGCACGTGCACGCTTCGCTGGTACTG  18197

Query  501    GCTGGGCATCCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCAT  557
              ||||||  | ||   |  || |   ||   ||||||||||||| | |||||||| |||||
Sbjct  18196  GCTGGGAGTGCGTTTCTTGAAG---AATGACTACTCGTGGCAGGTGTACAAGGCTTGCAT  18140

Query  558    CCCGCT  563
              ||||||
Sbjct  18139  CCCGCT  18134

>PHSO:scaffold_5
Length=6830280

 Score = 129 bits (142),  Expect = 1e-27
 Identities = 286/426 (67%), Gaps = 15/426 (4%)
 Strand=Plus/Minus

Query  141     CCCGCAGGCCAAGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCT  200
               ||||| |||    ||||||||  |||| |  | ||||  ||  ||||| | ||| |  | 
Sbjct  682400  CCCGCTGGCTTTCCTCGAGAATGAGGGATTTACGACCCAGGAGGACTTCACCGCCTGGCG  682341

Query  201     TAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCC  260
                ||||  |||  ||||||| | || || || |||||||||| | |      |||| |   
Sbjct  682340  CAAGGAGAACGGCTACAAGTCGCTGCGTGATTTCATGGACAGGGCCAA---GTACGACGT  682284

Query  261     CAACAGCGGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGAT  320
               || |||||||||   ||||   || |||||||| ||||| || |   |  | ||||| ||
Sbjct  682283  CACCAGCGGCGCCGACTTCTCCTGTGGCTTCACCGACCCCAAGGGCACCCCTCAGCCCAT  682224

Query  321     TCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTG  380
               |||| | |    |  | | ||| |  | || ||||| || || ||||| |||||| | ||
Sbjct  682223  TCCGGAAGGTAACAAGATGCGCTCTACCGGCTACACCCACGACGGCCCGTGCGAGGTGTG  682164

Query  381     GATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGC  440
               | | ||||||   | |||   | | |||||||| ||||||    |  |  |||  |  | 
Sbjct  682163  GCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAGAAGTTCCCGGGCAAGG-  682105

Query  441     GTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTG  500
                   ||| ||| | | ||||||||  |||||||||||||||||| |||    ||||||||
Sbjct  682104  ----ACT-ACACGGTGGACTACTCATCGTGCAAGGGCACGTGCACGCTTCGCTGGTACTG  682050

Query  501     GCTGGGCATCCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCAT  557
               ||||||  | ||   |  || |   ||   ||||||||||||| | |||||||| |||||
Sbjct  682049  GCTGGGAGTGCGTTTCTTGAAG---AATGACTACTCGTGGCAGGTGTACAAGGCTTGCAT  681993

Query  558     CCCGCT  563
               ||||||
Sbjct  681992  CCCGCT  681987

>PHCA:scaffold_7 PHYCAscaffold_7
Length=1368812

 Score = 120 bits (132),  Expect = 5e-25
 Identities = 285/420 (68%), Gaps = 22/420 (5%)
 Strand=Plus/Plus

Query  154     CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  213
               |||||||| |||||||  |||||   |   ||||||    |||  | || ||  ||||||
Sbjct  904397  CTCGAGAACCAGGGCTTTAAGACGCAGCAGGACTTTGCTTCGTGGCGTACGGAAAACAAC  904456

Query  214     TACAAGACCCTCCGCGAGTTCATGGACAA-GCCGGGTGCGTACAAGCCCAACAG-CGGCG  271
               |||||  |||| ||||| ||||||||||| |||   | |  |||  |   || | ||| |
Sbjct  904457  TACAAATCCCTTCGCGACTTCATGGACAATGCCAAATAC--ACAGTC---ACGGACGGAG  904511

Query  272     CAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACG  331
               |   ||||   ||||| || || ||||| || |   || ||||||| ||||||  ||   
Sbjct  904512  CCGACTTCTCTTGCGGGTTTACCGACCCGAAGGGTACGCCGCAGCCCATTCCGGCGGGAA  904571

Query  332     GCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACG  391
                 ||  | ||  |  | || |||||||| || || || || ||  | ||| |||||||| 
Sbjct  904572  ATGCCATGCGTTCCACTGGTTACACGCACGACGGTCCGTGTGAAGTGTGGCTTGACGACA  904631

Query  392     TCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCA--CTGA  449
                 | |||   | | || ||||| ||||||   || |||||     ||| ||  |  || |
Sbjct  904632  CGATGGTGCTGGATGGTGACAACTGCCACGA-GAAATTTCC----CCG-GTAAAGACT-A  904684

Query  450     CAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCAT  509
               || | | ||||||||| | |||||||||||||||| |||    |||||||||||||||||
Sbjct  904685  CACGGTGGACTACTCGTCTTGCAAGGGCACGTGCACGCTTCGCTGGTACTGGCTGGGCAT  904744

Query  510     CCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTCTC  566
               |||   |  || |   ||    |||||||||||| | |||||||| || || || || ||
Sbjct  904745  CCGTTTCTTGAAG---AATCAGTACTCGTGGCAGGTGTACAAGGCTTGTATTCCTCTGTC  904801

 Score = 113 bits (124),  Expect = 8e-23
 Identities = 275/411 (67%), Gaps = 17/411 (4%)
 Strand=Plus/Minus

Query  154     CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  213
               |||||||| |||||||  |||||   |   ||||| |  || |  |  || |  |||  |
Sbjct  905869  CTCGAGAACCAGGGCTTTAAGACGCAGCAGGACTTCACTGCCTGGCGCAACGAAAACGGC  905810

Query  214     TACAAGACCCTCCGCGAGTTCATGGACA-AGCCGGGTGCGTACAAGCCCAACAGCGGCGC  272
               |||||| | || || || |||||||||| |||    |  |||||    ||  | ||| ||
Sbjct  905809  TACAAGTCACTGCGTGACTTCATGGACAGAGC----TAAGTACACAGTCACGAACGGAGC  905754

Query  273     AACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGG  332
                  ||||   || || || || ||||| || |   || ||||||| ||||||  || |  
Sbjct  905753  CGACTTCTCTTGTGGGTTTACCGACCCGAAGGGTACGCCGCAGCCCATTCCGGCGGGCAA  905694

Query  333     CGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGT  392
               |||  | ||| |  | || |||||||| || || || || ||  | ||| ||||||||  
Sbjct  905693  CGCCATGCGCTCCACGGGTTACACGCACGATGGTCCGTGTGAAGTGTGGCTTGACGACAC  905634

Query  393     CAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAA  452
                | |||   | | || ||||| ||||||   || |||||     | ||    ||| ||| 
Sbjct  905633  GATGGTGCTGGATGGTGACAACTGCCACGA-GAAATTTCC----CGGCAAGGACT-ACAC  905580

Query  453     GATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCG  512
               | | ||||||||| | |||||||||||||||| |||    ||||||||||||||  | ||
Sbjct  905579  GGTGGACTACTCGTCTTGCAAGGGCACGTGCACGCTTCGTTGGTACTGGCTGGGTGTTCG  905520

Query  513     CCCGACGGGCAAGAGC---TACTCGTGGCAGATCTACAAGGCCTGCATCCC  560
               |     |   |||| |   |||||||||||| | |||||||| || |||||
Sbjct  905519  CTTCTTG---AAGAACGCGTACTCGTGGCAGGTGTACAAGGCTTGTATCCC  905472

 Score = 96.9 bits (106),  Expect = 6e-18
 Identities = 271/409 (66%), Gaps = 13/409 (3%)
 Strand=Plus/Plus

Query  154     CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  213
               |||||||  ||||||| ||||||   |   ||||| |  || |  |  || |  |||  |
Sbjct  901504  CTCGAGAGCCAGGGCTTCAAGACGCAGCAAGACTTCACTGCCTGGCGCAATGAAAACGGC  901563

Query  214     TACAAGACCCTCCGCGAGTTCATGGACA-AGCCGGGTGCGTACAAGCCCAACAGCGGCGC  272
               |||||  |||| || || |||||||||  ||||  || |  |||  |  |  | ||| ||
Sbjct  901564  TACAAATCCCTGCGTGACTTCATGGACCGAGCCAAGTAC--ACAGTC--AGGAACGGAGC  901619

Query  273     AACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCC-GAAGGACG  331
                  |||| | |||||||  || ||||| || |   || ||||||| ||||| | ||| | 
Sbjct  901620  CGACTTCAAGTGCGGCTATACCGACCCCAACGGTACGCCGCAGCCCATTCCTGCAGG-CA  901678

Query  332     GCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACG  391
                |||  | ||| |  | || |||||||| || || || || ||  | |||||||| ||| 
Sbjct  901679  ACGCCATGCGCTCCACGGGTTACACGCACGACGGTCCGTGTGAAGTGTGGATTGATGACA  901738

Query  392     TCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACA  451
                 | ||| | | | ||||| || ||||||   ||  || |   |   | | |     |||
Sbjct  901739  CGATGGTGATGGAAGGCGATAACTGCCACGA-GAAGTTCCCTGGTAAGGGCT-----ACA  901792

Query  452     AGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCC  511
                 || ||||||||| | |||||||||| ||||| |||  | ||||||||||||||  | |
Sbjct  901793  CCATCGACTACTCGCCCTGCAAGGGCAAGTGCACGCTGTACTGGTACTGGCTGGGTGTTC  901852

Query  512     GCCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCC  560
               ||     |   ||    |||||||||||| | |||||||  || |||||
Sbjct  901853  GCTTCCTGAAAAACTCGTACTCGTGGCAGGTGTACAAGGAGTGTATCCC  901901

 Score = 96.9 bits (106),  Expect = 6e-18
 Identities = 206/302 (68%), Gaps = 22/302 (7%)
 Strand=Plus/Plus

Query  276     CTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGG---ACGG  332
               |||| | |||||||| || ||||| || |   || ||||||| ||||||  ||   ||| 
Sbjct  908945  CTTCAAGTGCGGCTTTACCGACCCCAACGGTACGCCGCAGCCCATTCCGGCGGGTAACGC  909004

Query  333     C--GCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGAC  390
               |  |||||||  |||   || ||||||||||| || || || ||| | ||| ||||||| 
Sbjct  909005  CATGCGTTCC--ACG---GGTTACACGCATGATGGTCCGTGTGAGGTGTGGCTTGACGAT  909059

Query  391     GTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGAC  450
                  | |||   | |||| || || || |||   ||  || |   |   | | |     ||
Sbjct  909060  ACGATGGTGCTGGACGGAGAGAACTGTCACGA-GAAGTTCCCTGGTAAGGGCT-----AC  909113

Query  451     AAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATC  510
               |  || ||||||||| | ||||||||||| |||| |||  | |||| |||||| ||  | 
Sbjct  909114  ACCATCGACTACTCGTCTTGCAAGGGCACCTGCACGCTGTACTGGTTCTGGCTTGGTGTT  909173

Query  511     CG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTCTCG  567
               ||   || || |   ||   ||||||||||||| | |||||||| ||||| |||||  ||
Sbjct  909174  CGCTTCCTGAAG---AACGACTACTCGTGGCAGGTGTACAAGGCGTGCATTCCGCTGACG  909230

Query  568     GC  569
               ||
Sbjct  909231  GC  909232

 Score = 96.0 bits (105),  Expect = 2e-17
 Identities = 267/402 (66%), Gaps = 21/402 (5%)
 Strand=Plus/Minus

Query  166     GGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAACTACAAGACCCTC  225
               |||| ||||||   ||| ||||| |  || |  | |||||  |||  ||||||  | || 
Sbjct  876615  GGCTTCAAGACGCAGGCAGACTTCACTGCTTGGCGTAAGGAGAACGGCTACAAATCTCTG  876556

Query  226     CGCGAGTTCATGGACAA-GCCGGGTGCGTACAAGCCCAACAGCGGCGCAACCTTCGAATG  284
               || || |||||||| || |||  || |  |    |  ||    || ||   |||| | ||
Sbjct  876555  CGTGATTTCATGGATAACGCCAAGTACCCAGTCTCGGAA----GGTGCCGACTTCAAGTG  876500

Query  285     CGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGCAC  344
               |||||| || ||||| || |   || ||||||| ||||||  ||     ||  | ||  |
Sbjct  876499  CGGCTTTACCGACCCCAACGGTACGCCGCAGCCCATTCCGGCGGGAAATGCCATGCGTTC  876440

Query  345     GTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCA  404
                 | || |||||||| || || || || ||| | |||||||| |||   | ||| | | |
Sbjct  876439  CACTGGTTACACGCACGACGGTCCGTGTGAGGTGTGGATTGATGACACGATGGTGATGGA  876380

Query  405     CGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTC--ACTGACAAGATTGACTAC  462
                || ||||| ||||||   || | |||     ||  ||    ||| |||  || ||||||
Sbjct  876379  AGGTGACAACTGCCACGA-GA-AGTTC-----CCTGGTAAGGACT-ACACCATCGACTAC  876328

Query  463     TCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCG---CCCGACG  519
               ||| | |||||||||| ||||| |||  | ||||||||||||||  | ||   ||  |  
Sbjct  876327  TCGCCCTGCAAGGGCAAGTGCACGCTGTACTGGTACTGGCTGGGTGTGCGTTTCCTCA--  876270

Query  520     GGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCG  561
                  || || |||||||||||| | |||||||  || ||||||
Sbjct  876269  -AAAACAGATACTCGTGGCAGGTGTACAAGGAGTGTATCCCG  876229

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  176     CCACGGCTGACTTTAACGCGTACCT  200
               |||||||||||| | ||||||||||
Sbjct  638958  CCACGGCTGACTGTCACGCGTACCT  638934

>PHIF:NW_003303626.1 Phytophthora infestans T30-4 supercont1.133 
genomic scaffold, whole genome shotgun sequence
Length=313873

 Score = 117 bits (129),  Expect = 6e-24
 Identities = 183/256 (71%), Gaps = 12/256 (5%)
 Strand=Plus/Plus

Query  308     CGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCC  367
               || ||||||| ||||||  ||  | |||  | ||  || | || |||||||| || || |
Sbjct  267293  CGCCGCAGCCTATTCCGGCGGGTGACGCCATGCGATCGACTGGTTACACGCACGACGGAC  267352

Query  368     CATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACA  427
               | |||||| | ||| | ||||||   | |||   | | |||||||| || |||   || |
Sbjct  267353  CGTGCGAGGTGTGGCTCGACGACAAGATGGTGCTGGATGGCGACAACTGTCACGA-GA-A  267410

Query  428     TTTCGGAGACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGC  487
                |||  || |   |   ||| |||   | ||||||||| | |||||||||||||||| ||
Sbjct  267411  GTTCCCAGGCAAGG---ACT-ACACTGTGGACTACTCGTCATGCAAGGGCACGTGCACGC  267466

Query  488     TCAAGTGGTACTGGCTGGGCATCCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCT  544
               |    ||||||||||||||||||||   || || |  ||||   |||||||||||| | |
Sbjct  267467  TGCGCTGGTACTGGCTGGGCATCCGCTTCCTGAAGAACAAG---TACTCGTGGCAGGTGT  267523

Query  545     ACAAGGCCTGCATCCC  560
               | ||||||||||||||
Sbjct  267524  ATAAGGCCTGCATCCC  267539

>PHSO:scaffold_64
Length=40116

 Score = 115 bits (127),  Expect = 2e-23
 Identities = 248/368 (67%), Gaps = 21/368 (6%)
 Strand=Plus/Plus

Query  141    CCCGCAGGCCAAGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCT  200
              ||||| ||||   |||||||| || || | |  ||||  |   ||||||   ||||  | 
Sbjct  37961  CCCGCTGGCCTTCCTCGAGAACCAAGGATTCGCGACCCAGCAAGACTTTCGGGCGTGGCG  38020

Query  201    TAAGGCCAACAAC---TACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAA  257
              ||   |||| |||   ||||||||||| ||||| |||||||||   |  ||   ||||| 
Sbjct  38021  TA---CCAAGAACGGCTACAAGACCCTGCGCGACTTCATGGAC---CATGGCAAGTACAC  38074

Query  258    GCCCAACAGCGGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCC  317
              |   | ||  |||||   ||||   ||||| |  || ||||| || |   |  |||||||
Sbjct  38075  GGTGACCAAGGGCGCCGACTTCTCTTGCGGTTGGACCGACCCCAAGGGCACCCCGCAGCC  38134

Query  318    GATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGAT  377
               |||||| | |  | |||  | ||| |  | || ||||| || || ||||| |||||| |
Sbjct  38135  CATTCCGGACGGAGACGCCATGCGCTCCACGGGCTACACCCACGATGGCCCGTGCGAGGT  38194

Query  378    CTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGAC  437
              |||||| ||| ||    | ||   ||| |||||||| |||||   |||      | ||| 
Sbjct  38195  CTGGATCGACAACACGCGCGTGCTGCAGGGCGACAACTGCCA---CGA------GAAGAT  38245

Query  438    CGCGTTCACTG---ACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTG  494
              |||   ||  |   ||| ||| ||||||||||| || ||||||||||||| ||||   ||
Sbjct  38246  CGCCGACAAGGGCTACACGATCGACTACTCGGCTTGTAAGGGCACGTGCACGCTCCGTTG  38305

Query  495    GTACTGGC  502
              ||||||||
Sbjct  38306  GTACTGGC  38313

>PHRA:scaffold_106
Length=147471

 Score = 115 bits (127),  Expect = 2e-23
 Identities = 243/355 (68%), Gaps = 17/355 (5%)
 Strand=Plus/Minus

Query  213    CTACAAGACCCTCCGCGAGTTCATGGACAA-GCCGGGTGCGTACAAGCCCAACAGCGGCG  271
              ||||||| | || || || ||||||||||| |||  ||    |||     | || |||||
Sbjct  13273  CTACAAGTCGCTGCGTGACTTCATGGACAACGCCAAGT----ACAGTGTGACCAACGGCG  13218

Query  272    CAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACG  331
              |   ||||   |||||||| || ||||| || |   |  ||||||| ||||||   ||| 
Sbjct  13217  CCGACTTCTCTTGCGGCTTTACCGACCCCAAGGGAACCCCGCAGCCCATTCCGGCCGACA  13158

Query  332    GCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACG  391
               |||| | ||  |  | || |||||||| || || || |||||| | ||| | |||||| 
Sbjct  13157  ACGCGATGCGTTCCACGGGATACACGCACGACGGTCCGTGCGAGGTGTGGCTCGACGACA  13098

Query  392    TCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACA  451
                | |||     ||||||| || ||||||   || | |||   | |   |   ||| |||
Sbjct  13097  CGATGGTGCTCGACGGCGAGAACTGCCACGA-GA-AGTTCCCTGGCAAGG---ACT-ACA  13044

Query  452    AGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCC  511
                 | ||||||||| | |||||||||||||||| |||    ||||||||| ||||  |||
Sbjct  13043  CCGTCGACTACTCGTCCTGCAAGGGCACGTGCACGCTTCGTTGGTACTGGATGGGTGTCC  12984

Query  512    G---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
              |   || || ||   | | ||||||||||||  | |||||||  |||||||||||
Sbjct  12983  GATTCCTGAAGG---AAACCTACTCGTGGCAAGTGTACAAGGAGTGCATCCCGCT  12932

>PHKE:scaffold_622 scf_22126_622.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_622.1:1:14582:1 
REF
Length=14582

 Score = 115 bits (127),  Expect = 2e-23
 Identities = 242/355 (68%), Gaps = 17/355 (5%)
 Strand=Plus/Minus

Query  213   CTACAAGACCCTCCGCGAGTTCATGGACAA-GCCGGGTGCGTACAAGCCCAACAGCGGCG  271
             ||||||| | || ||||| ||||||||||| |||  ||    ||  |   | ||| || |
Sbjct  3816  CTACAAGTCGCTGCGCGACTTCATGGACAACGCCAAGT----ACTCGGTGACCAGTGGTG  3761

Query  272   CAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACG  331
             |   ||  |  ||||| || || ||||| || |   |  ||||||| |||||| ||| | 
Sbjct  3760  CTGACTCTGCTTGCGGTTTTACCGACCCCAATGGCACACCGCAGCCCATTCCGGAGGGCA  3701

Query  332   GCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACG  391
              |||  | ||| |  | || |||||||| || || || |||||| ||||||| |||||  
Sbjct  3700  ACGCCATGCGCTCCACGGGATACACGCACGACGGACCGTGCGAGGTCTGGATCGACGATA  3641

Query  392   TCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACA  451
              |   |  | |  |   ||||| ||||||   | | || |     | ||    ||| |||
Sbjct  3640  CCCTTGCGATGGGCAATGACAACTGCCACGAGG-CGTTCCC----CGGCAAGGACT-ACA  3587

Query  452   AGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCC  511
               || ||||||||||| ||||||||||||||||  |||   ||||||||||||||| | |
Sbjct  3586  CCATCGACTACTCGGCCTGCAAGGGCACGTGCACACTCCGTTGGTACTGGCTGGGCGTGC  3527

Query  512   G---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
             |   ||  | |   ||   ||||||||||||| | |||||||||||||| |||||
Sbjct  3526  GTTTCCTCAAG---AATTCCTACTCGTGGCAGGTATACAAGGCCTGCATTCCGCT  3475

 Score = 93.3 bits (102),  Expect = 7e-17
 Identities = 89/113 (79%), Gaps = 6/113 (5%)
 Strand=Plus/Plus

Query  454  ATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCG-  512
            || ||||||||||| ||||||||||||||||  |||   ||||||||||||||| | || 
Sbjct  25   ATCGACTACTCGGCCTGCAAGGGCACGTGCACACTCCGCTGGTACTGGCTGGGCGTGCGT  84

Query  513  --CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
              ||  | |   ||   ||||||||||||| | |||||||||||||| |||||
Sbjct  85   TTCCTCAAG---AATGCCTACTCGTGGCAGGTGTACAAGGCCTGCATTCCGCT  134

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  213   CTACAAGACCCTCCGCGAGTTCATGGACAA  242
             ||||||| | || ||||| |||||||||||
Sbjct  5345  CTACAAGTCGCTGCGCGACTTCATGGACAA  5316

>PHRA:scaffold_267
Length=29552

 Score = 114 bits (126),  Expect = 2e-23
 Identities = 245/356 (69%), Gaps = 19/356 (5%)
 Strand=Plus/Plus

Query  213   CTACAAGACCCTCCGCGAGTTCATGGACAA-GCCGGGTGCGTACAA---GCCCAACAGCG  268
             ||||||| | || || || ||||||||||| |||  ||    ||||   | || || |||
Sbjct  9479  CTACAAGTCGCTGCGTGACTTCATGGACAACGCCAAGT----ACAATGTGGCCGACGGCG  9534

Query  269   GCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGG  328
              ||    ||||   |||||||| || ||||| || |   |  ||||||| ||||||   |
Sbjct  9535  CCGA---CTTCTCTTGCGGCTTTACCGACCCCAAGGGAACCCCGCAGCCCATTCCGGCTG  9591

Query  329   ACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACG  388
                 |||| | ||  |  | || |||||||| || || || |||||| | ||| ||||||
Sbjct  9592  GTAACGCGATGCGTTCCACGGGATACACGCACGACGGTCCGTGCGAGGTGTGGCTTGACG  9651

Query  389   ACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTG  448
             ||   | |||     |||||||||| || |||   || | |||   | |   |   ||| 
Sbjct  9652  ACACGATGGTGCTCGACGGCGACAACTGTCACGA-GA-AGTTCCCTGGCAAGG---ACT-  9705

Query  449   ACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCA  508
             |||   | ||||||||| | |||||||||||||||| |||    ||||||||||||||||
Sbjct  9706  ACACCGTCGACTACTCGTCCTGCAAGGGCACGTGCACGCTTCGTTGGTACTGGCTGGGCA  9765

Query  509   TCCG-CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
             ||||   |  |  | | || ||||||||||||  | |||||||  |||||||||||
Sbjct  9766  TCCGTTTCCTCAAGAACGA-CTACTCGTGGCAAGTGTACAAGGAGTGCATCCCGCT  9820

>PHSO:scaffold_1
Length=13391543

 Score = 113 bits (125),  Expect = 8e-23
 Identities = 182/256 (71%), Gaps = 8/256 (3%)
 Strand=Plus/Plus

Query  312      GCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATG  371
                |||||| |||||| | |||  |||  | ||| |  |||| |||||||| || ||||| ||
Sbjct  2790579  GCAGCCCATTCCGGACGACAACGCTATGCGCTCCACAGGCTACACGCACGACGGCCCGTG  2790638

Query  372      CGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTC  431
                |||| | ||| | ||||||  || ||||| |||   |||||| ||||||     |||   
Sbjct  2790639  CGAGGTTTGGCTCGACGACACCATGGTCATGCAGTACGACAACTGCCACGAGTCCATC--  2790696

Query  432      GGAGACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAA  491
                  || | ||    ||| |||  || ||||||    ||||||    |||||||| |||| |
Sbjct  2790697  --AG-CGGCAAGGACT-ACACCATCGACTACAGCTCGTGCACCTCCACGTGCACGCTCTA  2790752

Query  492      GTGGTACTGGCTGGGCATCCGCC-CGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGG  550
                 |||| |||||||||| | |||  |  |  | | ||| ||||||||||||||||||||||
Sbjct  2790753  CTGGTTCTGGCTGGGCGTGCGCTACCTCAAGAACGAG-TACTCGTGGCAGATCTACAAGG  2790811

Query  551      CCTGCATCCCGCTCTC  566
                | ||| | ||||| ||
Sbjct  2790812  CGTGCGTACCGCTGTC  2790827

 Score = 111 bits (122),  Expect = 3e-22
 Identities = 292/435 (67%), Gaps = 32/435 (7%)
 Strand=Plus/Minus

Query  142      CCGCAGGCCAAGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTT  201
                |||| ||||   || ||||| ||||||||| |||||   |  ||||| |||||||  |  
Sbjct  2791814  CCGCTGGCCTTCCTGGAGAACCAGGGCTACGAGACCGTCGAGGACTTCAACGCGTGGCGC  2791755

Query  202      AAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCC  261
                   | |||   |||||||||||| ||||  |||||||||  | || || | |||| |   
Sbjct  2791754  CGCGACAAGGGCTACAAGACCCTGCGCGCCTTCATGGAC--GGCGCGT-CCTACACGGTG  2791698

Query  262      AACAGCGGCGCAACCTTCGAATGCGGCTTCACGGAC-CCAAAAGCGCCGGCGCAGCCGAT  320
                  |  ||| ||   || | | ||||| ||||| |||  |||  ||| | |||||||| ||
Sbjct  2791697  GCCGACGGGGCCGACTACTACTGCGGATTCACCGACATCAAGGGCGTC-GCGCAGCCCAT  2791639

Query  321      TCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTG  380
                |||   ||||||| |  | ||| |  | || |||||||| || ||||| |||||| ||||
Sbjct  2791638  TCC---GGACGGCACCATGCGCTCCACGGGCTACACGCACGACGGCCCGTGCGAGGTCTG  2791582

Query  381      GATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATT--TCGG--AGA  436
                | | |||  |    | ||   |||   |||||| ||||||   ||| ||   |||  |||
Sbjct  2791581  GCTGGACACCACGCGCGTGCTGCAGTCCGACAACTGCCAC-GAGACCTTCAGCGGCAAGA  2791523

Query  437      CCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGT  496
                   |||      || |  | ||||||    ||||||||||| | ||||  ||    ||||
Sbjct  2791522  ---CGT------ACGACCTCGACTACAGCTCGTGCAAGGGCTCCTGCACCCTGCGCTGGT  2791472

Query  497      ACTGGCTGGGCATCCGC--CCGACGGGCAAGAGC---TACTCGTGGCAGATCTACAAGGC  551
                ||||||||||| | |||  ||      ||||| |   |||||||||||| | ||||||||
Sbjct  2791471  ACTGGCTGGGCGTGCGCTTCC-----TCAAGAACGAATACTCGTGGCAGGTTTACAAGGC  2791417

Query  552      CTGCATCCCGCTCTC  566
                 ||| | ||||| ||
Sbjct  2791416  GTGCGTGCCGCTGTC  2791402

 Score = 104 bits (115),  Expect = 4e-20
 Identities = 202/290 (70%), Gaps = 10/290 (3%)
 Strand=Plus/Minus

Query  277      TTCGAATGCGGCTTCACG-GACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGC  335
                ||||| |||||| ||||| | ||||| | ||  | ||||||| || ||||   || || |
Sbjct  2793887  TTCGACTGCGGCCTCACGAGCCCCAAGACCGA-GACGCAGCCCATCCCGAGCAACAGCTC  2793829

Query  336      GTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCAG  395
                 || |  ||||| || |||||||  || ||||| |||||| ||||| | ||||||  || 
Sbjct  2793828  CTTTCAGACGTCGGGCTACACGCTGGACGGCCCCTGCGAGGTCTGGCTGGACGACACCAA  2793769

Query  396      GGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAAGAT  455
                |||       |||  ||| ||||||  || || |||    || ||   |||     ||||
Sbjct  2793768  GGTGGCTGCTGGCCGCAACTGCCACA-CG-CAGTTCCCGCACGGCCAGCACG----AGAT  2793715

Query  456      TGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATC-CGCC  514
                 ||||||   ||||||   | | |||||| ||||  |||||||||||| ||||||  |  
Sbjct  2793714  CGACTACAGCGCGTGCGGAGACTCGTGCACGCTCTGGTGGTACTGGCTCGGCATCAAGTA  2793655

Query  515      CGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTC  564
                || || |   |  ||||||||||||| ||||||||  |||| || |||||
Sbjct  2793654  CGTCGAGGGCG-CCTACTCGTGGCAGGTCTACAAGAACTGCGTCGCGCTC  2793606

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  24       TCTCGGCGCCGTCGCTGTCGCGGCGCTCGCG  54
                |||||| ||||  |||||||||||||| |||
Sbjct  1576864  TCTCGGAGCCGGAGCTGTCGCGGCGCTTGCG  1576894

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  144      GCAGGCCAAGCTCGAGAAGCAGG  166
                ||||||||||||| |||||||||
Sbjct  3278146  GCAGGCCAAGCTCAAGAAGCAGG  3278168

>PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.22, whole genome shotgun 
sequence
Length=998868

 Score = 113 bits (124),  Expect = 8e-23
 Identities = 284/424 (67%), Gaps = 31/424 (7%)
 Strand=Plus/Minus

Query  154     CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  213
               || ||||| ||||||| ||||||   ||  ||||||    |||  |  || |  ||||||
Sbjct  687040  CTTGAGAATCAGGGCTTCAAGACGCAGGAGGACTTTCTATCGTGGCGCAATGAGAACAAC  686981

Query  214     TACAAGACCCTCCGCGAGTTCATGGACAA-GCCGGGTGCGTACAAGCCCAACAGCGGCGC  272
               |||||  | || || || |||||||| || ||   || ||   |||   | |||||| ||
Sbjct  686980  TACAAATCTCTTCGTGACTTCATGGATAACGCAAAGTACG---AAGTG-ACCAGCGGTGC  686925

Query  273     AACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGA-AGG--A  329
                  ||||   ||||| || |||||||| || |   |  ||||||| ||||||  |||  |
Sbjct  686924  CGACTTCTCCTGCGGTTTTACGGACCCCAAGGGCACCCCGCAGCCCATTCCGGCAGGTAA  686865

Query  330     CGGC--GCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGAC  387
               || |  ||||||| |      || |||||||| || ||||| || ||  | ||| | |||
Sbjct  686864  CGCCATGCGTTCCACC-----GGATACACGCACGACGGCCCGTGTGAAGTGTGGCTCGAC  686810

Query  388     GACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACT  447
               ||    | |||     | || || || || |||    |  |  | |  |  |  | ||||
Sbjct  686809  GATACTATGGTGCTTGATGGTGAAAACTGTCACGAGAAGTTCCCTGGCAAGGACTACACT  686750

Query  448     GACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGC  507
               |      | ||||||||| |||||||||||||||||| ||||   |||||||||||||| 
Sbjct  686749  G------TGGACTACTCGTCGTGCAAGGGCACGTGCACGCTCCGTTGGTACTGGCTGGGT  686696

Query  508     ATCCGC--CCGACGGGCAAGAGC---TACTCGTGGCAGATCTACAAGGCCTGCATCCCGC  562
               || |||  ||      ||||| |   |||||||||||| | ||||||||||| |||||||
Sbjct  686695  ATTCGCTTCC-----TCAAGAACCAGTACTCGTGGCAGGTGTACAAGGCCTGTATCCCGC  686641

Query  563     TCTC  566
               | ||
Sbjct  686640  TTTC  686637

 Score = 111 bits (122),  Expect = 3e-22
 Identities = 276/415 (67%), Gaps = 17/415 (4%)
 Strand=Plus/Plus

Query  154     CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  213
               || ||||| ||||||| ||||||   ||  ||||| ||  | |  | | | |  |||  |
Sbjct  685450  CTTGAGAACCAGGGCTTCAAGACGCAGGAGGACTTCAAGTCCTGGCGTGACGAGAACGGC  685509

Query  214     TACAAGACCCTCCGCGAGTTCATGGACA-AGCCGGGTGCGTACAAGCCCAACAGCGGCGC  272
               |||||| | || ||||| || ||||||| |||   || ||   |||   | |||||||||
Sbjct  685510  TACAAGTCGCTTCGCGACTTTATGGACAGAGCAAAGTACG---AAGTG-ACCAGCGGCGC  685565

Query  273     AACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGG  332
                  ||||   ||||| || |||||||| || |   |  ||||||| ||||||  || |  
Sbjct  685566  TGACTTCTCCTGCGGTTTTACGGACCCCAAGGGCACCCCGCAGCCCATTCCGGCGGGCAA  685625

Query  333     CGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGT  392
               |||  | ||  |  | || |||||||| || ||||| || ||  | ||| | |||||   
Sbjct  685626  CGCCATGCGTTCCACCGGATACACGCACGATGGCCCGTGTGAAGTGTGGCTCGACGATAC  685685

Query  393     CAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAA  452
                | |||     |||||||||| || |||    |  |  | |  |  |  | |||||    
Sbjct  685686  TATGGTGCTTGACGGCGACAACTGTCACGAGAAGTTCCCTGGCAAGGACTACACTG----  685741

Query  453     GATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCG  512
                 | ||||||||| ||||||||||| |||| | |||    ||||||||||||||  | ||
Sbjct  685742  --TGGACTACTCGTCGTGCAAGGGCTCGTGTACGCTTCGCTGGTACTGGCTGGGTGTGCG  685799

Query  513     ---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTC  564
                  |  || |   ||    |||||||||||| | |||||||| ||||||||||||
Sbjct  685800  TTTCTTGAAG---AACTCGTACTCGTGGCAGGTGTACAAGGCGTGCATCCCGCTC  685851

 Score = 98.7 bits (108),  Expect = 2e-18
 Identities = 195/288 (68%), Gaps = 12/288 (4%)
 Strand=Plus/Minus

Query  276     CTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGC  335
               |||| ||||||| || |||||||| || |   |  ||||||| ||||||  || |  |||
Sbjct  682682  CTTCAAATGCGGTTTTACGGACCCCAAGGGCACCCCGCAGCCCATTCCGGCGGGCAACGC  682623

Query  336     GTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCAG  395
                 | ||  |  | || |||||||| || ||||| || ||  | ||| | |||||    | 
Sbjct  682622  CATGCGTTCCACCGGATACACGCACGATGGCCCGTGTGAAGTGTGGCTCGACGATACTAT  682563

Query  396     GGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAAGAT  455
               |||     |||||||||| || |||    |  |  | |  |  |  | |||||      |
Sbjct  682562  GGTGCTTGACGGCGACAACTGTCACGAGAAGTTCCCTGGCAAGGACTACACTG------T  682509

Query  456     TGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCG---  512
                ||||||||| |||||||||||||||||| |||  | ||||||||||| ||  | ||   
Sbjct  682508  GGACTACTCGTCGTGCAAGGGCACGTGCACGCTTTACTGGTACTGGCTAGGTGTGCGTTT  682449

Query  513     CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCC  560
               || || |   ||   ||||||||||||  | |||||||||||||| ||
Sbjct  682448  CCTGAAG---AACGACTACTCGTGGCAAGTATACAAGGCCTGCATTCC  682404

 Score = 59.0 bits (64),  Expect = 1e-06
 Identities = 145/216 (67%), Gaps = 12/216 (6%)
 Strand=Plus/Plus

Query  349     GGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGC  408
               |||||||| || || || ||||||||  | |   |||| ||   |  |||    || |||
Sbjct  714451  GGGTACACTCACGACGGTCCATGCGAAGTGTACCTTGATGATACCTTGGTGCTCCAAGGC  714510

Query  409     GACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAAGATTGACTACTCGGCG  468
               ||||||||||| |  || ||| |     | ||    |||| |   || ||||||||  ||
Sbjct  714511  GACAATTGCCA-TGAGAAATTCCC----CGGCAAGGACTGCCCC-ATCGACTACTCATCG  714564

Query  469     TGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCG---CCCGACGGGCAAG  525
               ||||| || || ||||  ||    ||||||||| ||||||||||   || || |   || 
Sbjct  714565  TGCAAAGGAACATGCACACTTCGATGGTACTGGTTGGGCATCCGCTTCCTGAAG---AAT  714621

Query  526     AGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCG  561
                  ||||| |||||| | |||||||  ||||| |||
Sbjct  714622  GCGTACTCATGGCAGGTGTACAAGGAATGCATTCCG  714657

>PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_711:1:15030:1 
REF
Length=15030

 Score = 109 bits (120),  Expect = 9e-22
 Identities = 304/457 (67%), Gaps = 26/457 (6%)
 Strand=Plus/Plus

Query  129   CACGAACTGGGGCCCGCAGGCCAAGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTT  188
             |||| ||||||  ||||   ||   ||||||||| | |||   ||||| |  |    | |
Sbjct  5229  CACGTACTGGGCGCCGCTATCCTTCCTCGAGAAGAACGGCGTGAAGACGAGCGAGAGCGT  5288

Query  189   TAACGCGTACCTTAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGG  248
               |||  | | | |||| |||   |||||  || || |||| | |||||||| | | |  
Sbjct  5289  CGACGGCTTCATGAAGGACAAGGGCTACAGCACGCTGCGCGCGCTCATGGACGA-CAGCA  5347

Query  249   TGC-GTACAAGCCCAAC---AGCGGCGCAACCTTCGAATGCGGCTTCACGGACCCAA--A  302
              || ||||||| |||||   | || ||  | ||||   ||||||| ||||||||| |  |
Sbjct  5348  AGCTGTACAAGACCAACTCGAACGCCGACAACTTCCTCTGCGGCTACACGGACCCGAGCA  5407

Query  303   AGCGCCGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGA  362
             || ||   |||||   || || |||||| || |  | |||||| | || |||||||| | 
Sbjct  5408  AGGGCT--CGCAGGTCATCCCCAAGGACAGCACCATGCGCACGACCGGCTACACGCACGT  5465

Query  363   AGGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTT  422
              ||||| |||||| ||||||| |||||||   | ||||    ||||||||| || |||  
Sbjct  5466  GGGCCCGTGCGAGGTCTGGATCGACGACGAGCGTGTCATCGCCGGCGACAACTGTCAC--  5523

Query  423   CGACATTTCGGAGACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTG  482
              ||      | ||  | |   |||   |||| | ||||||      |||||||||  |||
Sbjct  5524  -GA------GCAGGTCTCCAACACGACCAAGGTGGACTACAGCAACTGCAAGGGCGAGTG  5576

Query  483   CA---TGCTCAAGTGGTACTGGCTGGGCATCCGC-CCGACGGGCAAGAGCTACTCGTGGC  538
             ||   ||| |   ||||||||||| ||| | |||  |  |  | ||||  |  |||||||
Sbjct  5577  CACCATGCGC---TGGTACTGGCTCGGCCTGCGCTACCTCAAG-AAGAAGTGGTCGTGGC  5632

Query  539   AGATCTACAAGGCCTGCATCCCGCTCTCGGCCAACGG  575
             || | ||||||  ||||||| ||||| ||| | ||||
Sbjct  5633  AGGTGTACAAGAACTGCATCGCGCTCACGGGCGACGG  5669

 Score = 94.2 bits (103),  Expect = 7e-17
 Identities = 154/219 (70%), Gaps = 5/219 (2%)
 Strand=Plus/Plus

Query  154   CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGCCAACAAC  213
             ||||||   ||||||||||||  |||||| || || | |||||||   ||| | ||   |
Sbjct  3636  CTCGAGGGCCAGGGCTACAAGTGCACGGCGGATTTCACCGCGTACTACAAGTCGAAGGGC  3695

Query  214   TACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACAGCGGCGCA  273
             ||||||| ||| ||||  ||||||||| |   |   |||||||||  | |   |||||  
Sbjct  3696  TACAAGAACCTGCGCGGTTTCATGGACGACAAGAAGGCGTACAAGGTCGA---CGGCGGT  3752

Query  274   ACCTTCGAATGCGGCTTCACGGACCCAAAAGCGC-CGGCGCAGCCGATTCCGAAGGACGG  332
             |  || || |||||||  | |  | |  ||| || || |||||||||| |||  || |||
Sbjct  3753  AATTTTGAGTGCGGCTGGA-GCTCGCTCAAGGGCACGCCGCAGCCGATCCCGGCGGGCGG  3811

Query  333   CGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATG  371
              ||  ||||| || | || |||||||| || ||||| ||
Sbjct  3812  TGCTCTCCGCTCGACGGGCTACACGCACGACGGCCCGTG  3850

 Score = 77.9 bits (85),  Expect = 5e-12
 Identities = 124/173 (72%), Gaps = 9/173 (5%)
 Strand=Plus/Plus

Query  154   CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGC--CAACA  211
             || ||||| ||||||| |||||||||||| || ||  | || |||  ||  ||  |||  
Sbjct  1129  CTGGAGAACCAGGGCTTCAAGACCACGGCGGATTTCGAAGCCTAC--TACCGCGACAAGG  1186

Query  212   ACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACAGCGGCG  271
              |||||||||||| ||||| ||||||||| | | |   || ||||||  | || |||| |
Sbjct  1187  GCTACAAGACCCTGCGCGACTTCATGGACGACCAGACCGCCTACAAGGTCGACGGCGGTG  1246

Query  272   CAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGC-CGGCGCAGCCGATTCC  323
                 ||| || |||||||  | | || |  ||| || || |||||||||| ||
Sbjct  1247  ---ACTTTGAGTGCGGCTGGA-GCACGCTCAAGGGCACGCCGCAGCCGATCCC  1295

 Score = 69.8 bits (76),  Expect = 8e-10
 Identities = 200/306 (65%), Gaps = 9/306 (3%)
 Strand=Plus/Plus

Query  261    CAACAGCGGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGAT  320
              ||||| || | ||| ||| || ||||||| ||||||||| |       | ||||||| ||
Sbjct  10966  CAACATCGACTCAATCTTTGAGTGCGGCTACACGGACCCGACGTACGAGTCGCAGCCTAT  11025

Query  321    TCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTG  380
               ||||   |||||  | | ||     |||| |||| | | || || || |||||||||||
Sbjct  11026  CCCGACAAACGGCAAGCTGCGTTTCACAGGCTACATGAAGGACGGGCCGTGCGAGATCTG  11085

Query  381    GATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGC  440
              ||| |||||| ||| | |      | | |  || ||| |    ||| |  |||    | |
Sbjct  11086  GATCGACGACCTCAAGCTGCTCTCCAGTGCGAACTGCAAGAAGGACTTCCCGG---GCAC  11142

Query  441    GTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTG  500
              |  |||    ||  | |||||||||   |||||||||  ||||| |||    ||||||  
Sbjct  11143  GAGCAC---AAAACTCGACTACTCGAGCTGCAAGGGCGAGTGCACGCTGCGCTGGTACGC  11199

Query  501    GCTGGGCATCCGC---CCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCAT  557
              |||| || |  ||    ||||||||      ||||||||| || ||||||||  |||| |
Sbjct  11200  GCTGAGCGTGAGCAAGACGACGGGCGGCTCGTACTCGTGGGAGGTCTACAAGAACTGCGT  11259

Query  558    CCCGCT  563
              | ||||
Sbjct  11260  CGCGCT  11265

>PHSO:scaffold_4
Length=7609242

 Score = 105 bits (116),  Expect = 1e-20
 Identities = 200/293 (68%), Gaps = 15/293 (5%)
 Strand=Plus/Plus

Query  213      CTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACAGCGGCGC  272
                |||||||||||| ||||| |||||||||   |  ||   ||||| |   | ||  |||||
Sbjct  4365081  CTACAAGACCCTGCGCGACTTCATGGAC---CATGGCAAGTACACGGTGACCAAGGGCGC  4365137

Query  273      AACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGG  332
                   ||||   ||||| |  || ||||| || |   |  ||||||| |||||| | |  | 
Sbjct  4365138  CGACTTCTCTTGCGGTTGGACCGACCCCAAGGGCACCCCGCAGCCCATTCCGGACGGAGA  4365197

Query  333      CGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGT  392
                |||  | ||| |  | || ||||| || || || || |||||| ||||||| ||| ||  
Sbjct  4365198  CGCCATGCGCTCCACGGGCTACACCCACGATGGTCCGTGCGAGGTCTGGATCGACAACAC  4365257

Query  393      CAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTG---A  449
                  | ||   ||| |||||||| |||||   |||      | ||| |||   ||  |   |
Sbjct  4365258  GCGCGTGCTGCAGGGCGACAACTGCCA---CGA------GAAGATCGCCGACAAGGGCTA  4365308

Query  450      CAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGC  502
                || ||| ||||||||||| || ||||||||||||| ||||   ||||||||||
Sbjct  4365309  CACGATCGACTACTCGGCTTGTAAGGGCACGTGCACGCTCCGTTGGTACTGGC  4365361

 Score = 105 bits (116),  Expect = 1e-20
 Identities = 200/293 (68%), Gaps = 15/293 (5%)
 Strand=Plus/Minus

Query  213      CTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACAGCGGCGC  272
                |||||||||||| ||||| |||||||||   |  ||   ||||| |   | ||  |||||
Sbjct  4374212  CTACAAGACCCTGCGCGACTTCATGGAC---CATGGCAAGTACACGGTGACCAAGGGCGC  4374156

Query  273      AACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGG  332
                   ||||   ||||| |  || ||||| || |   |  ||||||| |||||| | |  | 
Sbjct  4374155  CGACTTCTCTTGCGGTTGGACCGACCCCAAGGGCACCCCGCAGCCCATTCCGGACGGAGA  4374096

Query  333      CGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGT  392
                |||  | ||| |  | || ||||| || || || || |||||| ||||||| ||| ||  
Sbjct  4374095  CGCCATGCGCTCCACGGGCTACACCCACGATGGTCCGTGCGAGGTCTGGATCGACAACAC  4374036

Query  393      CAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTG---A  449
                  | ||   ||| |||||||| |||||   |||      | ||| |||   ||  |   |
Sbjct  4374035  GCGCGTGCTGCAGGGCGACAACTGCCA---CGA------GAAGATCGCCGACAAGGGCTA  4373985

Query  450      CAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGC  502
                || ||| ||||||||||| || ||||||||||||| ||||   ||||||||||
Sbjct  4373984  CACGATCGACTACTCGGCTTGTAAGGGCACGTGCACGCTCCGTTGGTACTGGC  4373932

>PHCA:scaffold_84 PHYCAscaffold_84
Length=182275

 Score = 102 bits (112),  Expect = 1e-19
 Identities = 246/365 (67%), Gaps = 22/365 (6%)
 Strand=Plus/Minus

Query  207    CAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGC---GTACAAGCCCAA  263
              ||||  ||||||||| || ||||  |||||||||      |||||   |||||    || 
Sbjct  94091  CAACGGCTACAAGACTCTGCGCGCCTTCATGGAC------GGTGCCAAGTACACTGTCA-  94039

Query  264    CAG-CGGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTC  322
              ||| ||| ||   || | | |||||||||||| || | || ||  |  ||||||| ||||
Sbjct  94038  CAGACGGAGCTGACTACTATTGCGGCTTCACGAACGCCAAGGCAGCTCCGCAGCCCATTC  93979

Query  323    CGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGA  382
              ||   || ||| |  | ||  || | ||||||||||| || || || |||||| | ||| 
Sbjct  93978  CG---GATGGCACAATGCGTTCGACCGGGTACACGCACGATGGTCCGTGCGAGGTTTGGC  93922

Query  383    TTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGT  442
              | |||  |    | |||   ||    ||||| ||||||   ||| || | | |   |   
Sbjct  93921  TCGACTCCACGCGCGTCCTCCAGTCGGACAACTGCCACGA-GACGTTCCCGGGCAAG---  93866

Query  443    TCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGC  502
                ||  ||||  | ||||||    ||||||||||| ||||||||||    ||||||||| 
Sbjct  93865  --ACGTACAACCTGGACTACAGCTCGTGCAAGGGCTCGTGCATGCTGCGTTGGTACTGGT  93808

Query  503    TGGGCATCCGC-CCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCG  561
              |||| |  |||  |  |  | | |||| ||||||||||| | |||||||||||||| || 
Sbjct  93807  TGGGAACGCGCTTCCTCAAGAACGAGC-ACTCGTGGCAGGTGTACAAGGCCTGCATTCCT  93749

Query  562    CTCTC  566
              || ||
Sbjct  93748  CTTTC  93744

 Score = 60.8 bits (66),  Expect = 4e-07
 Identities = 172/259 (66%), Gaps = 8/259 (3%)
 Strand=Plus/Plus

Query  312    GCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATG  371
              |||| | |||||| | | |  |||  | ||| |  | ||||||||||| || || || ||
Sbjct  92974  GCAGGCCATTCCGGACGCCAACGCAATGCGCTCAACCGGGTACACGCACGACGGTCCGTG  93033

Query  372    CGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTC  431
              |||  | ||| | |||||    | ||||| |||   |||||| || |||   |  ||   
Sbjct  93034  CGAAGTGTGGCTGGACGATACGATGGTCATGCAGTACGACAACTGTCACGAGGCTATC--  93091

Query  432    GGAGACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAA  491
                || | ||    ||| |||  || ||||||    | |||| |  ||| |||| | |  |
Sbjct  93092  --AG-CGGCAAGGACT-ACACCATAGACTACAGTTCTTGCACGTCCACCTGCACGTTATA  93147

Query  492    GTGGTACTGGCTGGGCATCCGCC-CGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGG  550
               |||| |||||| ||  ||||   |  |  | | ||| ||||||||||||||||||||||
Sbjct  93148  CTGGTTCTGGCTCGGTGTCCGGTACCTCAAGAACGAG-TACTCGTGGCAGATCTACAAGG  93206

Query  551    CCTGCATCCCGCTCTCGGC  569
              ||||  | ||||| || ||
Sbjct  93207  CCTGTGTGCCGCTTTCCGC  93225

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 190/286 (66%), Gaps = 18/286 (6%)
 Strand=Plus/Minus

Query  276    CTTCGAATGCGGCTTCACG-GACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCG  334
              ||| || |||||| ||||| | ||||| | ||  | ||||||| || ||||   ||  | 
Sbjct  95508  CTTTGAGTGCGGCCTCACGAGTCCCAAGACCGA-GACGCAGCCCATCCCGACCAACAACT  95450

Query  335    CGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCA  394
              ||||||  || || || ||||| |  || ||||| |||||| ||||| | ||||||   |
Sbjct  95449  CGTTCCAGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTA  95390

Query  395    --GGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAA  452
                | |||  ||  | || ||| ||||||  |||  |  || ||     | |||   || |
Sbjct  95389  AAGTGTCT-GCGGGCCG-CAACTGCCACACCGAATTCCCGCAG-----GGTCAGC-ACCA  95338

Query  453    GATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATC-C  511
              | | ||||||    |||||   |   | |||| | |   |||||||||||| ||||||  
Sbjct  95337  GGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAA  95278

Query  512    GCCCGACGGGCAAG--AGCTACTCGTGGCAGATCTACAAGGCCTGC  555
              |  || ||   |||  | ||||||||||||  | ||||||  ||||
Sbjct  95277  GTACGTCG---AAGGAATCTACTCGTGGCAAGTGTACAAGAACTGC  95235

>PHRA:scaffold_56
Length=334739

 Score = 100 bits (110),  Expect = 5e-19
 Identities = 289/432 (67%), Gaps = 41/432 (9%)
 Strand=Plus/Plus

Query  154     CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGC-CAACAA  212
               || ||||| ||||||| | |||||  ||  ||||| |||||||  |    | | || |||
Sbjct  162619  CTGGAGAACCAGGGCTTCGAGACCGTGGGGGACTTCAACGCGTGGC----GCCGCAGCAA  162674

Query  213     C---TACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGC---GTACAAGCCCAACAG  266
               |   |||||||| |||||||  |||||||||      |||||   |||||    |     
Sbjct  162675  CGGGTACAAGACGCTCCGCGCCTTCATGGAC------GGTGCCAAGTACACTGTCGCGGA  162728

Query  267     CGGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAA  326
               ||| ||   || | | |||||||||||| || |  | ||  || | ||| | ||||||  
Sbjct  162729  CGGAGCCGACTACTACTGCGGCTTCACGAACGCCGACGCCACGCCACAGGCCATTCCG--  162786

Query  327     GGACGG---CGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGAT  383
                |||||   |||  | ||| || | || |||||||| || ||||| |||||| ||||| |
Sbjct  162787  -GACGGTAACGCTATGCGCTCGACGGGCTACACGCACGACGGCCCGTGCGAGGTCTGGCT  162845

Query  384     TGACG--ACGTCAGGG-TCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGC  440
                |||   |||   | | |||  ||||   |||| ||||||   | |||     || | ||
Sbjct  162846  CGACACCACGCGCGTGCTCACCCACG---ACAACTGCCACGAGGCCATC----AG-CGGC  162897

Query  441     GTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTG  500
                   ||| |||  || ||||||    |||||| ||| || ||||  ||  | ||||||||
Sbjct  162898  AAGGACT-ACACCATCGACTACAGTTCGTGCACGGGTACCTGCACACTGCACTGGTACTG  162956

Query  501     GCTGGGCATCCGCCCGACGGGCAAGAGC---TACTCGTGGCAGATCTACAAGGCCTGCAT  557
               | ||||| | |||   ||   ||||| |   ||||| |||||| | |||||||||||  |
Sbjct  162957  GATGGGCGTGCGCT--ACCT-CAAGAACGCGTACTCCTGGCAGGTGTACAAGGCCTGTGT  163013

Query  558     CCCGCTCTCGGC  569
                |||||||||||
Sbjct  163014  GCCGCTCTCGGC  163025

 Score = 97.8 bits (107),  Expect = 6e-18
 Identities = 199/291 (68%), Gaps = 10/291 (3%)
 Strand=Plus/Plus

Query  276     CTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGC  335
               |||||| |||||  |||||  ||| ||| |     ||||||  || ||||   || || |
Sbjct  161152  CTTCGACTGCGGACTCACGAGCCCCAAAACTGAAACGCAGCTCATCCCGACCAACAGCTC  161211

Query  336     GTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCAG  395
               |||||   |||| || |||||||  || ||||| || ||| ||||| | ||||||  || 
Sbjct  161212  GTTCCAGTCGTCGGGCTACACGCTCGACGGCCCGTGTGAGGTCTGGCTGGACGACACCAA  161271

Query  396     GGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAAGAT  455
               ||    |   |||  ||| ||||||  |||  |  || |     ||  ||   || ||||
Sbjct  161272  GGCGGCGGCGGGCCGCAACTGCCACACCGAGTTCCCGCA-----CGGCCAGC-ACCAGAT  161325

Query  456     TGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATC-CGCC  514
                |||||    ||||||   | | |||||||||||  |||||||||||| ||||||  |  
Sbjct  161326  CGACTATAGCGCGTGCGGAGCCGCGTGCATGCTCCGGTGGTACTGGCTCGGCATCAAGTA  161385

Query  515     CGACGGGCAAGAGC-TACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTC  564
               || |  | | | || |||||||||||| ||||||||  ||||||| |||||
Sbjct  161386  CGTC--GAAGGCGCGTACTCGTGGCAGGTCTACAAGAACTGCATCGCGCTC  161434

>PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_98.1_contig_1:1:103693:1 
REF
Length=103693

 Score = 96.0 bits (105),  Expect = 2e-17
 Identities = 209/305 (69%), Gaps = 10/305 (3%)
 Strand=Plus/Plus

Query  267    CGGCGCAACCTTCGAATGCGGCTTCACGGAC-CCAAAAGCGCCGGCGCAGCCGATTCCGA  325
              ||||||   ||||   |||||||||||||||  |||  ||| | || ||||| || ||  
Sbjct  57684  CGGCGCTGACTTCACCTGCGGCTTCACGGACATCAATGGCG-CAGCCCAGCCCATCCCAG  57742

Query  326    AGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTG  385
              | |||   ||  | ||  || | || ||||||||||| || || |||||| | ||| | |
Sbjct  57743  ACGACAATGCCATGCGTTCGACGGGTTACACGCATGACGGTCCCTGCGAGGTGTGGCTGG  57802

Query  386    ACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCA  445
              ||||    | ||||| |||   | |||||||||||  |  ||  || | |   ||    |
Sbjct  57803  ACGATACGATGGTCATGCAGTACAACAATTGCCACGACTCCA--TCAGTG---GCAAGGA  57857

Query  446    CTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
              || |||  |||||||||    |||| | |   || || | |||| | |||| |||| |||
Sbjct  57858  CT-ACACTATTGACTACAGCTCGTGTACGTCTACTTGTACGCTCTACTGGTTCTGGATGG  57916

Query  506    GCATCCGC-CCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTC  564
              || |||||     |  | | ||| |||||||||||| | |||||||| ||| | ||||||
Sbjct  57917  GCGTCCGCTATCTCAAGAACGAG-TACTCGTGGCAGGTGTACAAGGCGTGCGTGCCGCTC  57975

Query  565    TCGGC  569
              |||||
Sbjct  57976  TCGGC  57980

 Score = 67.1 bits (73),  Expect = 1e-08
 Identities = 88/120 (73%), Gaps = 8/120 (7%)
 Strand=Plus/Minus

Query  454    ATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCG-  512
              ||||||||     |||||| |||||| ||||  ||    ||||||||| ||||| |||| 
Sbjct  58814  ATTGACTATAGTTCGTGCACGGGCACATGCACCCTGCGCTGGTACTGGTTGGGCGTCCGT  58755

Query  513    ---CCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTCTCGGC  569
                 | | |   | | ||| |||||||||||| | |||||||| ||| |||||||||| ||
Sbjct  58754  TTTCTCAA---GAACGAG-TACTCGTGGCAGGTGTACAAGGCGTGCGTCCCGCTCTCTGC  58699

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 56/80 (70%), Gaps = 0/80 (0%)
 Strand=Plus/Minus

Query  479    CGTGCATGCTCAAGTGGTACTGGCTGGGCATCCGCCCGACGGGCAAGAGCTACTCGTGGC  538
              |||||| | |   |||||| ||||| ||  ||      |||| | || | ||||||||||
Sbjct  60515  CGTGCACGTTGTGGTGGTATTGGCTCGGTGTCAAGTATACGGACGAGGGATACTCGTGGC  60456

Query  539    AGATCTACAAGGCCTGCATC  558
              || | ||||||  |||| ||
Sbjct  60455  AGGTTTACAAGAACTGCGTC  60436

>PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.63, whole genome shotgun 
sequence
Length=342508

 Score = 92.4 bits (101),  Expect = 2e-16
 Identities = 178/257 (69%), Gaps = 12/257 (5%)
 Strand=Plus/Plus

Query  313     CAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGC  372
               ||||| |||||| | | |  |||  | ||  || | ||||||||||| || ||||| || 
Sbjct  242224  CAGCCCATTCCGGATGGCAACGCTATGCGTTCGACTGGGTACACGCACGACGGCCCGTGT  242283

Query  373     GAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCG  432
               ||| | ||| | ||||||  || ||||| |||   |||||| |||||    | ||  || 
Sbjct  242284  GAGGTGTGGCTGGACGACACCATGGTCATGCAGTACGACAACTGCCATGAAGCCA--TCA  242341

Query  433     GAGACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAG  492
               | |   ||    ||| ||| ||| |||||     |||||| |  ||| ||||  ||| | 
Sbjct  242342  GTG---GCAAATACT-ACACGATCGACTATAGCTCGTGCACGTCCACCTGCACACTCTAT  242397

Query  493     TGGTACTGGCTGGGCATCCGCCCGACGGGCAAGAGC---TACTCGTGGCAGATCTACAAG  549
               |||| |||||||||  ||||  | ||  | |||| |   |||||||||||||| ||||||
Sbjct  242398  TGGTTCTGGCTGGGTGTCCG--CTACCTG-AAGAACGAATACTCGTGGCAGATTTACAAG  242454

Query  550     GCCTGCATCCCGCTCTC  566
               |||||  |||| || ||
Sbjct  242455  GCCTGTGTCCCCCTTTC  242471

 Score = 84.2 bits (92),  Expect = 4e-14
 Identities = 97/128 (76%), Gaps = 6/128 (5%)
 Strand=Plus/Minus

Query  445     ACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTG  504
               ||| ||||  ||||||||    ||||||  || || ||||  ||    ||||||||||||
Sbjct  243144  ACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTG  243085

Query  505     GGCATCCGCCCGACGGGCAAGAG---CTACTCGTGGCAGATCTACAAGGCCTGCATCCCG  561
               ||| | |||   ||   |||||    |||||||||||||||||||||||| |||||||||
Sbjct  243084  GGCGTACGCT--ACCT-CAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCG  243028

Query  562     CTCTCGGC  569
               || |||||
Sbjct  243027  CTTTCGGC  243020

 Score = 44.6 bits (48),  Expect = 0.032
 Identities = 163/248 (66%), Gaps = 12/248 (5%)
 Strand=Plus/Minus

Query  311     CGCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCAT  370
               ||||||| || ||||   ||  | ||||||  ||||| || || ||||  || ||||| |
Sbjct  244953  CGCAGCCTATCCCGACAAACAACTCGTTCCAGACGTCGGGATATACGCTGGATGGCCCGT  244894

Query  371     GCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTT  430
               ||||| ||||| | ||||||   | |||       |||  ||| ||||||  |||   ||
Sbjct  244893  GCGAGGTCTGGCTGGACGACACGAAGGTGTCCTCGGGCCGCAACTGCCACACCGAA--TT  244836

Query  431     CGGAGACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCA--CGTGCATGCT  488
               |    || ||   || |||   | | ||||||    | |||  ||| |  ||||||  ||
Sbjct  244835  CCCTCACGGCCAGCA-TGA---GGTCGACTACAGCTCATGC--GGGAAGGCGTGCACACT  244782

Query  489     CAAGTGGTACTGGCTGGGCATCC-GCCCGACGGGCAAGAGCTACTCGTGGCAGATCTACA  547
               |  |||||| ||||| |||||   |  |   | |  | | ||||||||||||| ||||||
Sbjct  244781  CTCGTGGTATTGGCTCGGCATTAAGTACATTGAGGGA-ATCTACTCGTGGCAGGTCTACA  244723

Query  548     AGGCCTGC  555
               ||  ||||
Sbjct  244722  AGAACTGC  244715

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 65/91 (71%), Gaps = 8/91 (9%)
 Strand=Plus/Minus

Query  154     CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGC-CAACAA  212
               || ||||| ||||| ||| |||||   |  || || |||| ||  |    | | ||||||
Sbjct  243423  CTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGC----GCCGCAACAA  243368

Query  213     C---TACAAGACCCTCCGCGAGTTCATGGAC  240
               |   ||||||||||| || || |||||||||
Sbjct  243367  CGGGTACAAGACCCTGCGTGACTTCATGGAC  243337

>PYAP:scaffold_182 pag1_scaffold_182 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_182:1:48098:1 
REF
Length=48098

 Score = 78.8 bits (86),  Expect = 2e-12
 Identities = 88/118 (75%), Gaps = 0/118 (0%)
 Strand=Plus/Plus

Query  443   TCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGC  502
             ||| | ||||||| |||| |||   ||| ||||||   |||||| ||   ||||||||||
Sbjct  1822  TCAGTTACAAGATCGACTTCTCCAAGTGTAAGGGCGACTGCATGATCCGCTGGTACTGGC  1881

Query  503   TGGGCATCCGCCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCC  560
             | ||||| ||||     |||||||  |  ||||||||| | |||||||| || |||||
Sbjct  1882  TCGGCATGCGCCTACTCGGCAAGAAGTGGTCGTGGCAGGTGTACAAGGCGTGTATCCC  1939

>PHSO:scaffold_12
Length=2105860

 Score = 77.9 bits (85),  Expect = 5e-12
 Identities = 299/456 (66%), Gaps = 33/456 (7%)
 Strand=Plus/Minus

Query  154     CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGC-GTACCTTAAGGCCAACAA  212
               ||||||||| |||| | ||||||   ||   |||| | ||| |||||   ||| | ||||
Sbjct  167517  CTCGAGAAGGAGGGATTCAAGACGCAGGAGAACTTCA-CGCAGTACC---AGGTCGACAA  167462

Query  213     ---CTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACAGCGG  269
                  ||||||||  |||||||| |||||||| | | |      ||||||||  |     ||
Sbjct  167461  TGGCTACAAGAGTCTCCGCGACTTCATGGAGAGGGCCAA---GTACAAGCTGACGGATGG  167405

Query  270     CGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGA  329
                ||   |   |  ||||| |  || ||||| || |      |||| | ||| ||  ||||
Sbjct  167404  AGCCGACCAGGCCTGCGGATGGACCGACCCCAAGGGAATCCCGCAACAGATCCCCGAGGA  167345

Query  330     CGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGA  389
               |||| || | |||||||| || ||||| || || || || || |||||||  || | |||
Sbjct  167344  CGGCACGATGCGCACGTCGGGCTACACCCACGACGGACCGTGTGAGATCTACATGGGCGA  167285

Query  390     CGTCAGGGTCAAGCACGG-CGACAATTGCCACT--TCGA-CATTTCGGAGACCGCGTTCA  445
               |     || |   | ||  |  ||| ||||||   |||| || |    ||||   |||||
Sbjct  167284  CAAGCTGGCCCT-CTCGTACCTCAACTGCCACGAGTCGATCACTGACCAGAC---GTTCA  167229

Query  446     CTGACAAGATTGACTACT-CGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTG  504
                     || | ||||||  |||| |||  ||  |  ||||| ||  | ||||||||||||
Sbjct  167228  ------AGCTGGACTACAGCGGC-TGCGGGGATAGCTGCATCCTGTACTGGTACTGGCTG  167176

Query  505     GGCATCCGC---CCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCG  561
               ||| | ||    | || |||||||   | |||||||||  | |||||||  |||||||||
Sbjct  167175  GGCGTGCGTAAGCTGAAGGGCAAG---TTCTCGTGGCAAGTGTACAAGGAGTGCATCCCG  167119

Query  562     CTCTCGGCCAACGGTGGCGGCGCTGCTGCGGCACCG  597
               ||||   |   |  |||||||| || ||  ||||||
Sbjct  167118  CTCTACTCTGGCTCTGGCGGCGGTGGTGGTGCACCG  167083

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 82/116 (71%), Gaps = 3/116 (3%)
 Strand=Plus/Minus

Query  450     CAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCAT  509
               |||| | ||||||   ||||||   | ||  ||| || |  | ||||||||||||||| |
Sbjct  162035  CAAGCTGGACTACAGCGCGTGCGGAGACAGCTGCGTGTTGTACTGGTACTGGCTGGGCGT  161976

Query  510     CCGCCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTCT  565
                |||   |    |||| ||  ||||| |||| | |||||||  ||||||||| |||
Sbjct  161975  GCGCTTCA---TCAAGGGCATCTCGTAGCAGGTGTACAAGGAGTGCATCCCGATCT  161923

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 44/54 (81%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  280    GAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
              || ||||| ||||||||||| || |   || ||||||| ||||||| |||||||
Sbjct  95276  GACTGCGGTTTCACGGACCCGAACGGCACGCCGCAGCCCATTCCGACGGACGGC  95329

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 44/54 (81%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  280    GAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
              || ||||| ||||||||||| || |   || ||||||| ||||||| |||||||
Sbjct  97688  GACTGCGGTTTCACGGACCCGAACGGCACGCCGCAGCCCATTCCGACGGACGGC  97741

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 123/185 (66%), Gaps = 5/185 (3%)
 Strand=Plus/Minus

Query  207     CAACAACTACAAGACCCTCCGCGAGTTCATGGACAA-GCCGGGTGCGTACAAGCCCAACA  265
               ||||  |||||||| ||| || || ||||||||||| |||      ||||| |  ||   
Sbjct  168765  CAACGGCTACAAGAGCCTGCGTGATTTCATGGACAACGCC----AAGTACACGGTCACGG  168710

Query  266     GCGGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGA  325
                 || ||   |   |  ||||| |  || ||||| || |     || |||| ||||||  
Sbjct  168709  AAGGAGCCGACCAGGCCTGCGGATGGACCGACCCCAAGGGCATCGCCCAGCAGATTCCAT  168650

Query  326     AGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTG  385
                ||||||  |  | || ||||| || ||||| || || ||||| ||||||||||  || |
Sbjct  168649  CGGACGGAACCATGCGTACGTCGGGCTACACCCACGACGGCCCCTGCGAGATCTACATGG  168590

Query  386     ACGAC  390
                ||||
Sbjct  168589  GCGAC  168585

 Score = 47.3 bits (51),  Expect = 0.009
 Identities = 51/68 (75%), Gaps = 0/68 (0%)
 Strand=Plus/Minus

Query  493     TGGTACTGGCTGGGCATCCGCCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCC  552
               ||||||||||||||| | |||        ||| |  |||||||||||| | |||||||  
Sbjct  168488  TGGTACTGGCTGGGCGTGCGCTTCCTCAACAACAAGTACTCGTGGCAGGTGTACAAGGAG  168429

Query  553     TGCATCCC  560
               ||||||||
Sbjct  168428  TGCATCCC  168421

 Score = 47.3 bits (51),  Expect = 0.009
 Identities = 125/184 (68%), Gaps = 8/184 (4%)
 Strand=Plus/Minus

Query  206     CCAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTAC-AAGCCCAAC  264
               |||||  || |||||| |||||||| |||||||||||  |||   | |||  || |  ||
Sbjct  210390  CCAACGGCTTCAAGACTCTCCGCGACTTCATGGACAA--CGGCAAC-TACTCAGTC--AC  210336

Query  265     AGC-GGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCC  323
                 | || ||    |  |  |||||||  || |||| ||||| |    |||| | ||||||
Sbjct  210335  GTCGGGGGCTGATTAAGCGTGCGGCTGGACCGACCTAAAAG-GAGTCCGCAACAGATTCC  210277

Query  324     GAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGAT  383
                 | ||   |    | ||||| |  || ||||| | ||| |||||||||||||||||| |
Sbjct  210276  AGACGATAACATCATGCGCACATACGGCTACACCCGTGACGGCCCATGCGAGATCTGGCT  210217

Query  384     TGAC  387
                |||
Sbjct  210216  GGAC  210213

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  207     CAACAACTACAAGACCCTCCGCGAGTTCATGGACAA  242
               ||||  ||||||||  || ||||| |||||||||||
Sbjct  162269  CAACGGCTACAAGAGTCTGCGCGACTTCATGGACAA  162234

>PHKE:scaffold_761 scf_22126_761.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_761.1_contig_1:1:9298:1 
REF
Length=9298

 Score = 75.2 bits (82),  Expect = 2e-11
 Identities = 193/287 (67%), Gaps = 18/287 (6%)
 Strand=Plus/Minus

Query  283  TGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGC  342
            |||||||  || ||||| || |   |||| || || || ||  |||  || ||  | |||
Sbjct  663  TGCGGCTGGACCGACCCCAACGGCACGGCACAACCAATCCCAGAGGGGGGTGCCATGCGC  604

Query  343  ACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAG  402
             |  |||| ||||||||||| || ||||| ||| ||||||| ||| ||    | ||   |
Sbjct  603  TCCACAGGCTACACGCATGATGGTCCATGTGAGGTCTGGATCGACAACACGCGCGTGCTG  544

Query  403  CACGGCGACAATTGCCACTTCGAC-ATTTCGGAGACCGCGTTCACTGACAAGATTGACTA  461
             |  | |  |||||||||   ||| ||  | | ||  |     ||| |||  || |||||
Sbjct  543  GAAAGTGGTAATTGCCAC-GAGACGATCACTG-GAAAG----GACT-ACACCATCGACTA  491

Query  462  CTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCGC--CCGACG  519
             || || ||  | ||||| ||||||||    ||||||||| ||||  | |||  ||    
Sbjct  490  TTCTGCCTGTCAAGGCACCTGCATGCTGCGCTGGTACTGGTTGGGTGTTCGCTTCC----  435

Query  520  GGCAAGAGC---TACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
              ||||| |   |||||||||||| | ||||| ||||||||||| ||
Sbjct  434  -TCAAGAACTCTTACTCGTGGCAGGTGTACAAAGCCTGCATCCCACT  389

>PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 
genomic scaffold, whole genome shotgun sequence
Length=695754

 Score = 75.2 bits (82),  Expect = 2e-11
 Identities = 81/107 (76%), Gaps = 8/107 (7%)
 Strand=Plus/Minus

Query  467     CGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCG----CCCGACGGGC  522
               ||||||||||||| |||| |||    ||||||||||| ||  | ||    | | |     
Sbjct  358785  CGTGCAAGGGCACCTGCACGCTACGCTGGTACTGGCTTGGTGTGCGTTTTCTCAAA----  358730

Query  523     AAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTCTCGGC  569
               ||   |||||||||||||||||||||||| ||||||||||| |||||
Sbjct  358729  AACGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCTTTCGGC  358683

>PHRA:scaffold_33
Length=496317

 Score = 74.3 bits (81),  Expect = 7e-11
 Identities = 175/259 (68%), Gaps = 18/259 (7%)
 Strand=Plus/Plus

Query  311     CGCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCAT  370
               |||||| ||| ||  |||||||| |  | |||||||| || |||||||| || || || |
Sbjct  370820  CGCAGCAGATCCCAGAGGACGGCACCATGCGCACGTCGGGATACACGCACGACGGTCCGT  370879

Query  371     GCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGG-CGACAATTGCCACT--TCGACA  427
               |||||||||  || |  |||     || ||  | ||  |  ||| ||||||   ||||  
Sbjct  370880  GCGAGATCTACATGGGGGACAAGTTGG-CACTCTCGTACCTCAACTGCCACGAGTCGA--  370936

Query  428     TTTCGGAGACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGC  487
               |  ||||     ||||||      || | ||||||   |  ||   ||  |  ||||| |
Sbjct  370937  TCACGGACCAAACGTTCA------AGTTGGACTACAGCGGATGTGGGGATAGCTGCATCC  370990

Query  488     TCAAGTGGTACTGGCTGGGCATCCG---CCCGACGGGCAAGAGCTACTCGTGGCAGATCT  544
               |  | ||||||||||||||  | ||   || || |||||   |||||||||||||| | |
Sbjct  370991  TGTACTGGTACTGGCTGGGTGTGCGATACCTGAAGGGCA---GCTACTCGTGGCAGGTGT  371047

Query  545     ACAAGGCCTGCATCCCGCT  563
               ||||||  |||||||||||
Sbjct  371048  ACAAGGAATGCATCCCGCT  371066

 Score = 58.1 bits (63),  Expect = 5e-06
 Identities = 65/86 (76%), Gaps = 6/86 (7%)
 Strand=Plus/Minus

Query  481     TGCATGCTCAAGTGGTACTGGCTGGGCATCCG---CCCGACGGGCAAGAGCTACTCGTGG  537
               ||||| ||  | ||||||||||||||    ||   || || |||||   |||||||||||
Sbjct  171140  TGCATCCTGTACTGGTACTGGCTGGGTGCGCGATACCTGAAGGGCA---GCTACTCGTGG  171084

Query  538     CAGATCTACAAGGCCTGCATCCCGCT  563
               ||| | |||||||  ||||||| |||
Sbjct  171083  CAGGTGTACAAGGAATGCATCCTGCT  171058

 Score = 58.1 bits (63),  Expect = 5e-06
 Identities = 65/86 (76%), Gaps = 6/86 (7%)
 Strand=Plus/Minus

Query  481     TGCATGCTCAAGTGGTACTGGCTGGGCATCCG---CCCGACGGGCAAGAGCTACTCGTGG  537
               ||||| ||  | ||||||||||||||    ||   || || |||||   |||||||||||
Sbjct  175499  TGCATCCTGTACTGGTACTGGCTGGGTGCGCGATACCTGAAGGGCA---GCTACTCGTGG  175443

Query  538     CAGATCTACAAGGCCTGCATCCCGCT  563
               ||| | |||||||  ||||||| |||
Sbjct  175442  CAGGTGTACAAGGAATGCATCCTGCT  175417

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 43/54 (80%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  280     GAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
               || ||||| |||||||||||  | | | |  ||||||| ||||||| |||||||
Sbjct  430760  GACTGCGGTTTCACGGACCCGGACGGGACCCCGCAGCCCATTCCGACGGACGGC  430707

>PHCA:scaffold_67 PHYCAscaffold_67
Length=292061

 Score = 74.3 bits (81),  Expect = 7e-11
 Identities = 60/73 (82%), Gaps = 0/73 (0%)
 Strand=Plus/Minus

Query  311     CGCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCAT  370
               |||||| ||| |||  ||||||| |  | |||||||| || |||||||| || ||||| |
Sbjct  220606  CGCAGCAGATCCCGTCGGACGGCACCATGCGCACGTCGGGATACACGCACGATGGCCCGT  220547

Query  371     GCGAGATCTGGAT  383
               |||||||||||||
Sbjct  220546  GCGAGATCTGGAT  220534

 Score = 61.7 bits (67),  Expect = 4e-07
 Identities = 120/174 (69%), Gaps = 9/174 (5%)
 Strand=Plus/Minus

Query  213     CTACAAGACCCTCCGCGAGTTCATGGACAA-GCCGGGTGCGTACAAGCCCAAC--AGCGG  269
               |||||||| ||||||||| ||||||||||| |||  || || |   | |  ||  |||||
Sbjct  219693  CTACAAGAACCTCCGCGACTTCATGGACAATGCCAAGTACGCAGT-GACGGACGGAGCGG  219635

Query  270     CGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGA  329
                 ||| | |     | ||||   | ||||| || |      | || | ||||||  ||||
Sbjct  219634  ATCAAGCCT-----GTGGCTGGTCCGACCCGAACGGCATCCCTCAACAGATTCCAGAGGA  219580

Query  330     CGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGAT  383
                ||  || | || ||||| |||||||| || || ||||| || |||||||||||
Sbjct  219579  TGGAACGATGCGTACGTCGGGGTACACACACGACGGCCCGTGTGAGATCTGGAT  219526

 Score = 58.1 bits (63),  Expect = 5e-06
 Identities = 59/76 (78%), Gaps = 6/76 (8%)
 Strand=Plus/Minus

Query  493     TGGTACTGGCTGGGCATCCGC---CCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAG  549
               ||||||||||||||  | ||    |  | |||||||   |||||||||||| | ||||||
Sbjct  220430  TGGTACTGGCTGGGAGTGCGTAAACTCAAGGGCAAG---TACTCGTGGCAGGTGTACAAG  220374

Query  550     GCCTGCATCCCGCTCT  565
               |  |||||||||||||
Sbjct  220373  GAGTGCATCCCGCTCT  220358

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 63/84 (75%), Gaps = 2/84 (2%)
 Strand=Plus/Minus

Query  481     TGCATGCTCAAGTGGTACTGGCTGGGCATCCGCC-CGACGGGCAAGAGCTACTCGTGGCA  539
               ||||| ||  | ||||||||||||||  | |||  |  |  | ||||  |||||||||||
Sbjct  219434  TGCATTCTGTACTGGTACTGGCTGGGAGTTCGCTACCTCAAG-AAGAAGTACTCGTGGCA  219376

Query  540     GATCTACAAGGCCTGCATCCCGCT  563
                 | |||||||  |||||||||||
Sbjct  219375  AGTGTACAAGGAGTGCATCCCGCT  219352

 Score = 44.6 bits (48),  Expect = 0.032
 Identities = 42/54 (78%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  280     GAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
               || || || ||||||||||| || |   |  ||||||| ||||||| |||||||
Sbjct  112594  GACTGTGGTTTCACGGACCCGAACGGCACCCCGCAGCCAATTCCGACGGACGGC  112647

>PHPA:scaffold_39 NW_008649025.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.39, whole genome shotgun 
sequence
Length=634653

 Score = 72.5 bits (79),  Expect = 2e-10
 Identities = 67/84 (80%), Gaps = 6/84 (7%)
 Strand=Plus/Plus

Query  481     TGCATGCTCAAGTGGTACTGGCTGGGCATCCGC---CCGACGGGCAAGAGCTACTCGTGG  537
               ||||| ||| | ||||||||||||||| | |||   | || |||||||   |||||||||
Sbjct  150264  TGCATCCTCTACTGGTACTGGCTGGGCGTGCGCAAGCTGAAGGGCAAG---TACTCGTGG  150320

Query  538     CAGATCTACAAGGCCTGCATCCCG  561
               ||| | |||||||  |||||||||
Sbjct  150321  CAGGTGTACAAGGAATGCATCCCG  150344

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 34/41 (83%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  523     AAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
               ||||  |||||||||||| | |||||||  || ||||||||
Sbjct  151488  AAGAAGTACTCGTGGCAGGTGTACAAGGAGTGTATCCCGCT  151528

>PHSO:scaffold_11
Length=2192408

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 237/369 (64%), Gaps = 51/369 (14%)
 Strand=Plus/Minus

Query  213      CTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAACAGCGGCGC  272
                |||||| || || ||||| |||||||||   |  ||   ||||| |   | |   |||||
Sbjct  2022799  CTACAAAACTCTACGCGACTTCATGGAC---CGAGGCAAGTACACGGTGACCCAGGGCGC  2022743

Query  273      AACCTTCGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGG  332
                   || |   |||||||  ||  |||| || | | || ||||||| ||||||        
Sbjct  2022742  CGACTACTTCTGCGGCTGGACCAACCCCAAGGGGACGCCGCAGCCCATTCCG--------  2022691

Query  333      CGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGT  392
                  || |||  |||   || ||||| ||||| ||||| || ||||| ||| | ||||||||
Sbjct  2022690  --CGCTCC--ACG---GGTTACACCCATGACGGCCCGTGTGAGATTTGGCTGGACGACGT  2022638

Query  393      CAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAA  452
                  | ||   | |   || ||| ||||||            |||||   | || |  ||  
Sbjct  2022637  GCGCGTGCTGGAGTCCGGCAACTGCCAC------------GAGAC---GATCCCCCAC--  2022595

Query  453      GATTGACTACTCGGCGTGC------AAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGG  506
                ||| ||||||||| | |||      ||||||   |||| | |  | ||||||||||| ||
Sbjct  2022594  GATCGACTACTCGTCCTGCGAGAAGAAGGGCGGCTGCACGATGCACTGGTACTGGCTCGG  2022535

Query  507      CATCCGC--CCGACGGGCAAGAGCT---ACTCGTGGCAGATCTACAAGGCCTGCATCCCG  561
                  | |||  ||      ||||| ||   ||||||||||| |||||||||  |||||||| 
Sbjct  2022534  AGTGCGCTTCCT-----CAAGAACTCGTACTCGTGGCAGGTCTACAAGGAGTGCATCCCC  2022480

Query  562      CTCTCGGCC  570
                ||| |||||
Sbjct  2022479  CTCACGGCC  2022471

>PYIR:scaffold_1319 pir_scaffold_1319 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_1319:1:8199:1 
REF
Length=8199

 Score = 63.5 bits (69),  Expect = 1e-07
 Identities = 48/57 (84%), Gaps = 0/57 (0%)
 Strand=Plus/Minus

Query  451   AAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGC  507
             ||||| |||| |||||||||||||||| |||||||||||   |  |||||||| |||
Sbjct  5718  AAGATCGACTTCTCGGCGTGCAAGGGCTCGTGCATGCTCCGCTTCTACTGGCTCGGC  5662

>PHRA:scaffold_2892
Length=2014

 Score = 58.1 bits (63),  Expect = 5e-06
 Identities = 65/86 (76%), Gaps = 6/86 (7%)
 Strand=Plus/Minus

Query  481   TGCATGCTCAAGTGGTACTGGCTGGGCATCCG---CCCGACGGGCAAGAGCTACTCGTGG  537
             ||||| ||  | ||||||||||||||    ||   || || |||||   |||||||||||
Sbjct  1598  TGCATCCTGTACTGGTACTGGCTGGGTGCGCGATACCTGAAGGGCA---GCTACTCGTGG  1542

Query  538   CAGATCTACAAGGCCTGCATCCCGCT  563
             ||| | |||||||  ||||||| |||
Sbjct  1541  CAGGTGTACAAGGAATGCATCCTGCT  1516

>PHRA:scaffold_494
Length=11395

 Score = 58.1 bits (63),  Expect = 5e-06
 Identities = 65/86 (76%), Gaps = 6/86 (7%)
 Strand=Plus/Minus

Query  481   TGCATGCTCAAGTGGTACTGGCTGGGCATCCG---CCCGACGGGCAAGAGCTACTCGTGG  537
             ||||| ||  | ||||||||||||||    ||   || || |||||   |||||||||||
Sbjct  8234  TGCATCCTGTACTGGTACTGGCTGGGTGCGCGATACCTGAAGGGCA---GCTACTCGTGG  8178

Query  538   CAGATCTACAAGGCCTGCATCCCGCT  563
             ||| | |||||||  ||||||| |||
Sbjct  8177  CAGGTGTACAAGGAATGCATCCTGCT  8152

>PYUU:scaffold_1402 scf1117875581402 dna:supercontig supercontig:pug:scf1117875581402:1:979788:1 
REF
Length=979788

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 94/137 (69%), Gaps = 12/137 (9%)
 Strand=Plus/Minus

Query  353     ACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACA  412
               || ||||  | || ||||| ||| ||||||| ||||||  || | ||| ||||   ||| 
Sbjct  159769  ACTCGCACCACGGTCCATGTGAGCTCTGGATCGACGACACCAAGATCATGCACTCGGACG  159710

Query  413     ATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAAGATT------GACTACTCGG  466
               |||||| |  ||||       | || |||| | |||   ||||       ||||||||||
Sbjct  159709  ATTGCCGCGCCGACT------ACACGGCGTACCCTGCGGAGATCCCGGTCGACTACTCGG  159656

Query  467     CGTGCAAGGGCACGTGC  483
                ||||||||||| ||||
Sbjct  159655  TGTGCAAGGGCAAGTGC  159639

 Score = 47.3 bits (51),  Expect = 0.009
 Identities = 39/48 (81%), Gaps = 0/48 (0%)
 Strand=Plus/Minus

Query  458     ACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
               ||||||||| |||||||||||  ||||| || | ||  |||||| |||
Sbjct  164090  ACTACTCGGTGTGCAAGGGCAACTGCATCCTGACGTTCTACTGGTTGG  164043

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 33/41 (80%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  465     GGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
               |||||||||||||||||||   || | ||  |||||| |||
Sbjct  147675  GGCGTGCAAGGGCACGTGCCGTCTGACGTTCTACTGGTTGG  147635

>PYIW:scaffold_182 piw_scaffold_182 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_182:1:25962:1 
REF
Length=25962

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 41/48 (85%), Gaps = 0/48 (0%)
 Strand=Plus/Minus

Query  457    GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTG  504
              ||||||||||||||| | ||||||||| |||||| |   |||||||||
Sbjct  21475  GACTACTCGGCGTGCCACGGCACGTGCTTGCTCACGCTCTACTGGCTG  21428

 Score = 54.5 bits (59),  Expect = 6e-05
 Identities = 40/47 (85%), Gaps = 0/47 (0%)
 Strand=Plus/Plus

Query  457   GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCT  503
             |||||||||| ||||||||||||||||   |||| ||  ||||||||
Sbjct  1792  GACTACTCGGTGTGCAAGGGCACGTGCCGCCTCACGTTCTACTGGCT  1838

>PYIR:scaffold_573 pir_scaffold_573 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_573:1:20947:1 
REF
Length=20947

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 107/159 (67%), Gaps = 12/159 (8%)
 Strand=Plus/Plus

Query  353   ACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACA  412
             || ||||  | ||||| |||||  ||||||| ||| ||  || | ||| ||||   ||| 
Sbjct  5564  ACTCGCACCACGGCCCGTGCGAAGTCTGGATCGACAACACCAAGATCATGCACTCGGACG  5623

Query  413   ATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAAGATT------GACTACTCGG  466
             |||||| |  ||||       | ||||||| | | |   ||||       ||||||||  
Sbjct  5624  ATTGCCGCGCCGACT------ACACCGCGTACCCAGCTGAGATCCCAGTGGACTACTCCA  5677

Query  467   CGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
              ||||||||||| ||||  ||||| ||  |||||| |||
Sbjct  5678  AGTGCAAGGGCAAGTGCCAGCTCACGTTCTACTGGTTGG  5716

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 41/49 (84%), Gaps = 0/49 (0%)
 Strand=Plus/Plus

Query  457   GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
             ||||||||   ||||||||||| ||||| ||||| ||  ||||||||||
Sbjct  2892  GACTACTCCAAGTGCAAGGGCAAGTGCACGCTCACGTTCTACTGGCTGG  2940

 Score = 45.5 bits (49),  Expect = 0.032
 Identities = 64/91 (70%), Gaps = 12/91 (13%)
 Strand=Plus/Plus

Query  457   GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCGCCCG  516
             |||| |||||  ||||||||||| ||||   ||| ||  ||||||||||     ||| | 
Sbjct  7460  GACTTCTCGGTCTGCAAGGGCACATGCAGAGTCACGTTCTACTGGCTGG-----CGCTCC  7514

Query  517   ACGGGCAAGAGCTACTCGTGGCAGATCTACA  547
             ||  |||| |       ||||||||||||||
Sbjct  7515  ACTCGCAAAA-------GTGGCAGATCTACA  7538

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 32/38 (84%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  468    GTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
              ||||||||||||||||   |||| ||  ||||||||||
Sbjct  16137  GTGCAAGGGCACGTGCCGCCTCACGTTCTACTGGCTGG  16174

>PHKE:scaffold_354 scf_22126_354.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_354.1_contig_1:1:38044:1 
REF
Length=38044

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 127/189 (67%), Gaps = 7/189 (4%)
 Strand=Plus/Plus

Query  204    GGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGCCGGGTGCGTACAAGCCCAA  263
              || ||||||||||   | |||||| || |||||||||||   ||    |||||||     
Sbjct  14457  GGACAACAACTACGCCAGCCTCCGTGACTTCATGGACAA---GGCCAAGTACAAGGTTTC  14513

Query  264    CAGCGGCGCAACCTTC--GAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATT  321
                 ||| ||  |  ||  |  |||||||  || ||||| || |      |||||| ||| 
Sbjct  14514  GGACGGTGC--CGATCAGGCCTGCGGCTGGACCGACCCCAAGGGAATCCCGCAGCAGATC  14571

Query  322    CCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGG  381
              ||  |||||||| |  | ||||| || || ||||| || || || ||||| |||||||  
Sbjct  14572  CCCGAGGACGGCACTATGCGCACCTCCGGCTACACCCACGACGGACCATGTGAGATCTAC  14631

Query  382    ATTGACGAC  390
              || | ||||
Sbjct  14632  ATGGGCGAC  14640

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 191/294 (65%), Gaps = 32/294 (11%)
 Strand=Plus/Plus

Query  283    TGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGC  342
              |||||||  || ||||| || |      |||||| ||| ||  |||||||| |  | |||
Sbjct  14533  TGCGGCTGGACCGACCCCAAGGGAATCCCGCAGCAGATCCCCGAGGACGGCACTATGCGC  14592

Query  343    ACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGAC--GTCAGGGTCA  400
              || || || ||||| || || || ||||| |||||||  || | ||||  ||  | ||  
Sbjct  14593  ACCTCCGGCTACACCCACGACGGACCATGTGAGATCTACATGGGCGACAAGTTGGCGTT-  14651

Query  401    AGCACGGCGA----CAATTGCCACT--TCGACATTTCGGAGACCG--CGTTCACTGACAA  452
                   | ||     ||||||||||   ||||    ||   ||||   ||||||      |
Sbjct  14652  -----GTCGTATCTCAATTGCCACGAGTCGA----TCACTGACCAAACGTTCA------A  14696

Query  453    GATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCG  512
              | | ||||||   ||||||  || ||  |||||  |  | ||||| ||| ||||  | ||
Sbjct  14697  GTTGGACTACAGCGCGTGCGGGGACAGCTGCATCTTGTACTGGTATTGGTTGGGAGTGCG  14756

Query  513    C---CCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
              |   | || |||   |   |||||||||||||| |||||||  ||||| |||||
Sbjct  14757  CAAGCTGAAGGGTTCG---TACTCGTGGCAGATATACAAGGAGTGCATTCCGCT  14807

>PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 
genomic scaffold, whole genome shotgun sequence
Length=3552875

 Score = 54.5 bits (59),  Expect = 6e-05
 Identities = 52/67 (78%), Gaps = 0/67 (0%)
 Strand=Plus/Minus

Query  313      CAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGC  372
                ||||  |||||| |||||||  || | || ||| | || ||||||||||| || || || 
Sbjct  2748643  CAGCAAATTCCGGAGGACGGAACGATGCGTACGACGGGCTACACGCATGATGGACCGTGT  2748584

Query  373      GAGATCT  379
                |||||||
Sbjct  2748583  GAGATCT  2748577

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 62/83 (75%), Gaps = 6/83 (7%)
 Strand=Plus/Minus

Query  481      TGCATGCTCAAGTGGTACTGGCTGGGCATCCGC---CCGACGGGCAAGAGCTACTCGTGG  537
                |||||  || | ||||||||||||||  | |||   |  | |||||||   ||||| |||
Sbjct  2743259  TGCATCATCTATTGGTACTGGCTGGGTGTGCGCAAGCTCAAGGGCAAG---TACTCCTGG  2743203

Query  538      CAGATCTACAAGGCCTGCATCCC  560
                ||| | |||||||  ||||||||
Sbjct  2743202  CAGGTGTACAAGGAGTGCATCCC  2743180

>PYIR:scaffold_4543 pir_scaffold_4543 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_4543:1:893:1 
REF
Length=893

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 41/49 (84%), Gaps = 0/49 (0%)
 Strand=Plus/Minus

Query  457  GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
            ||||||||   ||||||||||| ||||| ||||| ||  ||||||||||
Sbjct  839  GACTACTCCAAGTGCAAGGGCAAGTGCACGCTCACGTTCTACTGGCTGG  791

 Score = 44.6 bits (48),  Expect = 0.032
 Identities = 39/49 (80%), Gaps = 0/49 (0%)
 Strand=Plus/Plus

Query  457  GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
            ||||||||   |||||||||||  ||| |||| | ||  ||||||||||
Sbjct  55   GACTACTCCAAGTGCAAGGGCAACTGCGTGCTGACGTTCTACTGGCTGG  103

>PHSO:scaffold_16
Length=803425

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 44/54 (81%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  280     GAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
               || ||||||||||||||||| || |   || ||||||| |||||||  ||||||
Sbjct  522011  GACTGCGGCTTCACGGACCCCAACGGCACGCCGCAGCCCATTCCGACAGACGGC  522064

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 44/54 (81%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  280     GAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
               || ||||||||||||||||| || |   || ||||||| ||||| | |||||||
Sbjct  524428  GACTGCGGCTTCACGGACCCCAACGGCACGCCGCAGCCCATTCCCACGGACGGC  524375

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 43/55 (78%), Gaps = 0/55 (0%)
 Strand=Plus/Minus

Query  279     CGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
               ||| ||||||||||| ||||| || |   || ||||||| || ||||  ||||||
Sbjct  554039  CGACTGCGGCTTCACCGACCCGAACGGTACGCCGCAGCCCATCCCGACCGACGGC  553985

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 43/55 (78%), Gaps = 0/55 (0%)
 Strand=Plus/Plus

Query  279     CGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
               ||| ||||||||||| ||||| || |   || ||||||| || ||||  ||||||
Sbjct  557113  CGACTGCGGCTTCACCGACCCGAACGGTACGCCGCAGCCCATCCCGACCGACGGC  557167

>PYAR:scaffold_88 par_scaffold_88 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_88:1:34485:1 
REF
Length=34485

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 79/113 (70%), Gaps = 6/113 (5%)
 Strand=Plus/Plus

Query  451   AAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATC  510
             ||| | |||| |||||||||||||||| |||| |||||    |  |||||||| ||| | 
Sbjct  3938  AAGGTGGACTTCTCGGCGTGCAAGGGCTCGTGTATGCTGCGCTTCTACTGGCTCGGCCTT  3997

Query  511   CGCCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
             |     |  |||||| ||      ||||||   ||||||  ||||||||| ||
Sbjct  3998  CAGAACAGCGGCAAGCGC------TGGCAGTCATACAAGAACTGCATCCCACT  4044

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 51/66 (77%), Gaps = 1/66 (2%)
 Strand=Plus/Plus

Query  446  CTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCT-G  504
            ||| ||||||  ||| ||||||||||||||| |  ||||||||    |  |||||||| |
Sbjct  540  CTGTCAAGATCAACTTCTCGGCGTGCAAGGGGAGCTGCATGCTGCGCTTCTACTGGCTCG  599

Query  505  GGCATC  510
            ||| ||
Sbjct  600  GGCTTC  605

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 103/152 (68%), Gaps = 12/152 (8%)
 Strand=Plus/Plus

Query  364   GGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTC  423
             || || |||||||||||| |||| ||   || ||     ||| ||||| | ||| |    
Sbjct  2582  GGTCCGTGCGAGATCTGGCTTGATGAAACCATGGCGTTCCACAGCGACGACTGCGA----  2637

Query  424   GA--CATTTCGGA--GACCGCGTTCACTGACAAGATTGACTACTCGGCGTGCAAGGGCAC  479
             ||  || |||||   | || ||| |   | |||| |  ||| ||||||||||||||| | 
Sbjct  2638  GAAGCAGTTCGGCTCGTCCACGTCC---GTCAAGGTCAACTTCTCGGCGTGCAAGGGGAG  2694

Query  480   GTGCATGCTCAAGTGGTACTGGCT-GGGCATC  510
              ||||||||    |  |||||||| |||| ||
Sbjct  2695  CTGCATGCTGCGCTTCTACTGGCTCGGGCTTC  2726

>PYAR:scaffold_1854 par_scaffold_1854 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1854:1:6753:1 
REF
Length=6753

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 37/43 (86%), Gaps = 0/43 (0%)
 Strand=Plus/Plus

Query  364   GGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACG  406
             || || |||||||  |||||||||||||||| |||| ||||||
Sbjct  2372  GGTCCGTGCGAGACGTGGATTGACGACGTCATGGTCCAGCACG  2414

>PYAR:scaffold_593 par_scaffold_593 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_593:1:15936:1 
REF
Length=15936

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 83/118 (70%), Gaps = 4/118 (3%)
 Strand=Plus/Minus

Query  449    ACAAGATTGACTACTCGGCGT--GCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGG  506
              ||||| | ||||  || ||||  |||||||    |||| | || | ||||||||||| | 
Sbjct  15892  ACAAGGTGGACT--TCAGCGTCTGCAAGGGTGACTGCACGATCCACTGGTACTGGCTCGC  15835

Query  507    CATCCGCCCGACGGGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTC  564
              ||  || |  |  |||||||  |  |||||||||   |||||||  ||||| ||| ||
Sbjct  15834  CAAGCGTCTCATTGGCAAGAAGTGGTCGTGGCAGGCGTACAAGGAGTGCATTCCGATC  15777

>PHRA:scaffold_79
Length=220511

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 81/115 (70%), Gaps = 10/115 (9%)
 Strand=Plus/Minus

Query  454    ATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCGC  513
              |||||||| ||| | ||||| ||||| || |   |  | ||||||||| | ||  | |||
Sbjct  25784  ATTGACTATTCGTCCTGCAAAGGCACCTGTACATTGCACTGGTACTGGATCGGAGTTCGC  25725

Query  514    --CCGACGGGCAAGAGCT---ACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
                ||      ||||| ||   ||||||||||| | |||||||  |||||| ||||
Sbjct  25724  TTCCT-----CAAGAACTCGTACTCGTGGCAGGTGTACAAGGAGTGCATCTCGCT  25675

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 48/63 (76%), Gaps = 1/63 (2%)
 Strand=Plus/Minus

Query  184    GACTTTAACGCGTACCTTAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACA-A  242
              ||||| ||||| |  | |   | ||||  |||||||||||| || || |||||||||| |
Sbjct  26042  GACTTCAACGCATGGCGTCGTGACAACGGCTACAAGACCCTGCGTGACTTCATGGACAGA  25983

Query  243    GCC  245
              |||
Sbjct  25982  GCC  25980

>PHIF:NW_003303391.1 Phytophthora infestans T30-4 supercont1.368 
genomic scaffold, whole genome shotgun sequence
Length=80461

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 47/60 (78%), Gaps = 0/60 (0%)
 Strand=Plus/Minus

Query  320    TTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCT  379
              ||||| |||||||  || | || ||| | || ||||||||||| || || || |||||||
Sbjct  80309  TTCCGGAGGACGGAACGATGCGTACGACGGGCTACACGCATGATGGACCGTGTGAGATCT  80250

>PYAP:scaffold_216 pag1_scaffold_216 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_216:1:44217:1 
REF
Length=44217

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 45/57 (79%), Gaps = 0/57 (0%)
 Strand=Plus/Plus

Query  450    CAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGG  506
              |||||| ||||||||   |||||||||||  |||||||||   |  |||||||| ||
Sbjct  34631  CAAGATCGACTACTCCAAGTGCAAGGGCAACTGCATGCTCCGCTTCTACTGGCTTGG  34687

>PYAP:scaffold_209 pag1_scaffold_209 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_209:1:44730:1 
REF
Length=44730

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 40/49 (82%), Gaps = 0/49 (0%)
 Strand=Plus/Plus

Query  457   GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
             |||||||||| |||||||||||  |||  ||| | ||  ||||||||||
Sbjct  2665  GACTACTCGGTGTGCAAGGGCAAATGCCAGCTGACGTTCTACTGGCTGG  2713

>PLHA:NW_020189073.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2165, whole genome shotgun sequence
Length=94632

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 77/108 (71%), Gaps = 2/108 (2%)
 Strand=Plus/Plus

Query  457    GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCGCCCG  516
              || |||||| ||||||||| ||  ||  |  |  | ||||||||||||| | | || |  
Sbjct  34987  GATTACTCGTCGTGCAAGGACAATTGTGTCATGTACTGGTACTGGCTGGCCGTTCGTCTT  35046

Query  517    ACGGGCAA-GAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
                |   || ||| || ||||||||  |||| ||||||||||| || ||
Sbjct  35047  CTGAAAAATGAG-TATTCGTGGCAAGTCTATAAGGCCTGCATTCCACT  35093

>PHRA:scaffold_4
Length=963095

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 102/149 (68%), Gaps = 15/149 (10%)
 Strand=Plus/Plus

Query  280     GAATGCGGCTTCACGGACCCAAAAG---CGCCGGCGCAGCCGATTCCGAAGGACGGCGCG  336
               || ||||||||||||||||| || |   ||||  || | |||   || | ||||||| ||
Sbjct  235218  GACTGCGGCTTCACGGACCCGAACGGCACGCCCTCGGACCCG---CCCACGGACGGCACG  235274

Query  337     TTC-----CGCACGTCAGGGTACAC-GCATGAAGGCCCATGCGAGATCTGGATTGACGAC  390
                 |     | |||||   ||||    ||| |  ||||| |||||||||||| ||||||||
Sbjct  235275  GCCACCTTCTCACGT---GGTATTGTGCACGCCGGCCCGTGCGAGATCTGGCTTGACGAC  235331

Query  391     GTCAGGGTCAAGCACGGCGACAATTGCCA  419
                  | ||||   ||   |||| |||||||
Sbjct  235332  AAGATGGTCCTTCAGAACGACGATTGCCA  235360

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 44/57 (77%), Gaps = 3/57 (5%)
 Strand=Plus/Plus

Query  531     CTCGTGGCAGATCTACAAGGCCTGCATCCCGCTCTCGG---CCAACGGTGGCGGCGC  584
               || ||||||| | ||||||  |||||||||||| ||||   ||   ||||| |||||
Sbjct  236959  CTGGTGGCAGGTGTACAAGAACTGCATCCCGCTTTCGGGTCCCGCTGGTGGAGGCGC  237015

>PHPA:scaffold_66 NW_008649052.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.66, whole genome shotgun 
sequence
Length=310063

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 157/241 (65%), Gaps = 11/241 (5%)
 Strand=Plus/Minus

Query  184     GACTTTAACGCGTACCTTAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACA-A  242
               ||||||||||| |  | |   | ||||   |||||||| ||||| || |||||||||| |
Sbjct  162997  GACTTTAACGCTTGGCGTCGCGACAACGGATACAAGACTCTCCGTGACTTCATGGACAGA  162938

Query  243     GCCGGGTGCGTACAAG---CCCAACAGCGGCGCAACCTTCGAATGCGGCTTCACGGACCC  299
               |||      ||||| |    || |  | | ||    ||||   || || |  ||||||||
Sbjct  162937  GCC----AAGTACACGGTTACCGAAGGTGCCGATTACTTC---TGTGGATGGACGGACCC  162885

Query  300     AAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCA  359
                || |   |  ||||||| |||||   ||  || ||  | ||  |  | || ||||| ||
Sbjct  162884  CAAGGGTACTCCGCAGCCCATTCCAGCGGGTGGTGCCATGCGTTCAACCGGTTACACTCA  162825

Query  360     TGAAGGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCA  419
               ||| || ||||||||| | ||| | || || ||  | ||   | | || | |||||||||
Sbjct  162824  TGACGGACCATGCGAGGTGTGGCTGGATGATGTTCGTGTGTTGGAGGGTGGCAATTGCCA  162765

Query  420     C  420
               |
Sbjct  162764  C  162764

>PHPA:scaffold_46 NW_008649032.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.46, whole genome shotgun 
sequence
Length=493760

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 157/241 (65%), Gaps = 11/241 (5%)
 Strand=Plus/Minus

Query  184   GACTTTAACGCGTACCTTAAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACA-A  242
             ||||||||||| |  | |   | ||||   |||||||| ||||| || |||||||||| |
Sbjct  3858  GACTTTAACGCTTGGCGTCGCGACAACGGATACAAGACTCTCCGTGACTTCATGGACAGA  3799

Query  243   GCCGGGTGCGTACAAG---CCCAACAGCGGCGCAACCTTCGAATGCGGCTTCACGGACCC  299
             |||      ||||| |    || |  | | ||    ||||   || || |  ||||||||
Sbjct  3798  GCC----AAGTACACGGTTACCGAAGGTGCCGATTACTTC---TGTGGATGGACGGACCC  3746

Query  300   AAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGCACGTCAGGGTACACGCA  359
              || |   |  ||||||| |||||   ||  || ||  | ||  |  | || ||||| ||
Sbjct  3745  CAAGGGTACTCCGCAGCCCATTCCAGCGGGTGGTGCCATGCGTTCAACCGGTTACACTCA  3686

Query  360   TGAAGGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCA  419
             ||| || ||||||||| | ||| | || || ||  | ||   | | || | |||||||||
Sbjct  3685  TGACGGACCATGCGAGGTGTGGCTGGATGATGTTCGTGTGTTGGAGGGTGGCAATTGCCA  3626

Query  420   C  420
             |
Sbjct  3625  C  3625

>PYUU:scaffold_2036 scf1117875582036 dna:supercontig supercontig:pug:scf1117875582036:1:1090657:1 
REF
Length=1090657

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 37/45 (82%), Gaps = 0/45 (0%)
 Strand=Plus/Minus

Query  462     CTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGG  506
               |||||||||||||||  ||||||||||   ||  |||||||| ||
Sbjct  713271  CTCGGCGTGCAAGGGTTCGTGCATGCTTCGGTTCTACTGGCTCGG  713227

>PYIW:scaffold_3717 piw_scaffold_3717 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_3717:1:2745:1 
REF
Length=2745

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 94/140 (67%), Gaps = 15/140 (11%)
 Strand=Plus/Minus

Query  202  AAGGCCAACAACTACAAGACCCTCCGCGAGTTCATGGACAAGC------------CGGGT  249
            ||||||  |||||||||||| |||   ||||||||   |||||            |||| 
Sbjct  219  AAGGCCGGCAACTACAAGACGCTCAAGGAGTTCATCTTCAAGCTCCAGCAGCCGTCGGGC  160

Query  250  GCGTACAA-GCCCAACAG--CGGCGCAACCTTCGAATGCGGCTTCACGGACCCAAAAGCG  306
             ||||||| | || || |  |||||  |||  ||| || || |||||  |||| || || 
Sbjct  159  TCGTACAAGGACCGACCGGCCGGCGGCACCACCGAGTGTGGTTTCACCAACCCGAACGCC  100

Query  307  CCGGCGCAGCCGATTCCGAA  326
             || |||||||| | || ||
Sbjct  99   ACGCCGCAGCCGCTGCCAAA  80

>PYIW:scaffold_3542 piw_scaffold_3542 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_3542:1:2951:1 
REF
Length=2951

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 37/45 (82%), Gaps = 0/45 (0%)
 Strand=Plus/Minus

Query  459   CTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCT  503
             |||| |||||||||||||||||||    |||| ||  ||||||||
Sbjct  1468  CTACGCGGCGTGCAAGGGCACGTGTCGCCTCACGTTCTACTGGCT  1424

>PHPA:scaffold_460 NW_008649446.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.460, whole genome 
shotgun sequence
Length=3430

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 43/55 (78%), Gaps = 0/55 (0%)
 Strand=Plus/Minus

Query  279  CGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
            ||| ||||| ||||||||||| || |   || | ||||| ||||| | |||||||
Sbjct  615  CGACTGCGGTTTCACGGACCCGAACGGTACGCCTCAGCCCATTCCCACGGACGGC  561

>PHPA:scaffold_20 NW_008649006.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.20, whole genome shotgun 
sequence
Length=1049362

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 80/115 (70%), Gaps = 10/115 (9%)
 Strand=Plus/Plus

Query  454     ATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCCGC  513
               || ||||| ||| |||||||||| |  ||  | ||| | ||||||||||| ||  | |||
Sbjct  363956  ATCGACTATTCGCCGTGCAAGGGAAACTGTGTTCTCTACTGGTACTGGCTCGGTGTGCGC  364015

Query  514     --CCGACGGGCAAGA---GCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCT  563
                 ||      |||||     || ||||||||| | ||||| |  |||||||| ||
Sbjct  364016  TTCC-----TCAAGAATTCGTATTCGTGGCAGGTGTACAAAGAATGCATCCCACT  364065

>PHIF:NW_003303752.1 Phytophthora infestans T30-4 supercont1.7 
genomic scaffold, whole genome shotgun sequence
Length=4595942

 Score = 46.4 bits (50),  Expect = 0.009
 Identities = 43/55 (78%), Gaps = 0/55 (0%)
 Strand=Plus/Minus

Query  279      CGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
                ||| || |||||||||||||| || |    ||| ||||| ||||| ||||| |||
Sbjct  2065227  CGATTGTGGCTTCACGGACCCTAACGGTAAGGCTCAGCCAATTCCCAAGGATGGC  2065173

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 42/55 (76%), Gaps = 0/55 (0%)
 Strand=Plus/Minus

Query  279      CGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
                ||| || || ||||||||||| || |    ||| || |||||||| ||||| |||
Sbjct  2062455  CGATTGTGGTTTCACGGACCCTAACGGTAAGGCTCAACCGATTCCCAAGGATGGC  2062401

>PYAP:scaffold_74 pag1_scaffold_74 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_74:1:72664:1 
REF
Length=72664

 Score = 45.5 bits (49),  Expect = 0.032
 Identities = 38/47 (81%), Gaps = 0/47 (0%)
 Strand=Plus/Minus

Query  457  GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCT  503
            |||||||||| |||||||||||  |||  ||| | ||  ||||||||
Sbjct  758  GACTACTCGGTGTGCAAGGGCAAATGCCAGCTAACGTTCTACTGGCT  712

 Score = 45.5 bits (49),  Expect = 0.032
 Identities = 38/47 (81%), Gaps = 0/47 (0%)
 Strand=Plus/Minus

Query  457   GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCT  503
             |||||||||| |||||||||||  |||  ||| | ||  ||||||||
Sbjct  3636  GACTACTCGGTGTGCAAGGGCAAATGCCAGCTAACGTTCTACTGGCT  3590

>PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 
genomic scaffold, whole genome shotgun sequence
Length=4722445

 Score = 45.5 bits (49),  Expect = 0.032
 Identities = 43/53 (81%), Gaps = 3/53 (6%)
 Strand=Plus/Plus

Query  535      TGGCAGATCTACAAGGCCTGCATCCCGCTCTCGG--CCAAC-GGTGGCGGCGC  584
                |||||| | ||||||  |||||||||||||||||  || || ||||| || ||
Sbjct  3736479  TGGCAGGTGTACAAGATCTGCATCCCGCTCTCGGGTCCTACGGGTGGAGGTGC  3736531

 Score = 44.6 bits (48),  Expect = 0.032
 Identities = 30/34 (88%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  535      TGGCAGATCTACAAGGCCTGCATCCCGCTCTCGG  568
                |||||| | ||||||  |||||||||||||||||
Sbjct  3772460  TGGCAGGTGTACAAGAACTGCATCCCGCTCTCGG  3772427

>PYIR:scaffold_572 pir_scaffold_572 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_572:1:20965:1 
REF
Length=20965

 Score = 44.6 bits (48),  Expect = 0.032
 Identities = 30/34 (88%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  10     CACTCTGTCGCCGTTCTCGGCGCCGTCGCTGTCG  43
              ||| | ||||||||||| | ||||||||||||||
Sbjct  18469  CACACCGTCGCCGTTCTTGCCGCCGTCGCTGTCG  18502

>PYVX:scaffold_50 pve_scaffold_50 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_50:1:72629:1 
REF
Length=72629

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 48/63 (76%), Gaps = 1/63 (2%)
 Strand=Plus/Plus

Query  364    GGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTC  423
              || || |||||||||||| | ||||||  || |||   ||||| |||| | ||| || ||
Sbjct  42350  GGTCCGTGCGAGATCTGGCTGGACGACACCATGGTGCTGCACGACGACGACTGCTAC-TC  42408

Query  424    GAC  426
              |||
Sbjct  42409  GAC  42411

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  280    GAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
              || |||||||||||||||||  | |   |||||||    || |||| |||||||
Sbjct  42189  GACTGCGGCTTCACGGACCCGGATGGCACGGCGCAAGACATCCCGACGGACGGC  42242

>PYIR:scaffold_155 pir_scaffold_155 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_155:1:48358:1 
REF
Length=48358

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 101/147 (69%), Gaps = 8/147 (5%)
 Strand=Plus/Minus

Query  364   GGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTC  423
             ||||| |||||||||||| | ||||||    | || | ||| | |||||| ||| |   |
Sbjct  2688  GGCCCGTGCGAGATCTGGCTCGACGACAAGCGCGTGATGCAGGACGACAACTGCGAAGGC  2629

Query  424   GACATTTCGGAGACCGCGTTCACTGAC----AAGATTGACTACTCGGCGTGCAAGGGCAC  479
              ||  |||||  | |  | || | |||    ||||| || | |||  | || |||||| |
Sbjct  2628  -AC-GTTCGG-CAGCAAGATC-CCGACGTGGAAGATCGATTTCTCATCCTGTAAGGGCTC  2573

Query  480   GTGCATGCTCAAGTGGTACTGGCTGGG  506
             |||||||||    |||| |||||| ||
Sbjct  2572  GTGCATGCTGCGCTGGTTCTGGCTCGG  2546

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  451  AAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCT  488
            ||||| ||||  ||  ||||||||||||  ||||||||
Sbjct  448  AAGATCGACTGGTCATCGTGCAAGGGCAACTGCATGCT  411

>PYAR:scaffold_480 par_scaffold_480 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_480:1:17633:1 
REF
Length=17633

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 34/41 (83%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  463  TCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCT  503
            ||||| |||||||||||||| | ||||| ||  || |||||
Sbjct  232  TCGGCCTGCAAGGGCACGTGTACGCTCACGTTCTATTGGCT  272

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 34/41 (83%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  463    TCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCT  503
              ||||| ||| |||||||||||| ||||| ||  || |||||
Sbjct  17323  TCGGCCTGCCAGGGCACGTGCACGCTCACGTTCTATTGGCT  17283

>PHPA:scaffold_5 NW_008648991.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.5, whole genome shotgun 
sequence
Length=2147012

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 49/64 (77%), Gaps = 4/64 (6%)
 Strand=Plus/Plus

Query  530      ACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTCTCGG---CCAACGGTGGCGGCGCTG  586
                |||| |||||  | ||||||  |||||||||||| ||||   |   ||||||||||| ||
Sbjct  1018748  ACTC-TGGCAAGTATACAAGAACTGCATCCCGCTTTCGGGTCCTGCCGGTGGCGGCGGTG  1018806

Query  587      CTGC  590
                 |||
Sbjct  1018807  GTGC  1018810

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  367      CCATGCGAGATCTGGATTGACGAC  390
                ||||||||||| ||||||||||||
Sbjct  1002734  CCATGCGAGATTTGGATTGACGAC  1002757

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 38/49 (78%), Gaps = 3/49 (6%)
 Strand=Plus/Plus

Query  520      GGCAAGAGCTACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTCTCGG  568
                |||||||  ||||   ||||| | || |||  |||||||||||| ||||
Sbjct  1016500  GGCAAGACGTACT---GGCAGGTGTATAAGAACTGCATCCCGCTTTCGG  1016545

>APAS:scaffold_9 supercont1.9 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.9:1:1535166:1 
REF
Length=1535166

 Score = 43.7 bits (47),  Expect = 0.11
 Identities = 33/38 (87%), Gaps = 1/38 (3%)
 Strand=Plus/Minus

Query  28      GGCGCCGTCGCTGTCGC-GGCGCTCGCGGCGCCCACCG  64
               ||||||||||||||||| || |||||||| | | ||||
Sbjct  953606  GGCGCCGTCGCTGTCGCTGGTGCTCGCGGTGTCGACCG  953569

>PYVX:scaffold_415 pve_scaffold_415 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_415:1:25766:1 
REF
Length=25766

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 29/33 (88%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  26     TCGGCGCCGTCGCTGTCGCGGCGCTCGCGGCGC  58
              ||| || |||||| | |||||||||||||||||
Sbjct  10639  TCGTCGTCGTCGCGGCCGCGGCGCTCGCGGCGC  10607

>PHSO:scaffold_13
Length=2041583

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 34/40 (85%), Gaps = 1/40 (3%)
 Strand=Plus/Plus

Query  27      CGGCGCCGTCGCTG-TCGCGGCGCTCGCGGCGCCCACCGC  65
               |||||||||||||| |||||| || | ||||| ||| |||
Sbjct  382892  CGGCGCCGTCGCTGTTCGCGGTGCACCCGGCGGCCAACGC  382931

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 42/54 (78%), Gaps = 2/54 (4%)
 Strand=Plus/Minus

Query  25       CTCGGCGCCGTCGCTGTCG-CGGCGCTCGCGGCGCCCACCGCGCTAGTGGAGGC  77
                || |||| |||||   ||| |||||| | | |||||||||||| ||||  ||||
Sbjct  1976844  CTTGGCGTCGTCGAACTCGTCGGCGCCCCCCGCGCCCACCGCG-TAGTCCAGGC  1976792

>APAS:scaffold_23 supercont1.23 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.23:1:838643:1 
REF
Length=838643

 Score = 42.8 bits (46),  Expect = 0.11
 Identities = 46/60 (77%), Gaps = 1/60 (2%)
 Strand=Plus/Minus

Query  383     TTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGG-AGACCGCG  441
               || ||||||| || ||||||||||||||  | ||||| || |   | |||| |||| |||
Sbjct  167164  TTCACGACGTGAGTGTCAAGCACGGCGATGAGTGCCATTTTGGGCTGTCGGCAGACGGCG  167105

>PYVX:scaffold_894 pve_scaffold_894 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_894:1:10447:1 
REF
Length=10447

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  356  CGCATGAAGGCCCATGCGAGATCTGGATTGACGAC  390
            |||| |||||||| ||||||||||||   ||||||
Sbjct  351  CGCACGAAGGCCCGTGCGAGATCTGGTGCGACGAC  385

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  356   CGCATGAAGGCCCATGCGAGATCTGGATTGACGAC  390
             |||| |||||||| ||||||||||||   ||||||
Sbjct  1507  CGCACGAAGGCCCGTGCGAGATCTGGTGCGACGAC  1473

>PYVX:scaffold_121 pve_scaffold_121 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_121:1:49194:1 
REF
Length=49194

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 42/55 (76%), Gaps = 0/55 (0%)
 Strand=Plus/Minus

Query  279    CGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
              ||| ||||||||||| |||||  | |    ||||||||| || ||||  ||||||
Sbjct  27384  CGACTGCGGCTTCACCGACCCGGATGGAGAGGCGCAGCCTATCCCGACCGACGGC  27330

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  25     CTCGGCGCCGTCGCTGTCGCGGCG  48
              |||||||||||||||||||| |||
Sbjct  18030  CTCGGCGCCGTCGCTGTCGCCGCG  18007

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 47/63 (75%), Gaps = 1/63 (2%)
 Strand=Plus/Minus

Query  364    GGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGCCACTTC  423
              || || |||||||||||| | ||||||  || |||    |||| |||| | ||| || ||
Sbjct  17635  GGTCCGTGCGAGATCTGGCTCGACGACACCATGGTGCTCCACGACGACGACTGCTAC-TC  17577

Query  424    GAC  426
              |||
Sbjct  17576  GAC  17574

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 41/55 (75%), Gaps = 0/55 (0%)
 Strand=Plus/Minus

Query  279    CGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
              ||| |||||||||||  ||||    |   |||||||||| || ||||  ||||||
Sbjct  17785  CGACTGCGGCTTCACCAACCCGTCCGGCACGGCGCAGCCCATCCCGACCGACGGC  17731

>PYIW:scaffold_1535 piw_scaffold_1535 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1535:1:8373:1 
REF
Length=8373

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 42/55 (76%), Gaps = 0/55 (0%)
 Strand=Plus/Plus

Query  534   GTGGCAGATCTACAAGGCCTGCATCCCGCTCTCGGCCAACGGTGGCGGCGCTGCT  588
             |||||||||||||| |  ||||   ||||||||||    |||  |||||| ||||
Sbjct  3096  GTGGCAGATCTACACGTACTGCGCGCCGCTCTCGGGTGGCGGCAGCGGCGGTGCT  3150

>PYIW:scaffold_1483 piw_scaffold_1483 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1483:1:8671:1 
REF
Length=8671

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  64    GCGCTAGTGGAGGCCCACCAGCGCG  88
             ||||| |||||||||||||||||||
Sbjct  5565  GCGCTCGTGGAGGCCCACCAGCGCG  5589

>PYIW:scaffold_360 piw_scaffold_360 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_360:1:20022:1 
REF
Length=20022

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 36/45 (80%), Gaps = 0/45 (0%)
 Strand=Plus/Plus

Query  280   GAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCG  324
             |||||||||||||||||||| || |   |  |||||||| | |||
Sbjct  2810  GAATGCGGCTTCACGGACCCGAACGGAACCCCGCAGCCGCTGCCG  2854

>PYIR:scaffold_407 pir_scaffold_407 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_407:1:27164:1 
REF
Length=27164

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  64    GCGCTAGTGGAGGCCCACCAGCGCG  88
             ||||| |||||||||||||||||||
Sbjct  3263  GCGCTCGTGGAGGCCCACCAGCGCG  3239

>PYAR:scaffold_170 par_scaffold_170 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_170:1:27305:1 
REF
Length=27305

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 38/46 (83%), Gaps = 3/46 (7%)
 Strand=Plus/Plus

Query  16    GTCGCCGTTCTCGGCGCCGTCGCTGTCGCGGCGCTCGC--GGCGCC  59
             ||||||||   || ||||||||||||||| ||| ||||  ||||||
Sbjct  8796  GTCGCCGTCGCCGTCGCCGTCGCTGTCGCTGCG-TCGCTTGGCGCC  8840

>PYAP:scaffold_187 pag1_scaffold_187 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_187:1:47143:1 
REF
Length=47143

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 42/55 (76%), Gaps = 0/55 (0%)
 Strand=Plus/Plus

Query  457    GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATCC  511
              |||||||||  |||||||||||| |||   || | ||  |||||||| | | |||
Sbjct  10292  GACTACTCGAAGTGCAAGGGCACCTGCCGTCTGACGTTCTACTGGCTCGCCCTCC  10346

>PHSO:scaffold_2
Length=11587142

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  98       CCGACGTCGTGTACACGGTCGCGAACCGCA  127
                |||||| |||||||||||||| || |||||
Sbjct  5336567  CCGACGACGTGTACACGGTCGTGAGCCGCA  5336538

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  146      AGGCCAAGCTCGAGAAGCAGGGC  168
                ||||||||||| |||||||||||
Sbjct  9741307  AGGCCAAGCTCAAGAAGCAGGGC  9741329

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  13       TCTGTCGCCGTTCTCGGCGCCGTCG  37
                ||||||||||| ||||| |||||||
Sbjct  8247652  TCTGTCGCCGTCCTCGGTGCCGTCG  8247676

>PHRA:scaffold_23
Length=570991

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  358     CATGAAGGCCCATGCGAGATCTGGATTGACGACGT  392
               ||||||||||| ||||||  |||| | ||||||||
Sbjct  384857  CATGAAGGCCCGTGCGAGGCCTGGGTCGACGACGT  384891

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 40/52 (77%), Gaps = 3/52 (6%)
 Strand=Plus/Plus

Query  457     GACTACTCGGCGTGCAAGGG---CACGTGCATGCTCAAGTGGTACTGGCTGG  505
               ||||||||||| ||||||||   || |||| || ||   |  ||||||||||
Sbjct  386671  GACTACTCGGCTTGCAAGGGCGACAAGTGCTTGTTCGTCTTCTACTGGCTGG  386722

>PHCA:scaffold_24 PHYCAscaffold_24
Length=787421

 Score = 41.9 bits (45),  Expect = 0.39
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  534     GTGGCAGATCTACAAGGCCTGCATCCCGCTCTCGG  568
               ||||||| | ||||||  ||||||||||||| |||
Sbjct  170931  GTGGCAGGTGTACAAGAACTGCATCCCGCTCACGG  170965

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 100/150 (67%), Gaps = 17/150 (11%)
 Strand=Plus/Plus

Query  280     GAATGCGGCTTCACGGACCCAAAAG---CGCCGGCGCAGCCGATTCCGAAGGACGGCGCG  336
               || ||||||||||| ||||| || |   |||| | | | |||   |||| ||||||| ||
Sbjct  167719  GACTGCGGCTTCACCGACCCCAAGGGCACGCCCGTGGACCCG---CCGACGGACGGCACG  167775

Query  337     ------TTC-CGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGA  389
                     ||| |||  |  |  || |||||     || || |||||||||||| | |||||
Sbjct  167776  GCCACCTTCTCGCGTGGTATTGTGCACGCC----GGTCCGTGCGAGATCTGGTTGGACGA  167831

Query  390     CGTCAGGGTCAAGCACGGCGACAATTGCCA  419
               |   | |||   |||   |||| |||||||
Sbjct  167832  CAAGATGGTGCTGCAGAACGACGATTGCCA  167861

>PYVX:scaffold_615 pve_scaffold_615 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_615:1:18143:1 
REF
Length=18143

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 34/40 (85%), Gaps = 4/40 (10%)
 Strand=Plus/Plus

Query  35    TCGCTGTCG-CGGCGCTCGCGGCGCCCACCGCGCTAGTGG  73
             |||| |||| ||||||||||||||    ||||||||||||
Sbjct  2006  TCGCGGTCGGCGGCGCTCGCGGCG---GCCGCGCTAGTGG  2042

>PYVX:scaffold_87 pve_scaffold_87 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_87:1:57714:1 
REF
Length=57714

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  18    CGCCGTTCTCGGCGCCGTCGCTGTCGC  44
             || |||||||||||||| |||||||||
Sbjct  8998  CGTCGTTCTCGGCGCCGCCGCTGTCGC  9024

>PYUU:scaffold_2029 scf1117875582029 dna:supercontig supercontig:pug:scf1117875582029:1:1550222:1 
REF
Length=1550222

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  474     GGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
               ||||| | ||||||||||||  ||||||||||
Sbjct  465160  GGGCAAGAGCATGCTCAAGTTCTACTGGCTGG  465191

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  474     GGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
               ||||| | ||||||||||||  ||||||||||
Sbjct  467740  GGGCAAGAGCATGCTCAAGTTCTACTGGCTGG  467771

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  474     GGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
               ||||| | ||||||||||||  ||||||||||
Sbjct  473883  GGGCAAGAGCATGCTCAAGTTCTACTGGCTGG  473852

>PYAR:scaffold_231 par_scaffold_231 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_231:1:24391:1 
REF
Length=24391

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 32/38 (84%), Gaps = 3/38 (8%)
 Strand=Plus/Plus

Query  21    CGTTCTCGGCGCCGTCGCTGTCGCGGCGCTCGCGGCGC  58
             |||||||||||||||||   ||   |||||||||||||
Sbjct  5368  CGTTCTCGGCGCCGTCGTGATC---GCGCTCGCGGCGC  5402

>PHRA:scaffold_52
Length=349176

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  364     GGCCCATGCGAGATCTGGATTGACGAC  390
               ||||| |||||||||||| ||||||||
Sbjct  102606  GGCCCGTGCGAGATCTGGCTTGACGAC  102580

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 41/55 (75%), Gaps = 0/55 (0%)
 Strand=Plus/Minus

Query  279     CGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGC  333
               ||| ||||| ||||||||||| |  |   |  ||||||| |||||   |||||||
Sbjct  102694  CGACTGCGGTTTCACGGACCCGAGCGGCACACCGCAGCCCATTCCTTCGGACGGC  102640

>PHCA:scaffold_14 PHYCAscaffold_14
Length=1100894

 Score = 41.0 bits (44),  Expect = 0.39
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  14      CTGTCGCCGTTCTCGGCGCCGTCGCTGTCGCG  45
               || |||||||| ||| |||| |||||||||||
Sbjct  562242  CTCTCGCCGTTGTCGCCGCCATCGCTGTCGCG  562211

>SADI:scaffold_57 supercont1.57 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.57:1:355175:1 
REF
Length=355175

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  26      TCGGCGCCGTCGCTGTCGCGGCGC  49
               ||| ||||||||||||||||||||
Sbjct  131281  TCGACGCCGTCGCTGTCGCGGCGC  131304

>SADI:scaffold_38 supercont1.38 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.38:1:581926:1 
REF
Length=581926

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 32/39 (82%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  151    AAGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTT  189
              |||||||||||||||   |||| |||  |||| ||||||
Sbjct  85306  AAGCTCGAGAAGCAGTCGTACATGACGCCGGCCGACTTT  85344

>SADI:scaffold_6 supercont1.6 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.6:1:1296634:1 
REF
Length=1296634

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  559     CCGCTCTCGGCCAACGGTGGCGGCGCTGC  587
               |||||| || |||||| ||||||||||||
Sbjct  178309  CCGCTCCCGACCAACGTTGGCGGCGCTGC  178281

>PYVX:scaffold_866 pve_scaffold_866 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_866:1:11109:1 
REF
Length=11109

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 32/39 (82%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  25     CTCGGCGCCGTCGCTGTCGCGGCGCTCGCGGCGCCCACC  63
              ||||  |||||||||||||| ||  |||| || ||||||
Sbjct  10360  CTCGATGCCGTCGCTGTCGCTGCTGTCGCTGCTCCCACC  10398

>PYIW:scaffold_6913 piw_scaffold_6913 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_6913:1:798:1 
REF
Length=798

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 61/85 (72%), Gaps = 3/85 (4%)
 Strand=Plus/Plus

Query  245  CGGGTGCGTACAAG--CCCAACAGC-GGCGCAACCTTCGAATGCGGCTTCACGGACCCAA  301
            ||||| ||||||||  ||   | || ||||  |||  ||| |||||||||||  |||| |
Sbjct  48   CGGGTCCGTACAAGGACCGCCCGGCTGGCGGCACCGCCGAGTGCGGCTTCACCAACCCGA  107

Query  302  AAGCGCCGGCGCAGCCGATTCCGAA  326
            | ||   | |||||||| | || ||
Sbjct  108  ACGCCAAGCCGCAGCCGCTGCCAAA  132

>PYIR:scaffold_841 pir_scaffold_841 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_841:1:14641:1 
REF
Length=14641

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  317   CGATTCCGAAGGACGGCGCGTTCCGCACG  345
             |||||||  |||||| |||||||||||||
Sbjct  5244  CGATTCCCGAGGACGACGCGTTCCGCACG  5216

>PYAP:scaffold_23 pag1_scaffold_23 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_23:1:110862:1 
REF
Length=110862

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 40/50 (80%), Gaps = 3/50 (6%)
 Strand=Plus/Minus

Query  280    GAATGCGGCTTCACGGACCCAAA-AGCG--CCGGCGCAGCCGATTCCGAA  326
              || ||||||||||| |||||||| ||||  || | ||||||| | || ||
Sbjct  10845  GAGTGCGGCTTCACTGACCCAAACAGCGGCCCAGTGCAGCCGCTGCCAAA  10796

>PLHA:NW_020187034.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_113, whole genome shotgun sequence
Length=380982

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 32/39 (82%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  529    TACTCGTGGCAGATCTACAAGGCCTGCATCCCGCTCTCG  567
              || ||||||||  | |||||||||||||| || || |||
Sbjct  95133  TATTCGTGGCAAGTGTACAAGGCCTGCATTCCACTGTCG  95171

>PHSO:scaffold_3
Length=10773376

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 38/49 (78%), Gaps = 0/49 (0%)
 Strand=Plus/Minus

Query  457      GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
                ||||||||| |||||||||||   ||  ||||   ||  ||||||||||
Sbjct  6431079  GACTACTCGTCGTGCAAGGGCGACTGTCTGCTGGTGTTCTACTGGCTGG  6431031

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 38/49 (78%), Gaps = 0/49 (0%)
 Strand=Plus/Minus

Query  457      GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
                ||||||||| |||||||||||   ||  ||||   ||  ||||||||||
Sbjct  6433474  GACTACTCGTCGTGCAAGGGCGACTGTCTGCTGGTGTTCTACTGGCTGG  6433426

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 40/52 (77%), Gaps = 3/52 (6%)
 Strand=Plus/Minus

Query  457      GACTACTCGGCGTGCAAGGG---CACGTGCATGCTCAAGTGGTACTGGCTGG  505
                ||||||||||||||||||||   || |||| || |    |  ||||||||||
Sbjct  6429372  GACTACTCGGCGTGCAAGGGTGACAAGTGCCTGTTTGTCTTCTACTGGCTGG  6429321

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  14       CTGTCGCCGTTCTCGGCGCCGTCGCTGTCGCGG  46
                || |||||||  |||  ||||||||||||||||
Sbjct  2055147  CTCTCGCCGTCGTCGCTGCCGTCGCTGTCGCGG  2055179

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  14       CTGTCGCCGTTCTCGGCGCCGTCGCTGTCGCGG  46
                || |||||||  |||  ||||||||||||||||
Sbjct  2099328  CTCTCGCCGTCGTCGCTGCCGTCGCTGTCGCGG  2099360

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  14       CTGTCGCCGTTCTCGGCGCCGTCGCTGTCGCGG  46
                || |||||||  |||  ||||||||||||||||
Sbjct  2103462  CTCTCGCCGTCGTCGCTGCCGTCGCTGTCGCGG  2103430

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  353      ACACGCATGAAGGCCCATGCGAGATCTGGATTGACGAC  390
                || ||||  | ||||||||||||  |||||| ||||||
Sbjct  6425718  ACTCGCACCACGGCCCATGCGAGGCCTGGATCGACGAC  6425681

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  17       TCGCCGTTCTCGGCGCCGTCGCTGTCGCGG  46
                |||||||  |||  ||||||||||||||||
Sbjct  2102323  TCGCCGTCGTCGCTGCCGTCGCTGTCGCGG  2102294

>PHRA:scaffold_1234
Length=7828

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  364   GGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGC  417
             ||||| ||||||||||   | |||||   || | ||  |||||||||||| |||
Sbjct  2642  GGCCCCTGCGAGATCTACCTCGACGATACCATGATCCTGCACGGCGACAACTGC  2589

>PHRA:scaffold_89
Length=200592

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  364     GGCCCATGCGAGATCTGGATTGACGACGTCAGGGTCAAGCACGGCGACAATTGC  417
               ||||| ||||||||||   | |||||   || | ||  |||||||||||| |||
Sbjct  123093  GGCCCCTGCGAGATCTACCTCGACGATACCATGATCCTGCACGGCGACAACTGC  123040

>PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.4, whole genome shotgun 
sequence
Length=2787191

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  358     CATGAAGGCCCATGCGAGATCTGG  381
               ||||||||||| ||||||||||||
Sbjct  492107  CATGAAGGCCCGTGCGAGATCTGG  492130

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  355     ACGCATGAAGGCCCATGCGAGATCTGGATTGAC  387
               ||||| ||||||||||||||| | |||  ||||
Sbjct  539371  ACGCACGAAGGCCCATGCGAGGTTTGGTGTGAC  539403

>HYAP:scaffold_103 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_103:1:248444:1 
REF
Length=248444

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  26      TCGGCGCCGTCGCTGTCGCGGCGCTCGCG  54
               ||||||||| ||||  |||||||||||||
Sbjct  114180  TCGGCGCCGACGCTCACGCGGCGCTCGCG  114208

>APIN:scaffold_15 supercont1.15 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.15:1:1428119:1 
REF
Length=1428119

 Score = 40.1 bits (43),  Expect = 1.4
 Identities = 28/31 (90%), Gaps = 1/31 (3%)
 Strand=Plus/Minus

Query  86       GCGTCTTCTTGCCCGACGTCGTGTACACGGT  116
                |||||||||||||||||| || | |||||||
Sbjct  1250450  GCGTCTTCTTGCCCGACGACGCG-ACACGGT  1250421

>SADI:scaffold_23 supercont1.23 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.23:1:702007:1 
REF
Length=702007

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  25      CTCGGCGCCGTCGCTGTCGCG  45
               |||||||||||||||||||||
Sbjct  453985  CTCGGCGCCGTCGCTGTCGCG  454005

>PYVX:scaffold_1067 pve_scaffold_1067 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1067:1:7590:1 
REF
Length=7590

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  577   GGCGGCGCTGCTGCGGCACCG  597
             |||||||||||||||||||||
Sbjct  4248  GGCGGCGCTGCTGCGGCACCG  4268

>PYUU:scaffold_2013 scf1117875582013 dna:supercontig supercontig:pug:scf1117875582013:1:390037:1 
REF
Length=390037

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  193    GCGTACCTTAAGGCCAACAACTACAA  218
              |||||||| ||||||||||||| |||
Sbjct  59746  GCGTACCTCAAGGCCAACAACTTCAA  59771

>PYIR:scaffold_2122 pir_scaffold_2122 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_2122:1:3740:1 
REF
Length=3740

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 30/35 (86%), Gaps = 2/35 (6%)
 Strand=Plus/Plus

Query  279   CGAATGCGGCTTCACGGACCCAAAAGCGCCGGCGC  313
             ||| |||||||||||||||||  || | |||||||
Sbjct  2032  CGAGTGCGGCTTCACGGACCC--AACCTCCGGCGC  2064

>PYAR:scaffold_285 par_scaffold_285 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_285:1:22418:1 
REF
Length=22418

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  27    CGGCGCCGTCGCTGTCGCGGCGCTCG  52
             ||||||||||||||||  ||||||||
Sbjct  5984  CGGCGCCGTCGCTGTCATGGCGCTCG  5959

>PHRA:scaffold_123
Length=117378

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 36/46 (78%), Gaps = 0/46 (0%)
 Strand=Plus/Plus

Query  353    ACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCAGGGT  398
              || ||||  | || || |||||| ||||||||||||||  || |||
Sbjct  24813  ACTCGCACCACGGTCCGTGCGAGGTCTGGATTGACGACACCAAGGT  24858

>PHPA:scaffold_16 NW_008649002.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.16, whole genome shotgun 
sequence
Length=1156373

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 87/130 (67%), Gaps = 12/130 (9%)
 Strand=Plus/Plus

Query  449     ACAAGATTGACTACTCGGCGTGC------AAGGGCACGTGCATGCTCAAGTGGTACTGGC  502
               ||||||||||||||||| | |||      || ||    || | |||  | |||| |||| 
Sbjct  489135  ACAAGATTGACTACTCGTCCTGCGAAAAGAAAGGTGGCTGTACGCTTTATTGGTTCTGGT  489194

Query  503     TGGGCATCCGCCCGACGGGCAAGA---GCTACTCGTGGCAGATCTACAAGGCCTGCATCC  559
               |||| ||||||      |  ||||   |||  || |||||  | |||||||  ||| |||
Sbjct  489195  TGGGAATCCGC---TTTGTAAAGAGCCGCTGGTCCTGGCAAGTTTACAAGGAGTGCGTCC  489251

Query  560     CGCTCTCGGC  569
               ||||  ||||
Sbjct  489252  CGCTAACGGC  489261

>PHIF:NW_003303741.1 Phytophthora infestans T30-4 supercont1.18 
genomic scaffold, whole genome shotgun sequence
Length=2518706

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 63/91 (69%), Gaps = 0/91 (0%)
 Strand=Plus/Minus

Query  283      TGCGGCTTCACGGACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGCGTTCCGC  342
                || ||||| || || |  ||||  ||  |||  || ||||| || ||||| ||| |  | 
Sbjct  1575565  TGTGGCTTAACCGAGCTGAAAGGCCCACCGCGACCCATTCCAAAAGACGGTGCGATGAGA  1575506

Query  343      ACGTCAGGGTACACGCATGAAGGCCCATGCG  373
                 |  | || ||||||||||| || || ||||
Sbjct  1575505  TCCACCGGCTACACGCATGACGGACCGTGCG  1575475

>PHCA:scaffold_4 PHYCAscaffold_4
Length=1587695

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  10      CACTCTGTCGCCGTTCTCGGCGCCGTCGCTG  40
               |||||  ||||||||||| ||||||||| ||
Sbjct  365172  CACTCGCTCGCCGTTCTCTGCGCCGTCGTTG  365202

>PHCA:scaffold_3 PHYCAscaffold_3
Length=1611504

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 32/38 (84%), Gaps = 1/38 (3%)
 Strand=Plus/Plus

Query  301     AAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCGCGTT  338
               ||||||||  ||||||| ||| ||  ||||||||||||
Sbjct  274073  AAAGCGCCA-CGCAGCCCATTACGTGGGACGGCGCGTT  274109

>SAPA:scaffold_5 supercont2.5 dna:supercontig supercontig:ASM15154v2:supercont2.5:1:1129684:1 
REF
Length=1129684

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  152     AGCTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTT  189
               ||||||||||||||   |||| |||  |||| ||||||
Sbjct  631541  AGCTCGAGAAGCAGTCGTACATGACGCCGGCCGACTTT  631578

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  520      GGCAAGAGCTACTCGTGGCAGAT  542
                ||||||| |||||||||||||||
Sbjct  1062026  GGCAAGAACTACTCGTGGCAGAT  1062048

>SADI:scaffold_7 supercont1.7 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.7:1:1218947:1 
REF
Length=1218947

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  341     GCACGTCAGGGTACACGCATGAAGGCCC  368
               |||||||| |||||||||||||  ||||
Sbjct  388069  GCACGTCAAGGTACACGCATGATTGCCC  388096

>PYVX:scaffold_885 pve_scaffold_885 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_885:1:10708:1 
REF
Length=10708

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 32/39 (82%), Gaps = 3/39 (8%)
 Strand=Plus/Minus

Query  6    CCTTCACTCTGTCGCCGTTCTCGGCGCCGTCGCTGTCGC  44
            |||||||   |||||||| ||  | ||||||||||||||
Sbjct  369  CCTTCAC---GTCGCCGTCCTGCGAGCCGTCGCTGTCGC  334

>PYVX:scaffold_689 pve_scaffold_689 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_689:1:15702:1 
REF
Length=15702

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 40/51 (78%), Gaps = 4/51 (8%)
 Strand=Plus/Minus

Query  18     CGCCGTTCTCGGCGCCGT-CGCTGTCGCGGCGCTCGCGGCGCCCACCGCGC  67
              ||||| || ||||||  | ||| |||||||||||||| |    ||||||||
Sbjct  12893  CGCCGCTCGCGGCGCTCTGCGCGGTCGCGGCGCTCGCCG---GCACCGCGC  12846

>PYVX:scaffold_302 pve_scaffold_302 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_302:1:30845:1 
REF
Length=30845

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  26    TCGGCGCCGTCGCTGTCGCGGCGCTCGCGGCGC  58
             ||| || |||||| | |||| ||||||||||||
Sbjct  2438  TCGTCGTCGTCGCGGCCGCGACGCTCGCGGCGC  2406

>PYVX:scaffold_48 pve_scaffold_48 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_48:1:73364:1 
REF
Length=73364

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 40/53 (75%), Gaps = 0/53 (0%)
 Strand=Plus/Plus

Query  600    CACAACCACAGCAGCTCCGGCCGTGGCAGAGAAGCCCGTCGCGGGCGAGGCCA  652
              |||||| ||| ||||  | || |  |  || ||| ||||||||||||| ||||
Sbjct  42618  CACAACGACATCAGCCGCTGCTGCAGGGGACAAGACCGTCGCGGGCGACGCCA  42670

>PYVX:scaffold_21 pve_scaffold_21 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_21:1:91492:1 
REF
Length=91492

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  27     CGGCGCCGTCGCTGTCGCGGCGCTCGCG  54
              |||||||||||| |||| || |||||||
Sbjct  23509  CGGCGCCGTCGCGGTCGTGGAGCTCGCG  23482

>PYUU:scaffold_1381 scf1117875581381 dna:supercontig supercontig:pug:scf1117875581381:1:502691:1 
REF
Length=502691

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  98     CCGACGTCGTGTACACGGTCGCG  120
              |||||||||||||| ||||||||
Sbjct  59670  CCGACGTCGTGTACTCGGTCGCG  59692

>PYUU:scaffold_2018 scf1117875582018 dna:supercontig supercontig:pug:scf1117875582018:1:689162:1 
REF
Length=689162

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  597     GAACACAACCACAGCAGCTCCGGCCGTG  624
               |||| ||||| |||||||||||| ||||
Sbjct  427542  GAACCCAACCCCAGCAGCTCCGGACGTG  427569

>PYUU:scaffold_2035 scf1117875582035 dna:supercontig supercontig:pug:scf1117875582035:1:696189:1 
REF
Length=696189

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  17      TCGCCGTTCTCGGCGCCGTCGCTGTCGC  44
               ||| |||||||  |||||||||||||||
Sbjct  594126  TCGTCGTTCTCTTCGCCGTCGCTGTCGC  594153

>PYIR:scaffold_785 pir_scaffold_785 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_785:1:15746:1 
REF
Length=15746

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 51/69 (74%), Gaps = 3/69 (4%)
 Strand=Plus/Minus

Query  65    CGCTAGTGGAGGCCCACCAGCGCGTCTTCTTGCCCGACGTCGTGTACACGGTCGCGAACC  124
             |||||| |||| |||| | |||||  |   ||  |||  ||| |  ||| ||||||| ||
Sbjct  1872  CGCTAGAGGAGACCCAGC-GCGCGATTG--TGGGCGAGATCGCGATCACCGTCGCGATCC  1816

Query  125   GCAACACGA  133
             |||||||||
Sbjct  1815  GCAACACGA  1807

>PYAR:scaffold_1208 par_scaffold_1208 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1208:1:9680:1 
REF
Length=9680

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  628  GAGAAGCCCGTCGCGGGCGAGGCCAGTT  655
            || ||||||||||| ||||| |||||||
Sbjct  152  GAAAAGCCCGTCGCCGGCGAAGCCAGTT  179

>PHSO:scaffold_78
Length=2739

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  14    CTGTCGCCGTTCTCGGCGCCGTCGCTGTCGCGG  46
             || |||||||  |||  ||||||||||||||||
Sbjct  1348  CTCTCGCCGTCGTCGCTGCCGTCGCTGTCGCGG  1316

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  17   TCGCCGTTCTCGGCGCCGTCGCTGTCGCGG  46
            |||||||  |||  ||||||||||||||||
Sbjct  209  TCGCCGTCGTCGCTGCCGTCGCTGTCGCGG  180

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  17    TCGCCGTTCTCGGCGCCGTCGCTGTCGCGG  46
             |||||||  |||  ||||||||||||||||
Sbjct  2481  TCGCCGTCGTCGCTGCCGTCGCTGTCGCGG  2452

>PHRA:scaffold_29
Length=529199

 Score = 38.3 bits (41),  Expect = 4.8
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  358     CATGAAGGCCCATGCGAGATCTGGATTGACGAC  390
               || || ||||| ||||||||||||  |||||||
Sbjct  453471  CACGACGGCCCGTGCGAGATCTGGTGTGACGAC  453503

>SAPA:scaffold_3 supercont2.3 dna:supercontig supercontig:ASM15154v2:supercont2.3:1:1275006:1 
REF
Length=1275006

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  37     GCTGTCGCGGCGCTCGCGGCGCCCA  61
              ||||  |||||||||||||||||||
Sbjct  52843  GCTGAGGCGGCGCTCGCGGCGCCCA  52867

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  37     GCTGTCGCGGCGCTCGCGGCGCCCA  61
              ||||  |||||||||||||||||||
Sbjct  54231  GCTGAGGCGGCGCTCGCGGCGCCCA  54207

>SADI:scaffold_107 supercont1.107 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.107:1:154773:1 
REF
Length=154773

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  150    CAAGCTCGAGAAGCAGGGCTACAAG  174
              |||||||| | ||||||||||||||
Sbjct  52265  CAAGCTCGCGGAGCAGGGCTACAAG  52289

>SADI:scaffold_4 supercont1.4 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.4:1:1391842:1 
REF
Length=1391842

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  295     GACCCAAAAGCGCCGGCGCAGCCGA  319
               || ||||||| ||||||||||||||
Sbjct  384520  GATCCAAAAGTGCCGGCGCAGCCGA  384544

>PYVX:scaffold_1228 pve_scaffold_1228 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1228:1:5612:1 
REF
Length=5612

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  30    CGCCGTCGCTGTCGCGGCGCTCGCG  54
             ||||||||||| |||| ||||||||
Sbjct  2941  CGCCGTCGCTGACGCGCCGCTCGCG  2917

>PYVX:scaffold_1184 pve_scaffold_1184 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1184:1:6076:1 
REF
Length=6076

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  27    CGGCGCCGTCGCTGTCGCGGCGCTC  51
             |||| ||||| ||||||||||||||
Sbjct  2111  CGGCTCCGTCACTGTCGCGGCGCTC  2135

>PYVX:scaffold_537 pve_scaffold_537 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_537:1:20546:1 
REF
Length=20546

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 31/37 (84%), Gaps = 1/37 (3%)
 Strand=Plus/Minus

Query  4     TCCCTTCACTCTGTCGCCGTTCTCGGCGCCGTCGCTG  40
             ||||||||||| |||||| | | || |||| ||||||
Sbjct  3920  TCCCTTCACTCGGTCGCCCTGCCCGCCGCC-TCGCTG  3885

>PYVX:scaffold_130 pve_scaffold_130 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_130:1:48274:1 
REF
Length=48274

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  44     CGGCGCTCGCGGCGCCCACCGCGCT  68
              ||||||||||||||| ||| |||||
Sbjct  14126  CGGCGCTCGCGGCGCGCACGGCGCT  14102

>PYVX:scaffold_98 pve_scaffold_98 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_98:1:54692:1 
REF
Length=54692

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  14     CTGTCGCCGTTCTCGGCGCCGTCGCTGTCG  43
              |||||| ||| |||| || |||||||||||
Sbjct  48693  CTGTCGTCGTCCTCGACGTCGTCGCTGTCG  48722

>PYVX:scaffold_12 pve_scaffold_12 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_12:1:106792:1 
REF
Length=106792

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  25     CTCGGCGCCGTCGCTGTCGC  44
              ||||||||||||||||||||
Sbjct  65570  CTCGGCGCCGTCGCTGTCGC  65551

>PYUU:scaffold_1789 scf1117875581789 dna:supercontig supercontig:pug:scf1117875581789:1:837833:1 
REF
Length=837833

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 38/50 (76%), Gaps = 0/50 (0%)
 Strand=Plus/Plus

Query  457     GACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGG  506
               |||| |||| | || ||||| |||||||||||      ||||||||| ||
Sbjct  698525  GACTTCTCGTCCTGTAAGGGGACGTGCATGCTGCGCATGTACTGGCTTGG  698574

>PYUU:scaffold_2031 scf1117875582031 dna:supercontig supercontig:pug:scf1117875582031:1:1316296:1 
REF
Length=1316296

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  33      CGTCGCTGTCGCGGCGCTCGCGGCGCCCAC  62
               |||| |||||| ||| || |||||||||||
Sbjct  509388  CGTCTCTGTCGTGGCACTGGCGGCGCCCAC  509359

>PYIW:scaffold_878 piw_scaffold_878 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_878:1:13019:1 
REF
Length=13019

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  213  CTACAAGACCCTCCGCGAGTTCATG  237
            ||||||| | |||||||||||||||
Sbjct  221  CTACAAGTCGCTCCGCGAGTTCATG  245

>PYIW:scaffold_75 piw_scaffold_75 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_75:1:33282:1 
REF
Length=33282

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  37     GCTGTCGCGGCGCTCGCGGCGCCCACCGCG  66
              ||||| || ||||||||||||| || ||||
Sbjct  32050  GCTGTTGCTGCGCTCGCGGCGCGCAACGCG  32079

>PYIR:scaffold_976 pir_scaffold_976 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_976:1:12025:1 
REF
Length=12025

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  214   TACAAGACCCTCCGCGAGTTCATGGACAAG  243
             |||||| | ||||| ||| |||||||||||
Sbjct  6912  TACAAGTCGCTCCGTGAGCTCATGGACAAG  6941

>PYIR:scaffold_922 pir_scaffold_922 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_922:1:13027:1 
REF
Length=13027

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  364  GGCCCATGCGAGATCTGGATTGACGACGTC  393
            ||||| ||||||||||||||  |||| |||
Sbjct  159  GGCCCTTGCGAGATCTGGATCAACGAGGTC  130

>PYAR:scaffold_1362 par_scaffold_1362 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1362:1:8841:1 
REF
Length=8841

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  516   GACGGGCAAGAGCTACTCGT  535
             ||||||||||||||||||||
Sbjct  3107  GACGGGCAAGAGCTACTCGT  3126

>PYAP:scaffold_33 pag1_scaffold_33 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_33:1:100549:1 
REF
Length=100549

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  142    CCGCAGGCCAAGCTCGAGAAGCAGG  166
              ||||||| ||||| |||||||||||
Sbjct  21748  CCGCAGGACAAGCCCGAGAAGCAGG  21772

>PHRA:scaffold_266
Length=32176

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  375    GATCTGGATTGACGACGTCAGGGTC  399
              ||||||||||||| |||||| ||||
Sbjct  23983  GATCTGGATTGACCACGTCAAGGTC  24007

>PHRA:scaffold_62
Length=334142

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  209     ACAACTACAAGACCCTCCGCGAGTTCATGG  238
               |||||||| |||  | ||||||||||||||
Sbjct  286671  ACAACTACCAGAAACGCCGCGAGTTCATGG  286642

>PHIF:NW_003303506.1 Phytophthora infestans T30-4 supercont1.253 
genomic scaffold, whole genome shotgun sequence
Length=123523

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  358   CATGAAGGCCCATGCGAGATCTGGATTGACGACGT  392
             || ||||| ||||||||||| |||   ||||||||
Sbjct  2169  CACGAAGGTCCATGCGAGATTTGGTGCGACGACGT  2203

>PHCA:scaffold_8 PHYCAscaffold_8
Length=1194346

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 38/50 (76%), Gaps = 0/50 (0%)
 Strand=Plus/Minus

Query  456     TGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGG  505
               |||||| ||| |||||||||||   ||| || ||  ||  |||||| |||
Sbjct  823956  TGACTATTCGTCGTGCAAGGGCGACTGCCTGTTCTCGTTCTACTGGTTGG  823907

>HYAP:scaffold_59 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_59:1:376122:1 
REF
Length=376122

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 56/80 (70%), Gaps = 0/80 (0%)
 Strand=Plus/Plus

Query  479     CGTGCATGCTCAAGTGGTACTGGCTGGGCATCCGCCCGACGGGCAAGAGCTACTCGTGGC  538
               ||||||  |||  |||||||||||| ||||| |     | ||     | |||||||||||
Sbjct  161631  CGTGCACCCTCCGGTGGTACTGGCTCGGCATTCAGTACATGGATGGTATCTACTCGTGGC  161690

Query  539     AGATCTACAAGGCCTGCATC  558
               || | || |||  ||| |||
Sbjct  161691  AGGTGTATAAGAACTGTATC  161710

>HYAP:scaffold_5 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_5:1:1104709:1 
REF
Length=1104709

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  28      GGCGCCGTCGCTGTCGCGGCGCTCG  52
               |||||||||||||||  ||||||||
Sbjct  510784  GGCGCCGTCGCTGTCATGGCGCTCG  510808

>APIN:scaffold_234 supercont1.234 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.234:1:27745:1 
REF
Length=27745

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 28/32 (88%), Gaps = 1/32 (3%)
 Strand=Plus/Plus

Query  12     CTCTGTCGCCGTTCTCGGCGCCGTCGCTGTCG  43
              |||| || ||||||  ||||||||||||||||
Sbjct  18640  CTCT-TCTCCGTTCGTGGCGCCGTCGCTGTCG  18670

>APIN:scaffold_19 supercont1.19 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.19:1:1079871:1 
REF
Length=1079871

 Score = 37.4 bits (40),  Expect = 4.8
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  42     CGCGGCGCTCGCGGCGCCCACCGCG  66
              ||||||||||||| | |||||||||
Sbjct  16189  CGCGGCGCTCGCGACTCCCACCGCG  16213

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 844668289824

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2