Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
PHPA:scaffold_6017073317150977715540.0
PHIF:NW_003303758.12119692127567896061e-153
PHCA:scaffold_95117775124446992438e-55
PHSO:scaffold_2541869854194427562324e-52
PHKE:scaffold_31115374158474911155e-20
APAS:scaffold_12268670226869526470.13
APIN:scaffold_3738801138803727440.45
PYUU:scaffold_201411418011420324431.6
SAPA:scaffold_330820930822921421.6
SADI:scaffold_2061334261336726421.6
PHPA:scaffold_71358439135845921421.6
PHIF:NW_003303757.12809466280949126421.6
SADI:scaffold_391899491902532415.5
PYUU:scaffold_202846830646833833415.5
PYAP:scaffold_112035112037828415.5
PLHA:NW_020190046.127429623415.5
PLHA:NW_020189786.128568328570523415.5
PLHA:NW_020188806.1289752899723415.5
PLHA:NW_020187532.13261759326178123415.5
PLHA:NW_020187350.144987744989923415.5
PLHA:NW_020187031.125589825592023415.5
PHIF:NW_003303756.12228753222877523415.5
PHIF:NW_003303750.131826231830039415.5
PHIF:NW_003303747.12198278219830023415.5
PHIF:NW_003303743.195572395574523415.5
PHIF:NW_003303622.120504020506223415.5
PHCA:scaffold_111187941882128415.5
PHCA:scaffold_7331765731768428415.5
PHCA:scaffold_5913304813307023415.5
PHCA:scaffold_3722830922833123415.5
HYAP:scaffold_16510032810036033415.5
SAPA:scaffold_74285032852220405.5
PYVX:scaffold_390228952292127405.5
PYIW:scaffold_33101207122620405.5
PYIR:scaffold_19463367342405.5
PLHA:NW_020187168.113679913681820405.5
PHRA:scaffold_2626329826332225405.5
PHKE:scaffold_2516097616100025405.5
PHCA:scaffold_90138471387125405.5
APIN:scaffold_3238888938891830405.5
BLASTN 2.9.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= PPTG_16673

Length=777
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

PHPA:scaffold_60 NW_008649046.1 Phytophthora parasitica INRA-310 ...  1402       0.0   
PHIF:NW_003303758.1 Phytophthora infestans T30-4 supercont1.1 gen...  547        1e-153
PHCA:scaffold_9 PHYCAscaffold_9                                       220        8e-55 
PHSO:scaffold_2                                                       210        4e-52 
PHKE:scaffold_311 scf_22126_311.1 dna:supercontig supercontig:Phy...  104        5e-20 
APAS:scaffold_1 supercont1.1 dna:supercontig supercontig:Apha_ast...  43.7       0.13  
APIN:scaffold_37 supercont1.37 dna:supercontig supercontig:Apha_i...  41.0       0.45  
PYUU:scaffold_2014 scf1117875582014 dna:supercontig supercontig:p...  40.1       1.6   
SAPA:scaffold_3 supercont2.3 dna:supercontig supercontig:ASM15154...  39.2       1.6   
SADI:scaffold_20 supercont1.20 dna:supercontig supercontig:Sap_di...  39.2       1.6   
PHPA:scaffold_7 NW_008648993.1 Phytophthora parasitica INRA-310 u...  39.2       1.6   
PHIF:NW_003303757.1 Phytophthora infestans T30-4 supercont1.2 gen...  39.2       1.6   
SADI:scaffold_3 supercont1.3 dna:supercontig supercontig:Sap_dicl...  38.3       5.5   
PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:p...  38.3       5.5   
PYAP:scaffold_1 pag1_scaffold_1 dna:supercontig supercontig:pag1_...  38.3       5.5   
PLHA:NW_020190046.1 Plasmopara halstedii genome assembly, contig:...  38.3       5.5   
PLHA:NW_020189786.1 Plasmopara halstedii genome assembly, contig:...  38.3       5.5   
PLHA:NW_020188806.1 Plasmopara halstedii genome assembly, contig:...  38.3       5.5   
PLHA:NW_020187532.1 Plasmopara halstedii genome assembly, contig:...  38.3       5.5   
PLHA:NW_020187350.1 Plasmopara halstedii genome assembly, contig:...  38.3       5.5   
PLHA:NW_020187031.1 Plasmopara halstedii genome assembly, contig:...  38.3       5.5   
PHIF:NW_003303756.1 Phytophthora infestans T30-4 supercont1.3 gen...  38.3       5.5   
PHIF:NW_003303750.1 Phytophthora infestans T30-4 supercont1.9 gen...  38.3       5.5   
PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 ge...  38.3       5.5   
PHIF:NW_003303743.1 Phytophthora infestans T30-4 supercont1.16 ge...  38.3       5.5   
PHIF:NW_003303622.1 Phytophthora infestans T30-4 supercont1.137 g...  38.3       5.5   
PHCA:scaffold_111 PHYCAscaffold_111                                   38.3       5.5   
PHCA:scaffold_73 PHYCAscaffold_73                                     38.3       5.5   
PHCA:scaffold_59 PHYCAscaffold_59                                     38.3       5.5   
PHCA:scaffold_37 PHYCAscaffold_37                                     38.3       5.5   
HYAP:scaffold_165 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  38.3       5.5   
SAPA:scaffold_74 supercont2.74 dna:supercontig supercontig:ASM151...  37.4       5.5   
PYVX:scaffold_390 pve_scaffold_390 dna:supercontig supercontig:pv...  37.4       5.5   
PYIW:scaffold_3310 piw_scaffold_3310 dna:supercontig supercontig:...  37.4       5.5   
PYIR:scaffold_194 pir_scaffold_194 dna:supercontig supercontig:pi...  37.4       5.5   
PLHA:NW_020187168.1 Plasmopara halstedii genome assembly, contig:...  37.4       5.5   
PHRA:scaffold_26                                                      37.4       5.5   
PHKE:scaffold_25 scf_22126_25.1 dna:supercontig supercontig:PhyKe...  37.4       5.5   
PHCA:scaffold_90 PHYCAscaffold_90                                     37.4       5.5   
APIN:scaffold_32 supercont1.32 dna:supercontig supercontig:Apha_i...  37.4       5.5   

>PHPA:scaffold_60 NW_008649046.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.60, whole genome shotgun 
sequence
Length=386225

 Score = 1402 bits (1554),  Expect = 0.0
 Identities = 777/777 (100%), Gaps = 0/777 (0%)
 Strand=Plus/Minus

Query  1       ATGCCTCTCTTCAGTCTCGCTCGATTCTTTAGCCTTAGCTCGCTCGGACGACGCCACCGT  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  171509  ATGCCTCTCTTCAGTCTCGCTCGATTCTTTAGCCTTAGCTCGCTCGGACGACGCCACCGT  171450

Query  61      CGCGGCGAAAGAGAACAGCGGCGAATTATGCGGAGCCGATCATCGCGGCGCGTACAGGAA  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  171449  CGCGGCGAAAGAGAACAGCGGCGAATTATGCGGAGCCGATCATCGCGGCGCGTACAGGAA  171390

Query  121     GTTTCAACCGTGAAAGGTGTTGTACACATACCATATATGGAGGCCACGTCCGTCGAGTTC  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  171389  GTTTCAACCGTGAAAGGTGTTGTACACATACCATATATGGAGGCCACGTCCGTCGAGTTC  171330

Query  181     GATATTCGCAGCAATCGATCGATCTCTTCGTCATTCTACGTGAAGGGCAGCGCTGCGTGT  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  171329  GATATTCGCAGCAATCGATCGATCTCTTCGTCATTCTACGTGAAGGGCAGCGCTGCGTGT  171270

Query  241     CCGGATCACCGCGGGTTGATGAACTCTTTGCGCTCGTTTCGAGCACAAGGCCCTGTCGAG  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  171269  CCGGATCACCGCGGGTTGATGAACTCTTTGCGCTCGTTTCGAGCACAAGGCCCTGTCGAG  171210

Query  301     GTTGCCAAGAAGGAGCAGAAGAAACTCCGCAAGGCATTGGAACGTGCGGTCAAACAAGAG  360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  171209  GTTGCCAAGAAGGAGCAGAAGAAACTCCGCAAGGCATTGGAACGTGCGGTCAAACAAGAG  171150

Query  361     CGAAAAGAAGCTCGCAAGATGCAGAAACTCGCCAAAAAGTCCGACAGGTCAGTGAGAGAA  420
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  171149  CGAAAAGAAGCTCGCAAGATGCAGAAACTCGCCAAAAAGTCCGACAGGTCAGTGAGAGAA  171090

Query  421     AGAGGTGGCAGCTGCAACCGAATCGCTTTGCTATCTACTACCACCGTGAGCGATTGCAGT  480
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  171089  AGAGGTGGCAGCTGCAACCGAATCGCTTTGCTATCTACTACCACCGTGAGCGATTGCAGT  171030

Query  481     GTCATGTCAGACCAGGAGATCTTGGCAGAGATCTGGGCTATGCGTTCATCGTCCATGGGC  540
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  171029  GTCATGTCAGACCAGGAGATCTTGGCAGAGATCTGGGCTATGCGTTCATCGTCCATGGGC  170970

Query  541     CGGGTGAGCGATGAGAGCATGCCTGTAGTAGACGACAAATTGGCGGATACTGCGCCCATG  600
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  170969  CGGGTGAGCGATGAGAGCATGCCTGTAGTAGACGACAAATTGGCGGATACTGCGCCCATG  170910

Query  601     GAGTTCTTGTTCTTCACGGGCTGCCCAGATGACAACAGCCTGGATGTAAGACACCGGCGG  660
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  170909  GAGTTCTTGTTCTTCACGGGCTGCCCAGATGACAACAGCCTGGATGTAAGACACCGGCGG  170850

Query  661     GCTCGATCGAAAGCCCGACTGGCGCGGTACAGTGCGACGCCGTCTTTCACAACGACTGTC  720
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  170849  GCTCGATCGAAAGCCCGACTGGCGCGGTACAGTGCGACGCCGTCTTTCACAACGACTGTC  170790

Query  721     CCCGTAAAATCGACATTGGTGTCCAACATGCCACCGCTATTCGTGCCACGCTTTTGA  777
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  170789  CCCGTAAAATCGACATTGGTGTCCAACATGCCACCGCTATTCGTGCCACGCTTTTGA  170733

>PHIF:NW_003303758.1 Phytophthora infestans T30-4 supercont1.1 
genomic scaffold, whole genome shotgun sequence
Length=6928287

 Score = 547 bits (606),  Expect = 1e-153
 Identities = 595/789 (75%), Gaps = 13/789 (2%)
 Strand=Plus/Plus

Query  1       ATGCCTCTCTTCAGTCTCGCTCGATTCTTTAGCCTTAGCTCGCTCGGACGACGCCACCGT  60
               |||| ||||   || ||||||||| |||||||||| ||||||||  | ||||  ||||  
Sbjct  211969  ATGCTTCTCGAAAGCCTCGCTCGAGTCTTTAGCCTCAGCTCGCTACGGCGACATCACCCC  212028

Query  61      CGCGGCGAAAGAGAACAGCGGCGAATTATGCGGAGCCGATCATCGCGGCGCGTACAGGAA  120
               |||| ||  ||| ||||| ||||  ||  | | || || ||||| || || ||||||| |
Sbjct  212029  CGCGACGGGAGAAAACAGTGGCGTCTTCAGTGTAGTCGTTCATCACGTCGTGTACAGGCA  212088

Query  121     GTTTCAACCGTGAAAGGTGTTGTACACATACCATATATGGAGGCCACGTCCGTCGAGTTC  180
               ||||| || |||||||| ||    ||   ||| || | | |  |  ||||||||||||||
Sbjct  212089  GTTTCCACTGTGAAAGGAGTCCCTCAGGCACCGTACACGCAAACTCCGTCCGTCGAGTTC  212148

Query  181     GATATTCGCAGCAATCGATCGATCTCTTCGTCATTCTACGTGAAGGGCAGCGCTGCGTGT  240
               |  || || | ||   || | |||||  || ||  || | | |||||   |  |||||||
Sbjct  212149  GCCATGCGTAACAGCAGACCAATCTCCCCGCCAACCTTCTTCAAGGGGGCCCGTGCGTGT  212208

Query  241     CCGGATCACCGCGGGTTGATGAACTCTTTGCGCTCGTTTCGAGCACAAGGCCCTGTCGAG  300
                | || |  | |||| |||  |  ||  |||| |||||||| ||||||| ||||||  ||
Sbjct  212209  TCAGACCGTCTCGGGCTGACAATGTCCATGCGGTCGTTTCGCGCACAAGACCCTGTTCAG  212268

Query  301     GTTGCCAAGAAGGAGCAGAAGAAACTCCGCAAGGCATTGGAACGTGCGGTCAAACAAGAG  360
                |||||||||| || |||||||| || |||||||| |||||||||||||  || ||||||
Sbjct  212269  ATTGCCAAGAACGACCAGAAGAAGCTTCGCAAGGCGTTGGAACGTGCGGCTAAGCAAGAG  212328

Query  361     CGAAAAGAAGCTCGCAAGATGCAGAAACTCGCCAAAAAGTCCGACAGGTCAGTGAGAGAA  420
               || |||||||||||||||| ||||||||||||   ||||||| |||||||| ||||||||
Sbjct  212329  CGGAAAGAAGCTCGCAAGAAGCAGAAACTCGCTCGAAAGTCCCACAGGTCACTGAGAGAA  212388

Query  421     AGAGGTGGCAGCTGCAACCGAATCGCTTTGCTATCTACTACCACCGTGAGCGATTGCAGT  480
               |||||| ||||| ||||||| |||||  |||| ||  |  || |||||  ||||||||||
Sbjct  212389  AGAGGTAGCAGCAGCAACCGGATCGCGCTGCTGTCGGCATCCTCCGTGTACGATTGCAGT  212448

Query  481     GTCATGTCAGACCAGGAGATCTTGGCAGAGATCTGGGCTATGCGTTCATCGTCCATGGGC  540
                ||| |||| || ||||||| ||||| ||||||||||||||||| ||||| | || || |
Sbjct  212449  ATCACGTCAAACGAGGAGATTTTGGCCGAGATCTGGGCTATGCGCTCATCCTTCACGGCC  212508

Query  541     CGGGTGAGCGATGAGAGCATGCCTGTAGTAGACGACAAATTGGCGGATACTGCGCCCATG  600
               |  ||||| |||||     || |||  | ||| || |||  ||||    |||||||||| 
Sbjct  212509  CAAGTGAGTGATGAAGATGTGTCTGCCGCAGATGATAAAGCGGCGAGCTCTGCGCCCATA  212568

Query  601     GAGTTCTTGTTCTTCACGGGCTGCCCAGATGACAACAGCCTGGATGTAAGACACCGGCGG  660
               || ||||||||||||| |||||||||||| |||| |||||  ||  |  || ||| ||||
Sbjct  212569  GAATTCTTGTTCTTCATGGGCTGCCCAGACGACAGCAGCCGCGAAATTGGATACCTGCGG  212628

Query  661     GCTCGATCGAAAGCCCGACTGGCGCGGTACAGTGCGACGCCGTCTTT---CA--------  709
               |||||| | ||| |||||  ||||||| | | |||||| ||||||||   ||        
Sbjct  212629  GCTCGACCCAAATCCCGATCGGCGCGGAATACTGCGACACCGTCTTTTGCCACGGCAATT  212688

Query  710     -CAACGACTGTCCCCGTAAAATCGACATTGGTGTCCAACATGCCACCGCTATTCGTGCCA  768
                | |||||  |||| || ||||||||||||||||| ||||||||  |||| || ||||||
Sbjct  212689  GCCACGACAATCCCGGTGAAATCGACATTGGTGTCGAACATGCCGTCGCTCTT-GTGCCA  212747

Query  769     CGCTTTTGA  777
               |||||||||
Sbjct  212748  CGCTTTTGA  212756

>PHCA:scaffold_9 PHYCAscaffold_9
Length=1114135

 Score = 220 bits (243),  Expect = 8e-55
 Identities = 471/699 (67%), Gaps = 50/699 (7%)
 Strand=Plus/Plus

Query  98      GATCATCGCGGCGCGTACAGGAAGTTTCAACCGTGAAAGGTGTTGTACACATACCATATA  157
               |||||| |||||  || ||||   ||||||| ||||| || ||  | ||  | |||  ||
Sbjct  511777  GATCATTGCGGCATGTGCAGGCGATTTCAACTGTGAACGGAGTGATTCAGGTGCCAGGTA  511836

Query  158     TGGAGGCCACGTCCGTCGAGTTCGATATTCGCAGCAATCGATCGATCTCTTCGTCATTCT  217
               ||||||  |||||||| ||||| || || ||||||||  ||||| | || |||||||| |
Sbjct  511837  TGGAGGATACGTCCGTTGAGTTTGACATGCGCAGCAACAGATCGTTGTCCTCGTCATTTT  511896

Query  218     ACGTGAAGGGCAGCGCTGCGTGTCCGGATCACCGCGGGTT----GATGAACTCTTTGCGC  273
               || | | | |||  |   ||| || |      || |  ||    ||| | |||  || ||
Sbjct  511897  ACTTTACGTGCACAGAC-CGTCTCGGT-----CGAGACTTTGCCGAT-ATCTCCATGGGC  511949

Query  274     TCGTTTCGAGCACAAGGCCCTGTCGAGGTTGCCAAGAAGGAGCAGAAGAAACTCCGCAAG  333
               ||  | ||| ||  |  |   | ||| ||| |||||||||| || || ||  ||||||||
Sbjct  511950  TCTGTGCGATCATTACAC---GACGAAGTTACCAAGAAGGACCAAAAAAAGATCCGCAAG  512006

Query  334     GCATTGGAACGTGCGGTCAAACAAGAGCGAAAAGAAGCTCGCAAGATGCAGAAACTCGCC  393
               ||| |||| ||| |  |||| |||||||||||||||||||| ||| ||||||||   || 
Sbjct  512007  GCACTGGACCGTACAATCAAGCAAGAGCGAAAAGAAGCTCGAAAGCTGCAGAAATGGGCA  512066

Query  394     AAAAAGTCCGACAG---GTCAGTGAGAGAAAGAGGTGGCAGCTGCAACCGAATCGCTTTG  450
                 ||||||||||||    |||  ||    | || |  ||| | ||| ||  ||   ||||
Sbjct  512067  CGAAAGTCCGACAGATCCTCAAGGACGCGAGGAAGCAGCACCAGCAGCCAGATAAGTTTG  512126

Query  451     CTATCTACTACCACCGTGAGCGATTGCAGTGTCATGTCAGACCAGGAGATCTTGGCAGAG  510
               || |   |    || ||||| ||||||| ||  | ||| ||||| ||||| ||||| |||
Sbjct  512127  CTGT---CCGTGACTGTGAGTGATTGCAATGGAACGTCGGACCAAGAGATTTTGGCGGAG  512183

Query  511     ATCTGGGCTATGCGTTCATCGTCCATGGGCCGGGTGAGCGATGAGAGCATGCCTGTAGTA  570
               |||||||||| |||  | |||||| ||||||       ||| |||    | |||| | | 
Sbjct  512184  ATCTGGGCTACGCGCCCTTCGTCCCTGGGCC------ACGACGAG---CTACCTGAAATC  512234

Query  571     GACGACAAATTGGCGGAT---ACTGCGCCCATGGAGTTCTTGTTCTTCACGGGCTGCCCA  627
               || | | ||||||  |||   ||    |||| ||||||  |||| ||||| |||||||||
Sbjct  512235  GATGCCGAATTGGTAGATGAAACAAGACCCACGGAGTTTCTGTTTTTCACTGGCTGCCCA  512294

Query  628     GATGACAACAGC---------CTGGATGTAAGACACCGGCGGGCTCGATCGAAAGCCCGA  678
               || || || | |          |||| ||  |  |||| |||  ||| || ||  ||   
Sbjct  512295  GACGATAAAAACTTACGCGAGTTGGACGTGGGGTACCGACGGCTTCGGTCTAA--CC---  512349

Query  679     CTGGCGCGGTACAGTGCGACGCCGTCTTTCACAACGACTGTCCCCGTAAAATCGACATTG  738
                   || | ||  ||||||| || || | | |||| || ||||| || ||| ||||  | 
Sbjct  512350  ----CGGGATATCGTGCGACTCCATCGTACGCAACCACAGTCCCTGTCAAACCGACGCTT  512405

Query  739     GTGTCCAACATGCCACCGCTATTCGTGCCACGCTTTTGA  777
               ||| || | ||||| ||||| ||| |||| || ||||||
Sbjct  512406  GTGACCGATATGCCCCCGCTCTTCATGCCGCGATTTTGA  512444

 Score = 46.4 bits (50),  Expect = 0.011
 Identities = 37/45 (82%), Gaps = 0/45 (0%)
 Strand=Plus/Plus

Query  1       ATGCCTCTCTTCAGTCTCGCTCGATTCTTTAGCCTTAGCTCGCTC  45
               |||| ||||   |||||||||||||| |||||||| | ||| |||
Sbjct  511689  ATGCATCTCGGTAGTCTCGCTCGATTATTTAGCCTGACCTCACTC  511733

>PHSO:scaffold_2
Length=11587142

 Score = 210 bits (232),  Expect = 4e-52
 Identities = 503/756 (67%), Gaps = 45/756 (6%)
 Strand=Plus/Plus

Query  52       CGCCACCGTCGCGGCGAAAGAGAACAGCGGCGAATTATGCGGAGCCGATCATCGCGGCGC  111
                || |||||||| | | |  ||  |||||||||| |   |||  | ||||| ||  | |||
Sbjct  5418698  CGACACCGTCGTGACAATGGAACACAGCGGCGACTCCGGCGACGTCGATCCTCAAGACGC  5418757

Query  112      GTACAGGAAGTTTCAACCGTGA---AAGGTGTTGTACACATACCATATATGGAGGCCACG  168
                || |||| ||   || | |||    | || ||||| |   | || | || |||| |  | 
Sbjct  5418758  GTGCAGGCAG---CACCGGTGGCCGACGGGGTTGTCCGGGTCCCCTCTACGGAGACATCT  5418814

Query  169      TCCGTCGAGTTCGATATTCGCAGCAATCGATCGATCTCTTCGTCATTCTACGTGAAGGGC  228
                 | || |||||||| || |||||||| ||||| || || ||||| ||| || | |   ||
Sbjct  5418815  CCTGTTGAGTTCGAAATGCGCAGCAACCGATCAATGTCGTCGTCGTTCCACTTCACAAGC  5418874

Query  229      AGCGCTGCGTGTCCGGATCACCGCGGGT---------------TG---ATGAACTCTTTG  270
                ||||  ||  |  | |||| || ||||                ||   |||| |||    
Sbjct  5418875  AGCGGAGCACGCACAGATCGCCTCGGGCGTGACCCCGCCGAGATGTCAATGAGCTCAGCC  5418934

Query  271      CGCTCGTTTCGAGCACAAGGCCCTGTCGAGGTTGCCAAGAAGGAGCAGAAGAAACTCCGC  330
                || || ||||| ||    |  || || ||  | ||||||   ||||||||||| ||||||
Sbjct  5418935  CGATCTTTTCGCGCGGTGGATCCCGTGGAACTCGCCAAGGCCGAGCAGAAGAAGCTCCGC  5418994

Query  331      AAGGCATTGGAACGTGCGGTCAAACAAGAGCGAAAAGAAGCTCGCAAGATGCAGAAACTC  390
                ||||||||||| || |||||    |||||||| || ||||| |  || ||| |||| |||
Sbjct  5418995  AAGGCATTGGAGCGCGCGGTGCGGCAAGAGCGGAAGGAAGCGCAAAA-ATGAAGAAGCTC  5419053

Query  391      GCCAAAAAGTCCGACAGGTCAGTGAGAGAAAGAGGTGGCAGCTGCAACCGAATCGCTTTG  450
                | ||| ||   ||| |  || | ||   |  ||||||||||| |||   | || ||  | 
Sbjct  5419054  GTCAACAATGTCGATATTTCCGCGACGAATCGAGGTGGCAGCGGCA---GGATAGCCGTC  5419110

Query  451      CTATCTACTACCACCGTGAGCGATTGCAGTGTCATGTCAGACCAGGAGATCTTGGCAGAG  510
                 | ||  ||   || |||||||||||||||| || ||| ||  |||| || ||||| || 
Sbjct  5419111  TTGTCCCCTGGTACTGTGAGCGATTGCAGTGCCACGTCGGATGAGGACATTTTGGCCGAA  5419170

Query  511      ATCTGGGCTATGCGTTCATCGTCCATGGGCCGGGTGAGCGATGA-GAGCATGCCTGTAGT  569
                |||||||| ||||| ||  |     ||| | | | ||||| ||| || | ||||||  ||
Sbjct  5419171  ATCTGGGCCATGCGGTCGCCACGTTTGGACGGCGCGAGCGGTGACGATC-TGCCTGAGGT  5419229

Query  570      AGACGACAAATTGGCGGATACTGCGCCCATGGAGTTCTTGTTCTTCACGGGCTGCCCAGA  629
                 |||||  | ||  | || || ||||||||||||||| |||| ||| |||||||||| ||
Sbjct  5419230  GGACGATGAGTTATCCGAGACAGCGCCCATGGAGTTCCTGTTTTTCTCGGGCTGCCCGGA  5419289

Query  630      TGACAACAGCC---------TGGATGTAAGACACCGGCGGGCTCGATCGAAAGCCCGACT  680
                 ||||| | ||         |||||||  || |||| ||    ||||||||  |||| | 
Sbjct  5419290  CGACAAGAACCTGCGCGTGTTGGATGTCGGATACCGACGCCTACGATCGAA--CCCG-CG  5419346

Query  681      GGCG---CGGTACAGTGCGACGCCGTCTTTCACAACGACTGTCCCCGTAAAATCGACATT  737
                ||||   ||||||   |  || ||||| | | | ||  | |||||| | ||  | ||  |
Sbjct  5419347  GGCGACCCGGTACCCGGTCACACCGTCCTACGCGACATCCGTCCCCATCAAGCCCACGCT  5419406

Query  738      GGTGTCCAACATGCCACCGCTATTCGTGCCACGCTT  773
                 || ||||||||||| ||||| || |  || |||||
Sbjct  5419407  CGTTTCCAACATGCCGCCGCTGTTTGCACCGCGCTT  5419442

>PHKE:scaffold_311 scf_22126_311.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_311.1:1:43504:1 
REF
Length=43504

 Score = 104 bits (115),  Expect = 5e-20
 Identities = 320/491 (65%), Gaps = 28/491 (6%)
 Strand=Plus/Minus

Query  292    CCTGTCGAGGTTGCCAAGAAGGAGCAGAAGAAACTCCGCAAGGCATTGGAACGTGCGGTC  351
              || || ||| | || |||   || | ||| || || |  ||||| ||||| |||||    
Sbjct  15847  CCGGTAGAGCTCGCTAAGCGTGACCCGAATAAGCTTCAGAAGGCTTTGGACCGTGCCACG  15788

Query  352    AAACAAGAGCGAAAAGAAG-CTCGCAAGATGCAGAAACTCGCCAAAAAGTCCGACAGGTC  410
               | ||||| || || |||| | ||||||||||||||  ||||||| ||| | |  ||  |
Sbjct  15787  CAGCAAGAACGGAA-GAAGACACGCAAGATGCAGAAGATCGCCAACAAGGCTGCTAGA-C  15730

Query  411    AGTGAGAGAAAGAGGTGGCAGCTGCAACCGAATCGCTTTGCTATCTACTACCACCGTGAG  470
              || | |  |     |  || || ||||||| ||||| ||||||||| ||          |
Sbjct  15729  AGCGGGGCA-----GCAGCGGCAGCAACCGGATCGCGTTGCTATCTGCTG---------G  15684

Query  471    CGATTGCAGTGTCATGTCAGACCAGGAGATCTTGGCAGAGATCTGGGCTATGCGTTCATC  530
               |  || ||| ||   || ||| |||| || ||||| ||||| |||||    || ||| |
Sbjct  15683  TGTCTGTAGTATCGCCTCGGACGAGGACATTTTGGCTGAGATATGGGCATCACGCTCACC  15624

Query  531    GTCCATGGGCCGGGTGAGC-GATGAGAGCATGCCTGTAGTAGACGACAAATTGGCGGATA  589
              |||  || | |||    || |||||   | ||||||  || |||||  | ||  |  |  
Sbjct  15623  GTCG-TGTGACGGTATTGCCGATGACGACCTGCCTGAGGTCGACGAAGACTTCTCACAGT  15565

Query  590    CTGCGCCCATGGAGTTCTTGTTCTTCACGGGCTGCCCAGATGACAACAGCC---------  640
              |||| |||||||||||| |||| || || |||||||| || ||||  | ||         
Sbjct  15564  CTGCACCCATGGAGTTCGTGTTTTTTACAGGCTGCCCGGACGACAGGAACCTGCGCGAGT  15505

Query  641    TGGATGTAAGACACCGGCGGGCTCGATCGAAAGCCCGACTGGCGCGGTACAGTGCGACGC  700
              |||||||  || | || ||   ||| || ||  | |||   ||||||| |    ||||  
Sbjct  15504  TGGATGTCGGATATCGACGACATCGCTCCAACACGCGAGCTGCGCGGTGCCCATCGACAT  15445

Query  701    CGTCTTTCACAACGACTGTCCCCGTAAAATCGACATTGGTGTCCAACATGCCACCGCTAT  760
              |||| |   |||||||  ||||  | ||  | ||  | |||||||| ||||| || || |
Sbjct  15444  CGTCGTATGCAACGACCATCCCTATCAAGCCAACGCTCGTGTCCAAGATGCCTCCACTGT  15385

Query  761    TCGTGCCACGC  771
              |||| || |||
Sbjct  15384  TCGTTCCCCGC  15374

>APAS:scaffold_1 supercont1.1 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.1:1:2615878:1 
REF
Length=2615878

 Score = 43.7 bits (47),  Expect = 0.13
 Identities = 25/26 (96%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  170      CCGTCGAGTTCGATATTCGCAGCAAT  195
                ||||||||||||||||||| ||||||
Sbjct  2268695  CCGTCGAGTTCGATATTCGAAGCAAT  2268670

>APIN:scaffold_37 supercont1.37 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.37:1:488699:1 
REF
Length=488699

 Score = 41.0 bits (44),  Expect = 0.45
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  37      AGCTCGCTCGGACGACGCCACCGTCGC  63
               |||||||||| ||| ||||||||||||
Sbjct  388011  AGCTCGCTCGAACGCCGCCACCGTCGC  388037

>PYUU:scaffold_2014 scf1117875582014 dna:supercontig supercontig:pug:scf1117875582014:1:494327:1 
REF
Length=494327

 Score = 40.1 bits (43),  Expect = 1.6
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  186     TCGCAGCAATCGATCGATCTCTTC  209
               |||||||||||| |||||||||||
Sbjct  114180  TCGCAGCAATCGCTCGATCTCTTC  114203

>SAPA:scaffold_3 supercont2.3 dna:supercontig supercontig:ASM15154v2:supercont2.3:1:1275006:1 
REF
Length=1275006

 Score = 39.2 bits (42),  Expect = 1.6
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  734     CATTGGTGTCCAACATGCCAC  754
               |||||||||||||||||||||
Sbjct  308209  CATTGGTGTCCAACATGCCAC  308229

>SADI:scaffold_20 supercont1.20 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.20:1:765613:1 
REF
Length=765613

 Score = 39.2 bits (42),  Expect = 1.6
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  414     GAGAGAAAGAGGTGGCAGCTGCAACC  439
               |||||||| ||||||||||| |||||
Sbjct  613367  GAGAGAAATAGGTGGCAGCTCCAACC  613342

>PHPA:scaffold_7 NW_008648993.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.7, whole genome shotgun 
sequence
Length=2078921

 Score = 39.2 bits (42),  Expect = 1.6
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  49       CGACGCCACCGTCGCGGCGAA  69
                |||||||||||||||||||||
Sbjct  1358439  CGACGCCACCGTCGCGGCGAA  1358459

>PHIF:NW_003303757.1 Phytophthora infestans T30-4 supercont1.2 
genomic scaffold, whole genome shotgun sequence
Length=5928454

 Score = 39.2 bits (42),  Expect = 1.6
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  263      ACTCTTTGCGCTCGTTTCGAGCACAA  288
                |||| |||||||||||||||||| ||
Sbjct  2809491  ACTCGTTGCGCTCGTTTCGAGCAGAA  2809466

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  293      CTGTCGAGGTTGCCAAGAAGGAGCAGAAGAAAC  325
                ||| | |||  |||||||||||| |||||||||
Sbjct  5690466  CTGCCAAGGCCGCCAAGAAGGAGAAGAAGAAAC  5690434

>SADI:scaffold_3 supercont1.3 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.3:1:1523884:1 
REF
Length=1523884

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 28/32 (88%), Gaps = 2/32 (6%)
 Strand=Plus/Plus

Query  419     AAAGAGGTGGCAGCTGC--AACCGAATCGCTT  448
               |||||||||||| ||||  || ||||||||||
Sbjct  918994  AAAGAGGTGGCATCTGCCGAAACGAATCGCTT  919025

>PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:pug:scf1117875582028:1:960197:1 
REF
Length=960197

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  185     TTCGCAGCAATCGATCGATCTCTTCGTCATTCT  217
               |||||  || ||||| |||||||||||| ||||
Sbjct  468338  TTCGCTTCAGTCGATGGATCTCTTCGTCTTTCT  468306

>PYAP:scaffold_1 pag1_scaffold_1 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_1:1:222494:1 
REF
Length=222494

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  531     GTCCATGGGCCGGGTGAGCGATGAGAGC  558
               ||||| ||||| || |||||||||||||
Sbjct  120351  GTCCAAGGGCCAGGCGAGCGATGAGAGC  120378

>PLHA:NW_020190046.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_3143, whole genome shotgun sequence
Length=304

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  597  CATGGAGTTCTTGTTCTTCACGG  619
            |||| ||||||||||||||||||
Sbjct  296  CATGTAGTTCTTGTTCTTCACGG  274

>PLHA:NW_020189786.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2881, whole genome shotgun sequence
Length=924714

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  597     CATGGAGTTCTTGTTCTTCACGG  619
               |||| ||||||||||||||||||
Sbjct  285705  CATGTAGTTCTTGTTCTTCACGG  285683

>PLHA:NW_020188806.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_1898, whole genome shotgun sequence
Length=313614

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  597    CATGGAGTTCTTGTTCTTCACGG  619
              |||| ||||||||||||||||||
Sbjct  28975  CATGTAGTTCTTGTTCTTCACGG  28997

>PLHA:NW_020187532.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_614, whole genome shotgun sequence
Length=3420761

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  597      CATGGAGTTCTTGTTCTTCACGG  619
                |||| ||||||||||||||||||
Sbjct  3261759  CATGTAGTTCTTGTTCTTCACGG  3261781

>PLHA:NW_020187350.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_430, whole genome shotgun sequence
Length=1405462

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  597     CATGGAGTTCTTGTTCTTCACGG  619
               |||| ||||||||||||||||||
Sbjct  449899  CATGTAGTTCTTGTTCTTCACGG  449877

>PLHA:NW_020187031.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_110, whole genome shotgun sequence
Length=2288132

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  597     CATGGAGTTCTTGTTCTTCACGG  619
               |||| ||||||||||||||||||
Sbjct  255920  CATGTAGTTCTTGTTCTTCACGG  255898

>PHIF:NW_003303756.1 Phytophthora infestans T30-4 supercont1.3 
genomic scaffold, whole genome shotgun sequence
Length=5458067

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  597      CATGGAGTTCTTGTTCTTCACGG  619
                |||| ||||||||||||||||||
Sbjct  2228753  CATGTAGTTCTTGTTCTTCACGG  2228775

>PHIF:NW_003303750.1 Phytophthora infestans T30-4 supercont1.9 
genomic scaffold, whole genome shotgun sequence
Length=4027111

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 33/39 (85%), Gaps = 3/39 (8%)
 Strand=Plus/Plus

Query  595     CCCATGGAGTTCTTGTTCTTCACGG-GCTG--CCCAGAT  630
               || ||||| ||||||||||||||||  |||  |||||||
Sbjct  318262  CCAATGGAATTCTTGTTCTTCACGGTACTGCTCCCAGAT  318300

>PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 
genomic scaffold, whole genome shotgun sequence
Length=3552875

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  158      TGGAGGCCACGTCCGTCGAGTTC  180
                |||||||||| ||||||||||||
Sbjct  2198300  TGGAGGCCACATCCGTCGAGTTC  2198278

>PHIF:NW_003303743.1 Phytophthora infestans T30-4 supercont1.16 
genomic scaffold, whole genome shotgun sequence
Length=3114892

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  263     ACTCTTTGCGCTCGTTTCGAGCA  285
               |||| ||||||||||||||||||
Sbjct  955745  ACTCGTTGCGCTCGTTTCGAGCA  955723

>PHIF:NW_003303622.1 Phytophthora infestans T30-4 supercont1.137 
genomic scaffold, whole genome shotgun sequence
Length=284897

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  597     CATGGAGTTCTTGTTCTTCACGG  619
               |||| ||||||||||||||||||
Sbjct  205062  CATGTAGTTCTTGTTCTTCACGG  205040

>PHCA:scaffold_111 PHYCAscaffold_111
Length=91577

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  278    TTCGAGCACAAGGCCCTGTCGAGGTTGC  305
              |||||||||||||  ||||||| |||||
Sbjct  18794  TTCGAGCACAAGGTGCTGTCGAAGTTGC  18821

>PHCA:scaffold_73 PHYCAscaffold_73
Length=348431

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  278     TTCGAGCACAAGGCCCTGTCGAGGTTGC  305
               |||||||||||||  ||||||| |||||
Sbjct  317657  TTCGAGCACAAGGTGCTGTCGAAGTTGC  317684

>PHCA:scaffold_59 PHYCAscaffold_59
Length=390573

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  597     CATGGAGTTCTTGTTCTTCACGG  619
               |||| ||||||||||||||||||
Sbjct  133070  CATGAAGTTCTTGTTCTTCACGG  133048

>PHCA:scaffold_37 PHYCAscaffold_37
Length=577888

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  597     CATGGAGTTCTTGTTCTTCACGG  619
               |||| ||||||||||||||||||
Sbjct  228331  CATGTAGTTCTTGTTCTTCACGG  228309

>HYAP:scaffold_165 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_165:1:143727:1 
REF
Length=143727

 Score = 38.3 bits (41),  Expect = 5.5
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  194     ATCGATCGATCTCTTCGTCATTCTACGTGAAGG  226
               ||||  ||||| |||||||||||| ||||| ||
Sbjct  100328  ATCGTGCGATCGCTTCGTCATTCTCCGTGATGG  100360

>SAPA:scaffold_74 supercont2.74 dna:supercontig supercontig:ASM15154v2:supercont2.74:1:183338:1 
REF
Length=183338

 Score = 37.4 bits (40),  Expect = 5.5
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  164    CCACGTCCGTCGAGTTCGAT  183
              ||||||||||||||||||||
Sbjct  28522  CCACGTCCGTCGAGTTCGAT  28503

>PYVX:scaffold_390 pve_scaffold_390 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_390:1:26772:1 
REF
Length=26772

 Score = 37.4 bits (40),  Expect = 5.5
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Minus

Query  47     GACGACG-CCACCGTCGCGGCGAAAGA  72
              |||| || |||||||||||||||||||
Sbjct  22921  GACGTCGTCCACCGTCGCGGCGAAAGA  22895

>PYIW:scaffold_3310 piw_scaffold_3310 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_3310:1:3350:1 
REF
Length=3350

 Score = 37.4 bits (40),  Expect = 5.5
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  305   CCAAGAAGGAGCAGAAGAAA  324
             ||||||||||||||||||||
Sbjct  1226  CCAAGAAGGAGCAGAAGAAA  1207

>PYIR:scaffold_194 pir_scaffold_194 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_194:1:42761:1 
REF
Length=42761

 Score = 37.4 bits (40),  Expect = 5.5
 Identities = 34/42 (81%), Gaps = 1/42 (2%)
 Strand=Plus/Plus

Query  415  AGAGAAAGAGGTGGCAGCTGCAACCGAATCGCTTTGCTATCT  456
            ||||| ||||||  || ||| ||  |||||||||||| ||||
Sbjct  633  AGAGATAGAGGTCTCAACTGAAATGGAATCGCTTTGC-ATCT  673

>PLHA:NW_020187168.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_247, whole genome shotgun sequence
Length=245403

 Score = 37.4 bits (40),  Expect = 5.5
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  45      CGGACGACGCCACCGTCGCG  64
               ||||||||||||||||||||
Sbjct  136818  CGGACGACGCCACCGTCGCG  136799

>PHRA:scaffold_26
Length=535347

 Score = 37.4 bits (40),  Expect = 5.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  299     AGGTTGCCAAGAAGGAGCAGAAGAA  323
               ||| ||||||||||||| |||||||
Sbjct  263298  AGGCTGCCAAGAAGGAGAAGAAGAA  263322

>PHKE:scaffold_25 scf_22126_25.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_25.1:1:190476:1 
REF
Length=190476

 Score = 37.4 bits (40),  Expect = 5.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  384     GAAACTCGCCAAAAAGTCCGACAGG  408
               ||||||||||||||| ||||| |||
Sbjct  161000  GAAACTCGCCAAAAAATCCGAGAGG  160976

>PHCA:scaffold_90 PHYCAscaffold_90
Length=152720

 Score = 37.4 bits (40),  Expect = 5.5
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  297    CGAGGTTGCCAAGAAGGAGCAGAAG  321
              |||| ||||||||||| ||||||||
Sbjct  13871  CGAGATTGCCAAGAAGAAGCAGAAG  13847

>APIN:scaffold_32 supercont1.32 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.32:1:740502:1 
REF
Length=740502

 Score = 37.4 bits (40),  Expect = 5.5
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  664     CGATCGAAAGCCCGACTGGCGCGGTACAGT  693
               ||||||||  | ||||||||||||| ||||
Sbjct  388889  CGATCGAAGTCGCGACTGGCGCGGTTCAGT  388918

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 965150116440

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2