Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
PHPA:scaffold_6324296524357961512300.0
PHIF:NW_003303697.13586353592336087150.0
PHCA:scaffold_8493698943006036665e-170
PHRA:scaffold_561624631630405786093e-154
PHSO:scaffold_1279134427919586156054e-153
PHKE:scaffold_9858644592586195418e-136
PHSO:scaffold_148188188193565413592e-86
PHRA:scaffold_7925675262065363451e-82
PHRA:scaffold_267928698205373318e-79
PHSO:scaffold_3518134186094783231e-76
PHSO:scaffold_56819876824624783231e-76
PHRA:scaffold_10612932134355063191e-75
PHCA:scaffold_79054729059654963049e-72
PYVX:scaffold_27514403149585562971e-69
PHPA:scaffold_226853366858505172916e-68
PHKE:scaffold_622347540095392892e-67
PHKE:scaffold_7613899155292803e-65
PHSO:scaffold_4436489543653614692751e-63
PHSO:scaffold_6437942383133722672e-61
PHIF:NW_003303730.16969186973984832481e-56
PHSO:scaffold_11202247220228904362398e-54
PHPA:scaffold_661626211631054852143e-47
PHPA:scaffold_46348239664852143e-47
PHSO:scaffold_121684211688304152081e-45
PHIF:NW_003303626.12670372675395052074e-45
PYUU:scaffold_2037129596412963553981918e-41
PHCA:scaffold_672193522197003521831e-38
PHPA:scaffold_203635873640654871782e-37
PYIR:scaffold_2249144918464061698e-35
PYIR:scaffold_50241546224811673e-34
PHRA:scaffold_333707183710663491413e-27
PHPA:scaffold_391499981503483511403e-27
PYIR:scaffold_48282516073651335e-25
PYAP:scaffold_560807584994281312e-24
PHKE:scaffold_35414475148093391296e-24
PHRA:scaffold_1051546731549272571232e-22
PLHA:NW_020187034.194829951803571222e-22
PHRA:scaffold_2892151618633491171e-20
PHRA:scaffold_494815284993491171e-20
PYIR:scaffold_81105341109364141114e-19
PHPA:scaffold_164888374892624291092e-18
PYIW:scaffold_711543056572321042e-17
PLHA:NW_020189073.134753350933471042e-17
PYAP:scaffold_18216751939269959e-15
PYAR:scaffold_345924432567128923e-14
PHIF:NW_003303747.127485812748747167923e-14
PHIF:NW_003303391.18025480420167871e-12
PHIF:NW_003303741.115753941575670277832e-11
PHIF:NW_003304531.153960567596e-05
PHSO:scaffold_16524318524427113586e-05
APAS:scaffold_4930265130270454586e-05
HYAP:scaffold_5916160916170193562e-04
SAPA:scaffold_1945083145088454530.002
SADI:scaffold_26425430754530.002
PYUU:scaffold_202950352750358660500.008
PYIR:scaffold_452241162416954480.029
PHPA:scaffold_460496613120480.029
PHIF:NW_003303753.12170783217081634480.029
PHRA:scaffold_5210264110269252470.10
PHRA:scaffold_423695923700446470.10
PHRA:scaffold_2943740443743330450.35
PHPA:scaffold_51018556101861864450.35
PHKE:scaffold_250202742029825450.35
PHPA:scaffold_76439334397038440.35
PHCA:scaffold_2239676039679738440.35
APIN:scaffold_991090891096962440.35
PYVX:scaffold_341236572371054431.2
PYIW:scaffold_87838745165431.2
PYAR:scaffold_445267172454431.2
PYAR:scaffold_212201322019059431.2
PHRA:scaffold_8912927512934369431.2
PHCA:scaffold_5014985814988124431.2
PHCA:scaffold_1164938664941934431.2
PYVX:scaffold_121220452211571421.2
PHKE:scaffold_3993083530973141421.2
PHIF:NW_003303738.11287058128708831421.2
APAS:scaffold_6920111820114831421.2
PYIW:scaffold_12003657367923414.3
PYIR:scaffold_201359693599123414.3
PHSO:scaffold_72907770290780233414.3
PHRA:scaffold_3728539428546271414.3
PHCA:scaffold_2416924516926723414.3
HYAP:scaffold_852226152229838414.3
PYVX:scaffold_10701499155860404.3
PYAP:scaffold_94420524211160404.3
PHRA:scaffold_63678576788125404.3
PHKE:scaffold_14865711155404.3
PHKE:scaffold_112713215727404.3
PHKE:scaffold_474160241606746404.3
PHKE:scaffold_211172391728446404.3
PHKE:scaffold_3612058112060627404.3
PHIF:NW_003303743.11481145148119551404.3
BLASTN 2.9.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= PPTG_17122

Length=615
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 ...  1110       0.0   
PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 ge...  645        0.0   
PHCA:scaffold_84 PHYCAscaffold_84                                     601        5e-170
PHRA:scaffold_56                                                      550        3e-154
PHSO:scaffold_1                                                       546        4e-153
PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercon...  489        8e-136
PHSO:scaffold_14                                                      324        2e-86 
PHRA:scaffold_79                                                      312        1e-82 
PHRA:scaffold_267                                                     299        8e-79 
PHSO:scaffold_35                                                      292        1e-76 
PHSO:scaffold_5                                                       292        1e-76 
PHRA:scaffold_106                                                     288        1e-75 
PHCA:scaffold_7 PHYCAscaffold_7                                       275        9e-72 
PYVX:scaffold_275 pve_scaffold_275 dna:supercontig supercontig:pv...  269        1e-69 
PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 ...  263        6e-68 
PHKE:scaffold_622 scf_22126_622.1 dna:supercontig supercontig:Phy...  261        2e-67 
PHKE:scaffold_761 scf_22126_761.1_contig_1 dna:supercontig superc...  253        3e-65 
PHSO:scaffold_4                                                       249        1e-63 
PHSO:scaffold_64                                                      242        2e-61 
PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 ge...  224        1e-56 
PHSO:scaffold_11                                                      216        8e-54 
PHPA:scaffold_66 NW_008649052.1 Phytophthora parasitica INRA-310 ...  194        3e-47 
PHPA:scaffold_46 NW_008649032.1 Phytophthora parasitica INRA-310 ...  194        3e-47 
PHSO:scaffold_12                                                      188        1e-45 
PHIF:NW_003303626.1 Phytophthora infestans T30-4 supercont1.133 g...  187        4e-45 
PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:p...  173        8e-41 
PHCA:scaffold_67 PHYCAscaffold_67                                     166        1e-38 
PHPA:scaffold_20 NW_008649006.1 Phytophthora parasitica INRA-310 ...  161        2e-37 
PYIR:scaffold_2249 pir_scaffold_2249 dna:supercontig supercontig:...  153        8e-35 
PYIR:scaffold_5024 pir_scaffold_5024 dna:supercontig supercontig:...  151        3e-34 
PHRA:scaffold_33                                                      128        3e-27 
PHPA:scaffold_39 NW_008649025.1 Phytophthora parasitica INRA-310 ...  127        3e-27 
PYIR:scaffold_4828 pir_scaffold_4828 dna:supercontig supercontig:...  121        5e-25 
PYAP:scaffold_560 pag1_scaffold_560 dna:supercontig supercontig:p...  119        2e-24 
PHKE:scaffold_354 scf_22126_354.1_contig_1 dna:supercontig superc...  117        6e-24 
PHRA:scaffold_105                                                     112        2e-22 
PLHA:NW_020187034.1 Plasmopara halstedii genome assembly, contig:...  111        2e-22 
PHRA:scaffold_2892                                                    106        1e-20 
PHRA:scaffold_494                                                     106        1e-20 
PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_sc...  101        4e-19 
PHPA:scaffold_16 NW_008649002.1 Phytophthora parasitica INRA-310 ...  99.6       2e-18 
PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:pi...  95.1       2e-17 
PLHA:NW_020189073.1 Plasmopara halstedii genome assembly, contig:...  95.1       2e-17 
PYAP:scaffold_182 pag1_scaffold_182 dna:supercontig supercontig:p...  86.9       9e-15 
PYAR:scaffold_3459 par_scaffold_3459 dna:supercontig supercontig:...  84.2       3e-14 
PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 ge...  84.2       3e-14 
PHIF:NW_003303391.1 Phytophthora infestans T30-4 supercont1.368 g...  79.7       1e-12 
PHIF:NW_003303741.1 Phytophthora infestans T30-4 supercont1.18 ge...  76.1       2e-11 
PHIF:NW_003304531.1 Phytophthora infestans T30-4 supercont1.4149 ...  54.5       6e-05 
PHSO:scaffold_16                                                      53.6       6e-05 
APAS:scaffold_49 supercont1.49 dna:supercontig supercontig:Apha_a...  53.6       6e-05 
HYAP:scaffold_59 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_5...  51.8       2e-04 
SAPA:scaffold_19 supercont2.19 dna:supercontig supercontig:ASM151...  49.1       0.002 
SADI:scaffold_264 supercont1.264 dna:supercontig supercontig:Sap_...  49.1       0.002 
PYUU:scaffold_2029 scf1117875582029 dna:supercontig supercontig:p...  46.4       0.008 
PYIR:scaffold_452 pir_scaffold_452 dna:supercontig supercontig:pi...  44.6       0.029 
PHPA:scaffold_460 NW_008649446.1 Phytophthora parasitica INRA-310...  44.6       0.029 
PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 gen...  44.6       0.029 
PHRA:scaffold_52                                                      43.7       0.10  
PHRA:scaffold_4                                                       43.7       0.10  
PHRA:scaffold_29                                                      41.9       0.35  
PHPA:scaffold_5 NW_008648991.1 Phytophthora parasitica INRA-310 u...  41.9       0.35  
PHKE:scaffold_250 scf_22126_250.1 dna:supercontig supercontig:Phy...  41.9       0.35  
PHPA:scaffold_76 NW_008649062.1 Phytophthora parasitica INRA-310 ...  41.0       0.35  
PHCA:scaffold_22 PHYCAscaffold_22                                     41.0       0.35  
APIN:scaffold_9 supercont1.9 dna:supercontig supercontig:Apha_inv...  41.0       0.35  
PYVX:scaffold_341 pve_scaffold_341 dna:supercontig supercontig:pv...  40.1       1.2   
PYIW:scaffold_878 piw_scaffold_878 dna:supercontig supercontig:pi...  40.1       1.2   
PYAR:scaffold_4452 par_scaffold_4452 dna:supercontig supercontig:...  40.1       1.2   
PYAR:scaffold_212 par_scaffold_212 dna:supercontig supercontig:pa...  40.1       1.2   
PHRA:scaffold_89                                                      40.1       1.2   
PHCA:scaffold_50 PHYCAscaffold_50                                     40.1       1.2   
PHCA:scaffold_11 PHYCAscaffold_11                                     40.1       1.2   
PYVX:scaffold_121 pve_scaffold_121 dna:supercontig supercontig:pv...  39.2       1.2   
PHKE:scaffold_399 scf_22126_399.1 dna:supercontig supercontig:Phy...  39.2       1.2   
PHIF:NW_003303738.1 Phytophthora infestans T30-4 supercont1.21 ge...  39.2       1.2   
APAS:scaffold_69 supercont1.69 dna:supercontig supercontig:Apha_a...  39.2       1.2   
PYIW:scaffold_1200 piw_scaffold_1200 dna:supercontig supercontig:...  38.3       4.3   
PYIR:scaffold_201 pir_scaffold_201 dna:supercontig supercontig:pi...  38.3       4.3   
PHSO:scaffold_7                                                       38.3       4.3   
PHRA:scaffold_37                                                      38.3       4.3   
PHCA:scaffold_24 PHYCAscaffold_24                                     38.3       4.3   
HYAP:scaffold_8 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_8:...  38.3       4.3   
PYVX:scaffold_1070 pve_scaffold_1070 dna:supercontig supercontig:...  37.4       4.3   
PYAP:scaffold_94 pag1_scaffold_94 dna:supercontig supercontig:pag...  37.4       4.3   
PHRA:scaffold_63                                                      37.4       4.3   
PHKE:scaffold_1486 scf_22126_1486.1_contig_1 dna:supercontig supe...  37.4       4.3   
PHKE:scaffold_1127 scf_22126_1127.1_contig_1 dna:supercontig supe...  37.4       4.3   
PHKE:scaffold_474 scf_22126_474.1 dna:supercontig supercontig:Phy...  37.4       4.3   
PHKE:scaffold_211 scf_22126_211.1_contig_1 dna:supercontig superc...  37.4       4.3   
PHKE:scaffold_36 scf_22126_36.1 dna:supercontig supercontig:PhyKe...  37.4       4.3   
PHIF:NW_003303743.1 Phytophthora infestans T30-4 supercont1.16 ge...  37.4       4.3   

>PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.63, whole genome shotgun 
sequence
Length=342508

 Score = 1110 bits (1230),  Expect = 0.0
 Identities = 615/615 (100%), Gaps = 0/615 (0%)
 Strand=Plus/Minus

Query  1       ATGGCTCCTTCTCTACTTTCGTCCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  243579  ATGGCTCCTTCTCTACTTTCGTCCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTA  243520

Query  61      CTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACT  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  243519  CTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACT  243460

Query  121     GATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACC  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  243459  GATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACC  243400

Query  181     GTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATG  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  243399  GTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATG  243340

Query  241     GACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTC  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  243339  GACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTC  243280

Query  301     AACGCCGCACCTCAGCCCATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGAT  360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  243279  AACGCCGCACCTCAGCCCATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGAT  243220

Query  361     GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAG  420
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  243219  GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAG  243160

Query  421     ACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTT  480
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  243159  ACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTT  243100

Query  481     CGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAG  540
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  243099  CGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAG  243040

Query  541     GCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCGAACGAATCGGTC  600
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  243039  GCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCGAACGAATCGGTC  242980

Query  601     GCCTTGGAGGTTTAA  615
               |||||||||||||||
Sbjct  242979  GCCTTGGAGGTTTAA  242965

 Score = 309 bits (342),  Expect = 5e-82
 Identities = 387/529 (73%), Gaps = 9/529 (2%)
 Strand=Plus/Plus

Query  74      CCAATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACTGATAACAAGGACA  133
               ||||||||||||| |||||| |  || |||| || || ||||| || ||  |||||||||
Sbjct  241985  CCAATGCCCACCAGGTTGTGTTGTTGTCAGCGCCTACGTACACTACGGACGACAAGGACA  242044

Query  134     CTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCA  193
               | ||||| || ||  | || ||| ||||  | ||||| | || |||    ||||| ||||
Sbjct  242045  CCAAGTACGCCCCTCTCGCATTCTTGGAAGATCAGGGTTTCGCGACACAAGAGGACTTCA  242104

Query  194     ACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGT  253
                 |  ||||||    |||| || ||  |  | ||||||| |||||  ||  | |||  ||
Sbjct  242105  CAGCCTGGCGCAAGGACAATGGTTATGATTCTCTGCGTGCCTTCAACGATGGTGCCTCGT  242164

Query  254     ACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTC  313
               |||| || | ||| || || ||   |  ||| || ||||| ||| |||| |  |    ||
Sbjct  242165  ACACTGTGAGTGACGGTGCTGATCTCACCTGTGGCTTCACCAACATCAATGGAGACGTTC  242224

Query  314     AGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTG  370
               ||||||||||||| || |   | ||||| || || || ||||| ||||| || |||||||
Sbjct  242225  AGCCCATTCCGGATGGCAACGCTATGCGTTCGACTGGGTACACGCACGACGGCCCGTGTG  242284

Query  371     AGGTTTGGCT---CGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCA  427
               |||| |||||   ||||||||     ||  | ||||  ||||||||||| ||  ||||||
Sbjct  242285  AGGTGTGGCTGGACGACACCA---TGGTCATGCAGTACGACAACTGCCATGAAGCCATCA  242341

Query  428     GTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGT  487
               |||||||    ||||   | ||||| |||||||||||    |||||||||||   |||||
Sbjct  242342  GTGGCAAATACTACACGATCGACTATAGCTCGTGCACGTCCACCTGCACACTCTATTGGT  242401

Query  488     ACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCA  547
                ||||||||| || |||||||| ||||| |  |||||||||||||| |||||||| ||  
Sbjct  242402  TCTGGCTGGGTGTCCGCTACCTGAAGAACGAATACTCGTGGCAGATTTACAAGGCCTGTG  242461

Query  548     TCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCGAACGAATC  596
               |||| |||||  |||| ||||| || |||||| |||| || ||||||||
Sbjct  242462  TCCCCCTTTCCACTTCTGCTCGCCGTCTTGAGGGTGCGGCCAACGAATC  242510

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 143/208 (69%), Gaps = 22/208 (11%)
 Strand=Plus/Minus

Query  344     CGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCA--AACGCGTGCTCCA  401
               |||| || || |  ||||| ||||| ||||| ||||| |||  ||  || | || |||  
Sbjct  244917  CGGGATATACGCTGGATGGCCCGTGCGAGGTCTGGCTGGACGACACGAAGGTGTCCTCGG  244858

Query  402     GTCGGACAACTGCCACGA-GA---CCATCAGTGGCAAGACTTACAACCTTGACTACAGCT  457
               | ||  ||||||||||   ||   || |||  ||| ||  | |   |   ||||||||||
Sbjct  244857  GCCG--CAACTGCCACACCGAATTCCCTCAC-GGCCAGCATGAGGTC---GACTACAGCT  244804

Query  458     CGTGCACTGGTA--CCTGCACACT-TCGTTGGTACTGGCTGGGCGTACGCTACCTCAAG-  513
               | |||   || |  | |||||||| |||| |||| ||||| ||| |    ||| |  || 
Sbjct  244803  CATGCG--GGAAGGCGTGCACACTCTCGT-GGTATTGGCTCGGCATTAAGTACATTGAGG  244747

Query  514     -AATGCCTACTCGTGGCAGATCTACAAG  540
                |||  ||||||||||||| ||||||||
Sbjct  244746  GAAT--CTACTCGTGGCAGGTCTACAAG  244721

>PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 
genomic scaffold, whole genome shotgun sequence
Length=695754

 Score = 645 bits (715),  Expect = 0.0
 Identities = 507/608 (83%), Gaps = 9/608 (1%)
 Strand=Plus/Minus

Query  1       ATGGCTCCTTCTCTACTTTCGTCCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTA  60
               |||||||||||  || ||||||| ||   |||||||||||||||||| ||||  | ||| 
Sbjct  359233  ATGGCTCCTTCCGTATTTTCGTCGCTTGTCGTGGCTGCTGTGCTTTCTAGCGGTGAGCTG  359174

Query  61      CTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACT  120
               || || |||||| |||  || ||||||||||| || || ||| ||||||||||||| || 
Sbjct  359173  CTCGCCCCCACGGCCACCGCTCACCAAGTTGTCCTGCTACCATCCCCGACCTACACAACC  359114

Query  121     GATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACC  180
               ||| | |||||||| || ||||||||  || |||| ||||||  ||||||||||||||||
Sbjct  359113  GATGATAAGGACACGAAATATGCACCTCTGACCTTTCTGGAGGGCCAGGGATACGAGACC  359054

Query  181     GTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATG  240
               |||||||| || ||||| ||||| |||||||||||||| ||||| |||||||||||||||
Sbjct  359053  GTCGAGGACTTTAACGGCTGGCGTCGCAACAACGGGTATAAGACTCTGCGTGACTTCATG  358994

Query  241     GACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTC  300
               ||         |||||||||| | |||||||| ||||| ||||| || |||||||| || 
Sbjct  358993  GA---------GTACACCGTCGCGGATGGAGCCGACTATTACTGTGGCTTCACGAATGTT  358943

Query  301     AACGCCGCACCTCAGCCCATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGAT  360
               |||||||| || || || | |||||||||| ||||||| |||||||| ||||| ||||||
Sbjct  358942  AACGCCGCTCCGCAACCTAATCCGGACGGAGCAATGCGTTCCACGGGCTACACACACGAT  358883

Query  361     GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAG  420
               || |||||||||||||||||||||| || |||||||||||||||||| ||||||||||| 
Sbjct  358882  GGCCCGTGTGAGGTTTGGCTCGACAGCACACGCGTGCTCCAGTCGGATAACTGCCACGAA  358823

Query  421     ACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTT  480
               ||||| | ||||||||| || ||  | ||||||||||||||||  || |||||||| || 
Sbjct  358822  ACCATTATTGGCAAGACCTATAATTTGGACTACAGCTCGTGCAAGGGCACCTGCACGCTA  358763

Query  481     CGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAG  540
               || ||||||||||| || || || |  ||||| || ||||||||||||||||||||||||
Sbjct  358762  CGCTGGTACTGGCTTGGTGTGCGTTTTCTCAAAAACGCCTACTCGTGGCAGATCTACAAG  358703

Query  541     GCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCGAACGAATCGGTC  600
               ||||||||||||||||||||||| || ||||| |||||   |||||||||| ||||||||
Sbjct  358702  GCTTGCATCCCGCTTTCGGCTTCGGCCCGACGTCTTGAAGTTGCCGCGAACAAATCGGTC  358643

Query  601     GCCTTGGA  608
               | ||| ||
Sbjct  358642  GTCTTTGA  358635

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 164/243 (67%), Gaps = 25/243 (10%)
 Strand=Plus/Minus

Query  311     CTCAGCCCATTCCGGACGGAACAATGCGCTCCA-----CGGGTTACACCCACGATGGTCC  365
               |||||||||| ||| ||| |||||  || | ||     |||| ||||| |  || || ||
Sbjct  395105  CTCAGCCCATCCCG-ACG-AACAACTCGTTTCAGACGTCGGGCTACACGCTGGACGGCCC  395048

Query  366     GTGTGAGGTTTGGCT---CGACACCAAACGCGTGCTCCAGTCGGACAACTGCCA---CGA  419
               ||||||| | |||||   |||||||||  | |  |||  | ||  |||||||||   |||
Sbjct  395047  GTGTGAGATCTGGCTGGACGACACCAAG-GTGGCCTCGGGCCG--CAACTGCCATACCGA  394991

Query  420     GA-CCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACAC  478
                  ||  ||  ||| ||    || |  | ||||||||||| |||   ||  | |||   |
Sbjct  394990  ATTCCCACAC-GGCCAGC---ACCAGGTCGACTACAGCTCATGCGGCGGCTCGTGCCATC  394935

Query  479     TTCGTTGGTACTGGCTGGGCGTACGCTACCTCAA--GAATGCCTACTCGTGGCAGATCTA  536
               |   |||||||||||| ||| |    ||| || |  ||||  |||||| |||||| ||||
Sbjct  394934  TATCTTGGTACTGGCTCGGCATCAAATACGTCGAGGGAAT--CTACTCTTGGCAGGTCTA  394877

Query  537     CAA  539
               |||
Sbjct  394876  CAA  394874

>PHCA:scaffold_84 PHYCAscaffold_84
Length=182275

 Score = 601 bits (666),  Expect = 5e-170
 Identities = 495/603 (82%), Gaps = 0/603 (0%)
 Strand=Plus/Minus

Query  1      ATGGCTCCTTCTCTACTTTCGTCCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTA  60
              ||||||||||| || || || |||||| |||||||||||| ||||||||| || || || 
Sbjct  94300  ATGGCTCCTTCCCTGCTGTCATCCCTCACCGTGGCTGCTGCGCTTTCCAGTGCTGCTCTT  94241

Query  61     CTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACT  120
              ||||| |||||| |  | || ||||| ||||| || |||||||| |||||||||||||| 
Sbjct  94240  CTTGCCCCCACGGCGGACGCTCACCAGGTTGTCCTTCTGCCAGCACCGACCTACACGACG  94181

Query  121    GATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACC  180
              |||||||||||||| ||||| || ||  | || |||||||||| ||| || | | |||||
Sbjct  94180  GATAACAAGGACACCAAGTACGCGCCTCTTGCTTTCCTGGAGAGCCAAGGGTTCAAGACC  94121

Query  181    GTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATG  240
              |||||||| ||||| || |||||||| | |||||| |||||||| ||||| | |||||||
Sbjct  94120  GTCGAGGACTTCAATGGATGGCGCCGTAGCAACGGCTACAAGACTCTGCGCGCCTTCATG  94061

Query  241    GACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTC  300
              ||| | ||||||||||| ||||| || ||||| |||||||| ||||| |||||||||| |
Sbjct  94060  GACGGTGCCAAGTACACTGTCACAGACGGAGCTGACTACTATTGCGGCTTCACGAACGCC  94001

Query  301    AACGCCGCACCTCAGCCCATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGAT  360
              || || || || |||||||||||||| || |||||||| || || || ||||| ||||||
Sbjct  94000  AAGGCAGCTCCGCAGCCCATTCCGGATGGCACAATGCGTTCGACCGGGTACACGCACGAT  93941

Query  361    GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAG  420
              |||||||| ||||||||||||||| |||  ||||| ||||||||||||||||||||||||
Sbjct  93940  GGTCCGTGCGAGGTTTGGCTCGACTCCACGCGCGTCCTCCAGTCGGACAACTGCCACGAG  93881

Query  421    ACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTT  480
              ||  ||   |||||||| |||||||| ||||||||||||||||  ||  | ||||  || 
Sbjct  93880  ACGTTCCCGGGCAAGACGTACAACCTGGACTACAGCTCGTGCAAGGGCTCGTGCATGCTG  93821

Query  481    CGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAG  540
              |||||||||||| ||||    |||| ||||||||| |   ||||||||||| | ||||||
Sbjct  93820  CGTTGGTACTGGTTGGGAACGCGCTTCCTCAAGAACGAGCACTCGTGGCAGGTGTACAAG  93761

Query  541    GCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCGAACGAATCGGTC  600
              || ||||| || |||||  |||| ||||| || |||||  | || || |||||||||| |
Sbjct  93760  GCCTGCATTCCTCTTTCATCTTCTGCTCGTCGTCTTGAAGGAGCTGCCAACGAATCGGCC  93701

Query  601    GCC  603
              |||
Sbjct  93700  GCC  93698

 Score = 327 bits (362),  Expect = 2e-87
 Identities = 436/602 (72%), Gaps = 18/602 (3%)
 Strand=Plus/Plus

Query  1      ATGGCTCCTTCTCTACTTTCGTCCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTA  60
              |||||||||||  |  |  | || || || |  ||||||||  | || || || || |||
Sbjct  92672  ATGGCTCCTTCGTTCGTGCCCTCTCTTTCAGCTGCTGCTGTTATCTCTAGTGCTGCACTA  92731

Query  61     CTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACT  120
              || ||         | |||||||||| |||||||| || || || || || ||||| || 
Sbjct  92732  CTCGC---------CGATGCCCACCAGGTTGTGCTGCTACCTGCGCCTACGTACACTACG  92782

Query  121    GATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACC  180
              ||| |||||| ||| ||||| || |||||||||||||||||  ||||||||| ||  |||
Sbjct  92783  GATGACAAGGCCACCAAGTACGCTCCATTGGCCTTCCTGGAAGACCAGGGATTCGCCACC  92842

Query  181    GTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATG  240
                 ||||||||||  |  |||||||   |||| || ||| |  |  |||| | |||||  
Sbjct  92843  CAGGAGGATTTCACGGCCTGGCGCCAAGACAATGGCTACGATTCGTTGCGAGCCTTCAAC  92902

Query  241    GACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTC  300
              ||| | |||   ||||| || | ||| || ||||||| |  ||| || ||||| ||    
Sbjct  92903  GACGGTGCCTCCTACACTGTAAGTGACGGTGCGGACTTCACCTGTGGCTTCACCAATAAA  92962

Query  301    AACGCCGCACCT-CAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGTTACACCCA  356
              ||||  | || | ||| ||||||||||||  |   |||||||||| || || ||||| ||
Sbjct  92963  AACGGTG-ACGTGCAGGCCATTCCGGACGCCAACGCAATGCGCTCAACCGGGTACACGCA  93021

Query  357    CGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGC--GTGCTCCAGTCGGACAACTGC  414
              ||| |||||||| || || ||||| |||   | |||   ||  | ||||  |||||||| 
Sbjct  93022  CGACGGTCCGTGCGAAGTGTGGCTGGACG--ATACGATGGTCATGCAGTACGACAACTGT  93079

Query  415    CACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGC  474
              |||||| | ||||| ||||||   |||| | | |||||||| || |||||    ||||||
Sbjct  93080  CACGAGGCTATCAGCGGCAAGGACTACACCATAGACTACAGTTCTTGCACGTCCACCTGC  93139

Query  475    ACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATC  534
              ||  |    |||| |||||| || || || ||||||||||| |  |||||||||||||||
Sbjct  93140  ACGTTATACTGGTTCTGGCTCGGTGTCCGGTACCTCAAGAACGAGTACTCGTGGCAGATC  93199

Query  535    TACAAGGCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCGAACGAA  594
              |||||||| ||  | |||||||| |||||||| || || || ||  |||| || ||||| 
Sbjct  93200  TACAAGGCCTGTGTGCCGCTTTCCGCTTCAGCCCGTCGTCTGGAAGGTGCAGCCAACGAG  93259

Query  595    TC  596
              ||
Sbjct  93260  TC  93261

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 165/243 (68%), Gaps = 27/243 (11%)
 Strand=Plus/Minus

Query  313    CAGCCCATTCCGGACGGAACAATGCGCTCCA-----CGGGTTACACCCACGATGGTCCGT  367
              |||||||| |||  |  |||||  || ||||     |||| ||||| |  || || ||||
Sbjct  95471  CAGCCCATCCCGACC--AACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGT  95414

Query  368    GTGAGGTTTGGCT---CGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGA-GA--  421
              | ||||| |||||   |||||| ||| | || || | | | | ||||||||||   ||  
Sbjct  95413  GCGAGGTCTGGCTGGACGACACTAAA-GTGT-CTGCGGGCCG-CAACTGCCACACCGAAT  95357

Query  422    -CCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACT-  479
               ||  ||| | ||  ||     |  | |||||||||||||||   |   |||||||  | 
Sbjct  95356  TCCCGCAGGGTCAGCACC----AGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTG  95301

Query  480    TCGTTGGTACTGGCTGGGCGTACGCTACCTC--AAGAATGCCTACTCGTGGCAGATCTAC  537
              |||| |||||||||| ||| |    ||| ||  | ||||  ||||||||||||  | |||
Sbjct  95300  TCGT-GGTACTGGCTCGGCATCAAGTACGTCGAAGGAAT--CTACTCGTGGCAAGTGTAC  95244

Query  538    AAG  540
              |||
Sbjct  95243  AAG  95241

>PHRA:scaffold_56
Length=334739

 Score = 550 bits (609),  Expect = 3e-154
 Identities = 469/578 (81%), Gaps = 3/578 (1%)
 Strand=Plus/Plus

Query  1       ATGGCTCCTTCTCTACTTTCGTCCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTA  60
               ||||| ||||| || || || || ||||| ||||| |||| ||| ||||| || ||| | 
Sbjct  162463  ATGGCCCCTTCCCTGCTCTCCTCGCTCTCAGTGGCCGCTGCGCTCTCCAGTGCCGCGTTT  162522

Query  61      CTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACT  120
               || || |||| | || | |||||||| || ||||| || || |||||||| ||||| || 
Sbjct  162523  CTCGCCCCCATGACCGACGCCCACCAGGTCGTGCTGCTTCCTGCCCCGACGTACACCACC  162582

Query  121     GATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACC  180
               || | ||| ||||| ||||| || ||  | |||||||||||||||||||| | |||||||
Sbjct  162583  GACAGCAAAGACACCAAGTACGCGCCGCTCGCCTTCCTGGAGAACCAGGGCTTCGAGACC  162642

Query  181     GTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATG  240
               || | ||| ||||||| ||||||||||| ||||||||||||||| || || | |||||||
Sbjct  162643  GTGGGGGACTTCAACGCGTGGCGCCGCAGCAACGGGTACAAGACGCTCCGCGCCTTCATG  162702

Query  241     GACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTC  300
               ||| | ||||||||||| ||| | || ||||| |||||||||||||| |||||||||| |
Sbjct  162703  GACGGTGCCAAGTACACTGTCGCGGACGGAGCCGACTACTACTGCGGCTTCACGAACGCC  162762

Query  301     AACGCCGCACCTCAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGTTACACCCAC  357
                ||||| | || ||| ||||||||||||| |   | |||||||| ||||| ||||| |||
Sbjct  162763  GACGCCACGCCACAGGCCATTCCGGACGGTAACGCTATGCGCTCGACGGGCTACACGCAC  162822

Query  358     GATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCAC  417
               || || ||||| ||||| |||||||||||||  |||||||||      ||||||||||||
Sbjct  162823  GACGGCCCGTGCGAGGTCTGGCTCGACACCACGCGCGTGCTCACCCACGACAACTGCCAC  162882

Query  418     GAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACA  477
               ||| ||||||| ||||||   |||| | | |||||||| |||||||| ||||||||||||
Sbjct  162883  GAGGCCATCAGCGGCAAGGACTACACCATCGACTACAGTTCGTGCACGGGTACCTGCACA  162942

Query  478     CTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTAC  537
               || |  ||||||||| ||||||| |||||||||||||| || ||||| |||||| | |||
Sbjct  162943  CTGCACTGGTACTGGATGGGCGTGCGCTACCTCAAGAACGCGTACTCCTGGCAGGTGTAC  163002

Query  538     AAGGCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCT  575
               ||||| ||  | ||||| |||||||||||||| || ||
Sbjct  163003  AAGGCCTGTGTGCCGCTCTCGGCTTCAGCTCGTCGGCT  163040

 Score = 340 bits (376),  Expect = 3e-91
 Identities = 445/608 (73%), Gaps = 30/608 (5%)
 Strand=Plus/Minus

Query  1       ATGGCTCCTTCTCTACTTTCGTCCCTCTCCG-TGGCTGCTGTGCTTTCCAGCGCGGCGCT  59
               ||||| |||||  |  |||| || ||||| | ||||  | ||||| ||||| || |||||
Sbjct  164150  ATGGCCCCTTCCTTCGTTTCCTCGCTCTCGGCTGGCATC-GTGCTCTCCAGTGCTGCGCT  164092

Query  60      ACTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGAC  119
                || ||         | | ||||||||||| ||||| ||||| |||||||| ||||| ||
Sbjct  164091  TCTCGC---------CGACGCCCACCAAGTCGTGCTGCTGCCTGCCCCGACGTACACCAC  164041

Query  120     TGATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGAC  179
                ||| | |||| ||| ||||| || || ||||||||||||||  ||||||| | |   ||
Sbjct  164040  CGATGATAAGGCCACCAAGTACGCTCCTTTGGCCTTCCTGGAAGACCAGGGCTTCTCCAC  163981

Query  180     CGTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTC--  237
                   ||||||||||  |  ||||||    | ||||| ||| |  | ||||| |  |||  
Sbjct  163980  GCAGGAGGATTTCACGGCCTGGCGCGAGGAGAACGGCTACGACTCGCTGCGCGCTTTCGA  163921

Query  238     --ATGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGA  295
                 |||||  ||| |  |||||| || | ||| || || ||||    ||| || |||||  
Sbjct  163920  CGATGGA--GCGTC--GTACACTGTAAGTGACGGCGCCGACTTTACCTGTGGGTTCACCG  163865

Query  296     ACGTCAACGCCGCACCT-CAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGTTAC  351
               || |||||| || || | ||| ||||||||||||| |   | |||||||| ||||| |||
Sbjct  163864  ACATCAACGGCG-ACGTGCAGGCCATTCCGGACGGCAACGCCATGCGCTCGACGGGCTAC  163806

Query  352     ACCCACGATGGTCCGTGTGAGGTTTGGCT---CGACACCAAACGCGTGCTCCAGTCGGAC  408
               || ||||| |||||||| ||||| |||||   ||||||||    | |||   |||  || 
Sbjct  163805  ACGCACGACGGTCCGTGCGAGGTCTGGCTGGACGACACCATGGTCATGC---AGTATGAT  163749

Query  409     AACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGT  468
               ||||||||||||  |||||| ||||||   || | | | |||||||| || |||||    
Sbjct  163748  AACTGCCACGAGGTCATCAGCGGCAAGGACTATACCATCGACTACAGTTCATGCACGTCC  163689

Query  469     ACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGG  528
               |||||||| |||   |||| |||| ||||||| ||||||||||| || |||||||| |||
Sbjct  163688  ACCTGCACGCTTTACTGGTTCTGGATGGGCGTGCGCTACCTCAACAACGCCTACTCCTGG  163629

Query  529     CAGATCTACAAGGCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCG  588
               ||| | |||||||| ||| ||||||| ||||| || ||||| || |||||| |||| || 
Sbjct  163628  CAGGTGTACAAGGCGTGCGTCCCGCTGTCGGCCTCGGCTCGGCGTCTTGAGGGTGCGGCC  163569

Query  589     AACGAATC  596
               || || ||
Sbjct  163568  AATGAGTC  163561

 Score = 71.6 bits (78),  Expect = 2e-10
 Identities = 193/286 (67%), Gaps = 21/286 (7%)
 Strand=Plus/Plus

Query  281     ACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGACGGAACAATGCGCT  340
               |||||||  |||||| |  |||  | | | | |||| ||| |||  |  ||||   || |
Sbjct  161157  ACTGCGGACTCACGAGCCCCAAAACTGAAACGCAGCTCATCCCGACC--AACAGCTCGTT  161214

Query  341     CCA-----CGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCT---CGACACCAAACG  392
               |||     |||| ||||| | ||| || ||||||||||| |||||   |||||||||  |
Sbjct  161215  CCAGTCGTCGGGCTACACGCTCGACGGCCCGTGTGAGGTCTGGCTGGACGACACCAAG-G  161273

Query  393     CGTGCTCCAGTCGGACAACTGCCAC---GAGA-CCATCAGTGGCAAGACTTACAACCTTG  448
               || ||  | | | | ||||||||||   |||  ||  ||  ||| ||    || |  | |
Sbjct  161274  CG-GCGGCGGGCCG-CAACTGCCACACCGAGTTCCCGCAC-GGCCAGC---ACCAGATCG  161327

Query  449     ACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACC  508
               |||| ||| |||||   |   | ||||  || || ||||||||||| ||| |    ||| 
Sbjct  161328  ACTATAGCGCGTGCGGAGCCGCGTGCATGCTCCGGTGGTACTGGCTCGGCATCAAGTACG  161387

Query  509     TCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
               || |    || |||||||||||| ||||||||   |||||| ||||
Sbjct  161388  TCGAAGGCGCGTACTCGTGGCAGGTCTACAAGAACTGCATCGCGCT  161433

>PHSO:scaffold_1
Length=13391543

 Score = 546 bits (605),  Expect = 4e-153
 Identities = 490/615 (80%), Gaps = 0/615 (0%)
 Strand=Plus/Minus

Query  1        ATGGCTCCTTCTCTACTTTCGTCCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTA  60
                |||||||||||  | || ||||| ||||| |  |||||| | || |||||||| ||||| 
Sbjct  2791958  ATGGCTCCTTCCTTCCTCTCGTCGCTCTCGGCTGCTGCTCTACTCTCCAGCGCCGCGCTG  2791899

Query  61       CTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACT  120
                || ||||| ||| |  | || ||||| || ||||| || || || ||||||||||| || 
Sbjct  2791898  CTCGCTCCGACGGCTGACGCGCACCAGGTCGTGCTGCTACCTGCGCCGACCTACACCACG  2791839

Query  121      GATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACC  180
                ||  |||||| ||| ||||| || ||  |||||||||||||||||||||| |||||||||
Sbjct  2791838  GACGACAAGGCCACCAAGTACGCGCCGCTGGCCTTCCTGGAGAACCAGGGCTACGAGACC  2791779

Query  181      GTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATG  240
                |||||||| ||||||| |||||||||| |||| || |||||||||||||| | |||||||
Sbjct  2791778  GTCGAGGACTTCAACGCGTGGCGCCGCGACAAGGGCTACAAGACCCTGCGCGCCTTCATG  2791719

Query  241      GACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTC  300
                ||| ||||    ||||| ||  | || || || |||||||||||||| |||||  || ||
Sbjct  2791718  GACGGCGCGTCCTACACGGTGGCCGACGGGGCCGACTACTACTGCGGATTCACCGACATC  2791659

Query  301      AACGCCGCACCTCAGCCCATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGAT  360
                || | ||   | ||||||||||||||||| || |||||||||||||| ||||| ||||| 
Sbjct  2791658  AAGGGCGTCGCGCAGCCCATTCCGGACGGCACCATGCGCTCCACGGGCTACACGCACGAC  2791599

Query  361      GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAG  420
                || ||||| ||||| ||||| |||||||  |||||||| ||||| |||||||||||||||
Sbjct  2791598  GGCCCGTGCGAGGTCTGGCTGGACACCACGCGCGTGCTGCAGTCCGACAACTGCCACGAG  2791539

Query  421      ACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTT  480
                ||| |||| |||||||| ||| |||| ||||||||||||||||  ||  ||||||| || 
Sbjct  2791538  ACCTTCAGCGGCAAGACGTACGACCTCGACTACAGCTCGTGCAAGGGCTCCTGCACCCTG  2791479

Query  481      CGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAG  540
                || ||||||||||||||||| |||| ||||||||| |  |||||||||||| | ||||||
Sbjct  2791478  CGCTGGTACTGGCTGGGCGTGCGCTTCCTCAAGAACGAATACTCGTGGCAGGTTTACAAG  2791419

Query  541      GCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCGAACGAATCGGTC  600
                || ||| | ||||| ||  | || ||  | || || ||    || || ||||| || |  
Sbjct  2791418  GCGTGCGTGCCGCTGTCCACGTCGGCCAGGCGGCTCGAAGCCGCGGCCAACGAGTCCGCT  2791359

Query  601      GCCTTGGAGGTTTAA  615
                ||| | ||| | |||
Sbjct  2791358  GCCCTTGAGTTCTAA  2791344

 Score = 356 bits (394),  Expect = 4e-96
 Identities = 439/601 (73%), Gaps = 12/601 (2%)
 Strand=Plus/Plus

Query  1        ATGGCTCCTTCTCTACTTTCGTCCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTA  60
                ||||||||||| ||  |||| || ||||| |  ||||||||||| ||  |||| ||||| 
Sbjct  2790277  ATGGCTCCTTCGCTCGTTTCCTCGCTCTCGGCTGCTGCTGTGCTATCTGGCGCTGCGCTG  2790336

Query  61       CTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACT  120
                || |||  | ||         ||||| || || || ||||| || ||||||||||| || 
Sbjct  2790337  CTGGCTGGCGCG---------CACCAGGTCGTACTGCTGCCCGCACCGACCTACACCACG  2790387

Query  121      GATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACC  180
                ||  |||||| ||| ||||| || ||  | |||||||||||  ||||||| | || ||| 
Sbjct  2790388  GACGACAAGGCCACCAAGTACGCGCCCCTCGCCTTCCTGGAAGACCAGGGCTTCGCGACG  2790447

Query  181      GTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATG  240
                   ||||| ||||  | ||||||     ||||||| ||| |  |  |||| |  ||||  
Sbjct  2790448  CAGGAGGACTTCACTGCGTGGCGTACAGACAACGGCTACGACTCGTTGCGCGCTTTCAAC  2790507

Query  241      GACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTC  300
                ||| | ||    ||||| ||  | ||||| || |||| |  ||| || ||||| |||  |
Sbjct  2790508  GACGGGGCGTCCTACACTGTGGCCGATGGCGCCGACTTCACCTGTGGCTTCACCAACACC  2790567

Query  301      AACGCCGCACCTCAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGTTACACCCAC  357
                ||||  | |   ||||||||||||||||  |   | ||||||||||| || ||||| |||
Sbjct  2790568  AACGGTGAAGTGCAGCCCATTCCGGACGACAACGCTATGCGCTCCACAGGCTACACGCAC  2790627

Query  358      GATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCAC  417
                || || ||||| |||||||||||||||  ||     ||  | ||||  ||||||||||||
Sbjct  2790628  GACGGCCCGTGCGAGGTTTGGCTCGACGACACCATGGTCATGCAGTACGACAACTGCCAC  2790687

Query  418      GAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACA  477
                ||| ||||||| ||||||   |||| | | |||||||||||||||||    || ||||| 
Sbjct  2790688  GAGTCCATCAGCGGCAAGGACTACACCATCGACTACAGCTCGTGCACCTCCACGTGCACG  2790747

Query  478      CTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTAC  537
                ||    |||| |||||||||||| |||||||||||||| |  ||||||||||||||||||
Sbjct  2790748  CTCTACTGGTTCTGGCTGGGCGTGCGCTACCTCAAGAACGAGTACTCGTGGCAGATCTAC  2790807

Query  538      AAGGCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCGAACGAATCG  597
                ||||| ||| | ||||| ||  | || || || || |||||| | ||  | ||||| |||
Sbjct  2790808  AAGGCGTGCGTACCGCTGTCTACGTCGGCCCGCCGTCTTGAGGGCGCGACCAACGAGTCG  2790867

Query  598      G  598
                |
Sbjct  2790868  G  2790868

 Score = 63.5 bits (69),  Expect = 1e-07
 Identities = 78/107 (73%), Gaps = 0/107 (0%)
 Strand=Plus/Minus

Query  448      GACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTAC  507
                ||||||||| |||||   |   | ||||| ||  | ||||||||||| ||| |    |||
Sbjct  2793713  GACTACAGCGCGTGCGGAGACTCGTGCACGCTCTGGTGGTACTGGCTCGGCATCAAGTAC  2793654

Query  508      CTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
                 || ||   ||||||||||||||| ||||||||   ||| || ||||
Sbjct  2793653  GTCGAGGGCGCCTACTCGTGGCAGGTCTACAAGAACTGCGTCGCGCT  2793607

>PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_98.1_contig_1:1:103693:1 
REF
Length=103693

 Score = 489 bits (541),  Expect = 8e-136
 Identities = 482/619 (78%), Gaps = 8/619 (1%)
 Strand=Plus/Minus

Query  1      ATGGCTCCTTCTCTACTTTCGTCCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTA  60
              ||||||||||||||   ||||   || ||||||||||||||||||||||| || || || 
Sbjct  59258  ATGGCTCCTTCTCTCGCTTCG---CTGTCCGTGGCTGCTGTGCTTTCCAGTGCCGCACTC  59202

Query  61     CTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACT  120
              || || || ||  || |||||||||| || || || || || |||||||| |||||||| 
Sbjct  59201  CTGGCCCCAACCGCCGATGCCCACCAGGTCGTACTGCTCCCGGCCCCGACGTACACGACG  59142

Query  121    GATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACC  180
              ||| |||| ||||| ||||| || ||  | |||||||||||||||||||| | ||| || 
Sbjct  59141  GATGACAAAGACACCAAGTACGCGCCTCTAGCCTTCCTGGAGAACCAGGGCTTCGAAACG  59082

Query  181    GTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATG  240
              || || || |||||||  ||||| || || ||||| ||||| ||  |||||| |||||||
Sbjct  59081  GTGGATGACTTCAACGCTTGGCGTCGTAATAACGGCTACAAAACTTTGCGTGCCTTCATG  59022

Query  241    GACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTC  300
              ||| |||| ||||||||||| || |||||||| |||||  ||||||| ||||| || |  
Sbjct  59021  GACGGCGCAAAGTACACCGTGACGGATGGAGCCGACTATCACTGCGGATTCACCAATGCT  58962

Query  301    AACGCCGCACCTCAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGTTACACCCAC  357
               |||| || |||||  |||||||   ||| |   | |||||||| ||||| ||||| |||
Sbjct  58961  GACGCTGCTCCTCAAGCCATTCCATCCGGCAACGCCATGCGCTCGACGGGCTACACACAC  58902

Query  358    GATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGC-TCCAGTCGGACAACTGCCA  416
              ||||||||||| ||||| ||||| ||||| |  ||||| | | ||  | |||||||||||
Sbjct  58901  GATGGTCCGTGCGAGGTCTGGCTGGACACGACGCGCGTACTTACACAC-GACAACTGCCA  58843

Query  417    CGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCAC  476
              |||  | ||||||||||||   |||| | ||||||| || |||||||| || || |||||
Sbjct  58842  CGAAGCAATCAGTGGCAAGGACTACACCATTGACTATAGTTCGTGCACGGGCACATGCAC  58783

Query  477    ACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTA  536
               || || ||||||||| ||||||| || |  |||||||| |  |||||||||||| | ||
Sbjct  58782  CCTGCGCTGGTACTGGTTGGGCGTCCGTTTTCTCAAGAACGAGTACTCGTGGCAGGTGTA  58723

Query  537    CAAGGCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCGAACGAATC  596
              |||||| ||| ||||||| || ||||| |||||  | ||  |  | || || ||||| ||
Sbjct  58722  CAAGGCGTGCGTCCCGCTCTCTGCTTCGGCTCGGAGGCTCAAAGGAGCGGCCAACGAGTC  58663

Query  597    GGTCGCCTTGGAGGTTTAA  615
              || |||  | ||| |||||
Sbjct  58662  GGCCGCTATCGAGTTTTAA  58644

 Score = 313 bits (346),  Expect = 4e-83
 Identities = 423/587 (72%), Gaps = 7/587 (1%)
 Strand=Plus/Plus

Query  18     TTCGTCCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAA  77
              ||| || || |  |||||||| || || ||||| || || ||  | || || |   | ||
Sbjct  57435  TTCTTCACTGTTGGTGGCTGCCGTTCTCTCCAGTGCTGCTCTGATCGCGCCTATTGCAAA  57494

Query  78     TGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACTGATAACAAGGACACTAA  137
               ||||||||||| || || || ||| | || || || ||||| ||| ||||||  || ||
Sbjct  57495  CGCCCACCAAGTCGTTCTGCTACCATCTCCTACGTATACGACGGATGACAAGGCTACCAA  57554

Query  138    GTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGG  197
              |||||| ||  | |||||||||||  ||||||| |    ||||   ||||| ||||  | 
Sbjct  57555  GTATGCGCCTCTCGCCTTCCTGGAAGACCAGGGGTTTTCGACCCAAGAGGACTTCACAGC  57614

Query  198    GTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACAC  257
               |||||  |  ||||||| |||    | || ||||  ||||  |||  |||   ||||||
Sbjct  57615  ATGGCGTAGTGACAACGGCTACGCCTCACTACGTGCTTTCAACGACGACGCATCGTACAC  57674

Query  258    CGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCC  317
               || |  || || || |||| |  |||||| |||||| || |||| | |||| | |||||
Sbjct  57675  TGTGAGCGACGGCGCTGACTTCACCTGCGGCTTCACGGACATCAATGGCGCAGCCCAGCC  57734

Query  318    CATTCCGGACGGAA---CAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGT  374
              ||| || ||||  |   | ||||| || ||||||||||| || || ||||| || |||||
Sbjct  57735  CATCCCAGACGACAATGCCATGCGTTCGACGGGTTACACGCATGACGGTCCCTGCGAGGT  57794

Query  375    TTGGCTCGACACCAAACGC--GTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGC  432
               ||||| |||   | |||   ||  | ||||   |||| ||||||||  |||||||||||
Sbjct  57795  GTGGCTGGACG--ATACGATGGTCATGCAGTACAACAATTGCCACGACTCCATCAGTGGC  57852

Query  433    AAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGG  492
              |||   ||||   |||||||||||||||| ||   ||| || || ||    |||| ||||
Sbjct  57853  AAGGACTACACTATTGACTACAGCTCGTGTACGTCTACTTGTACGCTCTACTGGTTCTGG  57912

Query  493    CTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCG  552
               ||||||| ||||| |||||||| |  |||||||||||| | |||||||| ||| | |||
Sbjct  57913  ATGGGCGTCCGCTATCTCAAGAACGAGTACTCGTGGCAGGTGTACAAGGCGTGCGTGCCG  57972

Query  553    CTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCGAACGAATCGGT  599
              || ||||| || || ||  | |||||| |||| |  |||||||||||
Sbjct  57973  CTCTCGGCATCGGCGCGCAGACTTGAGGGTGCAGTCAACGAATCGGT  58019

>PHSO:scaffold_14
Length=1806347

 Score = 324 bits (359),  Expect = 2e-86
 Identities = 399/541 (74%), Gaps = 7/541 (1%)
 Strand=Plus/Minus

Query  19      TCGTCCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAAT  78
               ||| ||||| |||||||| | |  || |||||   |||| | || || |||||  || | 
Sbjct  819356  TCGACCCTCGCCGTGGCTTCGGCCCTATCCAGTATGGCGATGCTCGCCCCCACTGCCGAC  819297

Query  79      GCCCACCAAGTTGTGCTCCTGCC--AGCCCCGACCTACACGACTGATAACAAGGACACTA  136
               || |||||  | ||||| || ||  |||| | |   |||  ||  || ||||||| ||||
Sbjct  819296  GCTCACCAGATCGTGCTGCTACCGGAGCCTCAATGGACA--ACCAATGACAAGGAAACTA  819239

Query  137     AGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACG  196
               ||||    ||  | |||||||| || |||||||| | | |||||   ||||| |||| ||
Sbjct  819238  AGTACAACCCGCTCGCCTTCCTTGAAAACCAGGGTTTCAAGACCCAGGAGGACTTCACCG  819179

Query  197     GGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACA  256
                 ||||||    | ||||| |||||| | |||||||| ||||||||| | ||||||||| 
Sbjct  819178  CCTGGCGCAAGGAGAACGGCTACAAGTCGCTGCGTGATTTCATGGACAGGGCCAAGTACG  819119

Query  257     CCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGC  316
                ||||||    || || |||| || ||| || |||||  ||  ||| | | | |||||||
Sbjct  819118  ACGTCACCAGCGGCGCCGACTTCTCCTGTGGCTTCACCGACCCCAAGGGCACCCCTCAGC  819059

Query  317     CCATTCCGGACGG-AACA--ATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGG  373
               |||||||||| || ||||  |||||||| || || ||||||||||| || ||||| ||||
Sbjct  819058  CCATTCCGGAAGGTAACAAGATGCGCTCTACCGGCTACACCCACGACGGCCCGTGCGAGG  818999

Query  374     TTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCA  433
               | |||||||||  ||     |||||  |    ||||||||||||||||   ||   ||||
Sbjct  818998  TGTGGCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAGAAGTTCCCGGGCA  818939

Query  434     AGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGC  493
               ||   ||||   | ||||||   |||||||  || || ||||| ||||| ||||||||||
Sbjct  818938  AGGACTACACGGTGGACTACTCATCGTGCAAGGGCACGTGCACGCTTCGCTGGTACTGGC  818879

Query  494     TGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGC  553
               |||| || || | | | ||||||| ||||||||||||| | |||||||||||||||||||
Sbjct  818878  TGGGAGTGCGTTTCTTGAAGAATGACTACTCGTGGCAGGTGTACAAGGCTTGCATCCCGC  818819

Query  554     T  554
               |
Sbjct  818818  T  818818

 Score = 233 bits (258),  Expect = 3e-59
 Identities = 376/540 (70%), Gaps = 28/540 (5%)
 Strand=Plus/Minus

Query  23      CCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCC  82
               ||||| |||||||| | |  || ||||||  |||||| |  || || ||  |  |||| |
Sbjct  815871  CCCTCGCCGTGGCTTCGGCCCTCTCCAGCATGGCGCTGCCGGCCCCAACCGCTGATGCTC  815812

Query  83      ACCAAGTTGTGCTCCTGCC--AGCCCCGACCTACACGACTGATAACAAGGACACTAAGTA  140
               ||||  | ||||| || ||  |||| | |   |||  ||  || |||||| ||| |||||
Sbjct  815811  ACCAGATCGTGCTGCTACCGGAGCCTCAATGGACA--ACCAATGACAAGGTCACAAAGTA  815754

Query  141     TGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTG  200
                   ||  | |||||||| || |||||||| | | |||||   ||||| |||   |  ||
Sbjct  815753  CAACCCGCTCGCCTTCCTTGAAAACCAGGGTTTCAAGACCCAGGAGGACTTCGCTGCCTG  815694

Query  201     GCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGT  260
               ||||    | ||||| ||| |||| ||||||||||||||||||   |||||||||  |||
Sbjct  815693  GCGCAAGGAGAACGGCTACCAGACGCTGCGTGACTTCATGGACAAGGCCAAGTACGACGT  815634

Query  261     CACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCAT  320
               |||    || || |||| || |||||| |||||  ||  ||| | | | |||||||||||
Sbjct  815633  CACCAGCGGCGCCGACTTCTCCTGCGGCTTCACCGACCCCAAGGGCACCCCTCAGCCCAT  815574

Query  321     TCCGGACGG-AACAA--TGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTG  377
               |||||| || |||||  ||||||||||||| ||||||||||| |||            ||
Sbjct  815573  TCCGGAAGGTAACAAGATGCGCTCCACGGGATACACCCACGACGGTG-----------TG  815525

Query  378     GCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGAC  437
               |||||||  ||     |||||  |    ||||||||||||||||   ||   ||||||  
Sbjct  815524  GCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAGAAGTTCCCGGGCAAGGA  815465

Query  438     TTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGG  497
                ||||   | ||||||   ||||| |  ||  | ||||| ||||| ||||||||| ||||
Sbjct  815464  CTACACGGTCGACTACTCGTCGTGTAAGGGCTCGTGCACGCTTCGCTGGTACTGGATGGG  815405

Query  498     CGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCTTTC  557
                          | |||||  | ||||||||| || | |||||||| ||||||||||| ||
Sbjct  815404  ----------ATGAAGAACTCGTACTCGTGGAAGGTGTACAAGGCCTGCATCCCGCTGTC  815355

 Score = 231 bits (255),  Expect = 4e-58
 Identities = 295/404 (73%), Gaps = 7/404 (2%)
 Strand=Plus/Plus

Query  23      CCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCC  82
               ||||| | |||||| | |  || |||||   |||| | || || || ||  || ||||||
Sbjct  813902  CCCTCGCTGTGGCTTCGGCCCTCTCCAGTATGGCGATGCTGGCCCCAACCGCCGATGCCC  813961

Query  83      ACCAAGTTGTGCTCCTGCC--AGCCCCGACCTACACGACTGATAACAAGGACACTAAGTA  140
               ||||  | ||||| ||| |  |||||| |  |  |||||     |||||||||| |||||
Sbjct  813962  ACCAGATCGTGCTGCTGTCGGAGCCCCAA--TGAACGACCAGCGACAAGGACACCAAGTA  814019

Query  141     TGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTG  200
                   || ||||||||||| ||||||||||| | ||||||    ||||| |||  |  |||
Sbjct  814020  CAACCCGTTGGCCTTCCTCGAGAACCAGGGCTTCGAGACGCAGGAGGACTTCGCCTCGTG  814079

Query  201     GCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGT  260
               |||   ||| ||||| |||||| | ||||||||||||||||||   || |||||||| ||
Sbjct  814080  GCGTGACAAGAACGGCTACAAGTCGCTGCGTGACTTCATGGACAAGGCTAAGTACACAGT  814139

Query  261     CACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCAT  320
                ||   |||||| |||| || |||||| |||||  ||  ||| |   | |||||||||||
Sbjct  814140  GACGAGTGGAGCCGACTTCTCCTGCGGCTTCACCGACCCCAAGGGTACCCCTCAGCCCAT  814199

Query  321     TC---CGGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTG  377
               ||   ||| ||   | ||||| || ||||||||||| ||||| || ||||| ||||| ||
Sbjct  814200  TCCGGCGGGCGACGCCATGCGTTCGACGGGTTACACGCACGACGGCCCGTGCGAGGTGTG  814259

Query  378     GCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGA  421
               |||||||  ||     |||||  ||   ||||||||||||||||
Sbjct  814260  GCTCGACGACACGAAGGTGCTGGAGGGCGACAACTGCCACGAGA  814303

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  520     TACTCGTGGCAGATCTACAAGGCTTGCATCCC  551
               |||||||||||| | |||||||  ||||||||
Sbjct  814328  TACTCGTGGCAGGTGTACAAGGAGTGCATCCC  814359

>PHRA:scaffold_79
Length=220511

 Score = 312 bits (345),  Expect = 1e-82
 Identities = 393/536 (73%), Gaps = 8/536 (1%)
 Strand=Plus/Minus

Query  23     CCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCC  82
              ||||| |||||||| | |  ||  ||||||| || || || ||||| ||  || | || |
Sbjct  26206  CCCTCGCCGTGGCTACAGGCCTGGCCAGCGCAGCTCTGCTGGCTCCGACCGCCGACGCGC  26147

Query  83     ACCAAGTTGTGCTCCTGCC--AGCCCCGACCTACACGACTGATAACAAGGACACTAAGTA  140
              |||||||||||||  | ||  |||||| |  |  ||||| || |||||||| || |||||
Sbjct  26146  ACCAAGTTGTGCTGTTACCGGAGCCCCAA--TGGACGACGGACAACAAGGATACCAAGTA  26089

Query  141    TGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGAT--TTCAACGGG  198
                  ||  |||||||||| |||   || || |  | |||  || ||||   |||||||  
Sbjct  26088  CAACCCGCTGGCCTTCCTCGAGGGTCAAGGCTTTGCGAC--TCAAGGAGACTTCAACGCA  26031

Query  199    TGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACC  258
              ||||| ||  ||||||| ||||||||||||||||||||||||||| | ||||||||||| 
Sbjct  26030  TGGCGTCGTGACAACGGCTACAAGACCCTGCGTGACTTCATGGACAGAGCCAAGTACACG  25971

Query  259    GTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCC  318
              || || || || || ||||||| |||||| |  ||  ||   |||| | |||| ||||| 
Sbjct  25970  GTGACCGAAGGTGCCGACTACTTCTGCGGGTGGACAGACCCAAACGGCACACCCCAGCCT  25911

Query  319    ATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGG  378
              ||||| | ||| |  ||||| || || || ||||| ||||| || ||||||||||| |||
Sbjct  25910  ATTCCAGCCGGTAATATGCGTTCAACCGGATACACGCACGACGGGCCGTGTGAGGTCTGG  25851

Query  379    CTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACT  438
              || ||||  |  || |||||||||   |||||||| ||||||    |    | ||||   
Sbjct  25850  CTAGACAATACCCGTGTGCTCCAGGGCGACAACTGTCACGAGCAGTTTCCCGACAAGGAC  25791

Query  439    TACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGC  498
              |||  | |||||||    || ||||  || ||||| ||| | |  ||||||||| | || 
Sbjct  25790  TACCCCATTGACTATTCGTCCTGCAAAGGCACCTGTACATTGCACTGGTACTGGATCGGA  25731

Query  499    GTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
              || |||| |||||||||  | |||||||||||| | |||||||  |||||| ||||
Sbjct  25730  GTTCGCTTCCTCAAGAACTCGTACTCGTGGCAGGTGTACAAGGAGTGCATCTCGCT  25675

>PHRA:scaffold_267
Length=29552

 Score = 299 bits (331),  Expect = 8e-79
 Identities = 390/537 (73%), Gaps = 7/537 (1%)
 Strand=Plus/Plus

Query  23    CCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCC  82
             ||||| | || ||| | || || ||||||  |||||| || || || ||  || | || |
Sbjct  9286  CCCTCGCAGTCGCTTCGGTCCTGTCCAGCATGGCGCTGCTGGCGCCTACTGCCGACGCTC  9345

Query  83    ACCAAGTTGTGCTCCTGCCAG--CCCCGACCTACACGACTGATAACAAGGACACTAAGTA  140
             |||| |||||||| ||||| |  |||| |  |  || || ||  |||||||||| |||||
Sbjct  9346  ACCAGGTTGTGCTGCTGCCGGAACCCCAA--TGGACTACCGACGACAAGGACACCAAGTA  9403

Query  141   TGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTG  200
                 ||  |||| ||||| || ||| | || | |  ||||   ||||| |||     |||
Sbjct  9404  CAACCCGCTGGCTTTCCTCGAAAACGAAGGCTTCACGACCCAGGAGGACTTCGCGTCGTG  9463

Query  201   GCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGT  260
             ||||  | | ||||| |||||| | ||||||||||||||||||  |||||||||||  ||
Sbjct  9464  GCGCGACGAAAACGGCTACAAGTCGCTGCGTGACTTCATGGACAACGCCAAGTACAATGT  9523

Query  261   CACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCAT  320
               | || || || |||| ||  ||||| || ||  ||  ||| |   | || ||||||||
Sbjct  9524  GGCCGACGGCGCCGACTTCTCTTGCGGCTTTACCGACCCCAAGGGAACCCCGCAGCCCAT  9583

Query  321   TCCGGACGGAA---CAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTG  377
             |||||  || |   | ||||| |||||||| ||||| ||||| |||||||| ||||| ||
Sbjct  9584  TCCGGCTGGTAACGCGATGCGTTCCACGGGATACACGCACGACGGTCCGTGCGAGGTGTG  9643

Query  378   GCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGAC  437
             ||| |||  ||     |||||| |    |||||||| |||||||   ||  |||||||  
Sbjct  9644  GCTTGACGACACGATGGTGCTCGACGGCGACAACTGTCACGAGAAGTTCCCTGGCAAGGA  9703

Query  438   TTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGG  497
              |||| | | ||||||   || ||||  || || ||||| ||||||||||||||||||||
Sbjct  9704  CTACACCGTCGACTACTCGTCCTGCAAGGGCACGTGCACGCTTCGTTGGTACTGGCTGGG  9763

Query  498   CGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
             | | || | ||||||||| | ||||||||||||  | |||||||  |||||||||||
Sbjct  9764  CATCCGTTTCCTCAAGAACGACTACTCGTGGCAAGTGTACAAGGAGTGCATCCCGCT  9820

>PHSO:scaffold_35
Length=32414

 Score = 292 bits (323),  Expect = 1e-76
 Identities = 354/478 (74%), Gaps = 7/478 (1%)
 Strand=Plus/Minus

Query  82     CACCAAGTTGTGCTCCTGCC--AGCCCCGACCTACACGACTGATAACAAGGACACTAAGT  139
              |||||  | ||||| |||||  ||||||    |  |||||| |  ||||||| || ||||
Sbjct  18609  CACCAGATCGTGCTGCTGCCGGAGCCCCTG--TGGACGACTAACGACAAGGAAACCAAGT  18552

Query  140    ATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGT  199
              |    ||  |||| ||||| |||||  ||||||    ||||   ||||| |||| ||  |
Sbjct  18551  ACAACCCGCTGGCTTTCCTCGAGAATGAGGGATTTACGACCCAGGAGGACTTCACCGCCT  18492

Query  200    GGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCG  259
              |||||    | ||||| |||||| | |||||||| ||||||||| | |||||||||  ||
Sbjct  18491  GGCGCAAGGAGAACGGCTACAAGTCGCTGCGTGATTTCATGGACAGGGCCAAGTACGACG  18432

Query  260    TCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCA  319
              ||||    || || |||| || ||| || |||||  ||  ||| | | | ||||||||||
Sbjct  18431  TCACCAGCGGCGCCGACTTCTCCTGTGGCTTCACCGACCCCAAGGGCACCCCTCAGCCCA  18372

Query  320    TTCCGGACGG-AACAA--TGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTT  376
              ||||||| || |||||  ||||||| || || ||||||||||| || ||||| ||||| |
Sbjct  18371  TTCCGGAAGGTAACAAGATGCGCTCTACCGGCTACACCCACGACGGCCCGTGCGAGGTGT  18312

Query  377    GGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGA  436
              ||||||||  ||     |||||  |    ||||||||||||||||   ||   |||||| 
Sbjct  18311  GGCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAGAAGTTCCCGGGCAAGG  18252

Query  437    CTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGG  496
                ||||   | ||||||   |||||||  || || ||||| ||||| |||||||||||||
Sbjct  18251  ACTACACGGTGGACTACTCATCGTGCAAGGGCACGTGCACGCTTCGCTGGTACTGGCTGG  18192

Query  497    GCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
              | || || | | | ||||||| ||||||||||||| | ||||||||||||||||||||
Sbjct  18191  GAGTGCGTTTCTTGAAGAATGACTACTCGTGGCAGGTGTACAAGGCTTGCATCCCGCT  18134

>PHSO:scaffold_5
Length=6830280

 Score = 292 bits (323),  Expect = 1e-76
 Identities = 354/478 (74%), Gaps = 7/478 (1%)
 Strand=Plus/Minus

Query  82      CACCAAGTTGTGCTCCTGCC--AGCCCCGACCTACACGACTGATAACAAGGACACTAAGT  139
               |||||  | ||||| |||||  ||||||    |  |||||| |  ||||||| || ||||
Sbjct  682462  CACCAGATCGTGCTGCTGCCGGAGCCCCTG--TGGACGACTAACGACAAGGAAACCAAGT  682405

Query  140     ATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGT  199
               |    ||  |||| ||||| |||||  ||||||    ||||   ||||| |||| ||  |
Sbjct  682404  ACAACCCGCTGGCTTTCCTCGAGAATGAGGGATTTACGACCCAGGAGGACTTCACCGCCT  682345

Query  200     GGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCG  259
               |||||    | ||||| |||||| | |||||||| ||||||||| | |||||||||  ||
Sbjct  682344  GGCGCAAGGAGAACGGCTACAAGTCGCTGCGTGATTTCATGGACAGGGCCAAGTACGACG  682285

Query  260     TCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCA  319
               ||||    || || |||| || ||| || |||||  ||  ||| | | | ||||||||||
Sbjct  682284  TCACCAGCGGCGCCGACTTCTCCTGTGGCTTCACCGACCCCAAGGGCACCCCTCAGCCCA  682225

Query  320     TTCCGGACGG-AACAA--TGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTT  376
               ||||||| || |||||  ||||||| || || ||||||||||| || ||||| ||||| |
Sbjct  682224  TTCCGGAAGGTAACAAGATGCGCTCTACCGGCTACACCCACGACGGCCCGTGCGAGGTGT  682165

Query  377     GGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGA  436
               ||||||||  ||     |||||  |    ||||||||||||||||   ||   |||||| 
Sbjct  682164  GGCTCGACGACACGATGGTGCTGGATGGCGACAACTGCCACGAGAAGTTCCCGGGCAAGG  682105

Query  437     CTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGG  496
                 ||||   | ||||||   |||||||  || || ||||| ||||| |||||||||||||
Sbjct  682104  ACTACACGGTGGACTACTCATCGTGCAAGGGCACGTGCACGCTTCGCTGGTACTGGCTGG  682045

Query  497     GCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
               | || || | | | ||||||| ||||||||||||| | ||||||||||||||||||||
Sbjct  682044  GAGTGCGTTTCTTGAAGAATGACTACTCGTGGCAGGTGTACAAGGCTTGCATCCCGCT  681987

 Score = 38.3 bits (41),  Expect = 4.3
 Identities = 34/43 (79%), Gaps = 0/43 (0%)
 Strand=Plus/Plus

Query  282      CTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCG  324
                |||| ||||||| |||   |||| | | || ||||||||||||
Sbjct  3040352  CTGCAGTTTCACCAACCGGAACGGCACGCCGCAGCCCATTCCG  3040394

>PHRA:scaffold_106
Length=147471

 Score = 288 bits (319),  Expect = 1e-75
 Identities = 369/506 (73%), Gaps = 7/506 (1%)
 Strand=Plus/Minus

Query  54     GGCGCTACTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAG--CCCCGACC  111
              |||||| || || |||||  || | || |||||  ||||||| ||||| |  |||| |  
Sbjct  13435  GGCGCTGCTGGCACCCACCGCCGACGCTCACCAGATTGTGCTGCTGCCGGAACCCCAA--  13378

Query  112    TACACGACTGATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGA  171
              |  ||||| ||| |||||||||| |||||    ||  |||| ||||| || ||| | || 
Sbjct  13377  TGGACGACCGATGACAAGGACACCAAGTACAACCCGCTGGCTTTCCTCGAAAACGAAGGC  13318

Query  172    TACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGT  231
              | || ||||   ||||| ||||  |  |||||   | | ||||| |||||| | ||||||
Sbjct  13317  TTCGCGACCCAGGAGGACTTCACTGCCTGGCGTACCGAGAACGGCTACAAGTCGCTGCGT  13258

Query  232    GACTTCATGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTC  291
              ||||||||||||  |||||||||||  || ||  | || || |||| ||  ||||| || 
Sbjct  13257  GACTTCATGGACAACGCCAAGTACAGTGTGACCAACGGCGCCGACTTCTCTTGCGGCTTT  13198

Query  292    ACGAACGTCAACGCCGCACCTCAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGT  348
              ||  ||  ||| |   | || ||||||||||||| ||  |   | ||||| |||||||| 
Sbjct  13197  ACCGACCCCAAGGGAACCCCGCAGCCCATTCCGGCCGACAACGCGATGCGTTCCACGGGA  13138

Query  349    TACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGAC  408
              ||||| ||||| |||||||| ||||| |||||||||  ||     |||||| |    || 
Sbjct  13137  TACACGCACGACGGTCCGTGCGAGGTGTGGCTCGACGACACGATGGTGCTCGACGGCGAG  13078

Query  409    AACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGT  468
              |||||||||||||   ||  |||||||   |||| | | ||||||   || ||||  || 
Sbjct  13077  AACTGCCACGAGAAGTTCCCTGGCAAGGACTACACCGTCGACTACTCGTCCTGCAAGGGC  13018

Query  469    ACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGG  528
              || ||||| ||||||||||||||| |||| || || | ||| ||| |  |||||||||||
Sbjct  13017  ACGTGCACGCTTCGTTGGTACTGGATGGGTGTCCGATTCCTGAAGGAAACCTACTCGTGG  12958

Query  529    CAGATCTACAAGGCTTGCATCCCGCT  554
              ||  | |||||||  |||||||||||
Sbjct  12957  CAAGTGTACAAGGAGTGCATCCCGCT  12932

>PHCA:scaffold_7 PHYCAscaffold_7
Length=1368812

 Score = 275 bits (304),  Expect = 9e-72
 Identities = 360/496 (73%), Gaps = 7/496 (1%)
 Strand=Plus/Minus

Query  61      CTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCC--AGCCCCGACCTACACGA  118
               || || |||||  || | ||||| ||  | || || |||||  |||||| |   |||  |
Sbjct  905965  CTGGCCCCCACTGCCGACGCCCATCAGATCGTTCTGCTGCCGGAGCCCCAATGGACA--A  905908

Query  119     CTGATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGA  178
               |  || |||||||||| |||||    ||  | || ||||| ||||||||||| |   |||
Sbjct  905907  CCAATGACAAGGACACCAAGTACAACCCGCTCGCTTTCCTCGAGAACCAGGGCTTTAAGA  905848

Query  179     CCGTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCA  238
               |     |||| ||||  |  ||||||  | | ||||| |||||| | |||||||||||||
Sbjct  905847  CGCAGCAGGACTTCACTGCCTGGCGCAACGAAAACGGCTACAAGTCACTGCGTGACTTCA  905788

Query  239     TGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACG  298
               ||||| | || |||||||| |||||  | ||||| |||| ||  || || || ||  || 
Sbjct  905787  TGGACAGAGCTAAGTACACAGTCACGAACGGAGCCGACTTCTCTTGTGGGTTTACCGACC  905728

Query  299     TCAACGCCGCACCTCAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGTTACACCC  355
                 || |   | || |||||||||||||  || |   | |||||||||||||||||||| |
Sbjct  905727  CGAAGGGTACGCCGCAGCCCATTCCGGCGGGCAACGCCATGCGCTCCACGGGTTACACGC  905668

Query  356     ACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCC  415
               |||||||||||||||| || ||||| |||  ||     |||||  |    ||||||||||
Sbjct  905667  ACGATGGTCCGTGTGAAGTGTGGCTTGACGACACGATGGTGCTGGATGGTGACAACTGCC  905608

Query  416     ACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCA  475
               ||||||   |    ||||||   ||||   | ||||||   || ||||  || || ||||
Sbjct  905607  ACGAGAAATTTCCCGGCAAGGACTACACGGTGGACTACTCGTCTTGCAAGGGCACGTGCA  905548

Query  476     CACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCT  535
               | |||||||||||||||||||| || |||| | | ||||| || |||||||||||| | |
Sbjct  905547  CGCTTCGTTGGTACTGGCTGGGTGTTCGCTTCTTGAAGAACGCGTACTCGTGGCAGGTGT  905488

Query  536     ACAAGGCTTGCATCCC  551
               |||||||||| |||||
Sbjct  905487  ACAAGGCTTGTATCCC  905472

 Score = 254 bits (281),  Expect = 3e-65
 Identities = 368/515 (71%), Gaps = 11/515 (2%)
 Strand=Plus/Plus

Query  54      GGCGCTACTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCC--AGCCCCGACC  111
               |||||| || ||||||||| || | ||||||||  | || || |||||  |||| | |  
Sbjct  908723  GGCGCTCCTAGCTCCCACGGCCGACGCCCACCAGATCGTTCTGCTGCCGGAGCCTCAA--  908780

Query  112     TACACGACTGATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGA  171
               |  |||||  || |||||||||| |||||    ||  | || ||||| |||||| |||| 
Sbjct  908781  TGGACGACCAATGACAAGGACACCAAGTACAACCCGCTTGCTTTCCTTGAGAACGAGGGC  908840

Query  172     TACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGT  231
               |     |||   ||||||||||  |  ||||||    | || || |||||  |  | || 
Sbjct  908841  TTTACAACCCAGGAGGATTTCACTGCTTGGCGCACTGAGAATGGCTACAAATCTTTACGC  908900

Query  232     GACTTCATGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTC  291
               |||||||||||| | || |||||| | || || || || || |||| | | ||||| || 
Sbjct  908901  GACTTCATGGACAGAGCTAAGTACCCGGTAACGGAAGGTGCCGACTTCAAGTGCGGCTTT  908960

Query  292     ACGAACGTCAACGCCGCACCTCAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGT  348
               ||  ||  |||||   | || |||||||||||||  || |   | ||||| |||||||||
Sbjct  908961  ACCGACCCCAACGGTACGCCGCAGCCCATTCCGGCGGGTAACGCCATGCGTTCCACGGGT  909020

Query  349     TACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACG--CGTGCTCCAGTCGG  406
               ||||| || ||||||||||||||||| ||||| |  || | |||   |||||  |    |
Sbjct  909021  TACACGCATGATGGTCCGTGTGAGGTGTGGCTTG--ACGATACGATGGTGCTGGACGGAG  909078

Query  407     ACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTG  466
               | ||||| |||||||   ||  ||| |||   |||| | | ||||||   || ||||  |
Sbjct  909079  AGAACTGTCACGAGAAGTTCCCTGGTAAGGGCTACACCATCGACTACTCGTCTTGCAAGG  909138

Query  467     GTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGT  526
               | |||||||| ||    |||| |||||| || || |||| ||| ||||| | ||||||||
Sbjct  909139  GCACCTGCACGCTGTACTGGTTCTGGCTTGGTGTTCGCTTCCTGAAGAACGACTACTCGT  909198

Query  527     GGCAGATCTACAAGGCTTGCATCCCGCTTTCGGCT  561
               ||||| | |||||||| ||||| |||||  |||||
Sbjct  909199  GGCAGGTGTACAAGGCGTGCATTCCGCTGACGGCT  909233

 Score = 240 bits (265),  Expect = 7e-61
 Identities = 354/501 (71%), Gaps = 3/501 (1%)
 Strand=Plus/Plus

Query  54      GGCGCTACTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTA  113
               |||||| || || |||||  | |  ||||| ||||||||||| ||||| || ||    | 
Sbjct  901401  GGCGCTCCTGGCCCCCACCGCTACGGCCCATCAAGTTGTGCTTCTGCCGGCGCCTCAATG  901460

Query  114     CACGACTGATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATA  173
                | ||| || |||| ||||||  || | |  ||| | || ||||| |||| |||||| | 
Sbjct  901461  GAAGACCGACAACAGGGACACCCAGCACGACCCACTCGCTTTCCTCGAGAGCCAGGGCTT  901520

Query  174     CGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGA  233
               | ||||     | || ||||  |  ||||||    | ||||| |||||  ||||||||||
Sbjct  901521  CAAGACGCAGCAAGACTTCACTGCCTGGCGCAATGAAAACGGCTACAAATCCCTGCGTGA  901580

Query  234     CTTCATGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCAC  293
               |||||||||||| ||||||||||| ||||   | ||||| |||| | | ||||| |  ||
Sbjct  901581  CTTCATGGACCGAGCCAAGTACACAGTCAGGAACGGAGCCGACTTCAAGTGCGGCTATAC  901640

Query  294     GAACGTCAACGCCGCACCTCAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGTTA  350
                 ||  |||||   | || ||||||||||| |  || |   | |||||||||||||||||
Sbjct  901641  CGACCCCAACGGTACGCCGCAGCCCATTCCTGCAGGCAACGCCATGCGCTCCACGGGTTA  901700

Query  351     CACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAA  410
               ||| ||||| ||||||||||| || ||| | ||   ||     ||| |  |    || ||
Sbjct  901701  CACGCACGACGGTCCGTGTGAAGTGTGGATTGATGACACGATGGTGATGGAAGGCGATAA  901760

Query  411     CTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTAC  470
               |||||||||||   ||  ||| |||   |||| | | ||||||    | ||||  || | 
Sbjct  901761  CTGCCACGAGAAGTTCCCTGGTAAGGGCTACACCATCGACTACTCGCCCTGCAAGGGCAA  901820

Query  471     CTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCA  530
                ||||| ||    |||||||||||||| || |||| ||| || ||  | |||||||||||
Sbjct  901821  GTGCACGCTGTACTGGTACTGGCTGGGTGTTCGCTTCCTGAAAAACTCGTACTCGTGGCA  901880

Query  531     GATCTACAAGGCTTGCATCCC  551
               | | |||||||  || |||||
Sbjct  901881  GGTGTACAAGGAGTGTATCCC  901901

 Score = 218 bits (241),  Expect = 2e-54
 Identities = 321/449 (71%), Gaps = 8/449 (2%)
 Strand=Plus/Plus

Query  115     ACGACTGATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATAC  174
               |||||  || |||||||||| |||||    ||| |||| ||||| ||||||||||| |  
Sbjct  904355  ACGACCAATGACAAGGACACCAAGTACAACCCACTGGCGTTCCTCGAGAACCAGGGCTTT  904414

Query  175     GAGACCGTCGAGGATTTCAACGGGTGGCGC-CGCAACAACGGGTACAAGACCCTGCGTGA  233
                ||||     |||| ||      ||||||  || || |||   |||||  |||| || ||
Sbjct  904415  AAGACGCAGCAGGACTTTGCTTCGTGGCGTACGGAA-AACAACTACAAATCCCTTCGCGA  904473

Query  234     CTTCATGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCAC  293
               ||||||||||   ||||| ||||| ||||| || ||||| |||| ||  ||||| || ||
Sbjct  904474  CTTCATGGACAATGCCAAATACACAGTCACGGACGGAGCCGACTTCTCTTGCGGGTTTAC  904533

Query  294     GAACGTCAACGCCGCACCTCAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGTTA  350
                 ||   || |   | || |||||||||||||  ||||   | ||||| ||||| |||||
Sbjct  904534  CGACCCGAAGGGTACGCCGCAGCCCATTCCGGCGGGAAATGCCATGCGTTCCACTGGTTA  904593

Query  351     CACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAA  410
               ||| ||||| ||||||||||| || ||||| |||  ||     |||||  |    |||||
Sbjct  904594  CACGCACGACGGTCCGTGTGAAGTGTGGCTTGACGACACGATGGTGCTGGATGGTGACAA  904653

Query  411     CTGCCACGAGACCAT--CAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGT  468
               |||||||||||   |  |   |  |||||| |||   | ||||||   || ||||  || 
Sbjct  904654  CTGCCACGAGAAATTTCCCCGGTAAAGACT-ACACGGTGGACTACTCGTCTTGCAAGGGC  904712

Query  469     ACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGG  528
               || ||||| ||||| ||||||||||||||| | || | | | ||||||   |||||||||
Sbjct  904713  ACGTGCACGCTTCGCTGGTACTGGCTGGGCATCCGTTTCTTGAAGAATCAGTACTCGTGG  904772

Query  529     CAGATCTACAAGGCTTGCATCCCGCTTTC  557
               ||| | ||||||||||| || || || ||
Sbjct  904773  CAGGTGTACAAGGCTTGTATTCCTCTGTC  904801

 Score = 186 bits (205),  Expect = 1e-44
 Identities = 345/504 (68%), Gaps = 7/504 (1%)
 Strand=Plus/Minus

Query  54      GGCGCTACTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCC--AGCCCCGACC  111
               |||||| || || |||||  | |  |||||||||||||| || || ||  |||| | |  
Sbjct  876730  GGCGCTCCTGGCCCCCACCGCTACGGCCCACCAAGTTGTCCTTCTCCCGAAGCCTCAA--  876673

Query  112     TACACGACTGATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGA  171
               |  | ||| || |||| ||||||  || |   |||  |  | ||||| ||   |   || 
Sbjct  876672  TGGAAGACCGACAACAGGGACACCCAGCACAAACCGCTTACATTCCTCGAAGGCGTAGGC  876613

Query  172     TACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGT  231
               | | ||||    |  || ||||  |  |||||     | ||||| |||||  | ||||||
Sbjct  876612  TTCAAGACGCAGGCAGACTTCACTGCTTGGCGTAAGGAGAACGGCTACAAATCTCTGCGT  876553

Query  232     GACTTCATGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTC  291
               || ||||||||   |||||||||| | ||| | || || || |||| | | ||||| || 
Sbjct  876552  GATTTCATGGATAACGCCAAGTACCCAGTCTCGGAAGGTGCCGACTTCAAGTGCGGCTTT  876493

Query  292     ACGAACGTCAACGCCGCACCTCAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGT  348
               ||  ||  |||||   | || |||||||||||||  ||||   | ||||| ||||| |||
Sbjct  876492  ACCGACCCCAACGGTACGCCGCAGCCCATTCCGGCGGGAAATGCCATGCGTTCCACTGGT  876433

Query  349     TACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGAC  408
               ||||| ||||| |||||||||||||| ||| | ||   ||     ||| |  |    |||
Sbjct  876432  TACACGCACGACGGTCCGTGTGAGGTGTGGATTGATGACACGATGGTGATGGAAGGTGAC  876373

Query  409     AACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGT  468
               |||||||||||||   ||  ||| |||   |||| | | ||||||    | ||||  || 
Sbjct  876372  AACTGCCACGAGAAGTTCCCTGGTAAGGACTACACCATCGACTACTCGCCCTGCAAGGGC  876313

Query  469     ACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGG  528
               |  ||||| ||    |||||||||||||| || || | |||||| ||    |||||||||
Sbjct  876312  AAGTGCACGCTGTACTGGTACTGGCTGGGTGTGCGTTTCCTCAAAAACAGATACTCGTGG  876253

Query  529     CAGATCTACAAGGCTTGCATCCCG  552
               ||| | |||||||  || ||||||
Sbjct  876252  CAGGTGTACAAGGAGTGTATCCCG  876229

 Score = 50.9 bits (55),  Expect = 7e-04
 Identities = 53/70 (76%), Gaps = 0/70 (0%)
 Strand=Plus/Minus

Query  224     CCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACT  283
               ||||  | |||||||| | |   ||||||||||| ||||| || ||||| |||| ||  |
Sbjct  902525  CCCTCTGCGACTTCATTGGCAATGCCAAGTACACAGTCACGGACGGAGCCGACTTCTCTT  902466

Query  284     GCGGTTTCAC  293
               |||| || ||
Sbjct  902465  GCGGGTTTAC  902456

>PYVX:scaffold_275 pve_scaffold_275 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_275:1:32274:1 
REF
Length=32274

 Score = 269 bits (297),  Expect = 1e-69
 Identities = 393/556 (71%), Gaps = 0/556 (0%)
 Strand=Plus/Minus

Query  46     TCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCCAGCC  105
              ||| | || ||||| || ||  ||    || | || |||||   |||| || |||| || 
Sbjct  14958  TCCGGTGCCGCGCTGCTCGCCACCGTCGCCGACGCGCACCAGTATGTGATCTTGCCGGCG  14899

Query  106    CCGACCTACACGACTGATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAAC  165
              ||||| |  |  || ||  ||||||||   | ||| || ||| |||| ||||||||| ||
Sbjct  14898  CCGACGTGGAACACGGACGACAAGGACGTCATGTACGCGCCACTGGCTTTCCTGGAGGAC  14839

Query  166    CAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACC  225
              ||||| | |  |||    ||||| ||||  | |||||||    ||||||| ||| |  | 
Sbjct  14838  CAGGGGTTCTCGACGCAGGAGGACTTCACGGCGTGGCGCTCGGACAACGGCTACGACTCG  14779

Query  226    CTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGC  285
              || |||| |||||||||| ||||   |||||| || || || || || ||  |    |||
Sbjct  14778  CTCCGTGCCTTCATGGACGGCGCGTCGTACACGGTGACGGACGGCGCCGATCAGACGTGC  14719

Query  286    GGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGACGGAACAATGCGCTCCACG  345
              || |  || |||    ||| | |  | ||| |  |||| |||||    ||||||||||||
Sbjct  14718  GGCTGGACCAACAAGGACGGCACGGCGCAGGCGCTTCCCGACGGCGTCATGCGCTCCACG  14659

Query  346    GGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCG  405
              || ||||| ||||  |||||||| ||||| |||||||||  ||     ||||| ||||  
Sbjct  14658  GGGTACACGCACGTCGGTCCGTGCGAGGTCTGGCTCGACGACACGATGGTGCTGCAGTAC  14599

Query  406    GACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACT  465
              ||||||||||||||  | |||  ||||||||| ||| |||| ||||||   || ||||| 
Sbjct  14598  GACAACTGCCACGACTCAATCTCTGGCAAGACCTACGACCTCGACTACTCGTCCTGCACG  14539

Query  466    GGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCG  525
                 || ||||| ||    |||| |||| ||||||| ||||||||||| || |  ||||||
Sbjct  14538  TCCACGTGCACGCTCTACTGGTTCTGGATGGGCGTCCGCTACCTCAACAACGAGTACTCG  14479

Query  526    TGGCAGATCTACAAGGCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCC  585
              |||||| | ||||||   ||| | ||||| ||||| || ||||| || || ||  | |||
Sbjct  14478  TGGCAGGTGTACAAGAACTGCGTACCGCTCTCGGCCTCGGCTCGCCGTCTCGAAGGCGCC  14419

Query  586    GCGAACGAATCGGTCG  601
              || ||||  |||| ||
Sbjct  14418  GCCAACGCCTCGGCCG  14403

 Score = 216 bits (239),  Expect = 8e-54
 Identities = 217/282 (77%), Gaps = 0/282 (0%)
 Strand=Plus/Plus

Query  271   GCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGACGGA  330
             ||||||| |   ||||| |||||| ||    ||||||| || |||||||| || ||||| 
Sbjct  7781  GCGGACTTCCGATGCGGCTTCACGGACCCGGACGCCGCGCCGCAGCCCATCCCCGACGGC  7840

Query  331   ACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAA  390
             |  |||||||||||||| ||||| ||||| || ||||| ||||| |||||||||  ||  
Sbjct  7841  ATTATGCGCTCCACGGGGTACACGCACGACGGCCCGTGCGAGGTCTGGCTCGACGACACG  7900

Query  391   CGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGAC  450
             || ||||| |||   ||||||||||| |||  ||||   ||||| || ||| ||||||||
Sbjct  7901  CGTGTGCTGCAGCACGACAACTGCCATGAGGTCATCTCCGGCAAAACCTACGACCTTGAC  7960

Query  451   TACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTC  510
             |||    ||||||  ||  | ||||| ||    ||||||||||| ||||| |||||||||
Sbjct  7961  TACTCGGCGTGCAACGGCTCGTGCACGCTGTACTGGTACTGGCTCGGCGTGCGCTACCTC  8020

Query  511   AAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCG  552
             ||| | | ||||||||||||| | |||||||| ||| | |||
Sbjct  8021  AAGCAAGTCTACTCGTGGCAGGTGTACAAGGCCTGCGTGCCG  8062

 Score = 206 bits (228),  Expect = 4e-51
 Identities = 332/471 (70%), Gaps = 20/471 (4%)
 Strand=Plus/Plus

Query  138    GTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGG  197
              ||| || ||  | || ||||| ||  ||||||| |  ||||| |||||||| ||||||| 
Sbjct  13613  GTACGCGCCGCTCGCGTTCCTTGAAGACCAGGGCTTTGAGACAGTCGAGGACTTCAACGC  13672

Query  198    GTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACAC  257
               |||||||||  |||||| |||||||| ||||||| |||||||||||  ||    || ||
Sbjct  13673  CTGGCGCCGCTCCAACGGCTACAAGACGCTGCGTGCCTTCATGGACCAGGCGTCCTATAC  13732

Query  258    CGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCC  317
               || || || || |||||| |    ||||| |||||  |  || | | | ||||||||||
Sbjct  13733  GGTGACGGACGGCGCGGACCAGACGTGCGGGTTCACTGAGATCGATGGCACACCTCAGCC  13792

Query  318    CATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTG  377
               || |||| |  |||  | || |||||||| ||||| |||||||| || |||||| | ||
Sbjct  13793  GATCCCGGCC--AAC-TTCCGATCCACGGGATACACGCACGATGGACCCTGTGAGATCTG  13849

Query  378    GCTCGACACCAAACGCG--TGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAA-  434
              ||||||| | |  ||||  | | |||    ||||| || |||||| |||||   ||||| 
Sbjct  13850  GCTCGACTCGACCCGCGTCTACGCCA--ACGACAATTGTCACGAGGCCATCTCGGGCAAG  13907

Query  435    GACTTACAACC-TTGACTACAGCTCGTGCACT------GGTACCTGCACACTTCGTTGGT  487
              |||  ||  || | |||||   ||||            || || ||||||||    ||||
Sbjct  13908  GAC--ACGGCCATCGACTA---CTCGNNNNNNNNNNGCGGCACATGCACACTCTACTGGT  13962

Query  488    ACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCA  547
              ||||| |||| || || |||||||| || ||||||||||||||  | ||||||   ||  
Sbjct  13963  ACTGGATGGGTGTGCGATACCTCAACAACGCCTACTCGTGGCAAGTGTACAAGAACTGTG  14022

Query  548    TCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCGAACGAATCGG  598
              | || || ||| | || |||||    || ||  | ||||| ||||  ||||
Sbjct  14023  TGCCACTCTCGACGTCGGCTCGCATGCTGGAAGGAGCCGCCAACGCCTCGG  14073

 Score = 123 bits (136),  Expect = 4e-26
 Identities = 184/257 (72%), Gaps = 7/257 (3%)
 Strand=Plus/Minus

Query  354   CCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTG  413
             |||||| |||||||| ||| | |||||||||  ||  ||| |  |||||   ||||||||
Sbjct  9064  CCACGACGGTCCGTGCGAGATCTGGCTCGACGACACTCGCATCTTCCAGGGCGACAACTG  9005

Query  414   CCACGAGACCATCAGTGGCAAG-ACTTACAACCTT-GACTACAGCTCGTGCACTGGTACC  471
             |||||||| | ||   |||||| ||  ||  || | ||||||   |||||||  ||  | 
Sbjct  9004  CCACGAGAGCGTCTCCGGCAAGGAC--ACGGCCGTCGACTACTCGTCGTGCAGCGGCTCG  8947

Query  472   TGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAG  531
             ||||| ||    |||| |||| |||| || |||||||| |||   || ||||||||||| 
Sbjct  8946  TGCACGCTGTACTGGTTCTGGATGGGTGTGCGCTACCTGAAGGGAGCGTACTCGTGGCAA  8887

Query  532   ATCTACAAGGCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTGCCGCGAAC  591
              | ||||||   ||| | ||||| ||| | || |||||    || ||| | ||||| |||
Sbjct  8886  GTGTACAAGAACTGCGTGCCGCTCTCGACGTCGGCTCGCATGCTCGAGGGAGCCGCCAAC  8827

Query  592   GAATCGG---TCGCCTT  605
             |  ||||   |||||||
Sbjct  8826  GCGTCGGCCATCGCCTT  8810

 Score = 92.4 bits (101),  Expect = 2e-16
 Identities = 88/113 (78%), Gaps = 0/113 (0%)
 Strand=Plus/Plus

Query  151    GCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCAAC  210
              || ||||| ||||||||||| | | ||||    ||||| |||| ||  |||||||||  |
Sbjct  12506  GCGTTCCTCGAGAACCAGGGCTTCAAGACGCAGGAGGACTTCAGCGCCTGGCGCCGCGCC  12565

Query  211    AACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCAC  263
              ||||| |||||||| |||||   ||||||||||   | |||||||||||| ||
Sbjct  12566  AACGGCTACAAGACGCTGCGCTCCTTCATGGACTCGGGCAAGTACACCGTGAC  12618

 Score = 72.5 bits (79),  Expect = 2e-10
 Identities = 135/195 (69%), Gaps = 4/195 (2%)
 Strand=Plus/Plus

Query  406    GACAACTGCCACGAGACCATCAGTGGCAAG-ACTTACAACCTT-GACTACAGCTCGTGCA  463
              |||||||||||||   ||||    |||||| ||  ||  || | ||||||   |||||||
Sbjct  12676  GACAACTGCCACGCCGCCATTTCGGGCAAGGAC--ACGGCCATCGACTACTCGTCGTGCA  12733

Query  464    CTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACT  523
                ||  | ||||| ||    ||||||||| |||| || |||||||| |||   || ||||
Sbjct  12734  AGGGCTCGTGCACGCTGTACTGGTACTGGATGGGTGTGCGCTACCTGAAGGGAGCGTACT  12793

Query  524    CGTGGCAGATCTACAAGGCTTGCATCCCGCTTTCGGCTTCAGCTCGACGCCTTGAGAGTG  583
              |||||||  | ||||||   ||  | || || ||| | || |||||    || |||   |
Sbjct  12794  CGTGGCAAGTGTACAAGAACTGTGTGCCACTCTCGACGTCGGCTCGTATGCTCGAGGCCG  12853

Query  584    CCGCGAACGAATCGG  598
              || | ||||| ||||
Sbjct  12854  CCTCCAACGAGTCGG  12868

>PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.22, whole genome shotgun 
sequence
Length=998868

 Score = 263 bits (291),  Expect = 6e-68
 Identities = 370/517 (72%), Gaps = 7/517 (1%)
 Strand=Plus/Plus

Query  43      CTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCCACCAAGTTGTGCTCCTGCC-  101
               || || |||  ||||||  | || || | | |  |||| |||||  ||||||| || || 
Sbjct  685336  CTGTCGAGCATGGCGCTCTTGGCCCCAATGGCTGATGCACACCAGATTGTGCTGCTCCCG  685395

Query  102     -AGCCCCGACCTACACGACTGATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGG  160
                |||| | |  |  |||||  || |||||||||| ||||||   || ||||| ||||| |
Sbjct  685396  GAGCCTCAA--TGGACGACGAATGACAAGGACACCAAGTATAACCCGTTGGCATTCCTTG  685453

Query  161     AGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACA  220
               |||||||||| | | ||||    ||||| |||||    |||||   | | ||||| ||||
Sbjct  685454  AGAACCAGGGCTTCAAGACGCAGGAGGACTTCAAGTCCTGGCGTGACGAGAACGGCTACA  685513

Query  221     AGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACT  280
               || | || || ||||| |||||| | || ||||||   || ||    || || |||| ||
Sbjct  685514  AGTCGCTTCGCGACTTTATGGACAGAGCAAAGTACGAAGTGACCAGCGGCGCTGACTTCT  685573

Query  281     ACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGACGGAA---CAATGC  337
                ||||||||| ||| ||  ||| | | | || |||||||||||||  || |   | ||||
Sbjct  685574  CCTGCGGTTTTACGGACCCCAAGGGCACCCCGCAGCCCATTCCGGCGGGCAACGCCATGC  685633

Query  338     GCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGC  397
               | ||||| || ||||| |||||||| |||||||| || |||||||||   |     ||||
Sbjct  685634  GTTCCACCGGATACACGCACGATGGCCCGTGTGAAGTGTGGCTCGACGATACTATGGTGC  685693

Query  398     TCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCT  457
               |  |    |||||||| |||||||   ||  |||||||   ||||   | ||||||   |
Sbjct  685694  TTGACGGCGACAACTGTCACGAGAAGTTCCCTGGCAAGGACTACACTGTGGACTACTCGT  685753

Query  458     CGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATG  517
               ||||||  ||  | || || ||||| |||||||||||||| || || | | | |||||  
Sbjct  685754  CGTGCAAGGGCTCGTGTACGCTTCGCTGGTACTGGCTGGGTGTGCGTTTCTTGAAGAACT  685813

Query  518     CCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
               | |||||||||||| | |||||||| |||||||||||
Sbjct  685814  CGTACTCGTGGCAGGTGTACAAGGCGTGCATCCCGCT  685850

 Score = 260 bits (287),  Expect = 7e-67
 Identities = 389/546 (71%), Gaps = 10/546 (2%)
 Strand=Plus/Minus

Query  23      CCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCC  82
               ||||| | |||||| |     | || |||  |||||| || ||||| | | |  |||| |
Sbjct  687174  CCCTCGCTGTGGCTACCACCTTGTCAAGCATGGCGCTCCTGGCTCCAATGGCTGATGCAC  687115

Query  83      ACCAAGTTGTGCTCCTGCCAG--CCCCGACCTACACGACTGATAACAAGGACACTAAGTA  140
               ||||  ||||||| || || |  |||| |  |  |||||| || |||||||||| |||||
Sbjct  687114  ACCAGATTGTGCTGCTCCCGGAACCCCAA--TGGACGACTAATGACAAGGACACCAAGTA  687057

Query  141     TGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGA-TTTCAACGGGT  199
                   || ||||| ||||| ||||| ||||| | | ||||    ||||| |||| |  | |
Sbjct  687056  CAACCCGTTGGCGTTCCTTGAGAATCAGGGCTTCAAGACGCAGGAGGACTTTCTATCG-T  686998

Query  200     GGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCG  259
               |||||    | |||   |||||  | || ||||||||||||||   ||| ||||||   |
Sbjct  686997  GGCGCAATGAGAACAACTACAAATCTCTTCGTGACTTCATGGATAACGCAAAGTACGAAG  686938

Query  260     TCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCA  319
               | ||    || || |||| || ||||||||| ||| ||  ||| | | | || |||||||
Sbjct  686937  TGACCAGCGGTGCCGACTTCTCCTGCGGTTTTACGGACCCCAAGGGCACCCCGCAGCCCA  686878

Query  320     TTCCGGACGGAA---CAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTT  376
               ||||||  || |   | ||||| ||||| || ||||| ||||| || |||||||| || |
Sbjct  686877  TTCCGGCAGGTAACGCCATGCGTTCCACCGGATACACGCACGACGGCCCGTGTGAAGTGT  686818

Query  377     GGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGA  436
               ||||||||   |     |||||  |    || ||||| |||||||   ||  ||||||| 
Sbjct  686817  GGCTCGACGATACTATGGTGCTTGATGGTGAAAACTGTCACGAGAAGTTCCCTGGCAAGG  686758

Query  437     CTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGG  496
                 ||||   | ||||||   |||||||  || || ||||| || ||||||||||||||||
Sbjct  686757  ACTACACTGTGGACTACTCGTCGTGCAAGGGCACGTGCACGCTCCGTTGGTACTGGCTGG  686698

Query  497     GCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCTTT  556
               |  | |||| |||||||||    |||||||||||| | |||||||| || ||||||||||
Sbjct  686697  GTATTCGCTTCCTCAAGAACCAGTACTCGTGGCAGGTGTACAAGGCCTGTATCCCGCTTT  686638

Query  557     C-GGCT  561
               | ||||
Sbjct  686637  CAGGCT  686632

 Score = 220 bits (243),  Expect = 6e-55
 Identities = 307/430 (71%), Gaps = 3/430 (1%)
 Strand=Plus/Minus

Query  125     ACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCG  184
               |||| || || ||||||   ||  | || ||||| || ||| | || | |  ||||   |
Sbjct  682833  ACAAAGAAACCAAGTATAACCCGCTCGCTTTCCTCGAAAACGAAGGCTTCACGACCCAGG  682774

Query  185     AGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACC  244
               |||| || |  |  ||||||    | || || |||||| | || ||||||||| ||||| 
Sbjct  682773  AGGACTTTACAGCCTGGCGCAAAGAGAATGGCTACAAGTCGCTTCGTGACTTCTTGGACA  682714

Query  245     GCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACG  304
                |||||| ||| | ||||| ||||| || |||| | | |||||||| ||| ||  ||| |
Sbjct  682713  ACGCCAAATACCCGGTCACAGATGGTGCTGACTTCAAATGCGGTTTTACGGACCCCAAGG  682654

Query  305     CCGCACCTCAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGTTACACCCACGATG  361
                | | || |||||||||||||  || |   | ||||| ||||| || ||||| |||||||
Sbjct  682653  GCACCCCGCAGCCCATTCCGGCGGGCAACGCCATGCGTTCCACCGGATACACGCACGATG  682594

Query  362     GTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGA  421
               | |||||||| || |||||||||   |     |||||  |    |||||||| |||||||
Sbjct  682593  GCCCGTGTGAAGTGTGGCTCGACGATACTATGGTGCTTGACGGCGACAACTGTCACGAGA  682534

Query  422     CCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTC  481
                  ||  |||||||   ||||   | ||||||   |||||||  || || ||||| ||| 
Sbjct  682533  AGTTCCCTGGCAAGGACTACACTGTGGACTACTCGTCGTGCAAGGGCACGTGCACGCTTT  682474

Query  482     GTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGG  541
                 ||||||||||| || || || | ||| ||||| | ||||||||||||  | |||||||
Sbjct  682473  ACTGGTACTGGCTAGGTGTGCGTTTCCTGAAGAACGACTACTCGTGGCAAGTATACAAGG  682414

Query  542     CTTGCATCCC  551
               | ||||| ||
Sbjct  682413  CCTGCATTCC  682404

 Score = 177 bits (195),  Expect = 7e-42
 Identities = 340/496 (69%), Gaps = 8/496 (2%)
 Strand=Plus/Plus

Query  63      TGCTCCCACGTCCA-ATGCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACTG  121
               ||||||||  | |  |||| |||||  ||||||| || ||||  ||    |  |||||  
Sbjct  714164  TGCTCCCAACTACTGATGCACACCAGATTGTGCTACTTCCAGAACCCCAGTGGACGACGA  714223

Query  122     ATAACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCG  181
               || ||||||| || |||||    ||  | || |||||||| || ||||| |   | ||| 
Sbjct  714224  ATGACAAGGATACCAAGTACAATCCGCTCGCTTTCCTGGAAAATCAGGGCTTTAA-ACC-  714281

Query  182     TC--GAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCAT  239
               ||  || || |||   |  ||| ||    | ||||| |||||  | || ||||| |||||
Sbjct  714282  TCAGGAAGACTTCGCTGCATGGAGCAAGGAGAACGGCTACAAATCGCTTCGTGATTTCAT  714341

Query  240     GGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGT  299
               |||| | |||||||||   || ||    || || || |  | ||| ||||| || |||  
Sbjct  714342  GGACAGAGCCAAGTACGAAGTTACCCCCGGTGCTGATTTTTCCTGTGGTTTTACAAACCC  714401

Query  300     CAACGCCGCACCTCAGCCCATTCCGG---ACGGAACAATGCGCTCCACGGGTTACACCCA  356
               ||| |   |||| || || |||||||   | || |  ||||| ||||| || ||||| ||
Sbjct  714402  CAAGGGTACACCACAACCTATTCCGGCGCAAGGTATCATGCGTTCCACCGGGTACACTCA  714461

Query  357     CGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCA  416
               ||| ||||| || || || |  || ||    |     ||||||||    ||||| |||||
Sbjct  714462  CGACGGTCCATGCGAAGTGTACCTTGATGATACCTTGGTGCTCCAAGGCGACAATTGCCA  714521

Query  417     CGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCAC  476
                ||||   ||   ||||||   | |  | | ||||||   |||||||  || || |||||
Sbjct  714522  TGAGAAATTCCCCGGCAAGGACTGCCCCATCGACTACTCATCGTGCAAAGGAACATGCAC  714581

Query  477     ACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTA  536
               |||||| ||||||||| ||||| | |||| ||| |||||||| ||||| |||||| | ||
Sbjct  714582  ACTTCGATGGTACTGGTTGGGCATCCGCTTCCTGAAGAATGCGTACTCATGGCAGGTGTA  714641

Query  537     CAAGGCTTGCATCCCG  552
               |||||  ||||| |||
Sbjct  714642  CAAGGAATGCATTCCG  714657

>PHKE:scaffold_622 scf_22126_622.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_622.1:1:14582:1 
REF
Length=14582

 Score = 261 bits (289),  Expect = 2e-67
 Identities = 386/539 (72%), Gaps = 11/539 (2%)
 Strand=Plus/Minus

Query  23    CCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCC  82
             ||||  ||||  || ||||  | ||||| || || || || || || |   || | || |
Sbjct  4009  CCCTTGCCGTAACTACTGTCTTGTCCAGTGCAGCTCTGCTCGCCCCAATTGCCGACGCAC  3950

Query  83    ACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACTGATAACAAGGACACTAAGTATG  142
             ||||| | ||||| ||||| |  || || |  || || ||  | || || || |||||  
Sbjct  3949  ACCAAATCGTGCTGCTGCCGGAGCCCACATGGACAACGGACGATAAAGATACAAAGTACA  3890

Query  143   CACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCG-AGGATTTCAACGGGTGG  201
               || ||||||||||| |||    | ||||   |  |||  | | || ||||  |  |||
Sbjct  3889  ACCCGTTGGCCTTCCTCGAGGGTGAAGGATTT-ACCCCGCAGGAAGACTTCACTGCCTGG  3831

Query  202   CGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTC  261
             ||   | | || || |||||| | ||||| ||||||||||||  |||||||||| | || 
Sbjct  3830  CGTATCGAGAATGGCTACAAGTCGCTGCGCGACTTCATGGACAACGCCAAGTACTCGGTG  3771

Query  262   ACTGATGGAGCGGACTACTACT-GCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCAT  320
             ||   ||| || |||| || || ||||||| ||  ||  ||| | | |||| ||||||||
Sbjct  3770  ACCAGTGGTGCTGACT-CTGCTTGCGGTTTTACCGACCCCAATGGCACACCGCAGCCCAT  3712

Query  321   TCCGGACGGAA---CAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTG  377
             |||||| || |   | |||||||||||||| ||||| ||||| || ||||| ||||| ||
Sbjct  3711  TCCGGAGGGCAACGCCATGCGCTCCACGGGATACACGCACGACGGACCGTGCGAGGTCTG  3652

Query  378   GCTCGACACCAAACGCGTGCTCCAGTCG--GACAACTGCCACGAGACCATCAGTGGCAAG  435
             | |||||   | || | |||    | |   ||||||||||||||| |  ||   ||||||
Sbjct  3651  GATCGACG--ATACCCTTGCGATGGGCAATGACAACTGCCACGAGGCGTTCCCCGGCAAG  3594

Query  436   ACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTG  495
                |||| | | ||||||    | ||||  || || |||||||| |||||||||||||||
Sbjct  3593  GACTACACCATCGACTACTCGGCCTGCAAGGGCACGTGCACACTCCGTTGGTACTGGCTG  3534

Query  496   GGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
             ||||| || | |||||||||| |||||||||||||| | |||||||| ||||| |||||
Sbjct  3533  GGCGTGCGTTTCCTCAAGAATTCCTACTCGTGGCAGGTATACAAGGCCTGCATTCCGCT  3475

 Score = 118 bits (130),  Expect = 2e-24
 Identities = 101/125 (81%), Gaps = 0/125 (0%)
 Strand=Plus/Plus

Query  430  GGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTAC  489
            ||||||   |||| | | ||||||    | ||||  || || |||||||| || ||||||
Sbjct  10   GGCAAGGACTACACCATCGACTACTCGGCCTGCAAGGGCACGTGCACACTCCGCTGGTAC  69

Query  490  TGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATC  549
            ||||||||||| || | ||||||||||||||||||||||||| | |||||||| ||||| 
Sbjct  70   TGGCTGGGCGTGCGTTTCCTCAAGAATGCCTACTCGTGGCAGGTGTACAAGGCCTGCATT  129

Query  550  CCGCT  554
            |||||
Sbjct  130  CCGCT  134

 Score = 86.9 bits (95),  Expect = 9e-15
 Identities = 173/254 (68%), Gaps = 2/254 (1%)
 Strand=Plus/Minus

Query  35    CTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCCACCAAGTTGTGC  94
             |||| |  || |||||||  || ||  | || || ||  || | || |||||| | ||||
Sbjct  5526  CTGCAGCTCTCTCCAGCGTAGCTCTGTTGGCCCCAACTGCCGACGCACACCAAATCGTGC  5467

Query  95    TCCTGCCAGCCCCGACCTACACGACTGATAACAAGGACACTAAGTATGCACCATTGGCCT  154
             | ||||| |  || || |  |||||  |  | |||||||| |||||    || |||||||
Sbjct  5466  TGCTGCCGGAGCCCACTTGGACGACGAACGATAAGGACACGAAGTACAACCCGTTGGCCT  5407

Query  155   TCCTGGAGAACCAGGGATACGAGACCGTCG-AGGATTTCAACGGGTGGCGCCGCAACAAC  213
             |||| |||    | ||||   |  |||  | | || ||||| |  |||||     | || 
Sbjct  5406  TCCTCGAGGGTGAAGGATTT-ACCCCGCAGGAAGACTTCAAGGCCTGGCGTGAGGAGAAT  5348

Query  214   GGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATGGAGCG  273
             || |||||| | ||||| ||||||||||||  |||||||||| | || ||   ||| || 
Sbjct  5347  GGCTACAAGTCGCTGCGCGACTTCATGGACAACGCCAAGTACCCGGTGACCAGTGGTGCT  5288

Query  274   GACTACTACTGCGG  287
             |||| | |||| ||
Sbjct  5287  GACTTCAACTGTGG  5274

>PHKE:scaffold_761 scf_22126_761.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_761.1_contig_1:1:9298:1 
REF
Length=9298

 Score = 253 bits (280),  Expect = 3e-65
 Identities = 376/529 (71%), Gaps = 7/529 (1%)
 Strand=Plus/Minus

Query  31   GTGGCTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCCACCAAGTT  90
            ||||  || | ||| ||  |||||||  || |||| || |   || |||| || ||| ||
Sbjct  915  GTGGTCGCAGCGCTGTCAGGCGCGGCTGTAATTGCCCCTATTACCGATGCGCATCAAATT  856

Query  91   GTGCTCCTGCCAGCCCCGACCTACACGACTGATAACAAGGACACTAAGTATGCACCATTG  150
            ||| | |||||||  |||   |  |  || || | |||||| |  |||||    ||  ||
Sbjct  855  GTGTTGCTGCCAGAGCCGCAGTGGAAAACAGACAGCAAGGAAATCAAGTACAACCCGCTG  796

Query  151  GCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCAAC  210
            || |||||||||||||| || | ||  |||   || |||  |||||  ||||| ||  | 
Sbjct  795  GCATTCCTGGAGAACCAAGGCTTCGCAACCCAGGAAGATGCCAACGCCTGGCGTCGTGAT  736

Query  211  AACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATGGA  270
            || || |||||||| || |||| ||||||||||   |||||||||   || || || || 
Sbjct  735  AATGGTTACAAGACGCTCCGTGCCTTCATGGACATGGCCAAGTACCAGGTGACCGAAGGT  676

Query  271  GCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC---GGAC  327
            || ||||||| |||||| |  ||  ||  ||||| | |  | || || || ||   ||  
Sbjct  675  GCTGACTACTTCTGCGGCTGGACCGACCCCAACGGCACGGCACAACCAATCCCAGAGGGG  616

Query  328  GGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACC  387
            ||  | ||||||||||| || ||||| || |||||||| |||||||| ||| |||||| |
Sbjct  615  GGTGCCATGCGCTCCACAGGCTACACGCATGATGGTCCATGTGAGGTCTGGATCGACAAC  556

Query  388  AAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTT  447
            |  ||||||||  |    |  || ||||||||||| |||| ||| |||   |||| | | 
Sbjct  555  ACGCGCGTGCTGGAAAGTGGTAATTGCCACGAGACGATCACTGGAAAGGACTACACCATC  496

Query  448  GACTA--CAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCT  505
            |||||  | ||  || ||  || |||||||  || || ||||||||| |||| || ||||
Sbjct  495  GACTATTCTGCCTGT-CA-AGGCACCTGCATGCTGCGCTGGTACTGGTTGGGTGTTCGCT  438

Query  506  ACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
             |||||||||  | |||||||||||| | ||||| || |||||||| ||
Sbjct  437  TCCTCAAGAACTCTTACTCGTGGCAGGTGTACAAAGCCTGCATCCCACT  389

>PHSO:scaffold_4
Length=7609242

 Score = 249 bits (275),  Expect = 1e-63
 Identities = 338/469 (72%), Gaps = 7/469 (1%)
 Strand=Plus/Plus

Query  30       CGTGGCTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCCACCAAGT  89
                ||| |||| ||| || || |||||||| ||  | || || ||  |  | || |||||  |
Sbjct  4364895  CGTCGCTGGTGTTCTGTCTAGCGCGGCTCTGTTGGCGCCAACCGCGGACGCGCACCAGAT  4364954

Query  90       TGTGCTCCTGCC--AGCCCCGACCTACACGACTGATAACAAGGACACTAAGTATGCACCA  147
                 ||  | | |||  ||||||    |  || ||  |  ||||||| || |||||    || 
Sbjct  4364955  CGTCTTGCAGCCTGAGCCCCAG--TGGACTACGAACGACAAGGAAACCAAGTACAACCCG  4365012

Query  148      TTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGC  207
                 |||||||||| |||||||| || | || ||||    | || ||    | |||||||  |
Sbjct  4365013  CTGGCCTTCCTTGAGAACCAAGGGTTCGCGACCCAGCAAGACTTTCGGGAGTGGCGCACC  4365072

Query  208      AACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGAT  267
                || ||||| |||||||||||||| |||||||||||||  | ||||||||| || ||  | 
Sbjct  4365073  AAGAACGGCTACAAGACCCTGCGCGACTTCATGGACCATGGCAAGTACACGGTGACCAAG  4365132

Query  268      GGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGAC  327
                || || |||| ||  |||||||  ||  ||  ||| | | | || |||||||||||||||
Sbjct  4365133  GGCGCCGACTTCTCTTGCGGTTGGACCGACCCCAAGGGCACCCCGCAGCCCATTCCGGAC  4365192

Query  328      GGA---ACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGAC  384
                |||    | |||||||||||||| |||||||||||||||||||| ||||| ||| |||||
Sbjct  4365193  GGAGACGCCATGCGCTCCACGGGCTACACCCACGATGGTCCGTGCGAGGTCTGGATCGAC  4365252

Query  385      ACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAAC  444
                | ||  |||||||| |||   ||||||||||||||||  |||   | ||||   ||||  
Sbjct  4365253  AACACGCGCGTGCTGCAGGGCGACAACTGCCACGAGAAGATCGCCGACAAGGGCTACACG  4365312

Query  445      CTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGC  493
                 | ||||||    | || |  || || ||||| || |||||||||||||
Sbjct  4365313  ATCGACTACTCGGCTTGTAAGGGCACGTGCACGCTCCGTTGGTACTGGC  4365361

 Score = 249 bits (275),  Expect = 1e-63
 Identities = 338/469 (72%), Gaps = 7/469 (1%)
 Strand=Plus/Minus

Query  30       CGTGGCTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCCACCAAGT  89
                ||| |||| ||| || || |||||||| ||  | || || ||  |  | || |||||  |
Sbjct  4374398  CGTCGCTGGTGTTCTGTCTAGCGCGGCTCTGTTGGCGCCAACCGCGGACGCGCACCAGAT  4374339

Query  90       TGTGCTCCTGCC--AGCCCCGACCTACACGACTGATAACAAGGACACTAAGTATGCACCA  147
                 ||  | | |||  ||||||    |  || ||  |  ||||||| || |||||    || 
Sbjct  4374338  CGTCTTGCAGCCTGAGCCCCAG--TGGACTACGAACGACAAGGAAACCAAGTACAACCCG  4374281

Query  148      TTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGC  207
                 |||||||||| |||||||| || | || ||||    | || ||    | |||||||  |
Sbjct  4374280  CTGGCCTTCCTTGAGAACCAAGGGTTCGCGACCCAGCAAGACTTTCGGGAGTGGCGCACC  4374221

Query  208      AACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGAT  267
                || ||||| |||||||||||||| |||||||||||||  | ||||||||| || ||  | 
Sbjct  4374220  AAGAACGGCTACAAGACCCTGCGCGACTTCATGGACCATGGCAAGTACACGGTGACCAAG  4374161

Query  268      GGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGAC  327
                || || |||| ||  |||||||  ||  ||  ||| | | | || |||||||||||||||
Sbjct  4374160  GGCGCCGACTTCTCTTGCGGTTGGACCGACCCCAAGGGCACCCCGCAGCCCATTCCGGAC  4374101

Query  328      GGA---ACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGAC  384
                |||    | |||||||||||||| |||||||||||||||||||| ||||| ||| |||||
Sbjct  4374100  GGAGACGCCATGCGCTCCACGGGCTACACCCACGATGGTCCGTGCGAGGTCTGGATCGAC  4374041

Query  385      ACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAAC  444
                | ||  |||||||| |||   ||||||||||||||||  |||   | ||||   ||||  
Sbjct  4374040  AACACGCGCGTGCTGCAGGGCGACAACTGCCACGAGAAGATCGCCGACAAGGGCTACACG  4373981

Query  445      CTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGC  493
                 | ||||||    | || |  || || ||||| || |||||||||||||
Sbjct  4373980  ATCGACTACTCGGCTTGTAAGGGCACGTGCACGCTCCGTTGGTACTGGC  4373932

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  528      GCAGATCTACAAGGCTTGCATCCCGCT  554
                |||| | ||||||||||||||||||||
Sbjct  4365362  GCAGGTGTACAAGGCTTGCATCCCGCT  4365388

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  528      GCAGATCTACAAGGCTTGCATCCCGCT  554
                |||| | ||||||||||||||||||||
Sbjct  4373931  GCAGGTGTACAAGGCTTGCATCCCGCT  4373905

>PHSO:scaffold_64
Length=40116

 Score = 242 bits (267),  Expect = 2e-61
 Identities = 277/372 (74%), Gaps = 3/372 (1%)
 Strand=Plus/Plus

Query  125    ACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCG  184
              ||||||| || |||||    ||  |||||||||| |||||||| |||| || ||||    
Sbjct  37942  ACAAGGAAACCAAGTACAACCCGCTGGCCTTCCTCGAGAACCAAGGATTCGCGACCCAGC  38001

Query  185    AGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACC  244
              | || ||    | ||||||   ||| ||||| |||||||||||||| |||||||||||||
Sbjct  38002  AAGACTTTCGGGCGTGGCGTACCAAGAACGGCTACAAGACCCTGCGCGACTTCATGGACC  38061

Query  245    GCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACG  304
                | ||||||||| || ||  | || || |||| ||  |||||||  ||  ||  ||| |
Sbjct  38062  ATGGCAAGTACACGGTGACCAAGGGCGCCGACTTCTCTTGCGGTTGGACCGACCCCAAGG  38121

Query  305    CCGCACCTCAGCCCATTCCGGACGGA---ACAATGCGCTCCACGGGTTACACCCACGATG  361
               | | || ||||||||||||||||||    | |||||||||||||| |||||||||||||
Sbjct  38122  GCACCCCGCAGCCCATTCCGGACGGAGACGCCATGCGCTCCACGGGCTACACCCACGATG  38181

Query  362    GTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGA  421
              | ||||| ||||| ||| |||||| ||  |||||||| |||   ||||||||||||||||
Sbjct  38182  GCCCGTGCGAGGTCTGGATCGACAACACGCGCGTGCTGCAGGGCGACAACTGCCACGAGA  38241

Query  422    CCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTC  481
                |||   | ||||   ||||   | ||||||    | || |  || || ||||| || |
Sbjct  38242  AGATCGCCGACAAGGGCTACACGATCGACTACTCGGCTTGTAAGGGCACGTGCACGCTCC  38301

Query  482    GTTGGTACTGGC  493
              ||||||||||||
Sbjct  38302  GTTGGTACTGGC  38313

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  528    GCAGATCTACAAGGCTTGCATCCCGCT  554
              |||| | ||||||||||||||||||||
Sbjct  38314  GCAGGTGTACAAGGCTTGCATCCCGCT  38340

>PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 
genomic scaffold, whole genome shotgun sequence
Length=2113949

 Score = 224 bits (248),  Expect = 1e-56
 Identities = 341/483 (71%), Gaps = 7/483 (1%)
 Strand=Plus/Plus

Query  77      ATGCCCACCAAGTTGTGCTCCTGCCAG--CCCCGACCTACACGACTGATAACAAGGACAC  134
               |||| |||||  ||||||| || || |  |||| |  |  |||||  |  ||||||||||
Sbjct  696918  ATGCTCACCAGATTGTGCTGCTCCCGGAACCCCAA--TGGACGACGCAAGACAAGGACAC  696975

Query  135     TAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAA  194
                |||||    ||  |||| ||| | ||||||||||| |   ||||     ||||||||||
Sbjct  696976  CAAGTACAACCCGCTGGCTTTCTTAGAGAACCAGGGCTTTAAGACGCAGCAGGATTTCAA  697035

Query  195     CGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTA  254
                |  |||||     | ||||| |||||  | || ||||||||||||||| | ||||||||
Sbjct  697036  GGCCTGGCGTGATGAAAACGGCTACAAATCGCTTCGTGACTTCATGGACAGAGCCAAGTA  697095

Query  255     CACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCA  314
               |  ||| ||    || || |||| ||  |||||||| ||| ||   || |   | || ||
Sbjct  697096  CGACGTGACCAGCGGCGCCGACTTCTCGTGCGGTTTTACGGACCCGAAGGGGACGCCGCA  697155

Query  315     GCCCATTCCGGACGGAA---CAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGA  371
               ||| |||||||  ||     | ||||| || || |||||||| ||||| || ||||| ||
Sbjct  697156  GCCTATTCCGGCGGGTGGCGCCATGCGATCGACTGGTTACACGCACGACGGACCGTGCGA  697215

Query  372     GGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGG  431
                || ||||| |||  |||    |||||  |    |||||||| |||||||   ||   ||
Sbjct  697216  AGTGTGGCTTGACGACAAGATGGTGCTGGATGGCGACAACTGTCACGAGAAGTTCCCAGG  697275

Query  432     CAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTG  491
               ||||   ||||   | ||||||   || ||||  || || ||||| || || ||||||||
Sbjct  697276  CAAGGACTACACTGTGGACTACTCGTCATGCAAGGGCACGTGCACGCTGCGCTGGTACTG  697335

Query  492     GCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCC  551
               ||||||||| |||| | | |||||  | |||||||||||| | |||||||| ||||| ||
Sbjct  697336  GCTGGGCGTGCGCTTCTTGAAGAACTCGTACTCGTGGCAGGTGTACAAGGCCTGCATTCC  697395

Query  552     GCT  554
               |||
Sbjct  697396  GCT  697398

 Score = 139 bits (153),  Expect = 2e-30
 Identities = 178/245 (73%), Gaps = 3/245 (1%)
 Strand=Plus/Plus

Query  310     CCTCAGCCCATTCCGGACGGAA---CAATGCGCTCCACGGGTTACACCCACGATGGTCCG  366
               || ||||| |||||||  ||     | ||||| || || |||||||| ||||| || |||
Sbjct  673444  CCGCAGCCTATTCCGGCGGGTGACGCCATGCGATCGACTGGTTACACGCACGACGGACCG  673503

Query  367     TGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATC  426
               || ||||| |||||||||  |||    |||||  |    |||||||| |||||||   ||
Sbjct  673504  TGCGAGGTGTGGCTCGACGACAAGATGGTGCTGGATGGCGACAACTGTCACGAGAAGTTC  673563

Query  427     AGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGG  486
                  ||||||   ||||   | ||||||   || ||||  || || ||||| || || |||
Sbjct  673564  CCAGGCAAGGACTACACTGTGGACTACTCGTCATGCAAGGGCACGTGCACGCTGCGCTGG  673623

Query  487     TACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGC  546
               |||||||||||| | |||| ||| |||||    |||||||||||| | || ||||| |||
Sbjct  673624  TACTGGCTGGGCATCCGCTTCCTGAAGAACAAGTACTCGTGGCAGGTGTATAAGGCCTGC  673683

Query  547     ATCCC  551
               |||||
Sbjct  673684  ATCCC  673688

>PHSO:scaffold_11
Length=2192408

 Score = 216 bits (239),  Expect = 8e-54
 Identities = 310/436 (71%), Gaps = 17/436 (4%)
 Strand=Plus/Minus

Query  125      ACAAGGACACTAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCG  184
                |||| || || |||||    ||  ||||||||||||||  |||||| | || |||    |
Sbjct  2022890  ACAAAGATACCAAGTACAACCCGCTGGCCTTCCTGGAGGGCCAGGGCTTCGCGACGCAGG  2022831

Query  185      AGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACC  244
                |||  ||| |||   |||||||  | || || ||||| || || || |||||||||||||
Sbjct  2022830  AGGGCTTCGACGCCCGGCGCCGTGATAATGGCTACAAAACTCTACGCGACTTCATGGACC  2022771

Query  245      GCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACG  304
                | | ||||||||| || ||  | || || ||||||| |||||| |  || |||  ||| |
Sbjct  2022770  GAGGCAAGTACACGGTGACCCAGGGCGCCGACTACTTCTGCGGCTGGACCAACCCCAAGG  2022711

Query  305      CCGCACCTCAGCCCATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTC  364
                   | || |||||||||||            ||||||||||||||||||||| || || |
Sbjct  2022710  GGACGCCGCAGCCCATTCC------------GCGCTCCACGGGTTACACCCATGACGGCC  2022663

Query  365      CGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCA  424
                |||||||| ||||||| |||  |   ||||||||  |||| | ||||||||||||||| |
Sbjct  2022662  CGTGTGAGATTTGGCTGGACGACGTGCGCGTGCTGGAGTCCGGCAACTGCCACGAGACGA  2022603

Query  425      TCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTT  484
                ||     || ||   || | || |  | | ||  |   |  ||   ||||||  | |  |
Sbjct  2022602  TC--CCCCACGATCGACTA-CTCG--TCCTGCGAGAAGAAGGGCGGCTGCACGATGCACT  2022548

Query  485      GGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTT  544
                |||||||||| || || |||| |||||||||  | |||||||||||| |||||||||  |
Sbjct  2022547  GGTACTGGCTCGGAGTGCGCTTCCTCAAGAACTCGTACTCGTGGCAGGTCTACAAGGAGT  2022488

Query  545      GCATCCCGCTTTCGGC  560
                ||||||| ||  ||||
Sbjct  2022487  GCATCCCCCTCACGGC  2022472

 Score = 44.6 bits (48),  Expect = 0.029
 Identities = 33/39 (85%), Gaps = 0/39 (0%)
 Strand=Plus/Minus

Query  346     GGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGAC  384
               |||| ||||||||  ||||||||||||||||   |||||
Sbjct  498995  GGTTTCACCCACGTCGGTCCGTGTGAGGTTTACATCGAC  498957

>PHPA:scaffold_66 NW_008649052.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.66, whole genome shotgun 
sequence
Length=310063

 Score = 194 bits (214),  Expect = 3e-47
 Identities = 334/485 (69%), Gaps = 9/485 (2%)
 Strand=Plus/Minus

Query  79      GCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACTGATAACAAGGACACTAAG  138
               ||||||||| | ||||| |  || |  |||   |  ||||| || |||||||| |  |||
Sbjct  163105  GCCCACCAAATCGTGCTGCAACCGGAGCCGCAATGGACGACGGACAACAAGGATATCAAG  163046

Query  139     TATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGG  198
               |||   ||| | || || || ||    || || | | | ||    ||||| || ||||  
Sbjct  163045  TATAACCCACTCGCTTTTCTCGAAGGTCAAGGTTTCCAAACTCAAGAGGACTTTAACGCT  162986

Query  199     TGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACC  258
               ||||| ||| ||||||| |||||||| || ||||||||||||||| | ||||||||||| 
Sbjct  162985  TGGCGTCGCGACAACGGATACAAGACTCTCCGTGACTTCATGGACAGAGCCAAGTACACG  162926

Query  259     GTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCC  318
               || || || || || || |||| ||| || |  ||| ||  ||| |   | || ||||||
Sbjct  162925  GTTACCGAAGGTGCCGATTACTTCTGTGGATGGACGGACCCCAAGGGTACTCCGCAGCCC  162866

Query  319     ATTC---CGGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTT  375
               ||||   |||  ||  | ||||| || || |||||||| || || || || || ||||| 
Sbjct  162865  ATTCCAGCGGGTGGTGCCATGCGTTCAACCGGTTACACTCATGACGGACCATGCGAGGTG  162806

Query  376     TGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAG  435
               ||||| ||       || ||| |  ||   | ||| ||||||||  | |||  ||| |||
Sbjct  162805  TGGCTGGATGATGTTCGTGTGTTGGAGGGTGGCAATTGCCACGAATCGATCCCTGGGAAG  162746

Query  436     ACTTACAACCTTGACTACAGCTCGTGC------ACTGGTACCTGCACACTTCGTTGGTAC  489
                  |||| | | ||||||   ||||||      |  |||  ||||   || || ||||||
Sbjct  162745  GACTACACCATCGACTACTCATCGTGCGAGAAGAAGGGTGGCTGCGTGCTACGCTGGTAC  162686

Query  490     TGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATC  549
               ||| |||| || |||| |||||| ||  | |||||||||||| | ||||| |  ||||| 
Sbjct  162685  TGGTTGGGTGTCCGCTTCCTCAAAAACTCGTACTCGTGGCAGGTGTACAAAGAGTGCATT  162626

Query  550     CCGCT  554
               || ||
Sbjct  162625  CCACT  162621

>PHPA:scaffold_46 NW_008649032.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.46, whole genome shotgun 
sequence
Length=493760

 Score = 194 bits (214),  Expect = 3e-47
 Identities = 334/485 (69%), Gaps = 9/485 (2%)
 Strand=Plus/Minus

Query  79    GCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACTGATAACAAGGACACTAAG  138
             ||||||||| | ||||| |  || |  |||   |  ||||| || |||||||| |  |||
Sbjct  3966  GCCCACCAAATCGTGCTGCAACCGGAGCCGCAATGGACGACGGACAACAAGGATATCAAG  3907

Query  139   TATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGG  198
             |||   ||| | || || || ||    || || | | | ||    ||||| || ||||  
Sbjct  3906  TATAACCCACTCGCTTTTCTCGAAGGTCAAGGTTTCCAAACTCAAGAGGACTTTAACGCT  3847

Query  199   TGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACC  258
             ||||| ||| ||||||| |||||||| || ||||||||||||||| | ||||||||||| 
Sbjct  3846  TGGCGTCGCGACAACGGATACAAGACTCTCCGTGACTTCATGGACAGAGCCAAGTACACG  3787

Query  259   GTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCC  318
             || || || || || || |||| ||| || |  ||| ||  ||| |   | || ||||||
Sbjct  3786  GTTACCGAAGGTGCCGATTACTTCTGTGGATGGACGGACCCCAAGGGTACTCCGCAGCCC  3727

Query  319   ATTC---CGGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTT  375
             ||||   |||  ||  | ||||| || || |||||||| || || || || || ||||| 
Sbjct  3726  ATTCCAGCGGGTGGTGCCATGCGTTCAACCGGTTACACTCATGACGGACCATGCGAGGTG  3667

Query  376   TGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAG  435
             ||||| ||       || ||| |  ||   | ||| ||||||||  | |||  ||| |||
Sbjct  3666  TGGCTGGATGATGTTCGTGTGTTGGAGGGTGGCAATTGCCACGAATCGATCCCTGGGAAG  3607

Query  436   ACTTACAACCTTGACTACAGCTCGTGC------ACTGGTACCTGCACACTTCGTTGGTAC  489
                |||| | | ||||||   ||||||      |  |||  ||||   || || ||||||
Sbjct  3606  GACTACACCATCGACTACTCATCGTGCGAGAAGAAGGGTGGCTGCGTGCTACGCTGGTAC  3547

Query  490   TGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATC  549
             ||| |||| || |||| |||||| ||  | |||||||||||| | ||||| |  ||||| 
Sbjct  3546  TGGTTGGGTGTCCGCTTCCTCAAAAACTCGTACTCGTGGCAGGTGTACAAAGAGTGCATT  3487

Query  550   CCGCT  554
             || ||
Sbjct  3486  CCACT  3482

>PHSO:scaffold_12
Length=2105860

 Score = 188 bits (208),  Expect = 1e-45
 Identities = 294/415 (71%), Gaps = 13/415 (3%)
 Strand=Plus/Minus

Query  145     CCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGC  204
               || ||||| ||||| |||||||| || | | ||||     || | |||| |  ||  |  
Sbjct  168830  CCGTTGGCGTTCCTCGAGAACCAAGGTTTCCAGACGCAGTAGAACTTCACCCAGTACCAG  168771

Query  205     CGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACT  264
                 | ||||||| ||||||| ||||||||| |||||||||  |||||||||||| ||||| 
Sbjct  168770  GTCGACAACGGCTACAAGAGCCTGCGTGATTTCATGGACAACGCCAAGTACACGGTCACG  168711

Query  265     GATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC-  323
               || ||||| ||| |   |||||| |  ||  ||  ||| | |    | ||||  ||||| 
Sbjct  168710  GAAGGAGCCGACCAGGCCTGCGGATGGACCGACCCCAAGGGCATCGCCCAGCAGATTCCA  168651

Query  324     --GGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTC  381
                 ||||||||| |||||  |  |||| ||||||||||| || || || ||| | |   | 
Sbjct  168650  TCGGACGGAACCATGCGTACGTCGGGCTACACCCACGACGGCCCCTGCGAGATCTACATG  168591

Query  382     GACACCAAACGCGTGCTCCAGTCGGAC---AACTGCCACGAGACCATCAGTGGCAAGACT  438
               | |  ||| |  | |||   |||| |    |||||||||||| | ||||  | | |||| 
Sbjct  168590  GGCGACAAGCTGGCGCT---GTCGTATCTGAACTGCCACGAGTCGATCACGGACCAGACG  168534

Query  439     TACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGT--TGGTACTGGCTGG  496
               | ||| || |||||||||   ||    | || |||||| ||| ||  |||||||||||||
Sbjct  168533  TTCAAGCTGGACTACAGCGGATGTGGCGATAGCTGCAC-CTT-GTACTGGTACTGGCTGG  168476

Query  497     GCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCC  551
               |||| |||| |||||| ||    |||||||||||| | |||||||  ||||||||
Sbjct  168475  GCGTGCGCTTCCTCAACAACAAGTACTCGTGGCAGGTGTACAAGGAGTGCATCCC  168421

 Score = 141 bits (156),  Expect = 1e-31
 Identities = 241/349 (69%), Gaps = 3/349 (1%)
 Strand=Plus/Minus

Query  209     ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
               |||| || |||||||  || || |||||||||||  | ||||||||||   | || ||||
Sbjct  167465  ACAATGGCTACAAGAGTCTCCGCGACTTCATGGAGAGGGCCAAGTACAAGCTGACGGATG  167406

Query  269     GAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC---GG  325
               |||| ||| |   |||||| |  ||  ||  ||| |     || || |  || ||   ||
Sbjct  167405  GAGCCGACCAGGCCTGCGGATGGACCGACCCCAAGGGAATCCCGCAACAGATCCCCGAGG  167346

Query  326     ACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACA  385
               |||| || |||||| |  |||| ||||||||||| || ||||||||| | |   | | | 
Sbjct  167345  ACGGCACGATGCGCACGTCGGGCTACACCCACGACGGACCGTGTGAGATCTACATGGGCG  167286

Query  386     CCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACC  445
                ||| |  |  |||  ||    ||||||||||||| | |||| || | |||| | ||| |
Sbjct  167285  ACAAGCTGGCCCTCTCGTACCTCAACTGCCACGAGTCGATCACTGACCAGACGTTCAAGC  167226

Query  446     TTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCT  505
               | |||||||||   |||   | || |||||  ||    ||||||||||||||||| ||  
Sbjct  167225  TGGACTACAGCGGCTGCGGGGATAGCTGCATCCTGTACTGGTACTGGCTGGGCGTGCGTA  167166

Query  506     ACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
               | || |||      | |||||||||  | |||||||  |||||||||||
Sbjct  167165  AGCTGAAGGGCAAGTTCTCGTGGCAAGTGTACAAGGAGTGCATCCCGCT  167117

 Score = 124 bits (137),  Expect = 4e-26
 Identities = 239/350 (68%), Gaps = 12/350 (3%)
 Strand=Plus/Minus

Query  209     ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
               ||||||| |||||||  ||||| ||||||||||||  || ||| ||| | |||||  | |
Sbjct  162270  ACAACGGCTACAAGAGTCTGCGCGACTTCATGGACAACGGCAACTACTCGGTCACGAAAG  162211

Query  269     GAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC---GG  325
               |||| ||| |   ||| || |  ||  ||   || |     || || |  |||||   ||
Sbjct  162210  GAGCCGACCAGGCCTGTGGGTGGACCGACCCGAATGGGATCCCCCAACAGATTCCTGAGG  162151

Query  326     ACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACA  385
               |||| || |||||| |  |||||| ||| ||||||| ||| |||||| | |   | |   
Sbjct  162150  ACGGCACCATGCGCACTTCGGGTTTCACACACGATGATCCCTGTGAGATCTACATGGGTG  162091

Query  386     CCAAACGCGTGCTCCAGTCGGAC---AACTGCCACGAGACCATCAGTGGCAAGACTTACA  442
                ||| |   ||   | |||| ||   |||||||||||  ||||||   || || | | ||
Sbjct  162090  ACAAGC---TGTCGCTGTCGTACCCGAACTGCCACGAATCCATCACGAGCCAGCCGTTCA  162034

Query  443     ACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTAC  502
               | || ||||||||| |||||   |  | ||||    |    ||||||||||||||||| |
Sbjct  162033  AGCTGGACTACAGCGCGTGCGGAGACAGCTGCGTGTTGTACTGGTACTGGCTGGGCGTGC  161974

Query  503     GCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCG  552
               ||| | |||||   | |  ||||| |||| | |||||||  |||||||||
Sbjct  161973  GCTTCATCAAG---GGCATCTCGTAGCAGGTGTACAAGGAGTGCATCCCG  161927

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 121/179 (68%), Gaps = 4/179 (2%)
 Strand=Plus/Minus

Query  210     CAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATGG  269
               |||||| | |||||| || || ||||||||||||  || ||| ||| | |||||    ||
Sbjct  210389  CAACGGCTTCAAGACTCTCCGCGACTTCATGGACAACGGCAACTACTCAGTCACGTCGGG  210330

Query  270     AGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGACG-  328
                || || ||    ||||| |  ||  || | || |  |  || || |  ||||| |||| 
Sbjct  210329  GGCTGATTAAGCGTGCGGCTGGACCGACCTAAAAGGAG-TCCGCAACAGATTCCAGACGA  210271

Query  329     GAACA--ATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACA  385
                ||||  |||||| |    || |||||||  || || || || ||| | ||||| ||||
Sbjct  210270  TAACATCATGCGCACATACGGCTACACCCGTGACGGCCCATGCGAGATCTGGCTGGACA  210212

 Score = 47.3 bits (51),  Expect = 0.008
 Identities = 41/50 (82%), Gaps = 1/50 (2%)
 Strand=Plus/Plus

Query  281    ACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGACGGA  330
              |||||||||||||| ||   |||| | | || ||||||||||| ||||||
Sbjct  95277  ACTGCGGTTTCACGGACCCGAACGGCACGCCGCAGCCCATTCC-GACGGA  95325

 Score = 47.3 bits (51),  Expect = 0.008
 Identities = 41/50 (82%), Gaps = 1/50 (2%)
 Strand=Plus/Plus

Query  281    ACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGACGGA  330
              |||||||||||||| ||   |||| | | || ||||||||||| ||||||
Sbjct  97689  ACTGCGGTTTCACGGACCCGAACGGCACGCCGCAGCCCATTCC-GACGGA  97737

>PHIF:NW_003303626.1 Phytophthora infestans T30-4 supercont1.133 
genomic scaffold, whole genome shotgun sequence
Length=313873

 Score = 187 bits (207),  Expect = 4e-45
 Identities = 343/505 (68%), Gaps = 32/505 (6%)
 Strand=Plus/Plus

Query  77      ATGCCCACCAAGTTGTGCTCCTGCC--AGCCCCGACCTACACGACTGATAACAAGGACAC  134
               |||| || ||  ||||||| || ||  |||||| |  |  |||||  |  ||||||||||
Sbjct  267037  ATGCACATCAGATTGTGCTGCTCCCGGAGCCCCAA--TGGACGACACAAGACAAGGACAC  267094

Query  135     TAAGTATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAA  194
                |||||    ||  |||| ||| | ||||||||||| |   || |     ||||||||||
Sbjct  267095  CAAGTACAATCCGCTGGCTTTCTTAGAGAACCAGGGCTTTAAGCCTCAGCAGGATTTCAA  267154

Query  195     CGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTA  254
                |  |||||     | ||||| |||||  | || ||||||||||||||| | ||||||||
Sbjct  267155  GGCCTGGCGTGATGAAAACGGCTACAAATCGCTTCGTGACTTCATGGACAGAGCCAAGTA  267214

Query  255     CACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAA-----CGCCGCA  309
               |  ||| ||    || || |||| ||  |||||||| ||| ||   ||     |||||||
Sbjct  267215  CGACGTGACCAGCGGCGCCGACTTCTCGTGCGGTTTTACGGACCCGAAGGGGACGCCGCA  267274

Query  310     --------------------CCTCAGCCCATTCCGGACGGAA---CAATGCGCTCCACGG  346
                                   || ||||| |||||||  ||     | ||||| || || |
Sbjct  267275  GCCTATTCCGGCGGGGGACGCCGCAGCCTATTCCGGCGGGTGACGCCATGCGATCGACTG  267334

Query  347     GTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGG  406
               ||||||| ||||| || ||||| ||||| |||||||||  |||    |||||  |    |
Sbjct  267335  GTTACACGCACGACGGACCGTGCGAGGTGTGGCTCGACGACAAGATGGTGCTGGATGGCG  267394

Query  407     ACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTG  466
               ||||||| |||||||   ||   ||||||   ||||   | ||||||   || ||||  |
Sbjct  267395  ACAACTGTCACGAGAAGTTCCCAGGCAAGGACTACACTGTGGACTACTCGTCATGCAAGG  267454

Query  467     GTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGT  526
               | || ||||| || || ||||||||||||||| | |||| ||| |||||    |||||||
Sbjct  267455  GCACGTGCACGCTGCGCTGGTACTGGCTGGGCATCCGCTTCCTGAAGAACAAGTACTCGT  267514

Query  527     GGCAGATCTACAAGGCTTGCATCCC  551
               ||||| | || ||||| ||||||||
Sbjct  267515  GGCAGGTGTATAAGGCCTGCATCCC  267539

>PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:pug:scf1117875582037:1:1414051:1 
REF
Length=1414051

 Score = 173 bits (191),  Expect = 8e-41
 Identities = 279/398 (70%), Gaps = 15/398 (4%)
 Strand=Plus/Plus

Query  151      GCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCAA-  209
                || ||||| |||||||| |||| ||||||    |  || ||||||| ||    |  ||| 
Sbjct  1295964  GCGTTCCTTGAGAACCAAGGATTCGAGACGACGGCCGACTTCAACGCGTA---CTACAAG  1296020

Query  210      --CAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAG---TACACCGTCACT  264
                  ||| || |||||||||||||||| ||||||||||  |   |||   ||||| ||| | 
Sbjct  1296021  GCCAAGGGCTACAAGACCCTGCGTGCCTTCATGGACGACAAGAAGGCGTACACAGTCGCC  1296080

Query  265      GATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCG  324
                  |||||| ||||   | ||||| |  |||||  || | |   | | |||  |||| || 
Sbjct  1296081  TCTGGAGCTGACTTTGAATGCGGATGGACGAAACTCGATGGTACGCGTCAATCCATCCCA  1296140

Query  325      GACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGAC  384
                |  || || || || || || |||||||||||||| ||||| || ||||| |||||||||
Sbjct  1296141  GCTGGCACGATCCGTTCGACTGGTTACACCCACGACGGTCCATGCGAGGTGTGGCTCGAC  1296200

Query  385      ACCAAACGCGTGCTCCAGTCGGACAACTGCCA---CGAGACCATCAGTGGCAAGACTTAC  441
                | ||  |||||| |  ||    ||||||||||   ||||    ||| ||| | |||  ||
Sbjct  1296201  AGCACGCGCGTGATGAAGGGCAACAACTGCCACACCGAG---TTCACTGGAACGACGCAC  1296257

Query  442      AACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTA  501
                |   | ||||||   |||||||  ||  | ||||| || || ||||||||| ||||  | 
Sbjct  1296258  ACAATCGACTACTCGTCGTGCAAGGGCTCGTGCACGCTGCGCTGGTACTGGATGGGTATT  1296317

Query  502      CGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAA  539
                |||| |||||||   |  |||||||||||| | |||||
Sbjct  1296318  CGCTTCCTCAAGGGCGAGTACTCGTGGCAGGTGTACAA  1296355

 Score = 173 bits (191),  Expect = 8e-41
 Identities = 180/234 (77%), Gaps = 8/234 (3%)
 Strand=Plus/Plus

Query  328      GGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACC  387
                ||||| || ||||| ||||| |||||||||||||| |||||||| || ||||||||    
Sbjct  1299745  GGAACCATTCGCTCGACGGGGTACACCCACGATGGGCCGTGTGAAGTGTGGCTCGATG--  1299802

Query  388      AAACG-CGTGCTCCAGTCGG---ACAACTGCCACGAGACCATCAGTGGCAAGACTTACAA  443
                  ||| |  | ||  |||||   ||||||||||||| |   ||   |||||||| | |  
Sbjct  1299803  --ACGTCAAGGTCATGTCGGGCGACAACTGCCACGACAAGTTCCCAGGCAAGACCTTCCC  1299860

Query  444      CCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACG  503
                 || ||||||||||||||||  ||| | ||||| || || ||||||||||| ||||| ||
Sbjct  1299861  GCTCGACTACAGCTCGTGCAAGGGTTCATGCACGCTGCGGTGGTACTGGCTCGGCGTGCG  1299920

Query  504      CTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCTTTC  557
                |||||| |||||    |||||||||||||| |||||||  ||| || |||||||
Sbjct  1299921  CTACCTGAAGAAGCGATACTCGTGGCAGATTTACAAGGAGTGCGTCTCGCTTTC  1299974

 Score = 159 bits (175),  Expect = 2e-36
 Identities = 284/413 (69%), Gaps = 9/413 (2%)
 Strand=Plus/Plus

Query  145      CCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGC  204
                ||| | || ||||| ||||||||||| ||| ||||    |  || ||||||| ||    |
Sbjct  1294421  CCACTTGCGTTCCTTGAGAACCAGGGCTACAAGACGACGGTCGACTTCAACGCGTA---C  1294477

Query  205      CGCAA---CAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAG---TACACC  258
                  |||   ||| || |||||||||||||||| |||||||||   | | |||   ||||  
Sbjct  1294478  TACAAGGCCAAGGGCTACAAGACCCTGCGTGCCTTCATGGATGACCCGAAGGCGTACAAG  1294537

Query  259      GTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCC  318
                ||  | | ||| || || | | | || || |  |||||  || | |     |  ||||| 
Sbjct  1294538  GTTGCCGCTGGTGCCGATTTCCAGTGTGGATGGACGAAACTCGATGGAAAGCGCCAGCCG  1294597

Query  319      ATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGG  378
                ||||| |  || || || || || || |||||||||||||| ||||| || ||||| |||
Sbjct  1294598  ATTCCAGCTGGCACGATCCGTTCGACTGGTTACACCCACGACGGTCCATGCGAGGTGTGG  1294657

Query  379      CTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACT  438
                ||||| | ||  |||||| |  ||    |||||||||||  |    ||   |||| ||| 
Sbjct  1294658  CTCGATAGCACGCGCGTGATGAAGGGCAACAACTGCCACTCGGAGTTCCCAGGCACGACC  1294717

Query  439      TACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGC  498
                | |||  | ||||||   |||||||  ||  | ||||| || || ||||||||| |||| 
Sbjct  1294718  TTCAAAATCGACTACTCGTCGTGCAAGGGCTCGTGCACGCTGCGCTGGTACTGGATGGGT  1294777

Query  499      GTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCC  551
                 | |||| |||||||      |||||||||||| | ||||||   ||| ||||
Sbjct  1294778  ATTCGCTTCCTCAAGGGCAAGTACTCGTGGCAGGTGTACAAGAACTGCGTCCC  1294830

 Score = 139 bits (153),  Expect = 2e-30
 Identities = 336/493 (68%), Gaps = 32/493 (6%)
 Strand=Plus/Plus

Query  79       GCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACTGATAACAAGGACACTAAG  138
                ||||||||  | ||| |||||||   |||||||| |||       | |||||||   || 
Sbjct  1298026  GCCCACCAGCTCGTGATCCTGCCCAACCCGACCTTCACCGTCCCCACCAAGGACG--AAC  1298083

Query  139      TATG--CACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACG  196
                 |||  | ||  | || ||||| ||||||||||| ||| |||||  ||  || |||||||
Sbjct  1298084  GATGGTCGCCGCTCGCGTTCCTCGAGAACCAGGGCTACAAGACCACCGCCGACTTCAACG  1298143

Query  197      GGTGGCGCCGCAA---CAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAA--  251
                  |    |  |||   ||| || |||||| | ||||| |  |||||||||  |   ||  
Sbjct  1298144  CCT---ACTACAAGTCCAAGGGCTACAAGTCGCTGCGCGCGTTCATGGACGACAAGAAGG  1298200

Query  252      -GTACACCGTC-ACT-GATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGC  308
                 |||||  ||| ||| ||    || |||| | | ||||| | ||| |||   |||| |||
Sbjct  1298201  CGTACAAGGTCAACTCGA--ACGCCGACTTCGAGTGCGGCTACACCAACAAGAACGGCGC  1298258

Query  309      ACCTCAGCCCATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTG  368
                 |  || || || |||| |  |||  | ||| ||||||| ||||| ||||| ||||||||
Sbjct  1298259  GCGCCAACCGATCCCGGCC--AAC-TTCCGCACCACGGGGTACACGCACGACGGTCCGTG  1298315

Query  369      TGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGG---ACAACTGCCACGAGACCAT  425
                 ||||| |||||||||| ||    |  | ||  |||||    |||||| ||| ||  | |
Sbjct  1298316  CGAGGTGTGGCTCGACAACA---CCAAGGTCTTGTCGGGTTCCAACTGTCACAAGGACTT  1298372

Query  426      CAGTGGCAAGACTTACAACCTTGA-CTACAGCTCGTGCACTGGTACCTGCACACTTCGTT  484
                |   ||||||||  ||  || ||| ||||    ||||||  ||  | |||||  | || |
Sbjct  1298373  CCCCGGCAAGACCCAC-GCCATGAGCTACGCGGCGTGCAAGGGCTCGTGCACGTTGCGCT  1298431

Query  485      GGTACTGGCTGGGCGTACGCTACCTCAA--GAATGCCTACTCGTGGCAGATCTACAAGGC  542
                |||||||| ||||| | |||| ||||||  | | ||  ||||||||||  | ||||||| 
Sbjct  1298432  GGTACTGGATGGGCATCCGCTTCCTCAAGGGCAAGC--ACTCGTGGCAAGTGTACAAGGA  1298489

Query  543      TTGCATCCCGCTT  555
                 ||| | ||||||
Sbjct  1298490  GTGCGTGCCGCTT  1298502

 Score = 133 bits (147),  Expect = 7e-29
 Identities = 280/416 (67%), Gaps = 15/416 (4%)
 Strand=Plus/Plus

Query  145      CCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGC  204
                ||| | || ||||| ||||||||||| | | ||||   ||  || ||||||| ||    |
Sbjct  1288697  CCACTTGCGTTCCTTGAGAACCAGGGCTTCAAGACGACCGCCGACTTCAACGCGTA---C  1288753

Query  205      CGCAA---CAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAG------TAC  255
                  |||   ||| || |||||| | ||||||| ||||||||||   | ||||      |||
Sbjct  1288754  TACAAGGCCAAGGGCTACAAGTCGCTGCGTGCCTTCATGGAC---GACAAGAAAGCATAC  1288810

Query  256      ACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAG  315
                |  ||  ||| ||| || || | | | || || |  |||||  || | |     |  |||
Sbjct  1288811  AAGGTTGCTGCTGGTGCCGATTTCCAGTGTGGATGGACGAAACTCGATGGAAAGCGCCAG  1288870

Query  316      CCCATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTT  375
                || ||||| |  || || || || || || |||||||||||||| ||||| || ||||| 
Sbjct  1288871  CCGATTCCAGCTGGCACGATCCGTTCGACTGGTTACACCCACGACGGTCCATGCGAGGTG  1288930

Query  376      TGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAG  435
                |||||||||| ||  |  ||| |  ||    |||||||||||  |    ||   |||| |
Sbjct  1288931  TGGCTCGACAACACCCTTGTGATGAAGGGCAACAACTGCCACTCGGAGTTCCCAGGCACG  1288990

Query  436      ACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTG  495
                ||  ||||  |    |||   |||||||  ||  | ||||| || || ||||||||| ||
Sbjct  1288991  ACGCACAAGATCAGTTACGCTTCGTGCAAGGGCTCGTGCACGCTGCGCTGGTACTGGATG  1289050

Query  496      GGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCC  551
                ||  | |||| |||||||      |||||||||||| | ||||||   ||| ||||
Sbjct  1289051  GGTATTCGCTTCCTCAAGGGCAAGTACTCGTGGCAGGTGTACAAGAACTGCGTCCC  1289106

 Score = 91.5 bits (100),  Expect = 2e-16
 Identities = 165/233 (71%), Gaps = 9/233 (4%)
 Strand=Plus/Plus

Query  325      GACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGAC  384
                ||| | || |||||| | || || ||||||||||  || |||||||| || ||| |||||
Sbjct  1301250  GACAGCACCATGCGCACGACCGGATACACCCACGTGGGCCCGTGTGAAGTCTGGATCGAC  1301309

Query  385      -ACCAAACGCGTGCTC-CAGTCGGACAACTGCCACGAGACCATCAGTG-GCAAGACTTAC  441
                 ||   | | ||  || ||| || |||||||||||||   ||  |||| |||| ||   |
Sbjct  1301310  GACGTCAAG-GTCATCGCAGGCG-ACAACTGCCACGAA--CA--AGTGAGCAACACCACC  1301363

Query  442      AACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTA  501
                ||  | |||||||||   ||||  || |  |||||  | |  ||||||||||| ||  | 
Sbjct  1301364  AAGGTGGACTACAGCAACTGCAAGGGCAAGTGCACGATGCACTGGTACTGGCTCGGATTG  1301423

Query  502      CGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
                |||| |||||||||    |  ||||||||  | ||||||   |||||| ||||
Sbjct  1301424  CGCTTCCTCAAGAAGAAGTGGTCGTGGCAAGTGTACAAGAACTGCATCGCGCT  1301476

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 138/206 (67%), Gaps = 6/206 (3%)
 Strand=Plus/Minus

Query  339      CTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCT  398
                ||||||||| |||  |    |||| ||||| ||||| |||||||||  |   | |  | |
Sbjct  1302831  CTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGAC---CTCAAGGT  1302775

Query  399      CCAGTCGGACA---ACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAG  455
                |  ||||||||   ||||||||   |    |   || | ||  |  |  || ||||||||
Sbjct  1302774  CATGTCGGACATGAACTGCCACACAAAGTACCCCGGTACGAACTTTATGCTCGACTACAG  1302715

Query  456      CTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAA  515
                ||||||||  ||  | ||||  || || ||||||||||| ||| | |    | | ||  |
Sbjct  1302714  CTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGTGAACGA  1302655

Query  516      TGCCTACTCGTGGCAGATCTACAAGG  541
                  | |||||||||||| | |||||||
Sbjct  1302654  GACGTACTCGTGGCAGGTGTACAAGG  1302629

>PHCA:scaffold_67 PHYCAscaffold_67
Length=292061

 Score = 166 bits (183),  Expect = 1e-38
 Identities = 249/352 (71%), Gaps = 9/352 (3%)
 Strand=Plus/Minus

Query  209     ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
               |||| || ||||||| ||| || ||||||||||||   ||||||||| | || || || |
Sbjct  219700  ACAATGGCTACAAGAACCTCCGCGACTTCATGGACAATGCCAAGTACGCAGTGACGGACG  219641

Query  269     GAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC---GG  325
               |||||||  |   ||| || |   |  ||   |||| |   ||||| |  |||||   ||
Sbjct  219640  GAGCGGATCAAGCCTGTGGCTGGTCCGACCCGAACGGCATCCCTCAACAGATTCCAGAGG  219581

Query  326     ACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACA  385
               | ||||| |||||  |  |||| ||||| ||||| || ||||||||| | ||| | |   
Sbjct  219580  ATGGAACGATGCGTACGTCGGGGTACACACACGACGGCCCGTGTGAGATCTGGATGGGGG  219521

Query  386     CCAAACGCGTGCTCCAGTCGGAC---AACTGCCACGAGACCATCAGTGGCAAGACTTACA  442
                ||| | ||  ||   |||| ||   |||||||||||  ||||||  | | |||| | ||
Sbjct  219520  ACAAGCTCGCTCT---GTCGTACCTCAACTGCCACGAATCCATCACGGACCAGACGTTCA  219464

Query  443     ACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTAC  502
               | || ||||||||    ||   || || |||||  ||    |||||||||||||| || |
Sbjct  219463  AGCTCGACTACAGTGGCTGTGGTGATAGCTGCATTCTGTACTGGTACTGGCTGGGAGTTC  219404

Query  503     GCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
               |||||||||||||    |||||||||||  | |||||||  |||||||||||
Sbjct  219403  GCTACCTCAAGAAGAAGTACTCGTGGCAAGTGTACAAGGAGTGCATCCCGCT  219352

 Score = 125 bits (138),  Expect = 1e-26
 Identities = 245/357 (69%), Gaps = 19/357 (5%)
 Strand=Plus/Minus

Query  209     ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
               |||| || |||||||  |||||||||||||||||    ||||||||||  ||  | || |
Sbjct  220708  ACAATGGCTACAAGAGTCTGCGTGACTTCATGGAGAAGGCCAAGTACAAGGTTTCGGACG  220649

Query  269     GAGCGGACTACTACTGCGGTTTCA------CGAACGTCAACGCCGCACCTCAGCCCATTC  322
               |||| ||  |    ||||| |  |      |||| | || | ||||| |  | ||| |  
Sbjct  220648  GAGCTGATCAGGCTTGCGGGTGGAGCGACCCGAAGGGCATC-CCGCAGCAGATCCCGT--  220592

Query  323     CGGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCG  382
               ||||||| || |||||| |  |||| ||||| |||||||| ||||| ||| | ||| | |
Sbjct  220591  CGGACGGCACCATGCGCACGTCGGGATACACGCACGATGGCCCGTGCGAGATCTGGATGG  220532

Query  383     ACACCAAACGCGTGCTCCAGTCGGAC---AACTGCCACGAGACCATCAGTGGCAAGACTT  439
                   ||| | ||  ||   |||| ||   |||||||||||  | |||   |   |||| |
Sbjct  220531  GGGACAAGCTCGCTCT---GTCGTACCTCAACTGCCACGAATCGATCCCCGAGCAGACGT  220475

Query  440     ACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGT--TGGTACTGGCTGGG  497
                ||| || ||||||||    ||   || || |||||   || ||  ||||||||||||||
Sbjct  220474  TCAAGCTCGACTACAGTGGCTGTGGTGATAGCTGCAT--TTTGTACTGGTACTGGCTGGG  220417

Query  498     CGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
                || ||  | ||||||      |||||||||||| | |||||||  |||||||||||
Sbjct  220416  AGTGCGTAAACTCAAGGGCAAGTACTCGTGGCAGGTGTACAAGGAGTGCATCCCGCT  220360

 Score = 37.4 bits (40),  Expect = 4.3
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  355     CACGATGGTCCGTGTGAGGTTTGGCTCGAC  384
               ||||  |||||||||||  |||||||||||
Sbjct  112675  CACGTCGGTCCGTGTGAAATTTGGCTCGAC  112704

>PHPA:scaffold_20 NW_008649006.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.20, whole genome shotgun 
sequence
Length=1049362

 Score = 161 bits (178),  Expect = 2e-37
 Identities = 331/487 (68%), Gaps = 19/487 (4%)
 Strand=Plus/Plus

Query  79      GCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACTGATAACAAGGACACTAAG  138
               || |||||||||||||| |  ||||| |||   |  |  || || |||| ||| ||  | 
Sbjct  363587  GCTCACCAAGTTGTGCTGCATCCAGCACCGCAGTGGATAACGGACAACAGGGATACCCAA  363646

Query  139     TATGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGG  198
                |    ||  | || ||||| || | |||||||| | ||||    || || || ||   |
Sbjct  363647  CACAACCCTCTTGCGTTCCTTGAAAGCCAGGGATTCAAGACGCAAGAAGACTTTAAGTCG  363706

Query  199     TGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACC  258
               ||||||  | | ||||| ||||| || || |||||||| ||||| |  ||||||||||| 
Sbjct  363707  TGGCGCATCCAGAACGGCTACAAAACACTCCGTGACTTTATGGAACATGCCAAGTACACT  363766

Query  259     GTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCC  318
               || || || |||||||||| ||  || ||||  || |||  ||| |   | || ||||| 
Sbjct  363767  GTTACCGAAGGAGCGGACTTCTCGTGTGGTTGGACCAACCCCAAAGGTACGCCACAGCCA  363826

Query  319     ATTCCGGACGGA---ACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTT  375
               |||||||  |||   |  |||||||| || || || ||||| || || || || ||  | 
Sbjct  363827  ATTCCGGCTGGAGGCATCATGCGCTCTACCGGATATACCCATGAGGGGCCATGCGAAATG  363886

Query  376     TGGCTCGACACCAAACGC--GTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGC-  432
               ||| |||     | ||||  |||  |||  | |||||||||||||     |||| || | 
Sbjct  363887  TGGGTCG--CTGATACGCAGGTGTACCAAGCCGACAACTGCCACG----TATCACTGCCA  363940

Query  433     ----AAGACT-TACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGT  487
                   |||| | | |||  | |||||     ||||||  || | |||    ||    ||||
Sbjct  363941  GGCAAAGAATATCCAA--TCGACTATTCGCCGTGCAAGGGAAACTGTGTTCTCTACTGGT  363998

Query  488     ACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCA  547
               ||||||| || || |||| |||||||||| | || ||||||||| | ||||| |  ||||
Sbjct  363999  ACTGGCTCGGTGTGCGCTTCCTCAAGAATTCGTATTCGTGGCAGGTGTACAAAGAATGCA  364058

Query  548     TCCCGCT  554
               |||| ||
Sbjct  364059  TCCCACT  364065

>PYIR:scaffold_2249 pir_scaffold_2249 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_2249:1:3349:1 
REF
Length=3349

 Score = 153 bits (169),  Expect = 8e-35
 Identities = 280/406 (69%), Gaps = 22/406 (5%)
 Strand=Plus/Minus

Query  149   TGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCA  208
             |||| ||| ||||||||||||| | | |||||   | ||| ||| |||  |    |  ||
Sbjct  1846  TGGCGTTCTTGGAGAACCAGGGCTTCAAGACCACGGCGGACTTCGACGCCTA---CTACA  1790

Query  209   A---CAACGGGTACAAGACCCTGCGTGACTTCATGGACC------GCGCCAAGTACACCG  259
             |   ||| || ||||||||||| ||||  |||||||||       ||||   |||||  |
Sbjct  1789  AGGCCAAGGGCTACAAGACCCTCCGTGCGTTCATGGACGACAAGAGCGC---GTACAAGG  1733

Query  260   TCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCA  319
             || | ||||| |||||||   | ||||| |  || ||  ||  || | | || ||||| |
Sbjct  1732  TCGCCGATGGCGCGGACTTTGAATGCGGCTGGACCAAGCTCGCCGGCACGCCGCAGCCGA  1673

Query  320   TTCCG---GACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTT  376
             | |||   | | | ||  |||||||||| || ||||||||||| |||||||| ||||| |
Sbjct  1672  TCCCGTCAGCCAGCACGGTGCGCTCCACAGGCTACACCCACGACGGTCCGTGCGAGGTCT  1613

Query  377   GGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGA  436
             |||||||||  |  || |||||| ||     ||||||||||  |    ||   |||| ||
Sbjct  1612  GGCTCGACAAGACCCGTGTGCTCAAGGGCACCAACTGCCACTCGGAGTTCCCGGGCACGA  1553

Query  437   CTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGG  496
             | | |||  | |||||    || ||||  ||| | |||   || || ||||||||| |||
Sbjct  1552  CCTTCAAGATCGACTATTCGTCTTGCAAGGGTTCGTGCGTGCTGCGCTGGTACTGGATGG  1493

Query  497   GCGTACGCTACCTCAAGAATGCC--TACTCGTGGCAGATCTACAAG  540
             || | |||| ||| |||   |||  ||||| |||||| | ||||||
Sbjct  1492  GCATCCGCTTCCTTAAG--GGCCAGTACTCATGGCAGGTGTACAAG  1449

>PYIR:scaffold_5024 pir_scaffold_5024 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_5024:1:718:1 
REF
Length=718

 Score = 151 bits (167),  Expect = 3e-34
 Identities = 326/481 (68%), Gaps = 30/481 (6%)
 Strand=Plus/Plus

Query  79   GCCCACCAAGTTGTGCTCCTGCCAGCCCCGACCTACACGACTGATAACAAGGACACTAA-  137
            || |||||   |||| |||| ||||| ||||| | |||      ||||  |||||  || 
Sbjct  154  GCTCACCAGAGTGTGATCCTACCAGCGCCGACGTTCAC------TAACCCGGACAAGAAC  207

Query  138  --GTA-TGCA--CCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTC  192
              ||| || |  ||| | || || || ||||||||||| ||| |||||  ||  || |||
Sbjct  208  GTGTACTGGAACCCACTCGCGTTTCTCGAGAACCAGGGCTACAAGACCACCGCAGACTTC  267

Query  193  AACGGGTGGCGCCGCAA---CAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCC  249
            ||||| |    |  |||   ||| || ||||||||||| ||||  |||||||||  |   
Sbjct  268  AACGGCT---ACATCAAGTCCAAGGGCTACAAGACCCTTCGTGCGTTCATGGACGACAAG  324

Query  250  AAG---TACA---CCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAAC  303
            |||   ||||    || | | |  || ||  |||   | ||||| | ||| ||| |||||
Sbjct  325  AAGGCATACAAGGTCGACGCGGCGGGCGCCAACTTTGAGTGCGGCTACACCAACATCAAC  384

Query  304  GCCGCACCTCAGCCCATTCCGGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGT  363
            | |   |  ||||| || || |  || ||||| |||||||| |||||||| ||||| |||
Sbjct  385  GGCAAGCGCCAGCCGATCCCAGCGGGCACAATCCGCTCCACAGGTTACACTCACGACGGT  444

Query  364  CCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGG---ACAACTGCCACGAG  420
            ||||| ||||| ||||| |||| ||    |  | ||  |||||    ||||||| || ||
Sbjct  445  CCGTGCGAGGTCTGGCTTGACAACA---CCAAGGTCATGTCGGGCACCAACTGCAACAAG  501

Query  421  ACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTT  480
              | ||   || |||||  ||    |   ||||   |||||||  ||  | ||||| || 
Sbjct  502  GACTTCCCGGGAAAGACCCACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTG  561

Query  481  CGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAG  540
            || ||||||||| ||||| | |||| |||||||||    |  ||||||||| | ||||||
Sbjct  562  CGCTGGTACTGGATGGGCCTTCGCTTCCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAG  621

Query  541  G  541
            |
Sbjct  622  G  622

>PHRA:scaffold_33
Length=496317

 Score = 128 bits (141),  Expect = 3e-27
 Identities = 238/349 (68%), Gaps = 3/349 (1%)
 Strand=Plus/Plus

Query  209     ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
               ||||||| |||| ||  ||||| |||||| |||||   ||||||||||  ||| | || |
Sbjct  370718  ACAACGGCTACACGAGTCTGCGAGACTTCCTGGACAAGGCCAAGTACAAGGTCTCGGACG  370777

Query  269     GAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC---GG  325
               |||| ||| |    ||||| |   || ||  ||| |     || ||||  || ||   ||
Sbjct  370778  GAGCTGACCAAGCTTGCGGGTGGTCGGACCCCAAGGGAATCCCGCAGCAGATCCCAGAGG  370837

Query  326     ACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACA  385
               |||| || |||||| |  |||| ||||| ||||| |||||||| ||| | |   | |   
Sbjct  370838  ACGGCACCATGCGCACGTCGGGATACACGCACGACGGTCCGTGCGAGATCTACATGGGGG  370897

Query  386     CCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACC  445
                |||    |  |||  ||    ||||||||||||| | ||||  | | | || | |||  
Sbjct  370898  ACAAGTTGGCACTCTCGTACCTCAACTGCCACGAGTCGATCACGGACCAAACGTTCAAGT  370957

Query  446     TTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCT  505
               | |||||||||   ||    | || |||||  ||    |||||||||||||| || || |
Sbjct  370958  TGGACTACAGCGGATGTGGGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGTGCGAT  371017

Query  506     ACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
               |||| |||     ||||||||||||| | |||||||  |||||||||||
Sbjct  371018  ACCTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGGAATGCATCCCGCT  371066

 Score = 103 bits (113),  Expect = 1e-19
 Identities = 234/349 (67%), Gaps = 5/349 (1%)
 Strand=Plus/Minus

Query  209     ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
               ||||||| |||| ||  ||||| || ||| |||||   ||||||||||  ||  | || |
Sbjct  171404  ACAACGGCTACACGAGTCTGCGAGATTTCCTGGACAAGGCCAAGTACAAGGTTTCGGACG  171345

Query  269     GAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC---GG  325
               |||| ||| |    ||| | |   || ||  |||||     || ||||  || ||   ||
Sbjct  171344  GAGCTGACCAAGCTTGCTGGTGGTCGGACC-CAACGGAATCCCGCAGCAGATCCCAGAGG  171286

Query  326     ACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACA  385
               |||| || ||| || |  |||| ||||| ||||| |||||||| ||| | |   | |  |
Sbjct  171285  ACGGCACCATGAGCCCGTCGGGATACACGCACGACGGTCCGTGCGAGATCTACATGGGGA  171226

Query  386     CCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACC  445
               | |   | |  |||  ||    |||||| |||||| | ||||  | | | || | |||  
Sbjct  171225  CAAGTTG-GCACTCTCGTACCTCAACTGTCACGAGTCGATCACGGACCAAACGTTCAAGT  171167

Query  446     TTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCT  505
               | |||||||||   |||   | || |||||  ||    |||||||||||||| |  || |
Sbjct  171166  TGGACTACAGCGGATGCGGGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGCGCGAT  171107

Query  506     ACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
               |||| |||     ||||||||||||| | |||||||  ||||||| |||
Sbjct  171106  ACCTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGGAATGCATCCTGCT  171058

 Score = 103 bits (113),  Expect = 1e-19
 Identities = 234/349 (67%), Gaps = 5/349 (1%)
 Strand=Plus/Minus

Query  209     ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
               ||||||| |||| ||  ||||| || ||| |||||   ||||||||||  ||  | || |
Sbjct  175763  ACAACGGCTACACGAGTCTGCGAGATTTCCTGGACAAGGCCAAGTACAAGGTTTCGGACG  175704

Query  269     GAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC---GG  325
               |||| ||| |    ||| | |   || ||  |||||     || ||||  || ||   ||
Sbjct  175703  GAGCTGACCAAGCTTGCTGGTGGTCGGACC-CAACGGAATCCCGCAGCAGATCCCAGAGG  175645

Query  326     ACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACA  385
               |||| || ||| || |  |||| ||||| ||||| |||||||| ||| | |   | |  |
Sbjct  175644  ACGGCACCATGAGCCCGTCGGGATACACGCACGACGGTCCGTGCGAGATCTACATGGGGA  175585

Query  386     CCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACC  445
               | |   | |  |||  ||    |||||| |||||| | ||||  | | | || | |||  
Sbjct  175584  CAAGTTG-GCACTCTCGTACCTCAACTGTCACGAGTCGATCACGGACCAAACGTTCAAGT  175526

Query  446     TTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCT  505
               | |||||||||   |||   | || |||||  ||    |||||||||||||| |  || |
Sbjct  175525  TGGACTACAGCGGATGCGGGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGCGCGAT  175466

Query  506     ACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
               |||| |||     ||||||||||||| | |||||||  ||||||| |||
Sbjct  175465  ACCTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGGAATGCATCCTGCT  175417

 Score = 38.3 bits (41),  Expect = 4.3
 Identities = 39/50 (78%), Gaps = 1/50 (2%)
 Strand=Plus/Minus

Query  281     ACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGACGGA  330
               |||||||||||||| ||    |||   | || ||||||||||| ||||||
Sbjct  430759  ACTGCGGTTTCACGGACCCGGACGGGACCCCGCAGCCCATTCC-GACGGA  430711

>PHPA:scaffold_39 NW_008649025.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.39, whole genome shotgun 
sequence
Length=634653

 Score = 127 bits (140),  Expect = 3e-27
 Identities = 239/351 (68%), Gaps = 3/351 (1%)
 Strand=Plus/Plus

Query  209     ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
               ||||||| |||||||  || ||||| |||||||| || ||||||||||  ||||| || |
Sbjct  149998  ACAACGGTTACAAGAGTCTCCGTGATTTCATGGATCGGGCCAAGTACAAGGTCACGGAGG  150057

Query  269     GAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGA--  326
               | || ||| |    |||||||  ||  ||   || | |   || |||   || |||||  
Sbjct  150058  GGGCCGACCAGGCTTGCGGTTGGACTGACCCGAAGGGCATTCCGCAGAAGATCCCGGAGG  150117

Query  327     -CGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACA  385
                |||||| |||||  | ||||| ||||| ||||| || ||||||||| | |   | | | 
Sbjct  150118  ACGGAACGATGCGTACGACGGGATACACGCACGACGGACCGTGTGAGATCTACATGGGCG  150177

Query  386     CCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACC  445
                 |||| ||  ||   ||    ||| ||||||||  | |||   |   |||| | ||| |
Sbjct  150178  AGAAACTCGCCCTATCGTACCTCAATTGCCACGAATCGATCCCCGAGCAGACGTTCAAGC  150237

Query  446     TTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCT  505
               | || |||||    |||   | ||  ||||  ||    ||||||||||||||||| ||| 
Sbjct  150238  TGGATTACAGTGGCTGCGGAGATAGTTGCATCCTCTACTGGTACTGGCTGGGCGTGCGCA  150297

Query  506     ACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCTTT  556
               | || |||      |||||||||||| | |||||||  ||||||||| |||
Sbjct  150298  AGCTGAAGGGCAAGTACTCGTGGCAGGTGTACAAGGAATGCATCCCGATTT  150348

 Score = 104 bits (114),  Expect = 4e-20
 Identities = 235/351 (67%), Gaps = 7/351 (2%)
 Strand=Plus/Plus

Query  209     ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
               ||||||| ||||| |  || || || || |||||   ||| |||||| | |||||||| |
Sbjct  151180  ACAACGGCTACAAAAGTCTCCGCGATTTTATGGATAACGCAAAGTACTCGGTCACTGACG  151239

Query  269     GAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGA--  326
               |||| ||  |   ||| || |  ||  ||   || |  |  || ||||  ||||| ||  
Sbjct  151240  GAGCCGATCAAGCCTGTGGATGGACCGACCCGAAAGGTGTCCCACAGCAGATTCCAGAAG  151299

Query  327     -CGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACA  385
                ||| || |||||  |  | || ||||||||||| ||||| |||||| | |   | |   
Sbjct  151300  ACGGTACTATGCGTACTTCCGGCTACACCCACGACGGTCCCTGTGAGATCTACATGGGGG  151359

Query  386     CCAAAC--GCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAA  443
                || ||  || |  ||   || ||  ||||||||||| | ||||  |   | || | |||
Sbjct  151360  ACACACTGGCATTGTCTTATCTGA--ACTGCCACGAGTCGATCACGGATCAAACGTTCAA  151417

Query  444     CCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACG  503
                 | ||||| ||| | |||  || || ||||   ||    ||||||||| |||| || ||
Sbjct  151418  GTTGGACTATAGCGCCTGCGGTGATAGCTGCGTGCTATACTGGTACTGGTTGGGTGTTCG  151477

Query  504     CTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
                ||||| || ||    |||||||||||| | |||||||  || ||||||||
Sbjct  151478  TTACCTAAAAAAGAAGTACTCGTGGCAGGTGTACAAGGAGTGTATCCCGCT  151528

 Score = 42.8 bits (46),  Expect = 0.10
 Identities = 35/43 (81%), Gaps = 0/43 (0%)
 Strand=Plus/Plus

Query  281    ACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC  323
              ||||||||||||||||    |||| | |||| ||||| |||||
Sbjct  68865  ACTGCGGTTTCACGAATCCGAACGGCACACCGCAGCCAATTCC  68907

>PYIR:scaffold_4828 pir_scaffold_4828 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_4828:1:781:1 
REF
Length=781

 Score = 121 bits (133),  Expect = 5e-25
 Identities = 258/365 (71%), Gaps = 28/365 (8%)
 Strand=Plus/Plus

Query  210  CAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAG-TACACCGTCAC-TGAT  267
            ||| || | ||||||| |||| || |||||||||  || |||| || ||||||   ||| 
Sbjct  251  CAAGGGATTCAAGACCATGCGCGAGTTCATGGACAACGACAAGCTATACCGTCCTGTGAG  310

Query  268  GGA-GCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCG--  324
             || || |||| | | ||||| | ||||||  || | | ||  || ||||||||||||  
Sbjct  311  CGACGCCGACTTCAAGTGCGGATACACGAAGCTCGATGGCGAGCCGCAGCCCATTCCGAA  370

Query  325  GACGGAACA-ATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGA  383
            ||  || || || ||| |||| || ||||| ||||| || ||||| ||| | ||||| ||
Sbjct  371  GAACGACCAGATCCGCACCACTGGATACACGCACGAAGGGCCGTGCGAGATCTGGCTGGA  430

Query  384  C-ACCAAACGCGTGCTCCAGTCGG--ACAACTGCCACGA-GAC----CATCAGTGGCAAG  435
            | ||   | | ||| || |  |||  | ||||||||| | |||    |||| |  ||| |
Sbjct  431  CGACGTCAAG-GTGTTCTA--CGGCAAGAACTGCCACTACGACGTGGCATCCG--GCATG  485

Query  436  A-CTTACA--ACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGG  492
            | ||| ||  | || |||| |||||| |||   || |  |||||  |    |||||||||
Sbjct  486  AACTTCCAGAAGCTCGACTTCAGCTCATGCGTGGGCAAGTGCACCATGTACTGGTACTGG  545

Query  493  CTGGGCGTACGC--TACCT-CAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATC  549
             ||||| | |||  ||    |||||  || | ||||||||| ||||||||||  ||||||
Sbjct  546  ATGGGCATCCGCGGTAGTGGCAAGA--GCGT-CTCGTGGCAAATCTACAAGGAGTGCATC  602

Query  550  CCGCT  554
            |||||
Sbjct  603  CCGCT  607

>PYAP:scaffold_560 pag1_scaffold_560 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_560:1:21458:1 
REF
Length=21458

 Score = 119 bits (131),  Expect = 2e-24
 Identities = 285/428 (67%), Gaps = 30/428 (7%)
 Strand=Plus/Minus

Query  145   CCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGC  204
             || ||||| ||||| |||||||||||   | || | | ||| ||  |||  || |  | |
Sbjct  8499  CCGTTGGCGTTCCTCGAGAACCAGGGTGTCAAGGCTGGCGACGACCTCACGGGCTTCCTC  8440

Query  205   CGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGC---GCCAAGTAC---ACC  258
             || | ||| ||   |||||| || ||||||| |||||||  |   ||||| |||   | |
Sbjct  8439  CGTAGCAAGGGCATCAAGACGCTCCGTGACTACATGGACAACAAGGCCAACTACAAGATC  8380

Query  259   GTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCC  318
             |   |   ||| |||  || | | || || | ||| |||   ||||  || |  ||||| 
Sbjct  8379  GAGGCGCGTGGTGCGAGCTTCGAGTGTGGCTACACCAACCCAAACGGTGCGCGCCAGCCT  8320

Query  319   ATTCC---GGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTT  375
             |||||   | |||| |  ||||| || || || ||||| ||||| || || |||||||| 
Sbjct  8319  ATTCCGAAGAACGGCATGATGCGTTCGACCGGCTACACGCACGACGGCCCATGTGAGGTC  8260

Query  376   TGGCTCGACACCAAACGCGTGCTC--CAG----TCGGACAACTGCCACGAGACCATCAGT  429
             |||||||||| ||  |||||||||  |||     | | ||||||||||  |    || | 
Sbjct  8259  TGGCTCGACAACACGCGCGTGCTCGGCAGCTACACTGGCAACTGCCACAGGGATGTCGGA  8200

Query  430   GGCAAGACT------TACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGT  483
               |||| ||      |||||  | |||| |  |  |||||  || | |||||  || |||
Sbjct  8199  AACAAGGCTGTGAGCTACAAGATCGACTTCTCCAAGTGCAAGGGCAACTGCATGCTCCGT  8140

Query  484   TGGTACTGGCTGGGCGTACGCTACCT------CAAGAATGCCTACTCGTGGCAGATCTAC  537
             ||||||||||| |||   |||  | |      ||||||    |  |||||||||||||||
Sbjct  8139  TGGTACTGGCTCGGCAAGCGCCTCATCGGTGGCAAGAA---GTGGTCGTGGCAGATCTAC  8083

Query  538   AAGGCTTG  545
             ||||| ||
Sbjct  8082  AAGGCGTG  8075

 Score = 99.6 bits (109),  Expect = 2e-18
 Identities = 246/369 (67%), Gaps = 21/369 (6%)
 Strand=Plus/Minus

Query  149    TGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCA  208
              |||| |||||||||||||||||   | || ||   || ||| |||  || |  |  ||| 
Sbjct  11239  TGGCGTTCCTGGAGAACCAGGGCGTCAAGGCCACTGATGATCTCACGGGCTACCTGCGCC  11180

Query  209    ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGC---GCCAAGTACACCGTCACTG  265
              | || ||    ||||| || ||||| ||||||||   |   ||||| || |  |||   |
Sbjct  11179  AGAAGGGCGTGAAGACGCTCCGTGATTTCATGGATAACAAGGCCAACTATAAGGTCGAGG  11120

Query  266    ATGGAGCGGAC---TACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTC  322
               || ||  | |   | | | ||||||| |||  |    ||||  || | ||| || ||||
Sbjct  11119  CTGCAGGTGCCACGTTCGAGTGCGGTTACACCGATCCAAACGGTGCCCGTCAACCAATTC  11060

Query  323    C---GGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGC  379
              |   | |||| |  |||||||| || |||||||| ||||| || ||||||||||||||||
Sbjct  11059  CATCGAACGGCATGATGCGCTCGACTGGTTACACGCACGACGGCCCGTGTGAGGTTTGGC  11000

Query  380    TCGACACCAAACGCGTGCT-----CCAG-TCGGACAACTGCCACGAGACCATCAGT---G  430
              |||| | ||  || |||||     | |  || | | |||||||| ||   ||| |    |
Sbjct  10999  TCGATAACACGCGAGTGCTTGGATCTACATCCGGCGACTGCCACAAGGATATCGGCCAGG  10940

Query  431    GCAAGACT---TACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGT  487
              ||| || |   |||||  | || | |  |  |||||  || | |||||  || |||||||
Sbjct  10939  GCATGATTAGCTACAAGATCGATTTCTCCAAGTGCAAGGGCAACTGCATGCTCCGTTGGT  10880

Query  488    ACTGGCTGG  496
              |||||||||
Sbjct  10879  ACTGGCTGG  10871

 Score = 85.1 bits (93),  Expect = 3e-14
 Identities = 277/419 (66%), Gaps = 30/419 (7%)
 Strand=Plus/Plus

Query  157    CTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCAACAACGGG  216
              || ||||||||||| ||| |||||  | |||| ||||||| ||  | |     |||||| 
Sbjct  12656  CTCGAGAACCAGGGCTACAAGACCACCAAGGACTTCAACGCGTACCTCTCGGCCAACGGC  12715

Query  217    TACAAGACCCTGCGTGACTTCATGGACCGCGCCAAG----TACACCGTCACTGATGGAGC  272
              |||||||| || |||||||||||||| |  |||  |    ||||  |  |   | || ||
Sbjct  12716  TACAAGACGCTCCGTGACTTCATGGA-CAAGCCTGGTGCCTACAAGGCTAACAAGGGTGC  12774

Query  273    GGACT-ACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTC---CGGACG  328
               ||||  | | || |||| |||| |    |||||  |||| ||||| || |   || |||
Sbjct  12775  -GACTGTCGAGTGTGGTTACACGGATCCGAACGCGCCACCGCAGCCGATCCCAACGAACG  12833

Query  329    GAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCA  388
              |     | ||| |  |||| ||||| ||||| || ||||| ||| | ||| |||||    
Sbjct  12834  GCGAGTTCCGCACATCGGGATACACGCACGAAGGCCCGTGCGAGATCTGGATCGAC----  12889

Query  389    AACGCG-TGCTCCAG-TCGG--ACAACTGCCACGAGACCATCAGTGGCAAG------ACT  438
               | | | || || ||  |||  | ||||| ||| |   ||||   |  |||      |||
Sbjct  12890  GATGTGATGGTCAAGAGCGGCAAGAACTGTCACTACGACATCTCGGAGAAGGCGTTCACT  12949

Query  439    TACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGC  498
               ||||  ||||||||||  | ||||  || |  ||||  ||    ||||||||||| |||
Sbjct  12950  GACAAGATTGACTACAGTGCATGCAAGGGCAAGTGCATGCTCAAGTGGTACTGGCTCGGC  13009

Query  499    GTACG-CTA--CCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
               | || | |     ||||||    || || ||||||||||||||||| ||||| || ||
Sbjct  13010  ATCCGTCCAATGGGCAAGAA---GTATTCATGGCAGATCTACAAGGCCTGCATACCACT  13065

>PHKE:scaffold_354 scf_22126_354.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_354.1_contig_1:1:38044:1 
REF
Length=38044

 Score = 117 bits (129),  Expect = 6e-24
 Identities = 233/339 (69%), Gaps = 11/339 (3%)
 Strand=Plus/Plus

Query  225    CCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTACTACTG  284
              ||| |||||||||||||||   ||||||||||  ||  | || || || ||  |   |||
Sbjct  14475  CCTCCGTGACTTCATGGACAAGGCCAAGTACAAGGTTTCGGACGGTGCCGATCAGGCCTG  14534

Query  285    CGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC---GGACGGAACAATGCGCTC  341
              ||| |  ||  ||  ||| |     || ||||  || ||   |||||| || |||||| |
Sbjct  14535  CGGCTGGACCGACCCCAAGGGAATCCCGCAGCAGATCCCCGAGGACGGCACTATGCGCAC  14594

Query  342    CACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAAC--GCGTGCTC  399
              | | || ||||||||||| || || |||||| | |   | | |  |||    ||||  ||
Sbjct  14595  CTCCGGCTACACCCACGACGGACCATGTGAGATCTACATGGGCGACAAGTTGGCGTTGTC  14654

Query  400    CAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCG  459
                 ||   ||| ||||||||| | |||| || | | || | |||  | ||||||||| ||
Sbjct  14655  GTATCT--CAATTGCCACGAGTCGATCACTGACCAAACGTTCAAGTTGGACTACAGCGCG  14712

Query  460    TGCACTGGTACCTGCACACTTCGT--TGGTACTGGCTGGGCGTACGCTACCTCAAGAATG  517
              |||   |  | |||||  ||| ||  ||||| ||| |||| || ||| | || |||  | 
Sbjct  14713  TGCGGGGACAGCTGCAT-CTT-GTACTGGTATTGGTTGGGAGTGCGCAAGCTGAAGGGTT  14770

Query  518    CCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCTTT  556
              | |||||||||||||| |||||||  ||||| |||||||
Sbjct  14771  CGTACTCGTGGCAGATATACAAGGAGTGCATTCCGCTTT  14809

>PHRA:scaffold_105
Length=157074

 Score = 112 bits (123),  Expect = 2e-22
 Identities = 180/257 (70%), Gaps = 4/257 (2%)
 Strand=Plus/Minus

Query  23      CCCTCTCCGTGGCTGCTGTGCTTTCCAGCGCGGCGCTACTTGCTCCCACGTCCAATGCCC  82
               ||||| | || ||| | || || ||||||  |||||| || || || ||  || | || |
Sbjct  154927  CCCTCGCAGTCGCTTCGGTCCTGTCCAGCATGGCGCTGCTGGCGCCTACTGCCGACGCTC  154868

Query  83      ACCAAGTTGTGCTCCTGCCAG--CCCCGACCTACACGACTGATAACAAGGACACTAAGTA  140
               |||| |||||||| ||||| |  |||| |  |  || || ||  ||| |||||| |||||
Sbjct  154867  ACCAGGTTGTGCTGCTGCCGGAACCCCAA--TGGACTACCGACGACAGGGACACCAAGTA  154810

Query  141     TGCACCATTGGCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTG  200
                   ||  |||| ||||| || | | | || | |  |||    ||||| |||     |||
Sbjct  154809  CAACCCGCTGGCTTTCCTCGAAAGCGAAGGCTTCACGACGCAGGAGGACTTCGCGTCGTG  154750

Query  201     GCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGT  260
               ||||  | | ||||| |||||| | ||||||||||||||||||  |||||||||||  ||
Sbjct  154749  GCGCGACGAAAACGGCTACAAGTCGCTGCGTGACTTCATGGACAACGCCAAGTACAGTGT  154690

Query  261     CACTGATGGAGCGGACT  277
                ||  | || || ||||
Sbjct  154689  GACCAACGGCGCCGACT  154673

>PLHA:NW_020187034.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_113, whole genome shotgun sequence
Length=380982

 Score = 111 bits (122),  Expect = 2e-22
 Identities = 245/357 (69%), Gaps = 13/357 (4%)
 Strand=Plus/Plus

Query  219    CAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGACTA  278
              |||||| || ||||||||||||||   ||| |||||||||||     | || || || | 
Sbjct  94829  CAAGACTCTTCGTGACTTCATGGATAACGCAAAGTACACCGTAGTCAAAGGTGCTGA-TC  94887

Query  279    CTAC-TGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGG---ACGGAACAA  334
              |  | ||||| |||||  |   ||| |   | || ||||||||||| |   ||    | |
Sbjct  94888  CAGCATGCGGATTCACAGATCCCAATGGTACGCCCCAGCCCATTCCCGCTAACAATGCTA  94947

Query  335    TGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCG  394
              ||||||| || || ||||| ||||||||||||||||| || |||||| |||  | ||  |
Sbjct  94948  TGCGCTCTACTGGATACACACACGATGGTCCGTGTGAAGTGTGGCTCAACA--ATACTAG  95005

Query  395    TGCTCCAGTCG-GA-CAACTGCCACGAGACCATCAGTGGC-AAGACT-TACAACCTTGAC  450
               | |  |  || || |||||||||||| |   |   |||| |||||| ||| |  | || 
Sbjct  95006  AGTTTTAAGCGCGAGCAACTGCCACGAAAAGTTTCCTGGCAAAGACTATACTA--TCGAT  95063

Query  451    TACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTC  510
              |||   || ||||  | ||  ||     | |||||||| ||||| || || || |  |||
Sbjct  95064  TACTCGTCCTGCAAGGATAATTGTCTGTTGCGTTGGTATTGGCTTGGTGTTCGTTTTCTC  95123

Query  511    AAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCTTTCGGCTTCAGCT  567
              ||| |    || ||||||||  | |||||||| ||||| || || |||   ||||||
Sbjct  95124  AAGGAAAAGTATTCGTGGCAAGTGTACAAGGCCTGCATTCCACTGTCGCGATCAGCT  95180

>PHRA:scaffold_2892
Length=2014

 Score = 106 bits (117),  Expect = 1e-20
 Identities = 234/349 (67%), Gaps = 4/349 (1%)
 Strand=Plus/Minus

Query  209   ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
             ||||||| |||| ||  ||||| || ||| |||||   ||||||||||  ||  | || |
Sbjct  1863  ACAACGGCTACACGAGTCTGCGAGATTTCCTGGACAAGGCCAAGTACAAGGTTTCGGACG  1804

Query  269   GAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC---GG  325
             |||| ||| |    ||||| |   || ||  ||| |     || ||||  || ||   ||
Sbjct  1803  GAGCTGACCAAGCTTGCGGGTGGTCGGACCCCAAGGGAATCCCGCAGCAGATCCCAGAGG  1744

Query  326   ACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACA  385
             |||| || ||| || |  |||| ||||| ||||| |||||||| ||| | |   | |  |
Sbjct  1743  ACGGCACCATGAGCCCGTCGGGATACACGCACGACGGTCCGTGCGAGATCTACATGGGGA  1684

Query  386   CCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACC  445
             | |   | |  |||  ||    |||||| |||||| | ||||  | | | || | |||  
Sbjct  1683  CAAGTTG-GCACTCTCGTACCTCAACTGTCACGAGTCGATCACGGACCAAACGTTCAAGT  1625

Query  446   TTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCT  505
             | |||||||||   |||   | || |||||  ||    |||||||||||||| |  || |
Sbjct  1624  TGGACTACAGCGGATGCGGGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGCGCGAT  1565

Query  506   ACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
             |||| |||     ||||||||||||| | |||||||  ||||||| |||
Sbjct  1564  ACCTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGGAATGCATCCTGCT  1516

>PHRA:scaffold_494
Length=11395

 Score = 106 bits (117),  Expect = 1e-20
 Identities = 234/349 (67%), Gaps = 4/349 (1%)
 Strand=Plus/Minus

Query  209   ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
             ||||||| |||| ||  ||||| || ||| |||||   ||||||||||  ||  | || |
Sbjct  8499  ACAACGGCTACACGAGTCTGCGAGATTTCCTGGACAAGGCCAAGTACAAGGTTTCGGACG  8440

Query  269   GAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC---GG  325
             |||| ||| |    ||||| |   || ||  ||| |     || ||||  || ||   ||
Sbjct  8439  GAGCTGACCAAGCTTGCGGGTGGTCGGACCCCAAGGGAATCCCGCAGCAGATCCCAGAGG  8380

Query  326   ACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACA  385
             |||| || ||| || |  |||| ||||| ||||| |||||||| ||| | |   | |  |
Sbjct  8379  ACGGCACCATGAGCCCGTCGGGATACACGCACGACGGTCCGTGCGAGATCTACATGGGGA  8320

Query  386   CCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACAACC  445
             | |   | |  |||  ||    |||||| |||||| | ||||  | | | || | |||  
Sbjct  8319  CAAGTTG-GCACTCTCGTACCTCAACTGTCACGAGTCGATCACGGACCAAACGTTCAAGT  8261

Query  446   TTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCT  505
             | |||||||||   |||   | || |||||  ||    |||||||||||||| |  || |
Sbjct  8260  TGGACTACAGCGGATGCGGGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGCGCGAT  8201

Query  506   ACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
             |||| |||     ||||||||||||| | |||||||  ||||||| |||
Sbjct  8200  ACCTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGGAATGCATCCTGCT  8152

>PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_8:1:111390:1 
REF
Length=111390

 Score = 101 bits (111),  Expect = 4e-19
 Identities = 276/414 (67%), Gaps = 28/414 (7%)
 Strand=Plus/Plus

Query  151     GCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCG--CCGC-  207
               || ||||||||| ||||| | | |  ||||  ||  || ||||||| ||  |   | || 
Sbjct  110534  GCATTCCTGGAGGACCAGAGCTTCCCGACCACCGCCGACTTCAACGCGTACCTGACAGCG  110593

Query  208     AACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAG---TACACCGTCACT  264
               |||||   ||||| | | |||||||  |||||| ||  | | | |   ||||| ||||  
Sbjct  110594  AACAA---GTACACGTCGCTGCGTGCGTTCATGAACAACTCGACGCTCTACACGGTCAAC  110650

Query  265     GATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCG  324
               |   | ||| |||     || || || |||||  || ||| ||  |  ||||| || |||
Sbjct  110651  GCGAGCGCGAACTTTGGGTGTGGCTTTACGAAGCTCGACGGCGAGCGGCAGCCAATCCCG  110710

Query  325     G---ACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCT-  380
                   ||||    |||||||  || || ||||||||||| |||||||| |||   ||| | 
Sbjct  110711  ACGAACGGCCAGATGCGCTTGACCGGGTACACCCACGACGGTCCGTGCGAGACCTGGATG  110770

Query  381     --CGACACCAAACGCGTGCTCCAGTCGGACAACTGCCAC---GAGA--CCATCAGTGGCA  433
                 ||| |||||  | ||   || |   || |||||||||   |||   || ||| |    
Sbjct  110771  AACGATACCAAG-GTGTTTGCCGGC--GAGAACTGCCACACGGAGCTGCCCTCAATT---  110824

Query  434     AGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGC  493
                 |  |||| | | ||||||    ||||||  ||  | |||| ||| ||  |||||||| 
Sbjct  110825  --AGCTACAGCATGGACTACTCGGCGTGCAAGGGCTCGTGCATACTGCGCCGGTACTGGA  110882

Query  494     TGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCA  547
               ||||| | |||||| ||||||| |  |||||||||||| | |||||||| ||||
Sbjct  110883  TGGGCATCCGCTACGTCAAGAACGAGTACTCGTGGCAGGTGTACAAGGCGTGCA  110936

 Score = 99.6 bits (109),  Expect = 2e-18
 Identities = 154/215 (72%), Gaps = 14/215 (7%)
 Strand=Plus/Plus

Query  334     ATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACG-  392
               || ||||||||||| || || ||||| || ||||| |||||||||||||||     ||| 
Sbjct  107306  ATCCGCTCCACGGGCTATACGCACGACGGCCCGTGCGAGGTTTGGCTCGAC----GACGT  107361

Query  393     CGTGCTCCAGTCG---GACAACTGCCA---CGAGACCATCAGTGGCAAGACTTACAACCT  446
               |  | |   ||||   || ||||||||   ||||    || | |||||||| | |||  |
Sbjct  107362  CAAGGTTATGTCGGGAGAGAACTGCCATACCGAG--TTTCCG-GGCAAGACGTTCAAGAT  107418

Query  447     TGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTA  506
                ||||||    ||||||  ||  | ||||| || || ||||||||| ||||| | |||| 
Sbjct  107419  CGACTACTCGACGTGCAAGGGATCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTT  107478

Query  507     CCTCAAGAATGCCTACTCGTGGCAGATCTACAAGG  541
               |||||||||    |  ||||||||| | |||||||
Sbjct  107479  CCTCAAGAACAAGTGGTCGTGGCAGGTGTACAAGG  107513

 Score = 99.6 bits (109),  Expect = 2e-18
 Identities = 163/232 (70%), Gaps = 5/232 (2%)
 Strand=Plus/Plus

Query  324     GGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGA  383
               |||| | || |||||| | || || ||||||||||  |||||||| ||||| ||| ||||
Sbjct  109054  GGACAGCACCATGCGCACGACCGGATACACCCACGTGGGTCCGTGCGAGGTCTGGATCGA  109113

Query  384     CACCAAACGCGTGCTC-CAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACA  442
               || |   |||||  || | | || ||||||||||||||    ||     ||| ||   ||
Sbjct  109114  CAACGTCCGCGTCATCGCCGGCG-ACAACTGCCACGAGCAGGTC---TCCAACACGACCA  109169

Query  443     ACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTAC  502
               |  | |||||||||   || |  ||  | |||||  | || ||||||||||| ||  | |
Sbjct  109170  AGGTGGACTACAGCAACTGTAAGGGCTCGTGCACCATGCGCTGGTACTGGCTCGGACTGC  109229

Query  503     GCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
               ||||||| || ||    |  ||||||||| | ||||||   |||||| ||||
Sbjct  109230  GCTACCTGAAAAAGAAGTGGTCGTGGCAGGTGTACAAGAACTGCATCGCGCT  109281

>PHPA:scaffold_16 NW_008649002.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.16, whole genome shotgun 
sequence
Length=1156373

 Score = 99.6 bits (109),  Expect = 2e-18
 Identities = 282/429 (66%), Gaps = 21/429 (5%)
 Strand=Plus/Plus

Query  151     GCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAG--GATTTCAACGGGTGGCGC-CGC  207
               ||||||||||||  |||||| | |  |   |||  |  || ||||| || |||||  | |
Sbjct  488837  GCCTTCCTGGAGTCCCAGGGCTTCCCGT--GTCAGGCAGACTTCAATGGCTGGCGTGCTC  488894

Query  208     AACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACA------CCGTC  261
               || |  || |||||||   |||| ||||||||||| || || || ||||      | |||
Sbjct  488895  AA-AGTGGCTACAAGAATTTGCGCGACTTCATGGATCGAGCTAAATACACGACCTCGGTC  488953

Query  262     ACTGATGGAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATT  321
               ||    || || ||  |   ||| || || ||  |  | || | | |||| |  ||||||
Sbjct  488954  ACGCCAGGCGCTGATCAAACCTGTGGCTTAACCGAGCTGAAAGGCCCACCGCGACCCATT  489013

Query  322     CC---GGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGG  378
               ||   ||| || |  |||   || ||||| ||||| || || |||||||| |  ||||  
Sbjct  489014  CCGAAGGATGGCATGATGAAGTCAACGGGCTACACGCATGACGGTCCGTGCGCTGTTTAC  489073

Query  379     CTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACT  438
               |||||   | | |  || ||  |||  |||||||| |||||||   ||  ||||||| | 
Sbjct  489074  CTCGATGACGAGCTAGTTCTGGAGTACGACAACTGTCACGAGAAGCTCCCTGGCAAGTCA  489133

Query  439     TACAACCTTGACTACAGCTCGTGC------ACTGGTACCTGCACACTTCGTTGGTACTGG  492
               |||||  ||||||||   || |||      |  |||  ||| || |||  ||||| ||||
Sbjct  489134  TACAAGATTGACTACTCGTCCTGCGAAAAGAAAGGTGGCTGTACGCTTTATTGGTTCTGG  489193

Query  493     CTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCG  552
                ||||  | ||||   | ||||    ||  || |||||  | |||||||  ||| |||||
Sbjct  489194  TTGGGAATCCGCTTTGTAAAGAGCCGCTGGTCCTGGCAAGTTTACAAGGAGTGCGTCCCG  489253

Query  553     CTTTCGGCT  561
               ||  |||||
Sbjct  489254  CTAACGGCT  489262

>PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_711:1:15030:1 
REF
Length=15030

 Score = 95.1 bits (104),  Expect = 2e-17
 Identities = 162/232 (70%), Gaps = 5/232 (2%)
 Strand=Plus/Plus

Query  324   GGACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGA  383
             |||| | || |||||| | || || ||||| ||||  || ||||| ||||| ||| ||||
Sbjct  5430  GGACAGCACCATGCGCACGACCGGCTACACGCACGTGGGCCCGTGCGAGGTCTGGATCGA  5489

Query  384   CACCAAACGCGTGCTC-CAGTCGGACAACTGCCACGAGACCATCAGTGGCAAGACTTACA  442
             |  | | || ||  || | | || ||||||| ||||||    ||     || |||   ||
Sbjct  5490  CGACGAGCGTGTCATCGCCGGCG-ACAACTGTCACGAGCAGGTCTCCAACACGAC---CA  5545

Query  443   ACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTAC  502
             |  | |||||||||   ||||  ||    |||||  | || ||||||||||| ||| | |
Sbjct  5546  AGGTGGACTACAGCAACTGCAAGGGCGAGTGCACCATGCGCTGGTACTGGCTCGGCCTGC  5605

Query  503   GCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
             |||||||||||||    |  ||||||||| | ||||||   |||||| ||||
Sbjct  5606  GCTACCTCAAGAAGAAGTGGTCGTGGCAGGTGTACAAGAACTGCATCGCGCT  5657

 Score = 78.8 bits (86),  Expect = 1e-12
 Identities = 73/93 (78%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  151   GCCTTCCTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGCGCCGCAAC  210
             || ||||||||||||||||| | | |||||   | ||||||| | |  |    |||| ||
Sbjct  1123  GCGTTCCTGGAGAACCAGGGCTTCAAGACCACGGCGGATTTCGAAGCCTACTACCGCGAC  1182

Query  211   AACGGGTACAAGACCCTGCGTGACTTCATGGAC  243
             || || |||||||||||||| ||||||||||||
Sbjct  1183  AAGGGCTACAAGACCCTGCGCGACTTCATGGAC  1215

>PLHA:NW_020189073.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2165, whole genome shotgun sequence
Length=94632

 Score = 95.1 bits (104),  Expect = 2e-17
 Identities = 235/347 (68%), Gaps = 15/347 (4%)
 Strand=Plus/Plus

Query  217    TACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATGGAGCGGAC  276
              |||||  | || ||||| ||  |  | ||||| || |||||||| || || ||||| || 
Sbjct  34753  TACAACTCACTTCGTGATTTTCTCAAACGCGCGAATTACACCGTGACCGAAGGAGCTGAT  34812

Query  277    TACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCGGACGG-AACA--  333
                  ||||||| |||||| |   ||| |   | || ||||||||||| |  || ||||  
Sbjct  34813  AGAGACTGCGGATTCACGGATCCCAATGGTACGCCCCAGCCCATTCCAGCTGGCAACAAT  34872

Query  334    ATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCT---CGACACCAAA  390
              ||||| | ||| || ||||| |||||||| |  |||||| | |||||    |||||||||
Sbjct  34873  ATGCGATTCACTGGATACACTCACGATGGCCTCTGTGAGATGTGGCTTGATGACACCAAA  34932

Query  391    CGCGTGCTCCAGTCGGA--CAACTGCCACGA-GACCATCAGTGGCAAGACTTACAACCTT  447
                 ||||| ||| ||||  |||||| ||| | |||  ||   |  ||||| | |    | 
Sbjct  34933  ---GTGCT-CAG-CGGATCCAACTGTCACAACGACTTTCCTGGAAAAGAC-TGCCCTGTC  34986

Query  448    GACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTAC  507
              || |||   |||||||  |  |  ||     |    ||||||||||||| ||| ||    
Sbjct  34987  GATTACTCGTCGTGCAAGGACAATTGTGTCATGTACTGGTACTGGCTGGCCGTTCGTCTT  35046

Query  508    CTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCGCT  554
              || || ||||  || ||||||||  |||| ||||| ||||| || ||
Sbjct  35047  CTGAAAAATGAGTATTCGTGGCAAGTCTATAAGGCCTGCATTCCACT  35093

>PYAP:scaffold_182 pag1_scaffold_182 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_182:1:48098:1 
REF
Length=48098

 Score = 86.9 bits (95),  Expect = 9e-15
 Identities = 184/269 (68%), Gaps = 22/269 (8%)
 Strand=Plus/Plus

Query  301   AACGCCGCACCTCAGCCCATTCCGGAC---GGAACAATGCGCTCCACGGGTTACACCCAC  357
             |||| | | | ||||||||| ||| |    || |  ||||| || ||||| | ||| |||
Sbjct  1675  AACGGCCCCCGTCAGCCCATCCCGAAGAATGGTATGATGCGTTCGACGGGCTTCACGCAC  1734

Query  358   GATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCT------CCAGTCGGACAAC  411
             || || || |||||||| ||| |||||| ||  || |||||      | ||| || ||||
Sbjct  1735  GACGG-CCATGTGAGGTCTGGATCGACAACACGCGTGTGCTTGGCTCCAAGTTGGGCAAC  1793

Query  412   TGCCACGAGACCATCAGT---GGCAAGAC---TTACAACCTTGACTACAGCTCGTGCACT  465
             |||||| ||| |||| |    |||| ||    ||||||  | |||| |  |  ||| |  
Sbjct  1794  TGCCACAAGAGCATCGGGCAGGGCATGATCAGTTACAAGATCGACTTCTCCAAGTGTAAG  1853

Query  466   GGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACG-CTA--CCTCAAGAATGCCTAC  522
             ||   |||||   | || ||||||||||| ||| | || |||  |  ||||||    |  
Sbjct  1854  GGCGACTGCATGATCCGCTGGTACTGGCTCGGCATGCGCCTACTCGGCAAGAA---GTGG  1910

Query  523   TCGTGGCAGATCTACAAGGCTTGCATCCC  551
             ||||||||| | |||||||| || |||||
Sbjct  1911  TCGTGGCAGGTGTACAAGGCGTGTATCCC  1939

 Score = 41.9 bits (45),  Expect = 0.35
 Identities = 36/45 (80%), Gaps = 0/45 (0%)
 Strand=Plus/Plus

Query  351   CACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGT  395
             ||||||| | |||||||||||| | ||| |||||  || ||| ||
Sbjct  4983  CACCCACAAGGGTCCGTGTGAGTTCTGGATCGACGACACACGTGT  5027

>PYAR:scaffold_3459 par_scaffold_3459 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_3459:1:3265:1 
REF
Length=3265

 Score = 84.2 bits (92),  Expect = 3e-14
 Identities = 97/128 (76%), Gaps = 6/128 (5%)
 Strand=Plus/Plus

Query  436   ACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTG  495
             ||| ||||  ||||||||    ||||||  || || ||||  ||    ||||||||||||
Sbjct  2443  ACTGACAAGATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTG  2502

Query  496   GGCGTACGCT--ACCT-CAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCCG  552
             ||| | |||   ||   |||||    |||||||||||||||||||||||| |||||||||
Sbjct  2503  GGCATCCGCCCGACGGGCAAGAG---CTACTCGTGGCAGATCTACAAGGCCTGCATCCCG  2559

Query  553   CTTTCGGC  560
             || |||||
Sbjct  2560  CTCTCGGC  2567

 Score = 41.9 bits (45),  Expect = 0.35
 Identities = 65/91 (71%), Gaps = 8/91 (9%)
 Strand=Plus/Plus

Query  157   CTGGAGAACCAGGGATACGAGACCGTCGAGGATTTCAACGGGTGGC----GCCGCAACAA  212
             || ||||| ||||| ||| |||||   |  || || |||| ||  |    | | ||||||
Sbjct  2152  CTCGAGAAGCAGGGCTACAAGACCACGGCTGACTTTAACGCGTACCTTAAGGC-CAACAA  2210

Query  213   CGGGTACAAGACCCTGCGTGACTTCATGGAC  243
             |   ||||||||||| || || |||||||||
Sbjct  2211  C---TACAAGACCCTCCGCGAGTTCATGGAC  2238

>PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 
genomic scaffold, whole genome shotgun sequence
Length=3552875

 Score = 84.2 bits (92),  Expect = 3e-14
 Identities = 119/167 (71%), Gaps = 3/167 (2%)
 Strand=Plus/Minus

Query  209      ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
                ||||||| |||||||  || |  || ||||||||||| ||||| ||||  ||| |  | |
Sbjct  2748747  ACAACGGCTACAAGAGTCTCCTAGATTTCATGGACCGAGCCAAATACAAGGTCTCAAAGG  2748688

Query  269      GAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC---GG  325
                |||| ||| |    |||||||  ||  ||   || |     || ||||  |||||   ||
Sbjct  2748687  GAGCTGACCAGGCTTGCGGTTGGACTGACCCGAAGGGTATTCCCCAGCAAATTCCGGAGG  2748628

Query  326      ACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAG  372
                ||||||| |||||  | ||||| ||||| || ||||| |||||||||
Sbjct  2748627  ACGGAACGATGCGTACGACGGGCTACACGCATGATGGACCGTGTGAG  2748581

 Score = 66.2 bits (72),  Expect = 9e-09
 Identities = 81/111 (73%), Gaps = 0/111 (0%)
 Strand=Plus/Minus

Query  441      CAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGT  500
                ||| || |||||||||   |||  || || |||||   |   ||||||||||||||| ||
Sbjct  2743290  CAAGCTGGACTACAGCGGCTGCGGTGATAGCTGCATCATCTATTGGTACTGGCTGGGTGT  2743231

Query  501      ACGCTACCTCAAGAATGCCTACTCGTGGCAGATCTACAAGGCTTGCATCCC  551
                 ||| | ||||||      ||||| |||||| | |||||||  ||||||||
Sbjct  2743230  GCGCAAGCTCAAGGGCAAGTACTCCTGGCAGGTGTACAAGGAGTGCATCCC  2743180

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 96/141 (68%), Gaps = 0/141 (0%)
 Strand=Plus/Minus

Query  409      AACTGCCACGAGACCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGT  468
                |||||||||||| | ||||  |   | || | ||| || || || ||  | ||   || |
Sbjct  2704637  AACTGCCACGAGTCGATCACAGATCAAACGTTCAAGCTCGATTATAGTGCCTGTGGTGAT  2704578

Query  469      ACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTACCTCAAGAATGCCTACTCGTGG  528
                ||||||    |    ||||| ||| ||||||| || || || |||||    |||||||||
Sbjct  2704577  ACCTGCGTGTTGTACTGGTATTGGTTGGGCGTTCGTTATCTTAAGAAGAAGTACTCGTGG  2704518

Query  529      CAGATCTACAAGGCTTGCATC  549
                ||  | |||||||  || |||
Sbjct  2704517  CAAGTGTACAAGGAGTGTATC  2704497

 Score = 50.0 bits (54),  Expect = 7e-04
 Identities = 36/42 (86%), Gaps = 0/42 (0%)
 Strand=Plus/Minus

Query  209      ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCA  250
                |||||||||||||||  || ||||||||||||||  || |||
Sbjct  2722729  ACAACGGGTACAAGAGTCTCCGTGACTTCATGGATAGCCCCA  2722688

 Score = 42.8 bits (46),  Expect = 0.10
 Identities = 35/43 (81%), Gaps = 0/43 (0%)
 Strand=Plus/Minus

Query  281      ACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC  323
                |||| ||||||||||||   |||| | |||| ||||| |||||
Sbjct  2827923  ACTGTGGTTTCACGAACCCGAACGACACACCGCAGCCTATTCC  2827881

>PHIF:NW_003303391.1 Phytophthora infestans T30-4 supercont1.368 
genomic scaffold, whole genome shotgun sequence
Length=80461

 Score = 79.7 bits (87),  Expect = 1e-12
 Identities = 118/167 (71%), Gaps = 3/167 (2%)
 Strand=Plus/Minus

Query  209    ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
              ||||||| |||||||  || |  || ||||||||||| ||||| ||||  ||| |  | |
Sbjct  80420  ACAACGGCTACAAGAGTCTCCTAGATTTCATGGACCGAGCCAAATACAAGGTCTCAAAGG  80361

Query  269    GAGCGGACTACTACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCC---GG  325
              |||| ||| |    |||||||  ||  ||   || |     || ||||   ||||   ||
Sbjct  80360  GAGCTGACCAGGCTTGCGGTTGGACTGACCCGAAGGGTATTCCCCAGCAATTTCCGGAGG  80301

Query  326    ACGGAACAATGCGCTCCACGGGTTACACCCACGATGGTCCGTGTGAG  372
              ||||||| |||||  | ||||| ||||| || ||||| |||||||||
Sbjct  80300  ACGGAACGATGCGTACGACGGGCTACACGCATGATGGACCGTGTGAG  80254

>PHIF:NW_003303741.1 Phytophthora infestans T30-4 supercont1.18 
genomic scaffold, whole genome shotgun sequence
Length=2518706

 Score = 76.1 bits (83),  Expect = 2e-11
 Identities = 183/277 (66%), Gaps = 9/277 (3%)
 Strand=Plus/Minus

Query  184      GAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGAC  243
                || || |||||||| |||||    || || || ||||||  |||||||||||| ||||||
Sbjct  1575670  GAAGACTTCAACGGTTGGCGTGCTAAGAATGGCTACAAGGACCTGCGTGACTTTATGGAC  1575611

Query  244      CGCGCCAAGTA------CACCGTCACTGATGGAGCGGACTACTACTGCGGTTTCACGAAC  297
                || || |||||      | | |||||   ||| || ||  |    || || || ||  | 
Sbjct  1575610  CGAGCTAAGTATGTGACCTCGGTCACGCCTGGCGCCGATCAAACTTGTGGCTTAACCGAG  1575551

Query  298      GTCAACGCCGCACCTCAGCCCATTCC---GGACGGAACAATGCGCTCCACGGGTTACACC  354
                 | || | | |||| |  ||||||||    |||||  | ||| | ||||| || ||||| 
Sbjct  1575550  CTGAAAGGCCCACCGCGACCCATTCCAAAAGACGGTGCGATGAGATCCACCGGCTACACG  1575491

Query  355      CACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGC  414
                || || || ||||| |   |||  ||||||    | |  ||  |  |||  || ||||| 
Sbjct  1575490  CATGACGGACCGTGCGCTATTTACCTCGACGATGAGCTTGTTATGGAGTATGATAACTGT  1575431

Query  415      CACGAGACCATCAGTGGCAAGACTTACAACCTTGACT  451
                |||||||  |||   |||| ||| |||||  | ||||
Sbjct  1575430  CACGAGAGTATCCCCGGCAGGACGTACAAGATCGACT  1575394

 Score = 59.0 bits (64),  Expect = 1e-06
 Identities = 50/62 (81%), Gaps = 0/62 (0%)
 Strand=Plus/Minus

Query  184      GAGGATTTCAACGGGTGGCGCCGCAACAACGGGTACAAGACCCTGCGTGACTTCATGGAC  243
                || || ||| |||| |||||   ||| ||||| ||||||  |||||||||||| ||||||
Sbjct  1596366  GAAGACTTCGACGGTTGGCGTGCCAAGAACGGCTACAAGGACCTGCGTGACTTTATGGAC  1596307

Query  244      CG  245
                ||
Sbjct  1596306  CG  1596305

>PHIF:NW_003304531.1 Phytophthora infestans T30-4 supercont1.4149 
genomic scaffold, whole genome shotgun sequence
Length=1472

 Score = 54.5 bits (59),  Expect = 6e-05
 Identities = 52/67 (78%), Gaps = 0/67 (0%)
 Strand=Plus/Minus

Query  209  ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCACTGATG  268
            |||||||||||||||  || ||||||||||||||  || |||  || |  ||||| || |
Sbjct  605  ACAACGGGTACAAGAGTCTCCGTGACTTCATGGATAGCCCCAGATATAAGGTCACGGAGG  546

Query  269  GAGCGGA  275
            | || ||
Sbjct  545  GGGCCGA  539

>PHSO:scaffold_16
Length=803425

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 82/113 (73%), Gaps = 12/113 (11%)
 Strand=Plus/Minus

Query  281     ACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTC---CGGACGGAACAATGC  337
               ||||||| |||||| ||  ||||| | | || ||||||||||   |||||||  ||| ||
Sbjct  524427  ACTGCGGCTTCACGGACCCCAACGGCACGCCGCAGCCCATTCCCACGGACGG--CAAGGC  524370

Query  338     -----GCTC-CACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGAC  384
                     ||| | |||  | || |||||  |||||||| ||| | |||||||||
Sbjct  524369  CACCTTCTCTCGCGGCCT-CATCCACGTGGGTCCGTGCGAGATCTGGCTCGAC  524318

 Score = 44.6 bits (48),  Expect = 0.029
 Identities = 36/44 (82%), Gaps = 0/44 (0%)
 Strand=Plus/Plus

Query  281     ACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCG  324
               ||||||| |||||| ||  ||||| | | || ||||||||||||
Sbjct  522012  ACTGCGGCTTCACGGACCCCAACGGCACGCCGCAGCCCATTCCG  522055

>APAS:scaffold_49 supercont1.49 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.49:1:457786:1 
REF
Length=457786

 Score = 53.6 bits (58),  Expect = 6e-05
 Identities = 44/54 (81%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  361     GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGC  414
               || ||||||||| |||||||||||| || ||||||| | |||   ||| |||||
Sbjct  302651  GGCCCGTGTGAGATTTGGCTCGACAACACACGCGTGTTTCAGAACGACGACTGC  302704

>HYAP:scaffold_59 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_59:1:376122:1 
REF
Length=376122

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 67/93 (72%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  448     GACTACAGCTCGTGCACTGGTACCTGCACACTTCGTTGGTACTGGCTGGGCGTACGCTAC  507
               |||||||||||||||   |   | ||||| || || ||||||||||| ||| | |  |||
Sbjct  161609  GACTACAGCTCGTGCGGAGACTCGTGCACCCTCCGGTGGTACTGGCTCGGCATTCAGTAC  161668

Query  508     CTCAAGAATGCCTACTCGTGGCAGATCTACAAG  540
                |  |   |  ||||||||||||| | || |||
Sbjct  161669  ATGGATGGTATCTACTCGTGGCAGGTGTATAAG  161701

>SAPA:scaffold_19 supercont2.19 dna:supercontig supercontig:ASM15154v2:supercont2.19:1:569072:1 
REF
Length=569072

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 43/54 (80%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  361     GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGC  414
               ||||||||||| || ||| |||||  ||| |||||| |||||   ||| |||||
Sbjct  450884  GGTCCGTGTGAAGTCTGGATCGACGACAAGCGCGTGTTCCAGAACGACGACTGC  450831

>SADI:scaffold_264 supercont1.264 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.264:1:6072:1 
REF
Length=6072

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 43/54 (80%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  361  GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGC  414
            ||||||||||| || |||||||||  ||| |||||  |||||   ||| |||||
Sbjct  307  GGTCCGTGTGAAGTCTGGCTCGACGACAAGCGCGTCTTCCAGAACGACGACTGC  254

>PYUU:scaffold_2029 scf1117875582029 dna:supercontig supercontig:pug:scf1117875582029:1:1550222:1 
REF
Length=1550222

 Score = 46.4 bits (50),  Expect = 0.008
 Identities = 46/60 (77%), Gaps = 0/60 (0%)
 Strand=Plus/Plus

Query  355     CACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGC  414
               ||| | ||||||||||| || |||   |||| ||  |||||| |||||   |||||||||
Sbjct  503527  CACCAAGGTCCGTGTGAAGTGTGGTGTGACAACACCCGCGTGTTCCAGGACGACAACTGC  503586

>PYIR:scaffold_452 pir_scaffold_452 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_452:1:24914:1 
REF
Length=24914

 Score = 44.6 bits (48),  Expect = 0.029
 Identities = 42/54 (78%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  361    GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGC  414
              |||||||||||| | ||| |||||  ||| ||||||  ||||   ||| |||||
Sbjct  24116  GGTCCGTGTGAGCTCTGGATCGACGACAAGCGCGTGTACCAGAACGACGACTGC  24169

>PHPA:scaffold_460 NW_008649446.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.460, whole genome 
shotgun sequence
Length=3430

 Score = 44.6 bits (48),  Expect = 0.029
 Identities = 84/120 (70%), Gaps = 13/120 (11%)
 Strand=Plus/Minus

Query  281  ACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTC---CGGACGGAACAATGC  337
            |||||||||||||| ||   ||||   | |||||||||||||   |||||||  ||| ||
Sbjct  613  ACTGCGGTTTCACGGACCCGAACGGTACGCCTCAGCCCATTCCCACGGACGG--CAAGGC  556

Query  338  --GCTCCACGGGTTACA---CCCACGATGGTCCGTGTGAGGTTTGGCTC---GACACCAA  389
                | | || ||   |     ||||  |||||||||||| | ||||||   ||||||||
Sbjct  555  CACTTTCTCGCGTGCAATTGTGCACGTCGGTCCGTGTGAGATCTGGCTCGATGACACCAA  496

>PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 
genomic scaffold, whole genome shotgun sequence
Length=4722445

 Score = 44.6 bits (48),  Expect = 0.029
 Identities = 30/34 (88%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  345      GGGTTACACCCACGATGGTCCGTGTGAGGTTTGG  378
                |||| || |||||  |||||||||||||||||||
Sbjct  2170783  GGGTAACTCCCACCCTGGTCCGTGTGAGGTTTGG  2170816

 Score = 44.6 bits (48),  Expect = 0.029
 Identities = 30/34 (88%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  345      GGGTTACACCCACGATGGTCCGTGTGAGGTTTGG  378
                |||| || |||||  |||||||||||||||||||
Sbjct  2171332  GGGTAACTCCCACCCTGGTCCGTGTGAGGTTTGG  2171299

 Score = 43.7 bits (47),  Expect = 0.10
 Identities = 28/31 (90%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  354      CCACGATGGTCCGTGTGAGGTTTGGCTCGAC  384
                ||||| ||||||||| ||| |||||||||||
Sbjct  3770469  CCACGCTGGTCCGTGCGAGATTTGGCTCGAC  3770439

>PHRA:scaffold_52
Length=349176

 Score = 43.7 bits (47),  Expect = 0.10
 Identities = 41/52 (79%), Gaps = 3/52 (6%)
 Strand=Plus/Minus

Query  281     ACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTC---CGGACGG  329
               |||||||||||||| ||   | || | |||| ||||||||||   |||||||
Sbjct  102692  ACTGCGGTTTCACGGACCCGAGCGGCACACCGCAGCCCATTCCTTCGGACGG  102641

>PHRA:scaffold_4
Length=963095

 Score = 43.7 bits (47),  Expect = 0.10
 Identities = 37/46 (80%), Gaps = 0/46 (0%)
 Strand=Plus/Plus

Query  522     CTCGTGGCAGATCTACAAGGCTTGCATCCCGCTTTCGGCTTCAGCT  567
               || ||||||| | ||||||   |||||||||||||||| | | |||
Sbjct  236959  CTGGTGGCAGGTGTACAAGAACTGCATCCCGCTTTCGGGTCCCGCT  237004

>PHRA:scaffold_29
Length=529199

 Score = 41.9 bits (45),  Expect = 0.35
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  355     CACGATGGTCCGTGTGAGGTTTGGCTCGAC  384
               ||||| ||||||||||||||||||  ||||
Sbjct  437433  CACGAGGGTCCGTGTGAGGTTTGGTGCGAC  437404

>PHPA:scaffold_5 NW_008648991.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.5, whole genome shotgun 
sequence
Length=2147012

 Score = 41.9 bits (45),  Expect = 0.35
 Identities = 49/64 (77%), Gaps = 2/64 (3%)
 Strand=Plus/Plus

Query  354      CCACGATGGTCCGTGTGAGGTTTGGCTCGAC-ACCAAACGCGTGCTCCAGTCGGACAACT  412
                |||||  || ||||||||| ||||||||||| || | | | ||||| |||   ||| | |
Sbjct  1018556  CCACGCCGGCCCGTGTGAGATTTGGCTCGACGACGAGATG-GTGCTGCAGAACGACGATT  1018614

Query  413      GCCA  416
                ||||
Sbjct  1018615  GCCA  1018618

>PHKE:scaffold_250 scf_22126_250.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_250.1:1:52150:1 
REF
Length=52150

 Score = 41.9 bits (45),  Expect = 0.35
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  354    CCACGATGGTCCGTGTGAGGTTTGG  378
              ||||||||||||||||||||| |||
Sbjct  20274  CCACGATGGTCCGTGTGAGGTGTGG  20298

>PHPA:scaffold_76 NW_008649062.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.76, whole genome shotgun 
sequence
Length=282732

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 32/38 (84%), Gaps = 3/38 (8%)
 Strand=Plus/Plus

Query  355    CACGATGGTCCGTGTGAGGTTTGGCT---CGACACCAA  389
              |||| ||||||||||||| | |||||   |||||||||
Sbjct  43933  CACGTTGGTCCGTGTGAGATCTGGCTTGACGACACCAA  43970

>PHCA:scaffold_22 PHYCAscaffold_22
Length=843021

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 32/38 (84%), Gaps = 3/38 (8%)
 Strand=Plus/Plus

Query  355     CACGATGGTCCGTGTGAGGTTTGGCTC---GACACCAA  389
               ||||  |||||||||||| ||||||||   ||||||||
Sbjct  396760  CACGTGGGTCCGTGTGAGATTTGGCTCGATGACACCAA  396797

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 32/38 (84%), Gaps = 3/38 (8%)
 Strand=Plus/Plus

Query  355     CACGATGGTCCGTGTGAGGTTTGGCTC---GACACCAA  389
               ||||  |||||||||||| ||||||||   ||||||||
Sbjct  399429  CACGTGGGTCCGTGTGAGATTTGGCTCGATGACACCAA  399466

>APIN:scaffold_9 supercont1.9 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.9:1:1715687:1 
REF
Length=1715687

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 46/62 (74%), Gaps = 0/62 (0%)
 Strand=Plus/Minus

Query  353     CCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACT  412
               ||||||| || || ||||||||||||  |||| | |  ||||||  |  |   |||||||
Sbjct  910969  CCCACGAAGGGCCATGTGAGGTTTGGTGCGACGCGACTCGCGTGTACTCGAACGACAACT  910910

Query  413     GC  414
               ||
Sbjct  910909  GC  910908

>PYVX:scaffold_341 pve_scaffold_341 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_341:1:29233:1 
REF
Length=29233

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Minus

Query  361    GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGC  414
              |||||||||||||| ||| |||||  ||     ||||||||    |||||||||
Sbjct  23710  GGTCCGTGTGAGGTCTGGTTCGACGACACCATGGTGCTCCACGGCGACAACTGC  23657

>PYIW:scaffold_878 piw_scaffold_878 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_878:1:13019:1 
REF
Length=13019

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 48/65 (74%), Gaps = 3/65 (5%)
 Strand=Plus/Plus

Query  361  GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGT---CGGACAACTGCCAC  417
            || ||||| ||||  |||  ||||| | | | |||||| | ||   ||||||||||||| 
Sbjct  387  GGCCCGTGCGAGGCCTGGTGCGACAACGAGCTCGTGCTGCCGTTCACGGACAACTGCCAG  446

Query  418  GAGAC  422
             ||||
Sbjct  447  CAGAC  451

>PYAR:scaffold_4452 par_scaffold_4452 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_4452:1:2219:1 
REF
Length=2219

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 41/54 (76%), Gaps = 0/54 (0%)
 Strand=Plus/Plus

Query  361  GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGC  414
            || ||||||||||| |||  ||||  ||| || ||| || |   ||||||||||
Sbjct  671  GGCCCGTGTGAGGTCTGGTGCGACGACAAGCGTGTGTTCTACGAGGACAACTGC  724

>PYAR:scaffold_212 par_scaffold_212 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_212:1:25069:1 
REF
Length=25069

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 44/59 (75%), Gaps = 0/59 (0%)
 Strand=Plus/Plus

Query  355    CACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTG  413
              ||||  ||||||||||| || |||  ||||   || |||||  |||||   ||||||||
Sbjct  20132  CACGTCGGTCCGTGTGAAGTCTGGTGCGACCAGAAGCGCGTCTTCCAGGAAGACAACTG  20190

>PHRA:scaffold_89
Length=200592

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 50/69 (72%), Gaps = 0/69 (0%)
 Strand=Plus/Minus

Query  351     CACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAA  410
               ||| |||| ||| || |||||| |||  ||||||  ||     ||||||||    |||||
Sbjct  129343  CACGCACGTTGGCCCCTGTGAGATTTATCTCGACGACACGATGGTGCTCCACAGCGACAA  129284

Query  411     CTGCCACGA  419
               |||||| ||
Sbjct  129283  CTGCCAGGA  129275

>PHCA:scaffold_50 PHYCAscaffold_50
Length=475612

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  355     CACGATGGTCCGTGTGAGGTTTGG  378
               ||||| ||||||||||||||||||
Sbjct  149858  CACGAAGGTCCGTGTGAGGTTTGG  149881

>PHCA:scaffold_11 PHYCAscaffold_11
Length=1076090

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  351     CACCCACGATGGTCCGTGTGAGGTTTGGCTCGAC  384
               |||||||  ||| |||||||||||||||  ||||
Sbjct  649419  CACCCACACTGGCCCGTGTGAGGTTTGGTGCGAC  649386

>PYVX:scaffold_121 pve_scaffold_121 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_121:1:49194:1 
REF
Length=49194

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 51/71 (72%), Gaps = 0/71 (0%)
 Strand=Plus/Minus

Query  361    GGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGAG  420
              |||||||||||| ||||||||||   ||     ||||||||    ||| ||||| ||  |
Sbjct  22115  GGTCCGTGTGAGATTTGGCTCGATGACACTATGGTGCTCCACGACGACGACTGCTACTCG  22056

Query  421    ACCATCAGTGG  431
              |||  | ||||
Sbjct  22055  ACCTACGGTGG  22045

>PHKE:scaffold_399 scf_22126_399.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_399.1:1:32365:1 
REF
Length=32365

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 97/141 (69%), Gaps = 10/141 (7%)
 Strand=Plus/Plus

Query  281    ACTGCGGTTTCACGAACGTCAACGCCGCACCTCAGCCCATTCCG---GACGG-AACAATG  336
              |||| ||||||||| ||   | || | | || ||||| || |||   ||||| ||   | 
Sbjct  30835  ACTGTGGTTTCACGGACCCGAGCGGCACCCCACAGCCGATCCCGTCGGACGGCAAGGCTA  30894

Query  337    CGCTC-CACGGGTTACACC-CACGATGGTCCGTGTGAGGTTTGGCTCGACACCA--AACG  392
              || || | || | ||  |  |||| ||||||||||||  | ||||| |||| ||  || |
Sbjct  30895  CGTTCTCTCGTGCTATGCAGCACGTTGGTCCGTGTGAAATCTGGCTTGACAGCACTAAGG  30954

Query  393    CGTGCTCCAGTCGGACAACTG  413
              |||  ||  |  |||||||||
Sbjct  30955  CGTTTTC--GAAGGACAACTG  30973

>PHIF:NW_003303738.1 Phytophthora infestans T30-4 supercont1.21 
genomic scaffold, whole genome shotgun sequence
Length=2319577

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  354      CCACGATGGTCCGTGTGAGGTTTGGCTCGAC  384
                ||||||||| ||||||||||| |||  ||||
Sbjct  1287058  CCACGATGGGCCGTGTGAGGTCTGGTGCGAC  1287088

>APAS:scaffold_69 supercont1.69 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.69:1:312879:1 
REF
Length=312879

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  318     CATTCCGGACGGAACAATGCGCTCCACGGGT  348
               |||||| || |||| |||| |||||||||||
Sbjct  201148  CATTCCCGAGGGAAGAATGGGCTCCACGGGT  201118

>PYIW:scaffold_1200 piw_scaffold_1200 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1200:1:10445:1 
REF
Length=10445

 Score = 38.3 bits (41),  Expect = 4.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  385   ACCAAACGCGTGCTCCAGTCGGA  407
             ||||| |||||||||||||||||
Sbjct  3679  ACCAAGCGCGTGCTCCAGTCGGA  3657

>PYIR:scaffold_201 pir_scaffold_201 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_201:1:42273:1 
REF
Length=42273

 Score = 38.3 bits (41),  Expect = 4.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  385    ACCAAACGCGTGCTCCAGTCGGA  407
              ||||| |||||||||||||||||
Sbjct  35969  ACCAAGCGCGTGCTCCAGTCGGA  35991

>PHSO:scaffold_7
Length=4006126

 Score = 38.3 bits (41),  Expect = 4.3
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  206      GCAACAACGGGTACAAGACCCTGCGTGACTTCA  238
                |||||||||||| |||| |||| ||||  ||||
Sbjct  2907770  GCAACAACGGGTTCAAGTCCCTCCGTGGGTTCA  2907802

>PHRA:scaffold_37
Length=441994

 Score = 38.3 bits (41),  Expect = 4.3
 Identities = 52/71 (73%), Gaps = 4/71 (6%)
 Strand=Plus/Plus

Query  351     CACCCACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGC--GTGCTCCAGTCGGAC  408
               ||| |||| ||| || |||||| |||  ||||||   | |||   ||||||||    |||
Sbjct  285394  CACGCACGTTGGCCCCTGTGAGATTTATCTCGACG--ATACGATGGTGCTCCACAGCGAC  285451

Query  409     AACTGCCACGA  419
               |||||||| ||
Sbjct  285452  AACTGCCAGGA  285462

>PHCA:scaffold_24 PHYCAscaffold_24
Length=787421

 Score = 38.3 bits (41),  Expect = 4.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  361     GGTCCGTGTGAGGTTTGGCTCGA  383
               |||||||||||| ||||||||||
Sbjct  169245  GGTCCGTGTGAGATTTGGCTCGA  169267

>HYAP:scaffold_8 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_8:1:893728:1 
REF
Length=893728

 Score = 38.3 bits (41),  Expect = 4.3
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  347     GTTACACCCACGATGGTCCGTGTGAGGTTTGGCTCGAC  384
               ||| |||||||  ||| ||||||||||| |||  ||||
Sbjct  522261  GTTTCACCCACCCTGGACCGTGTGAGGTCTGGTGCGAC  522298

>PYVX:scaffold_1070 pve_scaffold_1070 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1070:1:7524:1 
REF
Length=7524

 Score = 37.4 bits (40),  Expect = 4.3
 Identities = 44/60 (73%), Gaps = 0/60 (0%)
 Strand=Plus/Minus

Query  355   CACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGC  414
             || || |||||||||||||| |||  ||||  ||  | ||   |||||   |||||||||
Sbjct  1558  CATGACGGTCCGTGTGAGGTCTGGTGCGACGACACGCTCGCCTTCCAGGACGACAACTGC  1499

>PYAP:scaffold_94 pag1_scaffold_94 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_94:1:69112:1 
REF
Length=69112

 Score = 37.4 bits (40),  Expect = 4.3
 Identities = 44/60 (73%), Gaps = 0/60 (0%)
 Strand=Plus/Minus

Query  355    CACGATGGTCCGTGTGAGGTTTGGCTCGACACCAAACGCGTGCTCCAGTCGGACAACTGC  414
              ||||  || ||||||||||| |||   |||| | | || ||  |||||   |||||||||
Sbjct  42111  CACGTGGGCCCGTGTGAGGTCTGGTGTGACAACCAGCGTGTCTTCCAGAACGACAACTGC  42052

>PHRA:scaffold_63
Length=309551

 Score = 37.4 bits (40),  Expect = 4.3
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  340    TCCACGGGTTACACCCACGATGGTC  364
              |||||||||||| ||||||||| ||
Sbjct  67881  TCCACGGGTTACCCCCACGATGTTC  67857

>PHKE:scaffold_1486 scf_22126_1486.1_contig_1 dna:supercontig 
supercontig:PhyKer238_432v1:scf_22126_1486.1_contig_1:1:1233:1 
REF
Length=1233

 Score = 37.4 bits (40),  Expect = 4.3
 Identities = 41/55 (75%), Gaps = 0/55 (0%)
 Strand=Plus/Minus

Query  209  ACAACGGGTACAAGACCCTGCGTGACTTCATGGACCGCGCCAAGTACACCGTCAC  263
            ||||||| ||||  || || |  |||||||||||| |||  ||  |||| || ||
Sbjct  111  ACAACGGCTACACAACTCTCCTCGACTTCATGGACAGCGGGAACCACACAGTGAC  57

>PHKE:scaffold_1127 scf_22126_1127.1_contig_1 dna:supercontig 
supercontig:PhyKer238_432v1:scf_22126_1127.1_contig_1:1:2939:1 
REF
Length=2939

 Score = 37.4 bits (40),  Expect = 4.3
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Plus

Query  107  CGACCTACACGACTGATAACAAGGACA  133
            ||||||||||||||| | |||||||||
Sbjct  132  CGACCTACACGACTG-TGACAAGGACA  157

>PHKE:scaffold_474 scf_22126_474.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_474.1:1:25539:1 
REF
Length=25539

 Score = 37.4 bits (40),  Expect = 4.3
 Identities = 38/46 (83%), Gaps = 3/46 (7%)
 Strand=Plus/Plus

Query  373    GTTTGGCTCGACACCAAACGCGTGCTCC-AGTCGGACAACTGCCAC  417
              || |||||||||||| |||||||| ||| |||| || | || ||||
Sbjct  16024  GTGTGGCTCGACACC-AACGCGTGTTCCGAGTCCGAGATCT-CCAC  16067

>PHKE:scaffold_211 scf_22126_211.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_211.1_contig_1:1:59949:1 
REF
Length=59949

 Score = 37.4 bits (40),  Expect = 4.3
 Identities = 37/46 (80%), Gaps = 3/46 (7%)
 Strand=Plus/Minus

Query  208    AACAACGGGTACAAGACCCTG--CGTGA-CTTCATGGACCGCGCCA  250
              ||||||||||||||| ||| |  ||| | | |||||||| ||| ||
Sbjct  17284  AACAACGGGTACAAGTCCCAGGACGTCATCCTCATGGACGGCGACA  17239

>PHKE:scaffold_36 scf_22126_36.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_36.1:1:159174:1 
REF
Length=159174

 Score = 37.4 bits (40),  Expect = 4.3
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Minus

Query  107     CGACCTACACGACTGATAACAAGGACA  133
               ||||||||||||||| | |||||||||
Sbjct  120606  CGACCTACACGACTG-TGACAAGGACA  120581

>PHIF:NW_003303743.1 Phytophthora infestans T30-4 supercont1.16 
genomic scaffold, whole genome shotgun sequence
Length=3114892

 Score = 37.4 bits (40),  Expect = 4.3
 Identities = 39/51 (76%), Gaps = 3/51 (6%)
 Strand=Plus/Minus

Query  342      CACGGGTTACACCCACGATGGTCCGTGTGAGGTTTGG---CTCGACACCAA  389
                |||||| | ||| ||   ||||||||||||||| |||     |||||||||
Sbjct  1481195  CACGGGATTCACACATCCTGGTCCGTGTGAGGTCTGGTGTGACGACACCAA  1481145

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 756611567752

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2