Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
PHIF:NW_003303697.1432664435045238247640.0
PHPA:scaffold_63252618255026240929450.0
PHRA:scaffold_56147118149497239319280.0
PHCA:scaffold_84101906104281240618160.0
PHSO:scaffold_128015002803908241318110.0
PHKE:scaffold_986962771353173212460.0
PLHA:NW_020189861.118414041843048166311840.0
PYIR:scaffold_8985039978613062401e-53
PYUU:scaffold_2037131042313109375212231e-48
PYIW:scaffold_71113110138207201971e-41
PYAP:scaffold_16221875222643971531e-29
PYIW:scaffold_963120831217795956e-14
PYAR:scaffold_291324813371125774e-09
APIN:scaffold_2037930337940199583e-04
APAS:scaffold_1272932672938055550.004
SAPA:scaffold_24427728427834107540.004
PHRA:scaffold_3735575235578231520.014
PYVX:scaffold_132327637095500.050
PHPA:scaffold_61911784191181735460.60
PHPA:scaffold_164344593450549452.1
PHIF:NW_003303749.11521546152157530452.1
SADI:scaffold_4175179175285107442.1
PYIR:scaffold_7955366539227442.1
PYAR:scaffold_168178511788232442.1
PHIF:NW_003303743.12418893241892634442.1
PHIF:NW_003303734.116315016318334442.1
PHIF:NW_003303633.1448704490334442.1
PYVX:scaffold_10554062409233437.4
PYVX:scaffold_15970569709136437.4
PYAR:scaffold_25104614465441437.4
PYAP:scaffold_582137341376938437.4
PYAP:scaffold_110447804480829437.4
PLHA:NW_020187732.1496124966150437.4
PHSO:scaffold_82038239203827234437.4
PHPA:scaffold_1676854576858645437.4
PHKE:scaffold_7864518647424437.4
PHIF:NW_003303758.12447711244774434437.4
PHIF:NW_003303747.12313460231348829437.4
PHIF:NW_003303717.11007308100733629437.4
PHIF:NW_003303539.19935996329437.4
PHIF:NW_003303498.1530655309329437.4
HYAP:scaffold_253035938224437.4
APIN:scaffold_3717333117335929437.4
APIN:scaffold_12396397239643034437.4
SAPA:scaffold_3327623327626836427.4
PYUU:scaffold_202862208762211226427.4
PHRA:scaffold_5035920595842427.4
PHRA:scaffold_222589642427.4
PHKE:scaffold_3997412744231427.4
PHKE:scaffold_46619796200426427.4
PHIF:NW_003303745.1386903872439427.4
PHCA:scaffold_51452136145217238427.4
APIN:scaffold_51008172100819221427.4
APAS:scaffold_111091903109192826427.4
APAS:scaffold_11352148135217831427.4
BLASTN 2.9.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= PITG_18457

Length=3513
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 ge...  4296       0.0  
PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 ...  2656       0.0  
PHRA:scaffold_56                                                      1739       0.0  
PHCA:scaffold_84 PHYCAscaffold_84                                     1638       0.0  
PHSO:scaffold_1                                                       1634       0.0  
PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercon...  1124       0.0  
PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig:...  1068       0.0  
PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_sc...  217        1e-53
PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:p...  202        1e-48
PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:pi...  178        1e-41
PYAP:scaffold_162 pag1_scaffold_162 dna:supercontig supercontig:p...  139        1e-29
PYIW:scaffold_963 piw_scaffold_963 dna:supercontig supercontig:pi...  86.9       6e-14
PYAR:scaffold_29 par_scaffold_29 dna:supercontig supercontig:par_...  70.7       4e-09
APIN:scaffold_20 supercont1.20 dna:supercontig supercontig:Apha_i...  53.6       3e-04
APAS:scaffold_12 supercont1.12 dna:supercontig supercontig:Apha_a...  50.9       0.004
SAPA:scaffold_24 supercont2.24 dna:supercontig supercontig:ASM151...  50.0       0.004
PHRA:scaffold_37                                                      48.2       0.014
PYVX:scaffold_1323 pve_scaffold_1323 dna:supercontig supercontig:...  46.4       0.050
PHPA:scaffold_6 NW_008648992.1 Phytophthora parasitica INRA-310 u...  42.8       0.60 
PHPA:scaffold_164 NW_008649150.1 Phytophthora parasitica INRA-310...  41.9       2.1  
PHIF:NW_003303749.1 Phytophthora infestans T30-4 supercont1.10 ge...  41.9       2.1  
SADI:scaffold_4 supercont1.4 dna:supercontig supercontig:Sap_dicl...  41.0       2.1  
PYIR:scaffold_795 pir_scaffold_795 dna:supercontig supercontig:pi...  41.0       2.1  
PYAR:scaffold_168 par_scaffold_168 dna:supercontig supercontig:pa...  41.0       2.1  
PHIF:NW_003303743.1 Phytophthora infestans T30-4 supercont1.16 ge...  41.0       2.1  
PHIF:NW_003303734.1 Phytophthora infestans T30-4 supercont1.25 ge...  41.0       2.1  
PHIF:NW_003303633.1 Phytophthora infestans T30-4 supercont1.126 g...  41.0       2.1  
PYVX:scaffold_1055 pve_scaffold_1055 dna:supercontig supercontig:...  40.1       7.4  
PYVX:scaffold_15 pve_scaffold_15 dna:supercontig supercontig:pve_...  40.1       7.4  
PYAR:scaffold_2510 par_scaffold_2510 dna:supercontig supercontig:...  40.1       7.4  
PYAP:scaffold_582 pag1_scaffold_582 dna:supercontig supercontig:p...  40.1       7.4  
PYAP:scaffold_110 pag1_scaffold_110 dna:supercontig supercontig:p...  40.1       7.4  
PLHA:NW_020187732.1 Plasmopara halstedii genome assembly, contig:...  40.1       7.4  
PHSO:scaffold_8                                                       40.1       7.4  
PHPA:scaffold_16 NW_008649002.1 Phytophthora parasitica INRA-310 ...  40.1       7.4  
PHKE:scaffold_7 scf_22126_7.1 dna:supercontig supercontig:PhyKer2...  40.1       7.4  
PHIF:NW_003303758.1 Phytophthora infestans T30-4 supercont1.1 gen...  40.1       7.4  
PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 ge...  40.1       7.4  
PHIF:NW_003303717.1 Phytophthora infestans T30-4 supercont1.42 ge...  40.1       7.4  
PHIF:NW_003303539.1 Phytophthora infestans T30-4 supercont1.220 g...  40.1       7.4  
PHIF:NW_003303498.1 Phytophthora infestans T30-4 supercont1.261 g...  40.1       7.4  
HYAP:scaffold_2530 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold...  40.1       7.4  
APIN:scaffold_37 supercont1.37 dna:supercontig supercontig:Apha_i...  40.1       7.4  
APIN:scaffold_1 supercont1.1 dna:supercontig supercontig:Apha_inv...  40.1       7.4  
SAPA:scaffold_33 supercont2.33 dna:supercontig supercontig:ASM151...  39.2       7.4  
PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:p...  39.2       7.4  
PHRA:scaffold_503                                                     39.2       7.4  
PHRA:scaffold_222                                                     39.2       7.4  
PHKE:scaffold_399 scf_22126_399.1 dna:supercontig supercontig:Phy...  39.2       7.4  
PHKE:scaffold_46 scf_22126_46.1_contig_1 dna:supercontig supercon...  39.2       7.4  
PHIF:NW_003303745.1 Phytophthora infestans T30-4 supercont1.14 ge...  39.2       7.4  
PHCA:scaffold_5 PHYCAscaffold_5                                       39.2       7.4  
APIN:scaffold_5 supercont1.5 dna:supercontig supercontig:Apha_inv...  39.2       7.4  
APAS:scaffold_11 supercont1.11 dna:supercontig supercontig:Apha_a...  39.2       7.4  
APAS:scaffold_1 supercont1.1 dna:supercontig supercontig:Apha_ast...  39.2       7.4  

>PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 
genomic scaffold, whole genome shotgun sequence
Length=695754

 Score = 4296 bits (4764),  Expect = 0.0
 Identities = 2382/2382 (100%), Gaps = 0/2382 (0%)
 Strand=Plus/Plus

Query  410     AGCAATTTCGCAACAACAGCGTTGAGATTCGACAGTCTTTGCCTGAGCCGTGGGAACGGC  469
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432664  AGCAATTTCGCAACAACAGCGTTGAGATTCGACAGTCTTTGCCTGAGCCGTGGGAACGGC  432723

Query  470     ATTTTGGAATTCATCACGGTCGTCTCATGCGCaaaaaaaCTACGCAACACTGTCGTCTGT  529
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432724  ATTTTGGAATTCATCACGGTCGTCTCATGCGCAAAAAAACTACGCAACACTGTCGTCTGT  432783

Query  530     TGCCTAGTGTCAACAAAACTGATCCAAGCGTACCAACTCCTGAATTGCGCGAGGAGGATG  589
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432784  TGCCTAGTGTCAACAAAACTGATCCAAGCGTACCAACTCCTGAATTGCGCGAGGAGGATG  432843

Query  590     CCAAGCACGGCGTTTTGAACTTGGTCACGCGCGGGTTTCTCCCTGCGTACGCAGATCTGA  649
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432844  CCAAGCACGGCGTTTTGAACTTGGTCACGCGCGGGTTTCTCCCTGCGTACGCAGATCTGA  432903

Query  650     CTCCAGTCTTCAGTGGTACGAGCGATGGCTCTGGTGGTGGGGTGATGAAACAGCGTGCAA  709
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432904  CTCCAGTCTTCAGTGGTACGAGCGATGGCTCTGGTGGTGGGGTGATGAAACAGCGTGCAA  432963

Query  710     CCCGAATCTATAATCGCTCCGAACAAGTAGTTCGGTCGACTCCTTTTACTCAGTCCACAG  769
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432964  CCCGAATCTATAATCGCTCCGAACAAGTAGTTCGGTCGACTCCTTTTACTCAGTCCACAG  433023

Query  770     GCTATAATCTGGCATCATTGAAGTTCGATCTTCGAGCTCCACCAACGCCCCCACCTGTTG  829
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433024  GCTATAATCTGGCATCATTGAAGTTCGATCTTCGAGCTCCACCAACGCCCCCACCTGTTG  433083

Query  830     TGCCCGAAGCTACCTTTCCTGACAGTACAACCAGAAGACGAAGCACTAGGCGGAGTTCAG  889
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433084  TGCCCGAAGCTACCTTTCCTGACAGTACAACCAGAAGACGAAGCACTAGGCGGAGTTCAG  433143

Query  890     CTCTGCAAGGCCCCAACCCATTTACAAGGTCAGTACCGATATCTAGCAGTAAAATTAAGA  949
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433144  CTCTGCAAGGCCCCAACCCATTTACAAGGTCAGTACCGATATCTAGCAGTAAAATTAAGA  433203

Query  950     ATGGGAGGTCTGCCCATCCGACTTCGTTAATGTCGGCTGCAGTCGCTGCCTTCACGAACC  1009
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433204  ATGGGAGGTCTGCCCATCCGACTTCGTTAATGTCGGCTGCAGTCGCTGCCTTCACGAACC  433263

Query  1010    AGGGAGAGGATACGGAAAACAATAGAGACCGATTCAGTGACGACGACATCTCCGATGAGG  1069
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433264  AGGGAGAGGATACGGAAAACAATAGAGACCGATTCAGTGACGACGACATCTCCGATGAGG  433323

Query  1070    AGCAGGAAAGCGATGAAAATGACAAGGACGAATACGCCGAGATGGAGAAATTGGGGGCAA  1129
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433324  AGCAGGAAAGCGATGAAAATGACAAGGACGAATACGCCGAGATGGAGAAATTGGGGGCAA  433383

Query  1130    ATGTCGATAAAATTCGTGGTTACAACGAACTGCTGGATGTGTATAGTTTGCACCAGTTTC  1189
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433384  ATGTCGATAAAATTCGTGGTTACAACGAACTGCTGGATGTGTATAGTTTGCACCAGTTTC  433443

Query  1190    TGATTCACAAAGGACGGACCATGAGAGACACACCCGAGTTTGTTTCGTTCCGTCGCGTTA  1249
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433444  TGATTCACAAAGGACGGACCATGAGAGACACACCCGAGTTTGTTTCGTTCCGTCGCGTTA  433503

Query  1250    CACAGGAGCTTTGGGGCAGTGTAGAAGAGGCTCTGCGAGCGCTGGAGACTCTGCTCGCGC  1309
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433504  CACAGGAGCTTTGGGGCAGTGTAGAAGAGGCTCTGCGAGCGCTGGAGACTCTGCTCGCGC  433563

Query  1310    AGTATTTTGTACCTCTGGCTTACGTTGATGGCCAGCGACTGCTCGCACTCGCAGGTACAG  1369
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433564  AGTATTTTGTACCTCTGGCTTACGTTGATGGCCAGCGACTGCTCGCACTCGCAGGTACAG  433623

Query  1370    GCCAACCTCGATTCTCTAAGCGCGAACTGCTGTCCTGTATTGTGAATGAAGATCAAGTTA  1429
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433624  GCCAACCTCGATTCTCTAAGCGCGAACTGCTGTCCTGTATTGTGAATGAAGATCAAGTTA  433683

Query  1430    TGTCGGTACTGCGACGTCCAGGCCAACGGTATAAAGGGCGAGATCGTAAACGCCGTGCTG  1489
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433684  TGTCGGTACTGCGACGTCCAGGCCAACGGTATAAAGGGCGAGATCGTAAACGCCGTGCTG  433743

Query  1490    CTACTACAATCGAAGCTTGTGTTCGTATGTGGCTAGTCCGTCGGAGGTACGCTCGCACTC  1549
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433744  CTACTACAATCGAAGCTTGTGTTCGTATGTGGCTAGTCCGTCGGAGGTACGCTCGCACTC  433803

Query  1550    GTGCCAGCGACTTCAATGCGAGCAAAATTCAGCTTGCGTGGCGAGCCTACAGTTGCCATA  1609
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433804  GTGCCAGCGACTTCAATGCGAGCAAAATTCAGCTTGCGTGGCGAGCCTACAGTTGCCATA  433863

Query  1610    CAAGTCTCAAAGCTCGACTACGAGAAGTCCACCTAGAAAAACTCGAGAAATGGGAGAAAA  1669
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433864  CAAGTCTCAAAGCTCGACTACGAGAAGTCCACCTAGAAAAACTCGAGAAATGGGAGAAAA  433923

Query  1670    GGATGCACAATCTCAAGTCCCACTGGCCACAAATTGCTGGTCGCCGACGTGTTGTGGTCC  1729
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433924  GGATGCACAATCTCAAGTCCCACTGGCCACAAATTGCTGGTCGCCGACGTGTTGTGGTCC  433983

Query  1730    ACGTGCCGTCGTTATCGCTCGATGAACACTCACGTCTCGGTGCTGAGAACTTTGCCATAC  1789
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  433984  ACGTGCCGTCGTTATCGCTCGATGAACACTCACGTCTCGGTGCTGAGAACTTTGCCATAC  434043

Query  1790    AACAGAACCTCCAGCTGACGCGGGTATGCGCCGCTGCACTGGACTCTAACGTGGAACTGC  1849
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434044  AACAGAACCTCCAGCTGACGCGGGTATGCGCCGCTGCACTGGACTCTAACGTGGAACTGC  434103

Query  1850    TGCTTTATGTGTCGCCTTTCGAGCTCACATCGGATGTTTCTCAGTACTTCCTCAAACTGC  1909
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434104  TGCTTTATGTGTCGCCTTTCGAGCTCACATCGGATGTTTCTCAGTACTTCCTCAAACTGC  434163

Query  1910    TGCAACTTGGCGGTCTTGTTGACAGCAGACCTCGCGTCAAGTTAGTGTTTCCCGAGCAAA  1969
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434164  TGCAACTTGGCGGTCTTGTTGACAGCAGACCTCGCGTCAAGTTAGTGTTTCCCGAGCAAA  434223

Query  1970    CCACGCGCTTTCCAGCCCATTTCTCGCTGTCATCGTTGTTACTCTACTCGCCTCATTGTC  2029
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434224  CCACGCGCTTTCCAGCCCATTTCTCGCTGTCATCGTTGTTACTCTACTCGCCTCATTGTC  434283

Query  2030    TGCGGCGCATCCGACACTACACTACTGGCAAAGAGGCTTACCTTGTGATGGGGCTACCTG  2089
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434284  TGCGGCGCATCCGACACTACACTACTGGCAAAGAGGCTTACCTTGTGATGGGGCTACCTG  434343

Query  2090    GAGCTGAGGATCAACGACTAGCGATGGCGTTGGATCTGCCAATCCTCGGTGCGCCGCCAG  2149
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434344  GAGCTGAGGATCAACGACTAGCGATGGCGTTGGATCTGCCAATCCTCGGTGCGCCGCCAG  434403

Query  2150    CTCAAGCTCTGCCGCTGCTCACTCGCTCGGGTGGCAAGCGGTTGTTGATCCGAGCTGATG  2209
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434404  CTCAAGCTCTGCCGCTGCTCACTCGCTCGGGTGGCAAGCGGTTGTTGATCCGAGCTGATG  434463

Query  2210    TAAATGTCCCCAATGGTACTTACGAGCTGTACGATGAACATGAAGTCTGTGCAGCGCTCG  2269
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434464  TAAATGTCCCCAATGGTACTTACGAGCTGTACGATGAACATGAAGTCTGTGCAGCGCTCG  434523

Query  2270    CCAAGCTTGCTATCGCTCACATGGATCAACCGAGGTGGTTAATTAAGCTGGACTACGATC  2329
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434524  CCAAGCTTGCTATCGCTCACATGGATCAACCGAGGTGGTTAATTAAGCTGGACTACGATC  434583

Query  2330    CTCTTGATGTGGGCGAAGCGGTCGTTGACCTGTCAAACATGCAAGCGATGCGTGAGCTGC  2389
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434584  CTCTTGATGTGGGCGAAGCGGTCGTTGACCTGTCAAACATGCAAGCGATGCGTGAGCTGC  434643

Query  2390    GTCGAGAGAAGCGGACGCCCGAGTATTGGCGCCAACCAGGCCCTCGCGATGCAGCAGCAA  2449
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434644  GTCGAGAGAAGCGGACGCCCGAGTATTGGCGCCAACCAGGCCCTCGCGATGCAGCAGCAA  434703

Query  2450    AGCTGATTCTGGCAGAGCTAGAGCGTCCGGGAATGCTAGCGAGAATCGCGACTCCCATGC  2509
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434704  AGCTGATTCTGGCAGAGCTAGAGCGTCCGGGAATGCTAGCGAGAATCGCGACTCCCATGC  434763

Query  2510    AAACCGAAATATTCCCAAAATGGCGGGAGTTTATCGATGCCGTCGGCCATTTCGGCTGTG  2569
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434764  AAACCGAAATATTCCCAAAATGGCGGGAGTTTATCGATGCCGTCGGCCATTTCGGCTGTG  434823

Query  2570    TCGTTGAAGCTGTCCCTCCTACAGCCATTGCTGCCTCATCCGAGGCATCAACGGTGCTGG  2629
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434824  TCGTTGAAGCTGTCCCTCCTACAGCCATTGCTGCCTCATCCGAGGCATCAACGGTGCTGG  434883

Query  2630    TAGAGCCTGCCTACGTGCGCGCGAATCTGTTTGTAGACCCGGATGGCTCCGTACACATCT  2689
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434884  TAGAGCCTGCCTACGTGCGCGCGAATCTGTTTGTAGACCCGGATGGCTCCGTACACATCT  434943

Query  2690    CGTCGACGCAGAATGTGCTGGCAGCTGGAGGTGGGGGGCTGAATAGGAAAACTGTGGCGT  2749
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  434944  CGTCGACGCAGAATGTGCTGGCAGCTGGAGGTGGGGGGCTGAATAGGAAAACTGTGGCGT  435003

Query  2750    TCACGTTTCCTCAGACGGCTGCACCATATGAGGCAATTAAGG  2791
               ||||||||||||||||||||||||||||||||||||||||||
Sbjct  435004  TCACGTTTCCTCAGACGGCTGCACCATATGAGGCAATTAAGG  435045

 Score = 1308 bits (1450),  Expect = 0.0
 Identities = 725/725 (100%), Gaps = 0/725 (0%)
 Strand=Plus/Plus

Query  2789    AGGGTGCTTGCAACGCCGCGGGAAAGCTACTAGTAGAGACGAATGTCTGGGGTTACGTCA  2848
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  435104  AGGGTGCTTGCAACGCCGCGGGAAAGCTACTAGTAGAGACGAATGTCTGGGGTTACGTCA  435163

Query  2849    GCTTGGATTTCGTGGTCTTTCAGGATGAAAAGAGCAATGATGCACCTCGATTGTGGGCTC  2908
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  435164  GCTTGGATTTCGTGGTCTTTCAGGATGAAAAGAGCAATGATGCACCTCGATTGTGGGCTC  435223

Query  2909    TCGCTGTACATCCGTTCCTCACAGATTCCGCTACCAGCTTCGCTTGTTTCCACCTGCTCG  2968
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  435224  TCGCTGTACATCCGTTCCTCACAGATTCCGCTACCAGCTTCGCTTGTTTCCACCTGCTCG  435283

Query  2969    CTCGTGGTGTGTTAGATACGAATTCAGGTGTCTACCGAGTGGCCAACAAGTCACTGACTA  3028
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  435284  CTCGTGGTGTGTTAGATACGAATTCAGGTGTCTACCGAGTGGCCAACAAGTCACTGACTA  435343

Query  3029    CAGCCAATTCAGGACGAAAAAGCGAAAGTGGCAGCGCTACGGACTTGCTGCTGCGTGAAG  3088
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  435344  CAGCCAATTCAGGACGAAAAAGCGAAAGTGGCAGCGCTACGGACTTGCTGCTGCGTGAAG  435403

Query  3089    CTTTACTGGCCAAAAGTTCACTCGTAGGGGCTCGGCGTTGCTTCGTGGCGTGCTCGTACG  3148
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  435404  CTTTACTGGCCAAAAGTTCACTCGTAGGGGCTCGGCGTTGCTTCGTGGCGTGCTCGTACG  435463

Query  3149    TGTTCCACCCGCACGTGATCACTATGCAGTACACTGCTTTCTTCCACGCCTGCAGATTAC  3208
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  435464  TGTTCCACCCGCACGTGATCACTATGCAGTACACTGCTTTCTTCCACGCCTGCAGATTAC  435523

Query  3209    ACGGTGTGTGCTTTGACGTGGAGAGAACTCTAGGTACACTCTTCCTGCTCGCTGACAGTC  3268
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  435524  ACGGTGTGTGCTTTGACGTGGAGAGAACTCTAGGTACACTCTTCCTGCTCGCTGACAGTC  435583

Query  3269    TCACAGCTGGCGTCTTCGGTATCTTGAGTATTGGAGAAACCACAGAAGGAGCTCTGGCAT  3328
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  435584  TCACAGCTGGCGTCTTCGGTATCTTGAGTATTGGAGAAACCACAGAAGGAGCTCTGGCAT  435643

Query  3329    TTCTGCGGACTGCACTGGAAGTGATAGGCCGAGAAGCTGGCTCGACTATCAGTGTGGCTT  3388
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  435644  TTCTGCGGACTGCACTGGAAGTGATAGGCCGAGAAGCTGGCTCGACTATCAGTGTGGCTT  435703

Query  3389    CATCTCCATCTCGATCCGTTGCCTCTCGTAGTGGCAACTTTGCTCAGATTTTGTCTGCTA  3448
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  435704  CATCTCCATCTCGATCCGTTGCCTCTCGTAGTGGCAACTTTGCTCAGATTTTGTCTGCTA  435763

Query  3449    TTCGAGTGTCCACAGGCGGCGGCAAGAGCGACAGACTAGGGAAAATGCGGCAACGACAGC  3508
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  435764  TTCGAGTGTCCACAGGCGGCGGCAAGAGCGACAGACTAGGGAAAATGCGGCAACGACAGC  435823

Query  3509    GATAG  3513
               |||||
Sbjct  435824  GATAG  435828

 Score = 742 bits (822),  Expect = 0.0
 Identities = 411/411 (100%), Gaps = 0/411 (0%)
 Strand=Plus/Plus

Query  1       ATGGACAAGGTGCAGCAGCAACATCATGTGGAGGATGTGGGCCGGTTGTTGTTGCAGACA  60
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432171  ATGGACAAGGTGCAGCAGCAACATCATGTGGAGGATGTGGGCCGGTTGTTGTTGCAGACA  432230

Query  61      CAGGAGCAGCTTCGTGTGATGCGAGAGCAGATGACGGCAGCTGCAGCGGCCGTGGAGGCC  120
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432231  CAGGAGCAGCTTCGTGTGATGCGAGAGCAGATGACGGCAGCTGCAGCGGCCGTGGAGGCC  432290

Query  121     AATGCATCGCCAATGCGCCACAACGCAATTGTGACAACAGCCGAAGTCCAAGCTTTCAAC  180
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432291  AATGCATCGCCAATGCGCCACAACGCAATTGTGACAACAGCCGAAGTCCAAGCTTTCAAC  432350

Query  181     GCAATCTTGCAACAGACTGAGACAGAACTTCGGGCCAAAGCGGAACTTGTCCTCAATGGC  240
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432351  GCAATCTTGCAACAGACTGAGACAGAACTTCGGGCCAAAGCGGAACTTGTCCTCAATGGC  432410

Query  241     ATGGTTAACAGCAGTAGCAGTGCACGAAATAATCAGGCTCAGAGCGGCACTCTTCTTCCT  300
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432411  ATGGTTAACAGCAGTAGCAGTGCACGAAATAATCAGGCTCAGAGCGGCACTCTTCTTCCT  432470

Query  301     GCTGTCACGGTTGCCGCTGCTCCTTCGATCATGCACCGAAGTGGATACGATAAAGCTAAT  360
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432471  GCTGTCACGGTTGCCGCTGCTCCTTCGATCATGCACCGAAGTGGATACGATAAAGCTAAT  432530

Query  361     AAGCCACGACAAATGGACGCAAGCTCTATTCCCGTGGAATTCTTCCGAGAG  411
               |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  432531  AAGCCACGACAAATGGACGCAAGCTCTATTCCCGTGGAATTCTTCCGAGAG  432581

>PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.63, whole genome shotgun 
sequence
Length=342508

 Score = 2656 bits (2945),  Expect = 0.0
 Identities = 2033/2409 (84%), Gaps = 27/2409 (1%)
 Strand=Plus/Plus

Query  410     AGCAATTTCGCAACAACAGCGTTGAGATTCGACAGTCTTTG---------CCTGAGCCGT  460
               |||||||||| ||||  |||||||| ||||| |||||||||         |||||||| |
Sbjct  252618  AGCAATTTCGAAACAGTAGCGTTGAAATTCGCCAGTCTTTGATGCCGTCACCTGAGCCTT  252677

Query  461     GGGAACGGCATTTTGGAATTCATCACGGTCGTCTCATGCGCaaaaaaaCTACGCAACACT  520
               || |||| ||||| ||| |||||||||||||||||||||| || ||||| || |||||||
Sbjct  252678  GGCAACGACATTTCGGAGTTCATCACGGTCGTCTCATGCGTAAGAAAACCACTCAACACT  252737

Query  521     GTCGTCTGTTGCCTAGTGTCAACAAAACTGATCCAAGCGTACCAACTCCTGAATTGCGCG  580
               ||||||| ||||||||||||||||||  ||||||||||| |||  | || ||||||||||
Sbjct  252738  GTCGTCTATTGCCTAGTGTCAACAAAGTTGATCCAAGCGCACCGGCACCGGAATTGCGCG  252797

Query  581     AGGAGGATGCCAAGCACGGCGTTTTGAACTTGGTCACGCGCGGGTTTCTCCCTGCGTACG  640
               ||||||||||||||||||| ||||| ||||||||||| |||||||| |||||||| ||||
Sbjct  252798  AGGAGGATGCCAAGCACGGTGTTTTAAACTTGGTCACACGCGGGTTCCTCCCTGCATACG  252857

Query  641     CAGATCTGACTCCAGTCTTC---------AGTGGTACGAGCGATGGCTCTGGTGGTGGGG  691
               ||||||| ||||||| ||||         | |||||||||| |||||||| | |||||  
Sbjct  252858  CAGATCTAACTCCAGCCTTCGCAGGACCAAATGGTACGAGCAATGGCTCTTGCGGTGGAA  252917

Query  692     TGATGAAACAGCGTGCAACCCGAATCTATAATCGCTCCGAACAAGTAGTTCGGTCGACTC  751
               | ||||| || || || || ||||||||  | |||||||| |||| ||| ||||| ||||
Sbjct  252918  TTATGAAGCAACGAGCGACTCGAATCTACGACCGCTCCGAGCAAGCAGTGCGGTCTACTC  252977

Query  752     CTTTTACTCAGTCCACAGGCTATAATCTGGCATCATTGAAGTTCGATCTTCGAGCTCCAC  811
               ||||||| ||||| ||||| ||||| ||||||||| |||| ||||||||| | |||||||
Sbjct  252978  CTTTTACGCAGTCTACAGGGTATAACCTGGCATCACTGAAATTCGATCTTTGCGCTCCAC  253037

Query  812     CAACGCCCCCACCTGTTGTGCCCGAAGCTA----CCTT-----TCCTGACAGTACAACCA  862
               |||| |||||||||  | | || ||| |||    |||      |||||| || ||||| |
Sbjct  253038  CAACACCCCCACCTCCTATACCTGAATCTAAGGACCTGATGCCTCCTGAAAGCACAACAA  253097

Query  863     GAAGACGAAGCACTAGGCGGAGTTCAGCTCTGCAAGGCCCCAACCCATTTACAAGGTCAG  922
               |||||||||||   ||   |||||||||| | ||||||||||||| | |||| | |||  
Sbjct  253098  GAAGACGAAGCGTAAGAAAGAGTTCAGCTGTACAAGGCCCCAACCGAGTTACGATGTCGT  253157

Query  923     TACCGATATCTAGCAGTAAAATTAAGAATGGGAGGTCTGCCCATCCGACTTCGTTAATGT  982
               | |||| |||| |||  ||| | |||||| |  | ||||| ||||  |||||||||||||
Sbjct  253158  TCCCGAAATCTGGCAACAAAGTGAAGAATAGTCGATCTGCTCATCAAACTTCGTTAATGT  253217

Query  983     CGGCTGCAGTCGCTGCCTTCACGAACCAGGGAGAGGATACGGAAAACAATAGAGACCGAT  1042
               | ||||||||||||||||||||||||||||| || || | ||| ||||| |||| ||| |
Sbjct  253218  CAGCTGCAGTCGCTGCCTTCACGAACCAGGGCGAAGACATGGACAACAACAGAGGCCGTT  253277

Query  1043    TCAGTGACGACGACATCTCCGATGAGGAGCAGGAAAGCGATGAAAATGACAAGGACGAAT  1102
               |||||||||||||| |||| |||||||| ||||||| ||||||||||| |||||||||| 
Sbjct  253278  TCAGTGACGACGACGTCTCAGATGAGGATCAGGAAAACGATGAAAATGGCAAGGACGAAG  253337

Query  1103    ACGCCGAGATGGAGAAATTGGGGGCAAATGTCGATAAAATTCGTGGTTACAACGAACTGC  1162
               |||| ||||||||| || |||| ||||||||||||||||| |||||||||||||| ||| 
Sbjct  253338  ACGCTGAGATGGAGGAACTGGGCGCAAATGTCGATAAAATCCGTGGTTACAACGAGCTGT  253397

Query  1163    TGGATGTGTATAGTTTGCACCAGTTTCTGATTCACAAAGGACGGACCATGAGAGACACAC  1222
               |||||| |||||| || || |||||| |||||||||| ||||| |||||| |||||||||
Sbjct  253398  TGGATGCGTATAGCTTACATCAGTTTTTGATTCACAAGGGACGAACCATGCGAGACACAC  253457

Query  1223    CCGAGTTTGTTTCGTTCCGTCGCGTTACACAGGAGCTTTGGGGCAGTGTAGAAGAGGCTC  1282
               |||||||| |||||||||| |||||  |||| || |||||||| ||||| ||||| ||  
Sbjct  253458  CCGAGTTTATTTCGTTCCGCCGCGTGGCACAAGAACTTTGGGGTAGTGTCGAAGAAGCAT  253517

Query  1283    TGCGAGCGCTGGAGACTCTGCTCGCGCAGTATTTTGTACCTCTGGCTTACGTTGATGGCC  1342
               | |||||||||||| |||||||  | |||||||| || || |||||||| |||||||| |
Sbjct  253518  TACGAGCGCTGGAGGCTCTGCTGACCCAGTATTTCGTGCCACTGGCTTATGTTGATGGTC  253577

Query  1343    AGCGACTGCTCGCACTCGCAGGTACAGGCCAACCTCGATTCTCTAAGCGCGAACTGCTGT  1402
               | ||| |||| |||||||||||||| || || ||||||||||| || || |||||  | |
Sbjct  253578  AACGATTGCTAGCACTCGCAGGTACCGGTCAGCCTCGATTCTCCAAACGTGAACTTTTAT  253637

Query  1403    CCTGTATTGTGAATGAAGATCAAGTTATGTCGGTACTGCGACGTCCAGGCCAACGGTATA  1462
               |||| || ||||||||||| ||  ||||||| ||  |||||||||||||||| |||||||
Sbjct  253638  CCTGCATCGTGAATGAAGACCAGATTATGTCAGTGTTGCGACGTCCAGGCCAGCGGTATA  253697

Query  1463    AAGGGCGAGATCGTAAACGCCGTGCTGCTACTACAATCGAAGCTTGTGTTCGTATGTGGC  1522
               ||||| ||||||||||||||||||||||||||||| || |||| ||| | ||||||||| 
Sbjct  253698  AAGGGAGAGATCGTAAACGCCGTGCTGCTACTACAGTCCAAGCCTGTATCCGTATGTGGT  253757

Query  1523    TAGTCCGTCGGAGGTACGCTCGCACTCGTGCCAGCGACTTCAATGCGAGCAAAATTCAGC  1582
               ||||||||||| |||| ||  |  |||| ||||| ||| |||| |||| |||||||||||
Sbjct  253758  TAGTCCGTCGGCGGTATGCGAGATCTCGAGCCAGTGACATCAACGCGACCAAAATTCAGC  253817

Query  1583    TTGCGTGGCGAGCCTACAGTTGCCATACAAGTCTCAAAGCTCGACTACGAGAAGTCCACC  1642
               | ||||||||||| |||||||||||||||  ||||||| |||||||||||||||| |  |
Sbjct  253818  TAGCGTGGCGAGCTTACAGTTGCCATACAGCTCTCAAAACTCGACTACGAGAAGTTCGTC  253877

Query  1643    TAGAAAAACTCGAGAAATGGGAGAAAAGGATGCACAATCTCAAGTCCCACTGGCCACAAA  1702
                ||| |||||||||||||||||||||||||||  ||  || ||||| || ||| ||||||
Sbjct  253878  GAGAGAAACTCGAGAAATGGGAGAAAAGGATGTGCACCCTAAAGTCTCAGTGGTCACAAA  253937

Query  1703    TTGCTGGTCGCCGACGTGTTGTGGTCCACGTGCCGTCGTTATCGCTCGATGAACACTCAC  1762
               | || |  ||||| ||||||||||| ||||||||||||||||| || ||||| || |  |
Sbjct  253938  TCGCAGCACGCCGGCGTGTTGTGGTTCACGTGCCGTCGTTATCCCTTGATGAGCATTATC  253997

Query  1763    GTCTCGGTGCTGAGAACTTTGCCATACAACAGAACCTCCAGCTGACGCGGGTATGCGCCG  1822
               ||||  |||||||||| |||||| |||| ||||| || || || || || || ||||| |
Sbjct  253998  GTCTAAGTGCTGAGAATTTTGCCGTACAGCAGAATCTTCAACTTACTCGAGTGTGCGCTG  254057

Query  1823    CTGCACTGGACTCTAACGTGGAACTGCTGCTTTATGTGTCGCCTTTCGAGCTCACATCGG  1882
                |||||||||||| |||||||| |||||  | ||||||||||| |||||||||||| |||
Sbjct  254058  TTGCACTGGACTCGAACGTGGACCTGCTAGTGTATGTGTCGCCGTTCGAGCTCACAGCGG  254117

Query  1883    ATGTTTCTCAGTACTTCCTCAAACTGCTGCAACTTGGCGGTCTTGTTGACAGCAGACCTC  1942
               ||||||  ||||| ||||||||||||||||||||||| |||||||| |||||| ||||||
Sbjct  254118  ATGTTTTACAGTATTTCCTCAAACTGCTGCAACTTGGTGGTCTTGTGGACAGCGGACCTC  254177

Query  1943    GCGTCAAGTTAGTGTTTCCCGAGCAAACCACGCGCTTTCCAGCCCATTTCTCGCTGTCAT  2002
               | |||||||| || ||||| |||||| |||| || |||||||| ||||||||||| || |
Sbjct  254178  GTGTCAAGTTCGTTTTTCCAGAGCAATCCACACGTTTTCCAGCGCATTTCTCGCTCTCGT  254237

Query  2003    CGTTGTTACTCTACTCGCCTCATTGTCTGCGGCGCATCCGACACTACACTACTGGCAAAG  2062
               ||||| | |||||||||||||||||| |||| || |||||||||||||||||||||||||
Sbjct  254238  CGTTGCTTCTCTACTCGCCTCATTGTTTGCGACGAATCCGACACTACACTACTGGCAAAG  254297

Query  2063    AGGCTTACCTTGTGATGGGGCTACCTGGAGCTGAGGATCAACGACTAGCGATGGCGTTGG  2122
               | |||||||||||||||||||||||||| ||||| ||||||||||| ||||| ||  |||
Sbjct  254298  AAGCTTACCTTGTGATGGGGCTACCTGGTGCTGAAGATCAACGACTGGCGATTGCTCTGG  254357

Query  2123    ATCTGCCAATCCTCGGTGCGCCGCCAGCTCAAGCTCTGCCGCTGCTCACTCGCTCGGGTG  2182
               ||||||| ||||||||||| || |||||||||||||||||| ||||||||||||||||||
Sbjct  254358  ATCTGCCGATCCTCGGTGCCCCACCAGCTCAAGCTCTGCCGTTGCTCACTCGCTCGGGTG  254417

Query  2183    GCAAGCGGTTGTTGATCCGAGCTGATGTAAATGTCCCCAATGGTACTTACGAGCTGTACG  2242
               |||||||| | |||||||||||||||||||||||||||||||| || |||||| ||||||
Sbjct  254418  GCAAGCGGCTATTGATCCGAGCTGATGTAAATGTCCCCAATGGCACCTACGAGTTGTACG  254477

Query  2243    ATGAACATGAAGTCTGTGCAGCGCTCGCCAAGCTTGCTATCGCTCACATGGATCAACCGA  2302
               ||||||| ||| |||| |||||||| || || || |||||||||||||||||||||||||
Sbjct  254478  ATGAACACGAACTCTGCGCAGCGCTTGCTAAACTGGCTATCGCTCACATGGATCAACCGA  254537

Query  2303    GGTGGTTAATTAAGCTGGACTACGATCCTCTTGATGTGGGCGAAGCGGTCGTTGACCTGT  2362
                |||| | || ||||| ||||| ||||||||||  ||||||||||| |||||||| ||||
Sbjct  254538  AGTGGCTGATCAAGCTTGACTATGATCCTCTTGGAGTGGGCGAAGCAGTCGTTGATCTGT  254597

Query  2363    CAAACATGCAAGCGATGCGTGAGCTGCGTCGAGAGAAGCGGACGCCCGAGTATTGGCGCC  2422
               ||||||| ||||||||||| ||| ||||||||||||||||||| ||||||||||||||||
Sbjct  254598  CAAACATTCAAGCGATGCGAGAGTTGCGTCGAGAGAAGCGGACACCCGAGTATTGGCGCC  254657

Query  2423    AACCAGGCCCTCGCGATGCAGCAGCAAAGCTGATTCTGGCAGAGCTAGAGCGTCCGGGAA  2482
               |||| || ||||| |||||||| || ||| |||||||||| || |||||||||||||| |
Sbjct  254658  AACCGGGGCCTCGTGATGCAGCGGCGAAGATGATTCTGGCTGAACTAGAGCGTCCGGGGA  254717

Query  2483    TGCTAGCGAGAATCGCGACTCCCATGCAAACCGAAATATTCCCAAAATGGCGGGAGTTTA  2542
               ||||||||||| | ||| | ||||||||  ||||||| ||||||| |||||| || |  |
Sbjct  254718  TGCTAGCGAGACTTGCGGCGCCCATGCACTCCGAAATGTTCCCAACATGGCGAGACTACA  254777

Query  2543    TCGATGCCGTCGGCCATTTCGGCTGTGTCGTTGAAGCTGTCCCTCCTACAGCCATTGCTG  2602
               ||||||| |||||||||||||| |||||| |||||||||| || ||||||||||||||||
Sbjct  254778  TCGATGCTGTCGGCCATTTCGGTTGTGTCATTGAAGCTGTGCCCCCTACAGCCATTGCTG  254837

Query  2603    CCTCATCCGAGGCATCAACGGTGCTGGTAGAGCCTGCCTACGTGCGCGCGAATCTGTTTG  2662
               | ||  | ||||||||||| | |||||| || || || ||||| || || ||  ||||||
Sbjct  254838  CGTCTCCAGAGGCATCAACAGCGCTGGTGGAACCGGCTTACGTACGTGCAAACTTGTTTG  254897

Query  2663    TAGACCCGGATGGCTCCGTACACATCTCGTCGACGCAGAATGTGCTGGCAGCTGGAGGTG  2722
               | || |||||||||||||||||| || ||||||||||||||||||||||| |||||||||
Sbjct  254898  TTGATCCGGATGGCTCCGTACACGTCACGTCGACGCAGAATGTGCTGGCAACTGGAGGTG  254957

Query  2723    GGGGGCTGAATAGGAAAACTGTGGCGTTCACGTTTCCTCAGACGGCTGCACCATATGAGG  2782
               | ||||||||  |||| |||||||||||||||||||||||||| || |||||  ||||||
Sbjct  254958  GCGGGCTGAACCGGAAGACTGTGGCGTTCACGTTTCCTCAGACTGCAGCACCGCATGAGG  255017

Query  2783    CAATTAAGG  2791
               | |||||||
Sbjct  255018  CGATTAAGG  255026

 Score = 798 bits (884),  Expect = 0.0
 Identities = 612/724 (85%), Gaps = 6/724 (1%)
 Strand=Plus/Plus

Query  2789    AGGGTGCTTGCAACGCCGCGGGAAAGCTACTAGTAGAGACGAATGTCTGGGGTTACGTCA  2848
               ||||||| |||||||| || || ||| | ||||| ||||||||||||||||| |||||||
Sbjct  255093  AGGGTGCATGCAACGCTGCCGGGAAGTTGCTAGTGGAGACGAATGTCTGGGGCTACGTCA  255152

Query  2849    GCTTGGATTTCGTGGTCTTTCAGGATGAAAAGAGCAATGATGCACCTCGATTGTGGGCTC  2908
               | ||||| ||||||||||| ||||||||||||||||| | |||||| ||  | |||||||
Sbjct  255153  GTTTGGACTTCGTGGTCTTCCAGGATGAAAAGAGCAACGGTGCACCACGTCTATGGGCTC  255212

Query  2909    TCGCTGTACATCCGTTCCTCACAGATTCCGCTACCAGCTTCGCTTGTTTCCACCTGCTCG  2968
               |||| ||||| || |||||||||||||| ||| ||||||||||||| |||||| ||||||
Sbjct  255213  TCGCCGTACACCCTTTCCTCACAGATTCAGCTGCCAGCTTCGCTTGCTTCCACTTGCTCG  255272

Query  2969    CTCGTGGTGTGTTAGATACGAATTCAGGTGTCTACCGAGTGGCCAACAAGTCACTGACTA  3028
               |||| |||||||| ||||| |||||||||| ||| |||||||| | ||| |||||||| |
Sbjct  255273  CTCGCGGTGTGTTGGATACCAATTCAGGTGCCTATCGAGTGGCAAGCAAATCACTGACGA  255332

Query  3029    CAGCCAATTCAGGACGAAAAAGCGAAAGTGGCAGCGCTACGGACTTGCTGCTGCGTGAAG  3088
               ||| ||   | ||||| ||   || ||||||| || ||||||||||| || |||||||||
Sbjct  255333  CAGTCA---CCGGACGGAA---CGGAAGTGGCTGCACTACGGACTTGTTGTTGCGTGAAG  255386

Query  3089    CTTTACTGGCCAAAAGTTCACTCGTAGGGGCTCGGCGTTGCTTCGTGGCGTGCTCGTACG  3148
               ||| ||||||||||  ||| |||| ||| |||| ||| |||||||||| |||||||||||
Sbjct  255387  CTTCACTGGCCAAAGATTCGCTCGCAGGAGCTCCGCGGTGCTTCGTGGTGTGCTCGTACG  255446

Query  3149    TGTTCCACCCGCACGTGATCACTATGCAGTACACTGCTTTCTTCCACGCCTGCAGATTAC  3208
               ||||||| |||||||||| ||| ||||||||||| ||||||||||||||||| || ||||
Sbjct  255447  TGTTCCATCCGCACGTGACCACCATGCAGTACACAGCTTTCTTCCACGCCTGTAGGTTAC  255506

Query  3209    ACGGTGTGTGCTTTGACGTGGAGAGAACTCTAGGTACACTCTTCCTGCTCGCTGACAGTC  3268
               | || |||||||| |||||||||||||| ||||| ||||||||||||||||| || ||||
Sbjct  255507  ATGGCGTGTGCTTCGACGTGGAGAGAACACTAGGCACACTCTTCCTGCTCGCAGATAGTC  255566

Query  3269    TCACAGCTGGCGTCTTCGGTATCTTGAGTATTGGAGAAACCACAGAAGGAGCTCTGGCAT  3328
               ||||||| |||||||||||  ||||||| |||||||| || |  |||||||||||||| |
Sbjct  255567  TCACAGCAGGCGTCTTCGGCGTCTTGAGCATTGGAGAGACTATGGAAGGAGCTCTGGCGT  255626

Query  3329    TTCTGCGGACTGCACTGGAAGTGATAGGCCGAGAAGCTGGCTCGACTATCAGTGTGGCTT  3388
               | ||||| || ||||||||||| || || ||||||||||||||||||||||   ||| ||
Sbjct  255627  TCCTGCGTACAGCACTGGAAGTTATCGGTCGAGAAGCTGGCTCGACTATCAACATGGTTT  255686

Query  3389    CATCTCCATCTCGATCCGTTGCCTCTCGTAGTGGCAACTTTGCTCAGATTTTGTCTGCTA  3448
               | |||||||| ||| ||||  |    |||||||| ||||| || ||| | ||||||||| 
Sbjct  255687  CGTCTCCATCCCGACCCGTATCAGGGCGTAGTGGTAACTTCGCCCAGGTGTTGTCTGCTG  255746

Query  3449    TTCGAGTGTCCACAGGCGGCGGCAAGAGCGACAGACTAGGGAAAATGCGGCAACGACAGC  3508
               | ||||  || |||||||||||||||||||||||||| |||||||||| || |||||  |
Sbjct  255747  TCCGAGCATCTACAGGCGGCGGCAAGAGCGACAGACTTGGGAAAATGCAGCGACGACGCC  255806

Query  3509    GATA  3512
               ||||
Sbjct  255807  GATA  255810

 Score = 494 bits (547),  Expect = 1e-136
 Identities = 356/411 (87%), Gaps = 0/411 (0%)
 Strand=Plus/Plus

Query  1       ATGGACAAGGTGCAGCAGCAACATCATGTGGAGGATGTGGGCCGGTTGTTGTTGCAGACA  60
               ||||| |||||||||||||| || |||||||| |||||||| |||||| |||||||||||
Sbjct  252143  ATGGAGAAGGTGCAGCAGCAGCAGCATGTGGAAGATGTGGGGCGGTTGCTGTTGCAGACA  252202

Query  61      CAGGAGCAGCTTCGTGTGATGCGAGAGCAGATGACGGCAGCTGCAGCGGCCGTGGAGGCC  120
               ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct  252203  CAGGAGCAGCTTCGTGTAATGCGAGAGCAGATGACGGCAGCTGCAGCGGCAGTGGAGGCC  252262

Query  121     AATGCATCGCCAATGCGCCACAACGCAATTGTGACAACAGCCGAAGTCCAAGCTTTCAAC  180
               ||||||||||||||||| ||||  || || ||||||||||| || || || |||||||||
Sbjct  252263  AATGCATCGCCAATGCGTCACAGTGCTATAGTGACAACAGCTGAGGTGCAGGCTTTCAAC  252322

Query  181     GCAATCTTGCAACAGACTGAGACAGAACTTCGGGCCAAAGCGGAACTTGTCCTCAATGGC  240
               || ||  |||| ||||| ||||| || |||||  ||||||||||||| || |||||||| 
Sbjct  252323  GCGATTCTGCAGCAGACGGAGACGGAGCTTCGCTCCAAAGCGGAACTCGTGCTCAATGGA  252382

Query  241     ATGGTTAACAGCAGTAGCAGTGCACGAAATAATCAGGCTCAGAGCGGCACTCTTCTTCCT  300
               ||||| |||||||||| || ||||| ||| |||||| ||||||| || | | ||||||||
Sbjct  252383  ATGGTCAACAGCAGTAACAATGCACAAAACAATCAGACTCAGAGTGGAAATTTTCTTCCT  252442

Query  301     GCTGTCACGGTTGCCGCTGCTCCTTCGATCATGCACCGAAGTGGATACGATAAAGCTAAT  360
               |||||||||||||| |||   || |||| || |||||||||||||||| ||  |||||||
Sbjct  252443  GCTGTCACGGTTGCTGCTCTGCCGTCGACCAAGCACCGAAGTGGATACAATGGAGCTAAT  252502

Query  361     AAGCCACGACAAATGGACGCAAGCTCTATTCCCGTGGAATTCTTCCGAGAG  411
               |||||  ||||||||||||||||||| |||||  |||||||||| ||||||
Sbjct  252503  AAGCCTAGACAAATGGACGCAAGCTCGATTCCTATGGAATTCTTTCGAGAG  252553

>PHRA:scaffold_56
Length=334739

 Score = 1739 bits (1928),  Expect = 0.0
 Identities = 1822/2393 (76%), Gaps = 32/2393 (1%)
 Strand=Plus/Minus

Query  410     AGCAATTTCGCAACAACAGCGTTGAGATTCGACAGTCTTTG---------CCTGAGCCGT  460
               |||||||||  |||| |||||| ||| |||| |||||  ||         ||  |||  |
Sbjct  149497  AGCAATTTCATAACAGCAGCGTCGAGGTTCGGCAGTCGCTGATGCCGTCGCCGCAGCATT  149438

Query  461     GGGAACGGCATTTTGGAATTCATCACGGTCGTCTCATGCGCaaaaaaaCTACGCAACACT  520
               || |||| ||| | ||||| || ||||| || ||| |||| || ||||| || || ||||
Sbjct  149437  GGCAACGACATCTCGGAATCCAGCACGGACGCCTCCTGCGTAAGAAAACCACACAGCACT  149378

Query  521     GTCGTCTGTTGCCTAGTGTCAACAAAACTGATCCAAGCGTACCAACTCCTGAATTGCGCG  580
               |||| ||  |||| ||||||||||||   || || |  |  ||||| || ||  ||||||
Sbjct  149377  GTCGCCTCCTGCCCAGTGTCAACAAAGTCGACCCCACTGCGCCAACACCCGAGCTGCGCG  149318

Query  581     AGGAGGATGCCAAGCACGGCGTTTTGAACTTGGTCACGCGCGGGTTTCTCCCTGCGTACG  640
               | |||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||
Sbjct  149317  AAGAGGATGCCAAGCACGGCGTTTTGAACTTGGTCACGCGTGGGTTTCTGCCTGCGTACG  149258

Query  641     CAGATCTGACTCCAGTCTTC---------AGTGGTACGAGCGATGGCTCTGGTGGTGGGG  691
               |||||||||| ||||  ||          ||||| ||||  |||||||| ||      ||
Sbjct  149257  CAGATCTGACACCAGCGTTTGCAGGGTCAAGTGGCACGAAAGATGGCTCCGG------GG  149204

Query  692     TGATGAAACAGCGTGCAACCCGAATCTATAATCGCTCCGAACAAGTAGTTCGGTCGACTC  751
               | ||||| ||||| || || || |||||  |||| ||||| |||   | |||| | || |
Sbjct  149203  TTATGAAGCAGCGCGCGACTCGGATCTACGATCGGTCCGAGCAACCGGCTCGGGCTACAC  149144

Query  752     CTTTTACTCAGTCCACAGGCTATAATCTGGCATCATTGAAGTTCGATCTTCGAGCTCCAC  811
               | ||||| || || ||||||||||| || ||| || | ||||||||||| || || || |
Sbjct  149143  CATTTACGCAATCGACAGGCTATAACCTCGCAGCACTCAAGTTCGATCTCCGTGCGCCTC  149084

Query  812     CAACGCCCCCACCTGTTGTGCCCGAAGCTACCTTTCCTGACAGTACAACCAGAAGACGAA  871
               ||||||| || ||   || |||||||||| |   ||    |||  | || || |||||||
Sbjct  149083  CAACGCCTCCGCCACCTGCGCCCGAAGCTGC---TCGGACCAGCTCCACAAGGAGACGAA  149027

Query  872     GCACTAGGCGGAGTTCAGCTCTGCAAGGCCCCAACCCATTTACAAGGTCAGTACCGATAT  931
               |  | |||||  |||| ||  | ||||||||||||    | |  | |||  | ||   ||
Sbjct  149026  GTTCAAGGCGAGGTTCGGCAATCCAAGGCCCCAACAAGGTAATCATGTCTTTCCCAGGAT  148967

Query  932     CTAGCAGTAAAATTAAGAATGGGAGGTCTGCCCATCCGACTTCGTTAATGTCGGCTGCAG  991
               |||   | |     |||||||   | || |  | || || |||| |  | || |||||  
Sbjct  148966  CTACTGGGACTGGCAAGAATGACCGATCGGTGCGTCAGAATTCGCTCGTTTCAGCTGCGA  148907

Query  992     TCGCTGCCTTCACGAACCAGGGAGAGGATACGGAAAACAATAGAGACCGATTCAGTGACG  1051
               | ||||||||||||||||||   || || | |||   ||| || || |   ||   ||||
Sbjct  148906  TAGCTGCCTTCACGAACCAGAACGACGACATGGAGGGCAACAGGGAGCATATC---GACG  148850

Query  1052    ACGACATCTCCGATGAGGAGCAGGAAAGCGATGAAAATGACAAGGACGAATACGCCGAGA  1111
                ||| || || || ||||| || |   ||| ||| || |||||||||||| | ||||| |
Sbjct  148849  GCGAAATATCTGACGAGGACCAAGGTGGCGCTGATAACGACAAGGACGAAGAAGCCGAAA  148790

Query  1112    TGGAGAAATTGGGGGCAAATGTCGATAAAATTCGTGGTTACAACGAACTGCTGGATGTGT  1171
               ||||| |  |||| || || ||||| || || ||||| |||||||| |||||||||| ||
Sbjct  148789  TGGAGGAGCTGGGCGCTAACGTCGACAAGATCCGTGGCTACAACGATCTGCTGGATGCGT  148730

Query  1172    ATAGTTTGCACCAGTTTCTGATTCACAAAGGACGGACCATGAGAGACACACCCGAGTTTG  1231
               | || |||||||||||| |||||||||| |||||  | ||||||||||| |||||||| |
Sbjct  148729  ACAGCTTGCACCAGTTTTTGATTCACAAGGGACGTTCAATGAGAGACACCCCCGAGTTCG  148670

Query  1232    TTTCGTTCCGTCGCGTTACACAGGAGCTTTGGGGCAGTGTAGAAGAGGCTCTGCGAGCGC  1291
               | ||||||||  | ||| | |||||||| ||||| ||||| ||||||||||| || ||  
Sbjct  148669  TGTCGTTCCGGAGGGTTGCGCAGGAGCTATGGGGGAGTGTTGAAGAGGCTCTACGGGCAT  148610

Query  1292    TGGAGACTCTGCTCGCGCAGTATTTTGTACCTCTGGCTTACGTTGATGGCCAGCGACTGC  1351
               ||||||| || ||| ||||||||||||| |||||||||||||||||||| |||||  |||
Sbjct  148609  TGGAGACACTACTCACGCAGTATTTTGTGCCTCTGGCTTACGTTGATGGGCAGCGGTTGC  148550

Query  1352    TCGCACTCGCAGGTACAGGCCAACCTCGATTCTCTAAGCGCGAACTGCTGTCCTGTATTG  1411
               |  |||||||||  ||||| ||||||||||| || ||  |||| |||||  | || || |
Sbjct  148549  TATCACTCGCAGCCACAGGGCAACCTCGATTTTCCAAAAGCGAGCTGCTAGCTTGCATCG  148490

Query  1412    TGAATGAAGATCAAGTTATGTCGGTACTGCGACGTCCAGGCCAACGGTATAAAGGGCGAG  1471
               |||| ||||| || || ||||| ||| |||| ||||||||||| || ||||||||| |||
Sbjct  148489  TGAACGAAGAGCAGGTGATGTCAGTATTGCGTCGTCCAGGCCAGCGATATAAAGGGAGAG  148430

Query  1472    ATCGTAAACGCCGTGCTGCTACTACAATCGAAGCTTGTGTTCGTATGTGGCTAGTCCGTC  1531
               |||| || ||||||||||| || |||||  |||||||||| || ||||||  | |||| |
Sbjct  148429  ATCGCAAGCGCCGTGCTGCCACGACAATTCAAGCTTGTGTGCGAATGTGGTCAATCCGCC  148370

Query  1532    GGAGGTACGCTCGCACTCGTGCCAGCGACTTCAATGCGAGCAAAATTCAGCTTGCGTGGC  1591
               || ||||||  ||  | |||||||||||| ||| ||| |  | |||||||||||| ||||
Sbjct  148369  GGCGGTACGTCCGATCGCGTGCCAGCGACATCAGTGCTACGAGAATTCAGCTTGCTTGGC  148310

Query  1592    GAGCCTACAGTTGCCATACAAGTCTCAAAGCTCGACTACGAGAAGTCCACCTAGAAAAAC  1651
               |  | || ||||||||| ||   |||||| ||||  | ||||| || |  | |||  | |
Sbjct  148309  GCTCTTATAGTTGCCATGCAGCACTCAAAACTCGTTTGCGAGAGGTTCGTCGAGAGCAGC  148250

Query  1652    TCGAGAAATGGGAGAAAAGGATGCACAATCTCAAGTCCCACTGGCCACAAATTGCTGGTC  1711
               ||||||  |||||     |||||||  | || |   | || ||||| |||||||| || |
Sbjct  148249  TCGAGAGGTGGGAAGCTCGGATGCAGGACCTGAGAACGCAATGGCCTCAAATTGCAGGGC  148190

Query  1712    GCCGACGTGTTGTGGTCCACGTGCCGTCGTTATCGCTCGATGAACACTCACGTCTCGGTG  1771
               | |||||||| || || || ||||||||||||||||||||||||||||| || ||| |||
Sbjct  148189  GTCGACGTGTGGTCGTGCATGTGCCGTCGTTATCGCTCGATGAACACTCCCGCCTCAGTG  148130

Query  1772    CTGAGAACTTTGCCATACAACAGAACCTCCAGCTGACGCGGGTATGCGCCGCTGCACTGG  1831
               |||||||||| ||| | || |||||||| || || |||||| |||| || || || ||||
Sbjct  148129  CTGAGAACTTCGCCGTGCAGCAGAACCTTCAACTTACGCGGATATGTGCTGCAGCGCTGG  148070

Query  1832    ACTCTAACGTGGAACTGCTGCTTTATGTGTCGCCTTTCGAGCTCACATCGGATGTTTCTC  1891
               ||||  | || || |||||  | |||||||| || |||||||||||  | ||||| || |
Sbjct  148069  ACTCGCATGTTGATCTGCTAGTCTATGTGTCTCCGTTCGAGCTCACGGCTGATGTCTCGC  148010

Query  1892    AGTACTTCCTCAAACTGCTGCAACTTGGCGGTCTTGTTGACAGCAGACCTCGCGTCAAGT  1951
               ||||||||||||||||||| || |||||||| |||| ||||||  | ||||| || ||| 
Sbjct  148009  AGTACTTCCTCAAACTGCTTCAGCTTGGCGGACTTGCTGACAGTCGGCCTCGTGTGAAGC  147950

Query  1952    TAGTGTTTCCCGAGCAAACCACGCGCTTTCCAGCCCATTTCTCGCTGTCATCGTTGTTAC  2011
               | || || ||||||||| |  ||||||| || | ||| ||||| ||||| || ||| | |
Sbjct  147949  TTGTCTTCCCCGAGCAAGCTGCGCGCTTCCCGGACCACTTCTCTCTGTCGTCATTGCTGC  147890

Query  2012    TCTACTCGCCTCATTGTCTGCGGCGCATCCGACACTACACTACTGGCAAAGAGGCTTACC  2071
               ||||||||||||| ||||||||||| || || || |||||| |||||||||| |||||||
Sbjct  147889  TCTACTCGCCTCACTGTCTGCGGCGGATTCGGCATTACACTGCTGGCAAAGAAGCTTACC  147830

Query  2072    TTGTGATGGGGCTACCTGGAGCTGAGGATCAACGACTAGCGATGGCGTTGGATCTGCCAA  2131
               | ||||||||| | || || ||||| || |||||||||||| | ||| |||||||||| |
Sbjct  147829  TCGTGATGGGGTTGCCCGGTGCTGAAGACCAACGACTAGCGGTTGCGCTGGATCTGCCGA  147770

Query  2132    TCCTCGGTGCGCCGCCAGCTCAAGCTCTGCCGCTGCTCACTCGCTCGGGTGGCAAGCGGT  2191
               |||| |||||||| ||||||||||| || ||||| ||||||||||| || |||||| || 
Sbjct  147769  TCCTGGGTGCGCCACCAGCTCAAGCCCTACCGCTTCTCACTCGCTCCGGAGGCAAGAGGC  147710

Query  2192    TGTTGATCCGAGCTGATGTAAATGTCCCCAATGGTACTTACGAGCTGTACGATGAACATG  2251
               || |||| || || ||||| || || ||||  || || |||||||||||||| || || |
Sbjct  147709  TGCTGATACGCGCCGATGTGAACGTTCCCACGGGCACCTACGAGCTGTACGACGAGCACG  147650

Query  2252    AAGTCTGTGCAGCGCTCGCCAAGCTTGCTATCGCTCACATGGATCAACCGAGGTGGTTAA  2311
               |  | | ||||||||||||||| || ||| |||| |||||||| || || | |||| || 
Sbjct  147649  AGCTTTTTGCAGCGCTCGCCAAACTCGCTGTCGCACACATGGAGCAGCCAAAGTGGCTAC  147590

Query  2312    TTAAGCTGGACTACGATCCTCTTGATGTGGGCGAAGCGGTCGTTGACCTGTCAAACATGC  2371
               | ||||| |||||||| ||||||| | | || ||||| || |||||||||||    ||||
Sbjct  147589  TGAAGCTCGACTACGACCCTCTTGGTATCGGTGAAGCTGTGGTTGACCTGTCGGGAATGC  147530

Query  2372    AAGCGATGCGTGAGCTGCGTCGAGAGAAGCGGACGCCCGAGTATTGGCGCCAACCAGGCC  2431
               |||||||||| ||||| || || || ||||||||||| ||||| ||||| ||||| || |
Sbjct  147529  AAGCGATGCGGGAGCTACGGCGCGAAAAGCGGACGCCAGAGTACTGGCGACAACCGGGAC  147470

Query  2432    CTCGCGATGCAGCAGCAAAGCTGATTCTGGCAGAGCTAGAGCGTCCGGGAATGCTAGCGA  2491
               |||| || || || || |||||  | || |||||||| |||||||||||  |||||||  
Sbjct  147469  CTCGTGACGCTGCCGCTAAGCTCGTGCTAGCAGAGCTGGAGCGTCCGGGTGTGCTAGCTC  147410

Query  2492    GAATCGCGACTCCCATGCAAACCGAAATATTCCCAAAATGGCGGGAGTTTATCGATGCCG  2551
               |  | || || |||||||| |||||||| |||||    ||||| || || |  || ||  
Sbjct  147409  GGCTTGCAACGCCCATGCATACCGAAATCTTCCCTGCGTGGCGTGACTTCACAGAGGCTA  147350

Query  2552    TCGGCCATTTCGGCTGTGTCGTTGAAGCTGTCCCTCCTACAGCCATTGCTGCCTCATCCG  2611
               |||||||||||||||| ||| | ||||| || |||||  | |  || || ||| |  | |
Sbjct  147349  TCGGCCATTTCGGCTGCGTCATCGAAGCCGTTCCTCCAGCGGGTATCGCAGCCACGCCAG  147290

Query  2612    AGGCATCAACGGTGCTGGTAGAGCCTGCCTACGTGCGCGCGAATCTGTTTGTAGACCCGG  2671
               || | ||||   |||| || |||||||||||||||||||| ||  |||||||  | ||||
Sbjct  147289  AGTCTTCAAGCTTGCTCGTGGAGCCTGCCTACGTGCGCGCAAACTTGTTTGTCTATCCGG  147230

Query  2672    ATGGCTCCGTACACATCTCGTCGACGCAGAATGTGCTGGC-AGCTGGAGGTGGGGGGCTG  2730
               | |||   ||  | ||| | |||||||||||||| ||||| ||| |  || || || |||
Sbjct  147229  ACGGCAAGGTGTATATCACTTCGACGCAGAATGTCCTGGCGAGCAGT-GGCGGCGGACTG  147171

Query  2731    AATAGGAAAACTGTGGCGTTCACGTTTCCTCAGACGGCTGCACCATATGAGGC  2783
               ||  | || || ||||||||||| ||||| ||||| || || ||  | |||||
Sbjct  147170  AACCGCAAGACCGTGGCGTTCACATTTCCGCAGACAGCGGCCCCGCACGAGGC  147118

 Score = 489 bits (541),  Expect = 5e-135
 Identities = 549/730 (75%), Gaps = 16/730 (2%)
 Strand=Plus/Minus

Query  2789    AGGGTGCTTGCAACGCCGCGGGAAAGCTACTAGTAGAGACGAATGTCTGGGGTTACGTCA  2848
               ||||||| ||| | ||  |||| || || ||||| |||||||  || ||||| ||||| |
Sbjct  147047  AGGGTGCGTGCGATGCAACGGGGAAACTGCTAGTGGAGACGAGCGTGTGGGGCTACGTGA  146988

Query  2849    GCTTGGATTTCGTGGTCTTTCAGGATGAAAAGAGCAATGATGCAC--CTCGATTGTGGGC  2906
               | ||||| || || || || |||||||||||||  |  || || |  | || ||||||||
Sbjct  146987  GTTTGGACTTTGTCGTTTTCCAGGATGAAAAGA--ATGGAGGCTCGCCGCGGTTGTGGGC  146930

Query  2907    TCTCGCTGTACATCCGTTCCTCACAGATTCCGCTACCAGCTTCGCTTGTTTCCACCTGCT  2966
                || ||||| || || || ||||| || || ||| ||||||| || || |||||||||||
Sbjct  146929  GCTAGCTGTGCACCCATTTCTCACGGACTCGGCTGCCAGCTTTGCCTGCTTCCACCTGCT  146870

Query  2967    CGCTCGTGGTGTGTTAGATACGAATTCAGGTGTCTACCGAGTGGC--CAAC-AAGTCACT  3023
               |||||| ||||   | ||  |||||||||| | ||||||||||||  |  | || ||  |
Sbjct  146869  CGCTCGAGGTGCACTGGACGCGAATTCAGGCGCCTACCGAGTGGCTGCTTCGAACTCGAT  146810

Query  3024    GACTACAGCCAATTCAGGACGAAAAAGCGAAAGTGGCAGCGCTACGGACTTGCTGCTGCG  3083
               |   |  |||||| ||||||| |   | | ||||||| | ||| | ||  ||||||| ||
Sbjct  146809  GGTCAATGCCAATCCAGGACGGA---GTGGAAGTGGCGGGGCTGCAGATCTGCTGCTACG  146753

Query  3084    TGAAGCTTTACTGGCCAAAAGTTCACTCGTAGGGGCTCGGCGTTGCTTCGTGGCGTGCTC  3143
                ||||| |   || | |||    | ||||  || || |  || ||||| |||| ||||||
Sbjct  146752  CGAAGCCTCCTTGACGAAAGCGGCGCTCGCTGGAGCCCCTCGCTGCTTTGTGGTGTGCTC  146693

Query  3144    GTACGTGTTCCACCCGCACGTGATCACTATGCAGTACACTGCTTTCTTCCACGCCTGCAG  3203
               ||||||||||||||||||||||| ||| ||||||||| |||| || |||||||| ||| |
Sbjct  146692  GTACGTGTTCCACCCGCACGTGACCACGATGCAGTACTCTGCCTTTTTCCACGCTTGCCG  146633

Query  3204    ATTACACGGTGTGTGCTTTGACGTGGAGAGAACTCTAGGTACACTCTTCCTGCTCGCTGA  3263
                 | ||||| ||||| |||||||||||| | ||  | ||||| |||||||||||||| ||
Sbjct  146632  GCTGCACGGCGTGTGTTTTGACGTGGAGCGTACGTTGGGTACGCTCTTCCTGCTCGCCGA  146573

Query  3264    CAGTCTCACAGCTGGCGTCTTCGGTATCTTGAGTATTGGAGAAACCACAGAAGGAGCTCT  3323
               ||||||||| ||||| |||||||| ||||||||  |||| || || || ||||| ||  |
Sbjct  146572  CAGTCTCACTGCTGGAGTCTTCGGCATCTTGAGCGTTGGCGAGACGACTGAAGGTGCATT  146513

Query  3324    GGCATTTCTGCGGACTGCACTGGAAGTGATAGGCCGAGAAGCTGGCTCGACTATCAGTGT  3383
               ||| || ||||| |||||||| || ||||| ||||| || |  ||| ||||||||    |
Sbjct  146512  GGCGTTCCTGCGCACTGCACTCGAGGTGATTGGCCGCGAGGTCGGCGCGACTATCGAGAT  146453

Query  3384    GGCTTCATCTCCATCTCGATCCGTTGCCTCTCGTAGTGGCAACTTTGCTCAGATTTTGTC  3443
               ||      || |||||||| ||||  |  |||| | ||| |||||||| ||| |  ||||
Sbjct  146452  GG------CTACATCTCGACCCGTCTCAACTCGCAATGGGAACTTTGCGCAGGTGCTGTC  146399

Query  3444    TGCTATTCGAGTGTCCACAGGCGGCGGCAAGAGCGACAGACTAGGGAAAATGCGGCAACG  3503
               |||| |||||| |||||| ||||| |||||  | ||||| || || || |||||||  | 
Sbjct  146398  TGCTGTTCGAGCGTCCACCGGCGGTGGCAAAGGAGACAGGCTCGGCAAGATGCGGCGGCT  146339

Query  3504    ACAGCGATAG  3513
                | |||||||
Sbjct  146338  GCGGCGATAG  146329

 Score = 365 bits (404),  Expect = 4e-98
 Identities = 333/420 (79%), Gaps = 9/420 (2%)
 Strand=Plus/Minus

Query  1       ATGGACAAGGTGCAGCAGCAACATCATGTGGAGGATGTGGGCCGGTTGTTGTTGCAGACA  60
               ||||| ||||||||||||||||||||||| || |||||||| ||  || || | ||||| 
Sbjct  150004  ATGGAGAAGGTGCAGCAGCAACATCATGTAGAAGATGTGGGGCGACTGCTGCTACAGACG  149945

Query  61      CAGGAGCAGCTTCGTGTGATGCGAGAGCAGATGACGGCAGCTGCAGCGGCCGTGGAGGCC  120
               |||||||| || ||||| |||||||||||||||||||| |||||||||||||| ||||||
Sbjct  149944  CAGGAGCAACTGCGTGTCATGCGAGAGCAGATGACGGCGGCTGCAGCGGCCGTAGAGGCC  149885

Query  121     AATGCATCGCCAATGCGCCACAACGCAATTGTGACAACAGCCGAAGTCCAAGCTTTCAAC  180
               || || ||||||||||| |||| |||| | || || || || ||||| || |||||||| 
Sbjct  149884  AACGCGTCGCCAATGCGGCACAGCGCAGTGGTAACCACGGCTGAAGTGCAGGCTTTCAAT  149825

Query  181     GCAATCTTGCAACAGACTGAGACAGAACTTCGGGCCAAAGCGGAACTTGTCCTCAATGGC  240
               || ||| | || |||||||||   || || || |||||||| ||||| || ||||| |||
Sbjct  149824  GCCATCCTACAGCAGACTGAGGTGGAGCTGCGCGCCAAAGCAGAACTCGTGCTCAAGGGC  149765

Query  241     ATGGTTAACAGCAGTAGCAGTGCACGAAATAATCAGGCTCAGAGCGGCACTCTTCTTCCT  300
               ||||| |||||||| |||||||| | ||  ||||||  ||| |||||||| |||||||||
Sbjct  149764  ATGGTAAACAGCAGCAGCAGTGCTCAAACCAATCAGAGTCAAAGCGGCACACTTCTTCCT  149705

Query  301     GCTGTCACGGTTGCCGCTGCTCCTTCGATCATGCACCGAAGTGGATACGATAAAGCTAAT  360
               | |||||||||||| ||  |||| ||||  |  ||||| || |||||||     || |||
Sbjct  149704  GTTGTCACGGTTGCAGCGCCTCCGTCGACAAGACACCGCAGCGGATACGGGGGTGCAAAT  149645

Query  361     AAGCCA----CGACAA-----ATGGACGCAAGCTCTATTCCCGTGGAATTCTTCCGAGAG  411
               ||||||     |||||     |  ||||| ||||| || ||| | || ||||||||||||
Sbjct  149644  AAGCCAACGCTGACAAGTCGTACAGACGCTAGCTCGATCCCCATAGAGTTCTTCCGAGAG  149585

>PHCA:scaffold_84 PHYCAscaffold_84
Length=182275

 Score = 1638 bits (1816),  Expect = 0.0
 Identities = 1810/2406 (75%), Gaps = 54/2406 (2%)
 Strand=Plus/Plus

Query  410     AGCAATTTCGCAACAACAGCGTTGAGATTCGACAGTCTTTG---------CCTGAGCCGT  460
               ||||||| ||||||| ||| ||||||||||| |||||||||         ||| |||  |
Sbjct  101906  AGCAATTCCGCAACAGCAGTGTTGAGATTCGCCAGTCTTTGATGCCGTCACCTCAGCATT  101965

Query  461     GGGAACGGCATTTTGGAATTCATCACGGTCGTCTCATGCGCaaaaaaaCTACGCAACACT  520
               || | || ||| | ||  | || ||||| ||||||||||| || ||||| || || ||||
Sbjct  101966  GGCAGCGACATCTCGGGCTCCAGCACGGCCGTCTCATGCGTAAGAAAACCACTCAGCACT  102025

Query  521     GTCGTCTGTTGCCTAGTGTCAACAAAACTGATCCAAGCGTACCAACTCCTGAATTGCGCG  580
               | ||||| ||||| ||||| |||||| | ||||| |  | |||||| || ||||||||||
Sbjct  102026  GCCGTCTCTTGCCCAGTGTAAACAAAGCGGATCCGACTGCACCAACGCCCGAATTGCGCG  102085

Query  581     AGGAGGATGCCAAGCACGGCGTTTTGAACTTGGTCACGCGCGGGTTTCTCCCTGCGTACG  640
               | || || |||||||||||||| || ||| | |||||||| || || |||||||||||||
Sbjct  102086  AAGAAGACGCCAAGCACGGCGTGTTTAACCTCGTCACGCGTGGATTCCTCCCTGCGTACG  102145

Query  641     CAGATCTGACTCCAGTCTTCAGTGGTACGAGCGATGGCTCTGGTGGTGGGGTGATGAAAC  700
               | || ||||| ||||  ||      | | |||| || |   |  ||||   | ||||| |
Sbjct  102146  CCGACCTGACACCAGCGTT------TGCCAGCGGTGCCAACGACGGTG---TTATGAAGC  102196

Query  701     AGCGTGCAACCCGAATCTATAATCGCTCCGAACAAGTAGTTCGGTCGACTCCTTTTACTC  760
               || | || ||| |||||||  |||||||||| |||  ||  ||| |||| ||| | ||||
Sbjct  102197  AGAGAGCGACCAGAATCTACGATCGCTCCGAGCAATCAGCACGGCCGACACCTATCACTC  102256

Query  761     AGTCCACAGGCTATAATCTGGCATCATTGAAGTTCGATCTTCGAGCTCCACCAACGCCCC  820
               |||||||||| || || |||||| |  | |||||||| |||||||| || || || || |
Sbjct  102257  AGTCCACAGGTTACAACCTGGCAGCTCTCAAGTTCGACCTTCGAGCGCCTCCGACACCGC  102316

Query  821     CACCTGTTGTGCCCGAAGCTACCT----TTCCT-----GACAGTACAACCAGAAGACGAA  871
               ||||   ||  |||||  |  | |    |||||     |||||||| |   || | |  |
Sbjct  102317  CACCACCTGCTCCCGAGACGTCGTCGACTTCCTCAGCCGACAGTACGA---GACGGCAGA  102373

Query  872     GCACTAGGCGGAGTTCAGCTCTGCAAGGCCCCAACCCATTTACAAGGTCAGTACCGATAT  931
               |||| || ||| | ||||||   |||||  | |  | | | |||| | |  | ||    |
Sbjct  102374  GCACAAGACGGGGATCAGCTAGACAAGGTGCTAGTCGAGTCACAATGGCGTTCCCAGCGT  102433

Query  932     CTAGCAGTAAAATTAAGAATGGGAGGTCTGCCCATCCGACTTCGTTAATGTCGGCTGCAG  991
               |  |||  ||    |||||  | || || ||    | ||  ||  |  |||| |||||| 
Sbjct  102434  CC-GCA--AACGACAAGAACAGAAGATCAGCGAGGCAGAAATCTCTTGTGTCTGCTGCAA  102490

Query  992     TCGCTGCCTTCACGAACCAGGGAGAGGATACGGAAAACAATAGAGACCGATTCAGTGAC-  1050
               | || ||||| ||||||||||  || |    |||  ||||  ||||||| || || ||| 
Sbjct  102491  TTGCCGCCTTTACGAACCAGGACGACGT---GGAGGACAACCGAGACCGCTTTAGCGACC  102547

Query  1051    -----GACGACATCTCCGATGAGGAGCAGGAAAGCGATGAAAATGACAAGGACGAATACG  1105
                    || ||  | || || || ||||||  ||| |||||    ||||| ||||||    
Sbjct  102548  AGCCAGATGATGTTTCGGACGAAGAGCAG--AAG-GATGAG---GACAAAGACGAA----  102597

Query  1106    CCGAGATGGAGAAATTGGGGGCAAATGTCGATAAAATTCGTGGTTACAACGAACTGCTGG  1165
                 || | |||| |  |||| || || ||||| || || || || ||||| || ||| |||
Sbjct  102598  --GAAACGGAGGAGCTGGGCGCCAACGTCGACAAGATCCGGGGATACAATGAGCTGTTGG  102655

Query  1166    ATGTGTATAGTTTGCACCAGTTTCTGATTCACAAAGGACGGACCATGAGAGACACACCCG  1225
               |||  || || |||||||||||| |||||||||| |||||||| |||||||| || ||||
Sbjct  102656  ATGCTTACAGCTTGCACCAGTTTTTGATTCACAAGGGACGGACGATGAGAGATACCCCCG  102715

Query  1226    AGTTTGTTTCGTTCCGTCGCGTTACACAGGAGCTTTGGGGCAGTGTAGAAGAGGCTCTGC  1285
               ||||  | || ||||  || ||  |||||||||||||||| || || ||||| ||  | |
Sbjct  102716  AGTTCATCTCCTTCCACCGGGTGGCACAGGAGCTTTGGGGAAGCGTGGAAGAAGCCTTAC  102775

Query  1286    GAGCGCTGGAGACTCTGCTCGCGCAGTATTTTGTACCTCTGGCTTACGTTGATGGCCAGC  1345
               |||| || ||||| || ||| | || |||||||| || ||||| ||||| ||||| ||||
Sbjct  102776  GAGCTCTCGAGACACTTCTCACTCACTATTTTGTTCCCCTGGCGTACGTGGATGGTCAGC  102835

Query  1346    GACTGCTCGCACTCGCAGGTACAGGCCAACCTCGATTCTCTAAGCGCGAACTGCTGTCCT  1405
               |  ||||| | || |||| ||| || |||||||| ||||| ||||| ||| |  ||||||
Sbjct  102836  GCTTGCTCTCCCTAGCAGCTACTGGTCAACCTCGCTTCTCGAAGCGAGAATTATTGTCCT  102895

Query  1406    GTATTGTGAATGAAGATCAAGTTATGTCGGTACTGCGACGTCCAGGCCAACGGTATAAAG  1465
               | || || |||||||| || || ||| | | |||||||||||||||||| || || ||||
Sbjct  102896  GCATCGTCAATGAAGAGCAGGTGATGGCCGCACTGCGACGTCCAGGCCAGCGATACAAAG  102955

Query  1466    GGCGAGATCGTAAACGCCGTGCTGCTACTACAATCGAAGCTTGTGTTCGTATGTGGCTAG  1525
               |  |||| || || ||||||||||| ||||| ||| |||||| |||||| ||||||   |
Sbjct  102956  GAAGAGACCGCAAGCGCCGTGCTGCCACTACCATCCAAGCTTTTGTTCGGATGTGGGCGG  103015

Query  1526    TCCGTCGGAGGTACGCTCGCACTCGTGCCAGCGACTTCAATGCGAGCAAAATTCAGCTTG  1585
                ||||||  ||||||||||  |||| ||||| ||| | || || | || |||||||||||
Sbjct  103016  CCCGTCGCCGGTACGCTCGGTCTCGAGCCAGGGACATTAACGCCACCAGAATTCAGCTTG  103075

Query  1586    CGTGGCGAGCCTACAGTTGCCATACAAGTCTCAAAGCTCGACTACGAGAAGTCCACCTAG  1645
               | ||||| |||||||| |||||  ||  ||| ||||||||||||||||| || |  |  |
Sbjct  103076  CTTGGCGCGCCTACAGCTGCCACGCAGCTCTTAAAGCTCGACTACGAGAGGTTCGACGTG  103135

Query  1646    AAAAACTCGAGAAATGGGAGAAAAGGATGCACAATCTCAAGTCCCACTGGCCACAAATTG  1705
               |  |||| |||||||||||     ||||||||    | || ||||| ||| | || || |
Sbjct  103136  AGCAACTGGAGAAATGGGAAGCGCGGATGCACCGCTTAAAATCCCAATGGGCTCAGATCG  103195

Query  1706    CTGGTCGCCGACGTGTTGTGGTCCACGTGCCGTCGTTATCGCTCGATGAACACTCACGTC  1765
               |  ||| ||| ||||| || |||||||||||||| || |||||||| ||| |||| ||||
Sbjct  103196  CAAGTCACCGGCGTGTCGTTGTCCACGTGCCGTCCTTGTCGCTCGACGAATACTCGCGTC  103255

Query  1766    TCGGTGCTGAGAACTTTGCCATACAACAGAACCTCCAGCTGACGCGGGTATGCGCCGCTG  1825
               || ||||||| ||||| ||  | |  ||||| || || || || ||| | ||||| ||||
Sbjct  103256  TCAGTGCTGAAAACTTGGCAGTGCGGCAGAATCTTCAACTCACTCGGATCTGCGCTGCTG  103315

Query  1826    CACTGGACTCTAACGTGGAACTGCTGCTTTATGTGTCGCCTTTCGAGCTCACATCGGATG  1885
               |  |||||||   |||||| || ||  | || ||||||||||||||||||||  |||| |
Sbjct  103316  CGTTGGACTCCCGCGTGGATCTTCTAGTGTACGTGTCGCCTTTCGAGCTCACGACGGACG  103375

Query  1886    TTTCTCAGTACTTCCTCAAACTGCTGCAACTTGGCGGTCTTGTTGACAGCAGACCTCGCG  1945
               |||| ||||||||| |||| ||||| || ||||| || || | ||||||  ||||||| |
Sbjct  103376  TTTCCCAGTACTTCATCAAGCTGCTACAGCTTGGTGGCCTCGCTGACAGTCGACCTCGAG  103435

Query  1946    TCAAGTTAGTGTTTCCCGAGCAAACCACGCGCTTTCCAGCCCATTTCTCGCTGTCATCGT  2005
               ||||  || | |||||||||||| ||||||| |||||||| ||||||||||| || ||||
Sbjct  103436  TCAAACTACTTTTTCCCGAGCAAGCCACGCGGTTTCCAGCGCATTTCTCGCTCTCGTCGT  103495

Query  2006    TGTTACTCTACTCGCCTCATTGTCTGCGGCGCATCCGACACTACACTACTGGCAAAGAGG  2065
               || | || ||||| || |||||||| ||||| || ||||| |||||| |||| ||||| |
Sbjct  103496  TGCTGCTTTACTCACCGCATTGTCTACGGCGTATTCGACATTACACTGCTGGGAAAGAAG  103555

Query  2066    CTTACCTTGTGATGGGGCTACCTGGAGCTGAGGATCAACGACTAGCGATGGCGTTGGATC  2125
               | || || || ||||| || ||||| || |||||||| || ||||||||| |||||||  
Sbjct  103556  CGTATCTCGTCATGGGACTGCCTGGTGCGGAGGATCAGCGCCTAGCGATGACGTTGGACT  103615

Query  2126    TGCCAATCCTCGGTGCGCCGCCAGCTCAAGCTCTGCCGCTGCTCACTCGCTCGGGTGGCA  2185
               |||| ||||||||||||||||||||||||||||| ||||||||||| || ||||| ||||
Sbjct  103616  TGCCGATCCTCGGTGCGCCGCCAGCTCAAGCTCTACCGCTGCTCACGCGTTCGGGAGGCA  103675

Query  2186    AGCGGTTGTTGATCCGAGCTGATGTAAATGTCCCCAATGGTACTTACGAGCTGTACGATG  2245
               ||||||||||||| ||||| ||||| |||||||||  ||||||||||||||||||||| |
Sbjct  103676  AGCGGTTGTTGATTCGAGCGGATGTCAATGTCCCCGCTGGTACTTACGAGCTGTACGACG  103735

Query  2246    AACATGAAGTCTGTGCAGCGCTCGCCAAGCTTGCTATCGCTCACATGGATCAACCGAGGT  2305
               | || ||  |||   | || || |||||||||||  | || |||||||||||||| | ||
Sbjct  103736  AGCACGAGCTCTTCTCCGCTCTGGCCAAGCTTGCCGTTGCGCACATGGATCAACCCAAGT  103795

Query  2306    GGTTAATTAAGCTGGACTACGATCCTCTTGATGTGGGCGAAGCGGTCGTTGACCTGTCAA  2365
               ||||  | ||||| || || || |||||||  ||||| || |||||||| || |||||  
Sbjct  103796  GGTTGTTCAAGCTCGATTATGACCCTCTTGGCGTGGGGGAGGCGGTCGTGGATCTGTCCG  103855

Query  2366    ACATGCAAGCGATGCGTGAGCTGCGTCGAGAGAAGCGGACGCCCGAGTATTGGCGCCAAC  2425
                 ||||| |||||||||||| | ||  |||| ||||| ||||| ||||||||||| ||||
Sbjct  103856  GGATGCAGGCGATGCGTGAGTTACGGAGAGAAAAGCGAACGCCGGAGTATTGGCGGCAAC  103915

Query  2426    CAGGCCCTCGCGATGCAGCAGCAAAGCTGATTCTGGCAGAGCTAGAGCGTCCGGGAATGC  2485
               |||| || || |||||||| || || ||  |  || |||| || |||||||| |||| | 
Sbjct  103916  CAGGGCCACGTGATGCAGCCGCTAAACTCGTGTTGACAGAACTGGAGCGTCCAGGAACGT  103975

Query  2486    TAGCGAGAATCGCGACTCCCATGCAAACCGAAATATTCCCAAAATGGCGGGAGTTTATCG  2545
               ||||| |  | ||||  ||| |||| |  || || |||||    ||||  ||||||  ||
Sbjct  103976  TAGCGCGGCTGGCGATGCCCGTGCACAAAGACATTTTCCCCTCGTGGCTCGAGTTTGCCG  104035

Query  2546    ATGCCGTCGGCCATTTCGGCTGTGTCGTTGAAGCTGTCCCTCCTACAGCCATTGCTGCCT  2605
               | ||  |||||||||||||||||||  ||||||| || || |  ||||||||||| | | 
Sbjct  104036  AGGCTATCGGCCATTTCGGCTGTGTTATTGAAGCAGTTCCCCTAACAGCCATTGCCGTCA  104095

Query  2606    CATCCGAGGCATCAACGGTGCTGGTAGAGCCTGCCTACGTGCGCGCGAATCTGTTTGTAG  2665
               |  | ||| | || || |   || | ||||| |||||| | ||||||||  ||||||| |
Sbjct  104096  CGCCGGAGACGTCGACAGCATTGCTGGAGCCAGCCTACATCCGCGCGAACTTGTTTGTCG  104155

Query  2666    ACCCGGATGGCTCCGTACACATCTCGTCGACGCAGAATGTGCTGGCAGCTGGAGGTGGGG  2725
               |||| ||||||||||| ||| |  | ||||| | |||| |||||||  |||||||||| |
Sbjct  104156  ACCCAGATGGCTCCGTTCACGTGACATCGACACTGAATATGCTGGCGACTGGAGGTGGCG  104215

Query  2726    GGCTGAATAGGAAAACTGTGGCGTTCACGTTTCCTCAGACGGCTGCACCATATGAGGCAA  2785
               |||||||| |||  |||||||||||||||||||| ||||| || || ||| | || ||  
Sbjct  104216  GGCTGAATCGGAGGACTGTGGCGTTCACGTTTCCACAGACTGCAGCGCCACACGAAGCGG  104275

Query  2786    TTAAGG  2791
               ||||||
Sbjct  104276  TTAAGG  104281

 Score = 572 bits (633),  Expect = 5e-160
 Identities = 559/717 (78%), Gaps = 24/717 (3%)
 Strand=Plus/Plus

Query  2789    AGGGTGCTTGCAACGCCGCGGGAAAGCTACTAGTAGAGACGAATGTCTGGGGTTACGTCA  2848
               ||||||| |||| ||| || |||||||| ||||| ||||| || |||||||| ||||| |
Sbjct  104338  AGGGTGCGTGCAGCGCAGCAGGAAAGCTGCTAGTGGAGACCAACGTCTGGGGGTACGTAA  104397

Query  2849    GCTTGGATTTCGTGGTCTTTCAGGATGAAAAGAGCAATGATGCACCTCGATTGTGGGCTC  2908
               |||| || || |||||||| ||||| || |||||||| |  |||||  || ||||||| |
Sbjct  104398  GCTTAGACTTTGTGGTCTTCCAGGACGACAAGAGCAACGGCGCACCGAGACTGTGGGCAC  104457

Query  2909    TCGCTGTACATCCGTTCCTCACAGATTCCGCTACCAGCTTCGCTTGTTTCCACCTGCTCG  2968
               |||| || ||||| ||||||||||| || ||| |||||||||| || || || || ||||
Sbjct  104458  TCGCCGTGCATCCATTCCTCACAGACTCTGCTGCCAGCTTCGCCTGCTTTCATCTACTCG  104517

Query  2969    CTCGTGGTGTGTTAGATACGAATTCAGGTGTCTACCGAGTGGC--CAACAAG----TCAC  3022
               | ||||| ||||| ||  | |||||||| || |||||| ||||  || | ||    ||||
Sbjct  104518  CGCGTGGCGTGTTGGACGCCAATTCAGGAGTTTACCGAATGGCGGCAGCTAGCAGTTCAC  104577

Query  3023    TGACTACAGCCAATTCAGGACGAAAAAGCGAAAGTGGCAGCGCTACGGACTTGCTGCTGC  3082
               |||  ||||||||| |||||||||   ||| || |||  |  | ||  || || ||||||
Sbjct  104578  TGATGACAGCCAATGCAGGACGAA---GCGGAAATGGTGGAACGACAAACCTGTTGCTGC  104634

Query  3083    GTGAAGCTTTACTGGCCAAAAGTTCACTCGTAGGGGCTCGGCGTTGCTTCGTGGCGTGCT  3142
               ||||||||  |||||| ||| | || || | ||| || |  ||||||||||||| |||||
Sbjct  104635  GTGAAGCTGCACTGGCTAAAGGATCCCTGGCAGGAGCGCCTCGTTGCTTCGTGGTGTGCT  104694

Query  3143    CGTACGTGTTCCACCCGCACGTGATCACTATGCAGTACACTGCTTTCTTCCACGCCTGCA  3202
               ||||||||||||| |||||||||| ||| ||||||||||| || ||||||||||||||| 
Sbjct  104695  CGTACGTGTTCCATCCGCACGTGACCACCATGCAGTACACCGCCTTCTTCCACGCCTGCC  104754

Query  3203    GATTACACGGTGTGTGCTTTGACGTGGAGAGAACTCTAGGTACACTCTTCCTGCTCGCTG  3262
               || ||||||| |||||||||||||||||||| ||  | || |||||||||||||| ||||
Sbjct  104755  GACTACACGGCGTGTGCTTTGACGTGGAGAGGACCTTGGGCACACTCTTCCTGCTTGCTG  104814

Query  3263    ACAGTCTCACAGCTGGCGTCTTCGGTATCTTGAGTATTGGAGAAACCACAGAAGGAGCTC  3322
               |||||||||| ||||| || || ||  ||||||| |||||||| || || ||||||||| 
Sbjct  104815  ACAGTCTCACCGCTGGGGTGTTTGGCGTCTTGAGCATTGGAGAGACGACGGAAGGAGCTT  104874

Query  3323    TGGCATTTCTGCGGACTGCACTGGAAGTGATAGGCCGAGAAGCTGGCTCGACTATCAGTG  3382
               |||| ||  |||| |||||||| || ||||| ||||| || | |||  |||| |||    
Sbjct  104875  TGGCGTTCTTGCGTACTGCACTAGAGGTGATCGGCCGTGAGGTTGGTGCGACCATCGAGA  104934

Query  3383    TGGCTTCATCTCCATCTCGATCCGTTGCCTCTCGTAGTGGCAACTTTGCTCAGATTTTGT  3442
               || |||| ||| |||||||| ||||   |||       || |||||||| ||  | ||||
Sbjct  104935  TGTCTTCGTCTACATCTCGACCCGT---CTC------AGGGAACTTTGCGCACGTGTTGT  104985

Query  3443    CTGCTATTCGAGTGTCCACAGGCGGCGGCAAGAGCGACAGACTAGGGAAAATGCGGC  3499
               ||||  ||||||   ||||    || ||||||   ||| |||| ||||| |||||||
Sbjct  104986  CTGCGGTTCGAGCTGCCAC---TGGGGGCAAG---GACCGACTGGGGAAGATGCGGC  105036

 Score = 347 bits (384),  Expect = 1e-92
 Identities = 324/411 (79%), Gaps = 12/411 (3%)
 Strand=Plus/Plus

Query  1       ATGGACAAGGTGCAGCAGCAACATCATGTGGAGGATGTGGGCCGGTTGTTGTTGCAGACA  60
               ||||| ||||||||||| |||||||| |||||||||||||| ||||||||||||||||| 
Sbjct  101446  ATGGAGAAGGTGCAGCAACAACATCACGTGGAGGATGTGGGGCGGTTGTTGTTGCAGACG  101505

Query  61      CAGGAGCAGCTTCGTGTGATGCGAGAGCAGATGACGGCAGCTGCAGCGGCCGTGGAGGCC  120
               ||||||||||| ||||| ||||| ||||| ||||| ||||| || ||||| |||||||||
Sbjct  101506  CAGGAGCAGCTCCGTGTCATGCGGGAGCAAATGACAGCAGCAGCGGCGGCTGTGGAGGCC  101565

Query  121     AATGCATCGCCAATGCGCCACAACGCAATTGTGACAACAGCCGAAGTCCAAGCTTTCAAC  180
               ||| | || || |||||||| |  ||| | |||||||| ||||| || || || ||||||
Sbjct  101566  AATTCGTCCCCCATGCGCCATAGTGCAGTGGTGACAACCGCCGAGGTGCAGGCCTTCAAC  101625

Query  181     GCAATCTTGCAACAGACTGAGACAGAACTTCGGGCCAAAGCGGAACTTGTCCTCAATGGC  240
               || ||| |||| |  || ||||| || |||||||| ||||||||||| || |||||||| 
Sbjct  101626  GCGATCCTGCAGCGAACGGAGACGGAGCTTCGGGCGAAAGCGGAACTAGTGCTCAATGGG  101685

Query  241     ATGGTTAACAGCAGTAGCAGTGCACGAAATAATCAGGCTCAGAGCGGCACTCTTCTTCCT  300
               ||||| || ||||||  | | || |||           ||||||||||||| |||| |||
Sbjct  101686  ATGGTCAATAGCAGTTTC-GAGC-CGAG----------TCAGAGCGGCACTGTTCTCCCT  101733

Query  301     GCTGTCACGGTTGCCGCTGCTCCTTCGATCATGCACCGAAGTGGATACGATAAAGCTAAT  360
               |||||||| |||||     |||| ||||| | || ||| |||||||||   |  ||| ||
Sbjct  101734  GCTGTCACAGTTGCAAACCCTCCGTCGATAAAGCGCCGCAGTGGATACAGAAGGGCTTAT  101793

Query  361     AAGCCACGACAAATGGACGCAAGCTCTATTCCCGTGGAATTCTTCCGAGAG  411
               |||||  |||  | ||| || ||||| || ||| |||||||||| ||||||
Sbjct  101794  AAGCCTAGACGGACGGATGCCAGCTCCATCCCCATGGAATTCTTTCGAGAG  101844

>PHSO:scaffold_1
Length=13391543

 Score = 1634 bits (1811),  Expect = 0.0
 Identities = 1811/2413 (75%), Gaps = 35/2413 (1%)
 Strand=Plus/Plus

Query  410      AGCAATTTCGCAACAACAGCGTTGAGATTCGACAGTCTTT---GCCTGAGCCG------T  460
                ||||||| || |||| |||||||||| | || ||| || |   ||||  |||       |
Sbjct  2801500  AGCAATTCCGGAACAGCAGCGTTGAGGTCCGGCAGACTCTAATGCCTTCGCCCCTGCACT  2801559

Query  461      GGGAACGGCATTTTGGAATTCATCACGGTCGTCTCATGCGCaaaaaaaCTACGCAACACT  520
                 | | |||||| | || || |||||||| || ||||||||||| ||||| || |||||||
Sbjct  2801560  TGCAGCGGCATCTCGGGATCCATCACGGCCGCCTCATGCGCAAGAAAACCACACAACACT  2801619

Query  521      GTCGTCTGTTGCCTAGTGTCAACAAAACTGATCCAAGCGTACCAACTCCTGAATTGCGCG  580
                |||| ||  |||| ||||||||||||   || || || |  || || |||||| |||| |
Sbjct  2801620  GTCGCCTCCTGCCGAGTGTCAACAAAGTCGACCCCAGTGCGCCGACGCCTGAACTGCGAG  2801679

Query  581      AGGAGGATGCCAAGCACGGCGTTTTGAACTTGGTCACGCGCGGGTTTCTCCCTGCGTACG  640
                ||||||| ||||| ||||||||  | ||| ||||||| ||||||||||| ||||| ||||
Sbjct  2801680  AGGAGGACGCCAAACACGGCGTACTAAACCTGGTCACACGCGGGTTTCTACCTGCATACG  2801739

Query  641      CAGATCTGACTCCAGTCTT---------CAGTGGTACGAGCGATGGCTCTGGTGGTGGGG  691
                | || ||||| |||| |||         ||||||  ||| |||||| || |||||||| |
Sbjct  2801740  CTGACCTGACACCAGCCTTTGCAGGTCCCAGTGGAGCGAACGATGGATCGGGTGGTGGCG  2801799

Query  692      TGATGAAACAGCGTGCAACCCGAATCTATAATCGCTCCGAACAAGTAGTTCGGTCGACTC  751
                ||||||| |||||||| || || ||| |  |||| || || ||    |||||  |||| |
Sbjct  2801800  TGATGAAGCAGCGTGCGACGCGGATCCACGATCGATCAGAGCAGTCGGTTCGCCCGACGC  2801859

Query  752      CTTTTACTCAGTCCACAGGCTATAATCTGGCATCATTGAAGTTCGATCTTCGAGCTCCAC  811
                | || || |||||||| ||||| || || ||| |  | ||||| |||||||| || ||  
Sbjct  2801860  CGTTCACGCAGTCCACGGGCTACAACCTCGCAGCGCTAAAGTTTGATCTTCGGGCGCCGT  2801919

Query  812      CAACGCCCCCACCTGTTGTGCCCGAAGCTACCTTTCCTGACAGT---ACAACCAGAAGAC  868
                  ||||| ||||||  ||  |||||  | | |  ||| |  | |   || ||||||||||
Sbjct  2801920  TTACGCCTCCACCTCCTGCACCCGAGTCCAGCCCTCCCGCTACTGCCACGACCAGAAGAC  2801979

Query  869      GAAGCACTAGGCGGAGTTCAGCTCTGCAAGGCCCCAACCCATTTACAAGGTCAGTACCGA  928
                | ||||| ||| |  |||||||    || || || | |    | || | ||| || || |
Sbjct  2801980  GCAGCACCAGGAGAGGTTCAGCCGGACATGGTCCAAGCAAGGTCACGATGTC-GTTCCCA  2802038

Query  929      TA-TCTAGCAGTAAAATTAAGAATGGGAGGTCTGCCCATCCGACTTCGTTAATGTCGGCT  987
                 | |||   ||       ||||  || || || |  | || ||  ||| |  |||| |||
Sbjct  2802039  GAGTCTGCTAGGGCCGACAAGAGCGGCAGATCGGTACGTCAGAGCTCGCTGGTGTCCGCT  2802098

Query  988      GCAGTCGCTGCCTTCACGAACCAGGGAGAGGATACGGAAAACAATAGAGACCGATTCAGT  1047
                ||| | || ||||||||||||||  | || ||   |||| ||||  |||| || ||||||
Sbjct  2802099  GCAATAGCGGCCTTCACGAACCAAAGCGACGACTTGGAAGACAACCGAGAGCGCTTCAGT  2802158

Query  1048     GAC---------GACGACATCTCCGATGAGGAGCAGGAAAGCGATGAAAATGACAAGGAC  1098
                ||          || || ||||| ||||||||||||||   |||||| || || ||||||
Sbjct  2802159  GAGCAGCCAGATGAGGAAATCTCGGATGAGGAGCAGGAGGACGATGAGAACGAGAAGGAC  2802218

Query  1099     GAATACGCCGAGATGGAGAAATTGGGGGCAAATGTCGATAAAATTCGTGGTTACAACGAA  1158
                ||  | |||||||||||| |  |||| || || ||||| || || || || |||||||| 
Sbjct  2802219  GAGGAGGCCGAGATGGAGGAGCTGGGCGCCAACGTCGACAAGATCCGCGGATACAACGAG  2802278

Query  1159     CTGCTGGATGTGTATAGTTTGCACCAGTTTCTGATTCACAAAGGACGGACCATGAGAGAC  1218
                |||||||| | ||| ||| ||||||||||  |||| ||||| ||||| |||||| |||| 
Sbjct  2802279  CTGCTGGACGCGTACAGTCTGCACCAGTTCTTGATCCACAAGGGACGAACCATGCGAGAT  2802338

Query  1219     ACACCCGAGTTTGTTTCGTTCCGTCGCGTTACACAGGAGCTTTGGGGCAGTGTAGAAGAG  1278
                |||||||||||||| |||||||| |||||  | ||||||||||||||||| || || |||
Sbjct  2802339  ACACCCGAGTTTGTGTCGTTCCGCCGCGTAGCGCAGGAGCTTTGGGGCAGCGTCGAGGAG  2802398

Query  1279     GCTCTGCGAGCGCTGGAGACTCTGCTCGCGCAGTATTTTGTACCTCTGGCTTACGTTGAT  1338
                || ||||| ||| |||||||||| ||| ||||||| || || || ||||| |||| ||||
Sbjct  2802399  GCCCTGCGCGCGTTGGAGACTCTCCTCACGCAGTACTTCGTGCCGCTGGCGTACGCTGAT  2802458

Query  1339     GGCCAGCGACTGCTCGCACTCGCAGGTACAGGCCAACCTCGATTCTCTAAGCGCGAACTG  1398
                ||||||||  || |  | |||||    || ||||| ||||| ||||| |||||||| |||
Sbjct  2802459  GGCCAGCGCTTGTTGTCTCTCGCTTCCACCGGCCAGCCTCGGTTCTCCAAGCGCGAGCTG  2802518

Query  1399     CTGTCCTGTATTGTGAATGAAGATCAAGTTATGTCGGTACTGCGACGTCCAGGCCAACGG  1458
                 ||||||| || ||||| ||||| || || ||| |||| || || || ||||| || || 
Sbjct  2802519  TTGTCCTGCATCGTGAACGAAGAGCAGGTAATGGCGGTGCTCCGTCGACCAGGACAGCGA  2802578

Query  1459     TATAAAGGGCGAGATCGTAAACGCCGTGCTGCTACTACAATCGAAGCTTGTGTTCGTATG  1518
                || |||||  |||| || || ||||| ||||| || |||||| |||| ||||| || |||
Sbjct  2802579  TACAAAGGCAGAGACCGCAAGCGCCGAGCTGCGACGACAATCCAAGCCTGTGTCCGGATG  2802638

Query  1519     TGGCTAGTCCGTCGGAGGTACGCTCGCACTCGTGCCAGCGACTTCAATGCGAGCAAAATT  1578
                |||  | |||| ||  |||| |   |  | || || ||||||||||  ||||  || || 
Sbjct  2802639  TGGTCAATCCGCCGCCGGTATGTGAGATCGCGCGCGAGCGACTTCAGCGCGACGAAGATC  2802698

Query  1579     CAGCTTGCGTGGCGAGCCTACAGTTGCCATACAAGTCTCAAAGCTCGACTACGAGAAGTC  1638
                ||||| || ||||| |||| ||| |||||  |   | | ||||||||||| |||||  | 
Sbjct  2802699  CAGCTCGCATGGCGCGCCTTCAGCTGCCACGCGGCTTTGAAAGCTCGACTGCGAGAGCTT  2802758

Query  1639     CACCTAGAAAAACTCGAGAAATGGGAGAAAAGGATGCACAATCTCAAGTCCCACTGGCCA  1698
                |  |  ||  | || || || |||||    | |||| || | || ||| |||| ||||  
Sbjct  2802759  CGGCGGGAGCAGCTTGACAACTGGGAAGCCAAGATGAACGACCTGAAGACCCAGTGGCAT  2802818

Query  1699     CAAATTGCTGGTCGCCGACGTGTTGTGGTCCACGTGCCGTCGTTATCGCTCGATGAACAC  1758
                || ||||| || |||||||| ||||| || ||||||||||| || ||||| |||||||||
Sbjct  2802819  CAGATTGCAGGACGCCGACGCGTTGTCGTGCACGTGCCGTCCTTGTCGCTGGATGAACAC  2802878

Query  1759     TCACGTCTCGGTGCTGAGAACTTTGCCATACAACAGAACCTCCAGCTGACGCGGGTATGC  1818
                || || ||  | || |||||||| ||  | || ||||||||||||||||||||| |||||
Sbjct  2802879  TCGCGCCTTAGCGCCGAGAACTTCGCAGTGCAGCAGAACCTCCAGCTGACGCGGATATGC  2802938

Query  1819     GCCGCTGCACTGGACTCTAACGTGGAACTGCTGCTTTATGTGTCGCCTTTCGAGCTCACA  1878
                || || || |||||||| |||||||| |||||  | || ||| | || ||||||||||| 
Sbjct  2802939  GCTGCAGCTCTGGACTCGAACGTGGATCTGCTTGTGTACGTGGCCCCCTTCGAGCTCACC  2802998

Query  1879     TCGGATGTTTCTCAGTACTTCCTCAAACTGCTGCAACTTGGCGGTCTTGTTGACAGCAGA  1938
                 | || || || || ||||||||||| |||||||| || |||||||| | ||| || |||
Sbjct  2802999  GCTGACGTCTCGCACTACTTCCTCAAGCTGCTGCAGCTGGGCGGTCTGGCTGATAGTAGA  2803058

Query  1939     CCTCGCGTCAAGTTAGTGTTTCCCGAGCAAACCACGCGCTTTCCAGCCCATTTCTCGCTG  1998
                || ||||| ||| | |||||||| |||||  |  | ||||||||||| ||||||||||| 
Sbjct  2803059  CCGCGCGTGAAGCTCGTGTTTCCAGAGCAGGCTGCCCGCTTTCCAGCGCATTTCTCGCTC  2803118

Query  1999     TCATCGTTGTTACTCTACTCGCCTCATTGTCTGCGGCGCATCCGACACTACACTACTGGC  2058
                || ||  | || || ||||||||||| ||||||||||||||||| ||||||||  | |||
Sbjct  2803119  TCGTCAGTCTTGCTGTACTCGCCTCACTGTCTGCGGCGCATCCGGCACTACACGGCAGGC  2803178

Query  2059     AAAGAGGCTTACCTTGTGATGGGGCTACCTGGAGCTGAGGATCAACGACTAGCGATGGCG  2118
                ||||| || ||||| ||||||||| | |||||  | || || || || || || || || 
Sbjct  2803179  AAAGACGCATACCTCGTGATGGGGTTGCCTGGTACAGAAGACCAGCGGCTGGCTATCGCC  2803238

Query  2119     TTGGATCTGCCAATCCTCGGTGCGCCGCCAGCTCAAGCTCTGCCGCTGCTCACTCGCTCG  2178
                 ||||  |||| ||||| ||||| |||||| ||||||| || ||  ||||||||||||| 
Sbjct  2803239  CTGGACTTGCCTATCCTTGGTGCACCGCCACCTCAAGCACTACCATTGCTCACTCGCTCA  2803298

Query  2179     GGTGGCAAGCGGTTGTTGATCCGAGCTGATGTAAATGTCCCCAATGGTACTTACGAGCTG  2238
                |||||||||||| || | ||||| ||||| || || |||||||  || ||||||||||| 
Sbjct  2803299  GGTGGCAAGCGGCTGCTCATCCGCGCTGACGTGAACGTCCCCACCGGCACTTACGAGCTC  2803358

Query  2239     TACGATGAACATGAAGTCTGTGCAGCGCTCGCCAAGCTTGCTATCGCTCACATGGATCAA  2298
                ||||| || || ||| | |  ||||| || |||||||||||  |||| ||||||||||| 
Sbjct  2803359  TACGACGAGCACGAACTGTTCGCAGCACTTGCCAAGCTTGCAGTCGCGCACATGGATCAG  2803418

Query  2299     CCGAGGTGGTTAATTAAGCTGGACTACGATCCTCTTGATGTGGGCGAAGCGGTCGTTGAC  2358
                ||||| |||||  | ||||| |||||||| || |||| ||| || |||||||| ||||| 
Sbjct  2803419  CCGAGATGGTTGCTCAAGCTCGACTACGACCCCCTTGGTGTTGGTGAAGCGGTGGTTGAT  2803478

Query  2359     CTGTCAAACATGCAAGCGATGCGTGAGCTGCGTCGAGAGAAGCGGACGCCCGAGTATTGG  2418
                |||||    |||||||||||||| ||||| || |||||||||  ||||||||||||||||
Sbjct  2803479  CTGTCGGGGATGCAAGCGATGCGCGAGCTACGACGAGAGAAGAAGACGCCCGAGTATTGG  2803538

Query  2419     CGCCAACCAGGCCCTCGCGATGCAGCAGCAAAGCTGATTCTGGCAGAGCTAGAGCGTCCG  2478
                |||||||| || || |||||||| ||| | |||||  | || || || || |||||||| 
Sbjct  2803539  CGCCAACCGGGACCGCGCGATGCTGCATCCAAGCTCGTGCTAGCTGAACTGGAGCGTCCA  2803598

Query  2479     GGAATGCTAGCGAGAATCGCGACTCCCATGCAAACCGAAATATTCCCAAAATGGCGGGAG  2538
                ||  || | ||| || | ||||| |||||||| ||||| || |||||   |||||| |||
Sbjct  2803599  GGCGTGTTGGCGCGACTTGCGACGCCCATGCACACCGAGATCTTCCCGTCATGGCGAGAG  2803658

Query  2539     TTTATCGATGCCGTCGGCCATTTCGGCTGTGTCGTTGAAGCTGTCCCTCCTACAGCCATT  2598
                |  | ||| ||  || ||||||||||||| || || ||||| || ||||| |||  | | 
Sbjct  2803659  TACACCGAAGCGATCAGCCATTTCGGCTGCGTGGTCGAAGCCGTTCCTCCCACAAGCTTC  2803718

Query  2599     GCTGCCTCATCCGAGGCATCAACGGTGCTGGTAGAGCCTGCCTACGTGCGCGCGAATCTG  2658
                |  |||||  ||||| |  | |    |   || ||||| |||||||| ||||||||  ||
Sbjct  2803719  GTCGCCTCGCCCGAGACTGCGAGCTCGTCCGTGGAGCCGGCCTACGTACGCGCGAACTTG  2803778

Query  2659     TTTGTAGACCCGGATGGCTCCGTACACATCTCGTCGACGCAGAATGTGCTGGCAGCTGGA  2718
                ||  | |||||||| ||| | || |||||| ||||||||||||||||||||   ||  | 
Sbjct  2803779  TTCATTGACCCGGACGGCACAGTTCACATCACGTCGACGCAGAATGTGCTG---GCCAGT  2803835

Query  2719     GGTGGGGGGCTGAATAGGAAAACTGTGGCGTTCACGTTTCCTCAGACGGCTGCACCATAT  2778
                || || || || ||| ||||||| |||||||||||||| || ||||| |  || ||  | 
Sbjct  2803836  GGCGGAGGACTCAATCGGAAAACGGTGGCGTTCACGTTCCCCCAGACAGTGGCGCCGCAC  2803895

Query  2779     GAGGCAATTAAGG  2791
                |||||  ||||||
Sbjct  2803896  GAGGCGGTTAAGG  2803908

 Score = 516 bits (571),  Expect = 4e-143
 Identities = 554/731 (76%), Gaps = 9/731 (1%)
 Strand=Plus/Plus

Query  2789     AGGGTGCTTGCAACGCCGCGGGAAAGCTACTAGTAGAGACGAATGTCTGGGGTTACGTCA  2848
                ||||||| ||||  || ||||| ||||| ||||| ||||| || |||||||| ||||| |
Sbjct  2803974  AGGGTGCGTGCACTGCTGCGGGGAAGCTGCTAGTGGAGACCAACGTCTGGGGCTACGTGA  2804033

Query  2849     GCTTGGATTTCGTGGTCTTTCAGGATGAAAAGAGCAATGATGCACCTCGATTGTGGGCTC  2908
                |  |||| ||||| || || ||||| || ||||||   |  ||||| ||  | ||||| |
Sbjct  2804034  GTCTGGACTTCGTCGTGTTCCAGGACGACAAGAGCGGCGGCGCACCACGGCTCTGGGCGC  2804093

Query  2909     TCGCTGTACATCCGTTCCTCACAGATTCCGCTACCAGCTTCGCTTGTTTCCACCTGCTCG  2968
                ||||||| ||||||||||| ||||| || ||| | |||||||| || || ||||| ||||
Sbjct  2804094  TCGCTGTGCATCCGTTCCTGACAGACTCTGCTGCGAGCTTCGCGTGCTTTCACCTTCTCG  2804153

Query  2969     CTCGTGGTGTGTTAGATACGAATTCAGGTGTCTACCGAGTGGC--CAACAAGT----CAC  3022
                | || || ||| | ||  |||  ||||| | ||||||| ||||  || ||| |    |||
Sbjct  2804154  CCCGGGGCGTGCTCGACGCGAGCTCAGGAGGCTACCGAATGGCTGCAGCAAATTCGACAC  2804213

Query  3023     TGACTACAGCCAATTCAGGACGAAAAAGCGAAAGTGGCAGCGCTACGGACTTGCTGCTGC  3082
                |  |  | | ||||||||||||||   |||   ||||  || | |||||| |||| || |
Sbjct  2804214  TTGCGGCCGTCAATTCAGGACGAAGTGGCG---GTGGGGGCACAACGGACCTGCTACTAC  2804270

Query  3083     GTGAAGCTTTACTGGCCAAAAGTTCACTCGTAGGGGCTCGGCGTTGCTTCGTGGCGTGCT  3142
                | || || |  ||||| ||  |  | |  |  ||  | |  || |||| ||||| |||||
Sbjct  2804271  GAGAGGCGTCGCTGGCGAAGGGGGCTCAGGCTGGCACGCCTCGCTGCTACGTGGTGTGCT  2804330

Query  3143     CGTACGTGTTCCACCCGCACGTGATCACTATGCAGTACACTGCTTTCTTCCACGCCTGCA  3202
                ||||||| |||||||||||||||| ||| |||||||||||||| ||||||||||||||| 
Sbjct  2804331  CGTACGTCTTCCACCCGCACGTGACCACCATGCAGTACACTGCCTTCTTCCACGCCTGCC  2804390

Query  3203     GATTACACGGTGTGTGCTTTGACGTGGAGAGAACTCTAGGTACACTCTTCCTGCTCGCTG  3262
                || | || || ||||| || ||||| ||| | || ||||| || |||||||||||| | |
Sbjct  2804391  GACTGCATGGAGTGTGTTTCGACGTTGAGCGCACGCTAGGAACGCTCTTCCTGCTCACAG  2804450

Query  3263     ACAGTCTCACAGCTGGCGTCTTCGGTATCTTGAGTATTGGAGAAACCACAGAAGGAGCTC  3322
                ||||||||||||| || ||||||||  |||||||  |||| || ||||| || || ||  
Sbjct  2804451  ACAGTCTCACAGCCGGTGTCTTCGGCGTCTTGAGCGTTGGGGAGACCACCGACGGGGCGT  2804510

Query  3323     TGGCATTTCTGCGGACTGCACTGGAAGTGATAGGCCGAGAAGCTGGCTCGACTATCAGTG  3382
                |||| ||  |||| |||||||| |||||||| ||||| || || ||| ||||| ||    
Sbjct  2804511  TGGCGTTCATGCGCACTGCACTTGAAGTGATCGGCCGCGAGGCCGGCGCGACTGTCGAAA  2804570

Query  3383     TGGCTTCATCTCCATCTCGATCCGTTGCCTCTCGTAGTGGCAACTTTGCTCAGATTTTGT  3442
                ||||| | || ||||||||| |||   |  |||| || |||||||| |||||  | ||||
Sbjct  2804571  TGGCTACCTCCCCATCTCGACCCGGCTCAGCTCGCAGCGGCAACTTCGCTCAAGTGTTGT  2804630

Query  3443     CTGCTATTCGAGTGTCCACAGGCGGCGGCAAGAGCGACAGACTAGGGAAAATGCGGCAAC  3502
                ||||| |||| | |||||||||||| |||||  |||||||||| || | |||||||| ||
Sbjct  2804631  CTGCTGTTCGCGCGTCCACAGGCGGAGGCAAAGGCGACAGACTCGGTAGAATGCGGCGAC  2804690

Query  3503     GACAGCGATAG  3513
                  |  ||||||
Sbjct  2804691  TGCGTCGATAG  2804701

 Score = 316 bits (350),  Expect = 2e-83
 Identities = 319/413 (77%), Gaps = 4/413 (1%)
 Strand=Plus/Plus

Query  1        ATGGACAAGGTGCAGCAGCAACATCATGTGGAGGATGTGGGCCGGTTGTTGTTGCAGACA  60
                ||||| ||||| |||||||| ||||| || || |||||||| ||  || || ||||||| 
Sbjct  2801037  ATGGAGAAGGTTCAGCAGCAGCATCACGTAGAAGATGTGGGTCGACTGCTGCTGCAGACG  2801096

Query  61       CAGGAGCAGCTTCGTGTGATGCGAGAGCAGATGACGGCAGCTGCAGCGGCCGTGGAGGCC  120
                ||||||||||| || || ||||||||||||||||| || || || || ||||||||||||
Sbjct  2801097  CAGGAGCAGCTCCGAGTCATGCGAGAGCAGATGACTGCGGCGGCTGCAGCCGTGGAGGCC  2801156

Query  121      AATGCATCGCCAATGCGCCACAACGCAATTGTGACAACAGCCGAAGTCCAAGCTTTCAAC  180
                || |||||||| ||||| |||| |||| | ||||| |||||||| || || || ||||||
Sbjct  2801157  AACGCATCGCCGATGCGGCACAGCGCAGTCGTGACCACAGCCGAGGTGCAGGCGTTCAAC  2801216

Query  181      GCAATCTTGCAACAGACTGAGACAGAACTTCGGGCCAAAGCGGAACTTGTCCTCAATGGC  240
                || || ||||| ||||| ||| |||| || || ||||| ||||| || || || || |||
Sbjct  2801217  GCCATTTTGCAGCAGACAGAGGCAGAGCTGCGCGCCAAGGCGGAGCTCGTTCTAAACGGC  2801276

Query  241      ATGGTTAACAGCAGTAGCAGTGCACGAAATAATCAGGCTCAGAGCGGCACTCTTCTTCCT  300
                ||||| |||||||| ||||| || | ||| || ||   ||||||||| || || || |||
Sbjct  2801277  ATGGTCAACAGCAGCAGCAGCGCTCAAAACAACCAAAGTCAGAGCGGAACACTGCTCCCT  2801336

Query  301      GCTGTCACGGTTGCCGCTGCTCCTTCGATCATGCACCGAAGTGGATACGATAAAGCTAAT  360
                || ||||| || || ||  |||| || |  |  ||||| || ||||| |  ||  | |  
Sbjct  2801337  GCCGTCACAGTCGCAGCGCCTCCCTCCACAAGACACCGCAGCGGATATGCCAAGCCCA--  2801394

Query  361      AAGCCACGACAA--ATGGACGCAAGCTCTATTCCCGTGGAATTCTTCCGAGAG  411
                 ||   ||| ||  |||||||| ||||| || ||  |||||||||| ||||||
Sbjct  2801395  GAGTGGCGAAAAGTATGGACGCGAGCTCAATCCCGATGGAATTCTTTCGAGAG  2801447

>PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_98.1_contig_1:1:103693:1 
REF
Length=103693

 Score = 1124 bits (1246),  Expect = 0.0
 Identities = 1288/1732 (74%), Gaps = 22/1732 (1%)
 Strand=Plus/Plus

Query  1060   TCCGATGAGGAGCAGGAAAGCGATGAAAATGACAAGGACGAATACGCCGAGATGGAGAAA  1119
              ||||| ||||| ||||     | || |||||| |  || ||  |||||||||||||  ||
Sbjct  69627  TCCGACGAGGACCAGGGCGCAGCTGGAAATGATAGAGATGAGGACGCCGAGATGGAAGAA  69686

Query  1120   TTGGGGGCAAATGTCGATAAAATTCGTGGTTACAACGAACTGCTGGATGTGTATAGTTTG  1179
               | ||||| || ||||| || || || || |||||||||||  ||||||  || ||||||
Sbjct  69687  CTTGGGGCCAACGTCGACAAGATCCGCGGCTACAACGAACTATTGGATGCCTACAGTTTG  69746

Query  1180   CACCAGTTTCTGATTCACAAAGGACGGACCATGAGAGACACACCCGAGTTTGTTTCGTTC  1239
              || |||||| | |||||||| || || || ||| | ||||| || |||||||| || |||
Sbjct  69747  CATCAGTTTTTAATTCACAAGGGGCGCACAATGCGGGACACGCCGGAGTTTGTATCATTC  69806

Query  1240   CGTCGCGTTACACAGGAGCTTTGGGGCAGTGTAGAAGAGGCTCTGCGAGCGCTGGAGACT  1299
              || || ||  ||||||| |  ||||| |  || ||||| ||| | || || |||||| ||
Sbjct  69807  CGACGGGTAGCACAGGAACAGTGGGGGAACGTTGAAGATGCTTTACGTGCACTGGAGGCT  69866

Query  1300   CTGCTCGCGCAGTATTTTGTACCTCTGGCTTACGTTGATGGCCAGCGACTGCTCGCACTC  1359
               | ||| ||||||| ||||| ||  |||| ||| | |||||||||||| || |  |||||
Sbjct  69867  TTACTCACGCAGTACTTTGTTCCATTGGCGTACATCGATGGCCAGCGATTGTTGTCACTC  69926

Query  1360   GCAGGTACAGGCCAACCTCGATTCTCTAAGCGCGAACTGCTGTCCTGTATTGTGAATGAA  1419
              ||||  ||||| ||  |||| ||||| ||  | |||||||||||||||||||||||||||
Sbjct  69927  GCAGCCACAGGTCAGTCTCGCTTCTCGAAATGGGAACTGCTGTCCTGTATTGTGAATGAA  69986

Query  1420   GATCAAGTTATGTCGGTACTGCGACGTCCAGGCCAACGGTATAAAGGGCGAGATCGTAAA  1479
              || ||||||| | || |||| || ||||| |||||||| || || ||  | ||||| |||
Sbjct  69987  GACCAAGTTACGGCGATACTCCGGCGTCCTGGCCAACGATACAAGGGAAGGGATCGCAAA  70046

Query  1480   CGCCGTGCTGCTACTACAATCGAAGCTTGTGTTCGTATGTGGCTAGTCCGTCGGAGGTAC  1539
              || ||||||||||| ||| |  |||||| ||| || ||||||  | | || ||  | |||
Sbjct  70047  CGACGTGCTGCTACAACACTTCAAGCTTCTGTGCGCATGTGGTCACTGCGCCGCCGATAC  70106

Query  1540   GCTCGCACTCGTGCCAGC--GACTTCAATGCGAGCAAAATTCAGCTTGCGTGGCGAGCCT  1597
              |||||   |||||  ||   | |   | ||| | |||||| ||||| || ||||| ||||
Sbjct  70107  GCTCGG--TCGTGTAAGAATGTCGGTAGTGCTACCAAAATCCAGCTAGCATGGCGTGCCT  70164

Query  1598   ACAGTTGCCATACAAGTCTCAAAGCTCGACTACGAGAAGTCCACCTAGAAAAACTCGAGA  1657
              |||| ||||||  |  ||||||| | ||  | || ||  | | || | || |||| || |
Sbjct  70165  ACAGCTGCCATGAAGCTCTCAAAACCCGCTTGCGCGATCTTCGCCAAAAACAACTTGAAA  70224

Query  1658   AATGGGAGAAAAGGATGCACAATCTCAAGTCCCACTGGCCACAAATTGCTGGTCGCCGAC  1717
              | |||||   | | ||||||  ||| ||   ||| ||| | || || || |  |||||||
Sbjct  70225  AGTGGGAAGTACGCATGCACGCTCTGAAAAACCAATGGTCTCAGATAGCAGCACGCCGAC  70284

Query  1718   GTGTTGTGGTCCACGTGCCGTCGTTATCGCTCGATGAACACTCACGTCTCGGTGCTGAGA  1777
              |||| || || ||||| || || ||||| || || ||||| || || || || |||||||
Sbjct  70285  GTGTCGTCGTTCACGTCCCATCATTATCACTTGACGAACATTCTCGCCTTGGAGCTGAGA  70344

Query  1778   ACTTTGCCATACAACAGAACCTCCAGCTGACGCGGGTATGCGCCGCTGCACTGGACTCTA  1837
              |||| ||| | || || || || ||||| |||||| ||||||| || || |||||||| |
Sbjct  70345  ACTTCGCCGTGCAGCAAAATCTTCAGCTCACGCGGATATGCGCTGCAGCGCTGGACTCCA  70404

Query  1838   ACGTGGAACTGCTGCTTTATGTGTCGCCTTTCGAGCTCACATCGGATGTTTCTCAGTACT  1897
              |||| || || ||  | |||||||| ||||||||||||||  | || || || |||||||
Sbjct  70405  ACGTCGACCTCCTTGTGTATGTGTCCCCTTTCGAGCTCACGGCTGACGTCTCGCAGTACT  70464

Query  1898   TCCTCAAACTGCTGCAACTTGGCGGTCTTGTTGACAGCAGACCTCGCGTCAAGTTAGTGT  1957
              ||||||| ||||||||||||||||| |||| ||||||| |||||||||| ||| | ||||
Sbjct  70465  TCCTCAAGCTGCTGCAACTTGGCGGACTTGCTGACAGCCGACCTCGCGTGAAGCTCGTGT  70524

Query  1958   TTCCCGAGCAAACCACGCGCTTTCCAGCCCATTTCTCGCTGTCATCGTTGTTACTCTACT  2017
              |||| || ||  |   ||| || |||   |||||||| || || ||  || | || || |
Sbjct  70525  TTCCAGAACAGGCTTTGCGTTTCCCAAGTCATTTCTCTCTATCGTCTCTGCTGCTGTATT  70584

Query  2018   CGCCTCATTGTCTGCGGCGCATCCGACACTACACTACTGGCAAAGAGGCTTACCTTGTGA  2077
              | || || ||| |  |||| || |||||||| ||  |||| || || || ||||| ||||
Sbjct  70585  CTCCACACTGTTTAAGGCGTATTCGACACTATACAGCTGGAAAGGATGCCTACCTCGTGA  70644

Query  2078   TGGGGCTACCTGGAGCTGAGGATCAACGACTAGCGATGGCGTTGGATCTGCCAATCCTCG  2137
              |||| |||||||| || || ||||| |||||||| || || || |||||||| ||| | |
Sbjct  70645  TGGGACTACCTGGTGCCGAAGATCAGCGACTAGCTATCGCATTAGATCTGCCGATCTTGG  70704

Query  2138   GTGCGCCGCCAGCTCAAGCTCTGCCGCTGCTCACTCGCTCGGGTGGCAAGCGGTTGTTGA  2197
              ||||||| |||||||| || |||||||| ||||| |||||||| || || ||| |||| |
Sbjct  70705  GTGCGCCACCAGCTCAGGCCCTGCCGCTACTCACACGCTCGGGAGGTAAACGGCTGTTAA  70764

Query  2198   TCCGAGCTGATGTAAATGTCCCCAATGGTACTTACGAGCTGTACGATGAACATGAAGTCT  2257
              |||| |||||||| || || || |  || || |||||||| ||||| || |||||| |||
Sbjct  70765  TCCGTGCTGATGTTAACGTGCCTACGGGCACCTACGAGCTTTACGACGATCATGAACTCT  70824

Query  2258   GTGCAGCGCTCGCCAAGCTTGCTATCGCTCACATGGATCAACCGAGGTGGTTAATTAAGC  2317
               ||||||||| |||||||| ||| |  | || ||||| |||||  | ||| |  | || |
Sbjct  70825  TTGCAGCGCTTGCCAAGCTCGCTGTTACGCATATGGACCAACCTCGATGGCTGCTCAAAC  70884

Query  2318   TGGACTACGATCCTCTTGATGTGGGCGAAGCGGTCGTTGACCTGTCAAACATGCAAGCGA  2377
              | |||||||| ||||||| |||||| |||||  |  ||||| | |||   |||||||| |
Sbjct  70885  TCGACTACGACCCTCTTGGTGTGGGTGAAGCCATAATTGACTTATCAGGGATGCAAGCAA  70944

Query  2378   TGCGTGAGCTGCGTCGAGAGAAGCGGACGCCCGAGTATTGGCGCCAACCAGGCCCTCGCG  2437
              |||| ||||| || || ||||| ||  | || |||||||||||||| |||||||| || |
Sbjct  70945  TGCGAGAGCTCCGGCGGGAGAAACGAGCACCGGAGTATTGGCGCCAGCCAGGCCCGCGAG  71004

Query  2438   ATGCAGCAGCAAAGCTGATTCTGGCAGAGCTAGAGCGTCCGGGAATGCTAGCGAGAATCG  2497
              |||| |||||||| ||  | ||||| |||||||||   || || |||||||| | |   |
Sbjct  71005  ATGCGGCAGCAAAACTACTGCTGGCGGAGCTAGAGAAGCCAGGTATGCTAGCCAAACATG  71064

Query  2498   CGACTCCCATGCAAACCGAAATATTCCCAAAATGGCGGGAGTTTATCGATGCCGTCGGCC  2557
              || | ||  |||| |||||||| |||||    ||||| || || |  || ||| | | ||
Sbjct  71065  CGGCACCTGTGCACACCGAAATCTTCCCGTCGTGGCGAGAATTCACTGAGGCCATTGCCC  71124

Query  2558   ATTTCGGCTGTGTCGTTGAAGCTGTCCCTCCTACAGCCA---------------TTGCTG  2602
              |||||||||| ||  | ||||| |  |||||||| ||||               ||||||
Sbjct  71125  ATTTCGGCTGCGTAATAGAAGCAGCGCCTCCTACGGCCATTTCGGGACTTAACGTTGCTG  71184

Query  2603   CCTCATCCGAGGCATCAACGGTGCTGGTAGAGCCTGCCTACGTGCGCGCGAATCTGTTTG  2662
               |||  | || ||| || |   |   || |||||  | || |||||||| ||||| ||||
Sbjct  71185  TCTCCCCAGAAGCACCAGCAACGTCAGTGGAGCCATCTTATGTGCGCGCCAATCTCTTTG  71244

Query  2663   TAGACCCGGATGGCTCCGTACACATCTCGTCGACGCAGAATGTGCTGGCAGCTGGAGGTG  2722
              || |||| |||||  | || ||  |  | || ||||||||||||||||||    | ||  
Sbjct  71245  TAAACCCCGATGGTACAGTGCATGTGACATCAACGCAGAATGTGCTGGCA---AGCGGCA  71301

Query  2723   GGGGGCTGAATAGGAAAACTGTGGCGTTCACGTTTCCTCAGACGGCTGCACC  2774
              | ||||| ||  |||| || |||||||  ||||| |||||||| || |||||
Sbjct  71302  GTGGGCTTAACCGGAAGACCGTGGCGTATACGTTCCCTCAGACAGCAGCACC  71353

 Score = 370 bits (409),  Expect = 3e-99
 Identities = 511/711 (72%), Gaps = 17/711 (2%)
 Strand=Plus/Plus

Query  2789   AGGGTGCTTGCAACGCCGCGGGAAAGCTACTAGTAGAGACGAATGTCTGGGGTTACGTCA  2848
              ||||||| |||| |||  | ||    || || || || |  |  || ||||| || ||||
Sbjct  71435  AGGGTGCATGCAGCGCAACCGGGCGACTGCTTGTGGAAATAAGCGTTTGGGGATATGTCA  71494

Query  2849   GCTTGGATTTCGTGGTCTTTCAGGATGAAAAGAGCAATGATGCACCTCGATTGTGGGCTC  2908
              |  |||| || || ||||| ||||| ||||||||||  |  ||||| ||  | |||||||
Sbjct  71495  GTGTGGACTTTGTAGTCTTCCAGGACGAAAAGAGCAGCGGAGCACCACGGCTTTGGGCTC  71554

Query  2909   TCGCTGTACATCCGTTCCTCACAGATTCCGCTACCAGCTTCGCTTGTTTCCACCTGCTCG  2968
              | ||||| || |||| ||||||| | || ||| ||||||| || || ||||||||||| |
Sbjct  71555  TGGCTGTGCACCCGTACCTCACAAACTCAGCTGCCAGCTTTGCATGCTTCCACCTGCTTG  71614

Query  2969   CTCGTGGTGTGTTAGATACGAATTCAGGTGTCTACCGAGTGGCC---AACAAGTCACTGA  3025
              | || |||    | ||| | ||||||||||| |||  ||||||    | |||  |  || 
Sbjct  71615  CCCGCGGTAGTCTGGATTCCAATTCAGGTGTTTACAAAGTGGCATCTACCAATACCTTGG  71674

Query  3026   CTACAGCCAATTCAGGACGAAAAAGCGAAAGTGGCAGCGCTACG---GACTTGCTGCTGC  3082
              | || |  ||| | || || |  |||   |||||  | | || |   ||  |||| ||||
Sbjct  71675  CCACGGGTAATCCTGGCCGCAGTAGC---AGTGGTGGTGGTATGACAGAGCTGCTACTGC  71731

Query  3083   GTGAAGCTTTACTGGCCAAA-AGTTCACTCGTAGGGGCTCGGCGTTGCTTCGTGGCGTGC  3141
              |||| ||||  || |||||| |   |  || | ||  | |  ||  |||  ||||  |||
Sbjct  71732  GTGAGGCTTCGCTAGCCAAAGACCGCCATC-TCGGTACCCCACGCAGCTATGTGGTATGC  71790

Query  3142   TCGTACGTGTTCCACCCGCACGTGATCACTATGCAGTACACTGCTTTCTTCCACGCCTGC  3201
              ||||| ||||||||||| ||||||| ||| ||||||||||  ||||| || |||||||||
Sbjct  71791  TCGTATGTGTTCCACCCACACGTGACCACCATGCAGTACAGCGCTTTTTTTCACGCCTGC  71850

Query  3202   AGATTACACGGTGTGTGCTTTGACGTGGAGAGAACTCTAGGTACACTCTTCCTGCTCGCT  3261
               |  |||| ||||| ||||||||||||||| | || ||||| || ||||| |||||| ||
Sbjct  71851  CGCCTACATGGTGTATGCTTTGACGTGGAGCGCACACTAGGCACTCTCTTTCTGCTCACT  71910

Query  3262   GACAGTCTCACAGCTGGCGTCTTCGGTATCTTGAGTATTGGAGAAACCACAGAAGGAGCT  3321
              || |||||||||||||| ||||| ||| | |||||  |||||||||| || || || || 
Sbjct  71911  GATAGTCTCACAGCTGGTGTCTTTGGTGTGTTGAGCGTTGGAGAAACAACTGACGGTGCA  71970

Query  3322   CTGGCATTTCTGCGGACTGCACTGGAAGTGATAGGCCGAGAAGCTGGCTCGACTATCAGT  3381
               ||||||| ||||| || |||||||||||||| || || || || ||  |||| ||    
Sbjct  71971  TTGGCATTCCTGCGTACAGCACTGGAAGTGATCGGGCGCGAGGCAGGAGCGACCATTGAA  72030

Query  3382   GTGGCTTCATCTCCATCTCGATCCGTTGCCTCTCGTAGTGGCAACTTTGCTCAGATTTTG  3441
               ||||| | |||| ||| |  || |      |||  || ||||||||||| ||| | || 
Sbjct  72031  ATGGCTGCGTCTCGATCCCACTCAG------CTCACAGCGGCAACTTTGCACAGGTATTA  72084

Query  3442   TCTGCTATTCGAGTGTCCACAGGCGGCGGCAAGAGCGACAGACTAGGGAAA  3492
              ||||| || || |  || || || || |||||| | || || || || |||
Sbjct  72085  TCTGCCATCCGCGCATCAACTGGTGGTGGCAAGGGTGATAGGCTTGGAAAA  72135

 Score = 248 bits (274),  Expect = 8e-63
 Identities = 307/420 (73%), Gaps = 9/420 (2%)
 Strand=Plus/Plus

Query  1      ATGGACAAGGTGCAGCAGCAACATCATGTGGAGGATGTGGGCCGGTTGTTGTTGCAGACA  60
              ||||| ||| |||| ||||| || || ||||| |||||||| ||  |  || ||||||| 
Sbjct  68421  ATGGAGAAGATGCAACAGCAGCACCACGTGGAAGATGTGGGGCGCCTTCTGCTGCAGACG  68480

Query  61     CAGGAGCAGCTTCGTGTGATGCGAGAGCAGATGACGGCAGCTGCAGCGGCCGTGGAGGCC  120
              ||||| ||  | ||||| ||||||||||| |||||||| || ||||  || ||||| |||
Sbjct  68481  CAGGAACAATTGCGTGTTATGCGAGAGCAAATGACGGCGGCAGCAGAAGCAGTGGAAGCC  68540

Query  121    AATGCATCGCCAATGCGCCACAACGCAATTGTGACAACAGCCGAAGTCCAAGCTTTCAAC  180
              || ||||| || ||||| ||||   || | || || |||||||| || ||||||||||| 
Sbjct  68541  AACGCATCACCGATGCGTCACAGTACAGTGGTAACCACAGCCGAGGTGCAAGCTTTCAAT  68600

Query  181    GCAATCTTGCAACAGACTGAGACAGAACTTCGGGCCAAAGCGGAACTTGTCCTCAATGGC  240
              || || |||||  | || ||||  ||||| || || ||||| || ||||| ||||| |||
Sbjct  68601  GCTATTTTGCAGAAAACAGAGATGGAACTGCGTGCTAAAGCAGAGCTTGTGCTCAACGGC  68660

Query  241    ATGGTTAACAGCAGTAGCAGTGCACGAAATAATCAGGCTCAGAGCGGCACTCTTCTTCCT  300
              ||||| || ||||||||||  |  | ||  |||||    |||  |||||||||||| || 
Sbjct  68661  ATGGTCAATAGCAGTAGCAACGACCAAAGCAATCAAAACCAGCACGGCACTCTTCTCCCC  68720

Query  301    GCTGTCACGGTTGCCGCTGCTCCTTCGATCATGCACCGAAGTGGATACGATAAAGCTAAT  360
              |||||||| ||||  ||  |||| || || |  |  ||  | || |||||||  |     
Sbjct  68721  GCTGTCACAGTTGGAGCACCTCCATCTATAAGACTGCGCGGAGGCTACGATAGTGTCGGC  68780

Query  361    AAGCC----ACGACAA-----ATGGACGCAAGCTCTATTCCCGTGGAATTCTTCCGAGAG  411
              |||||    | |||||     | |||||   |||| |||||  |||||||||| ||||||
Sbjct  68781  AAGCCCAAGATGACAACTCGTAAGGACGGTGGCTCGATTCCTATGGAATTCTTTCGAGAG  68840

 Score = 214 bits (236),  Expect = 2e-52
 Identities = 257/351 (73%), Gaps = 9/351 (3%)
 Strand=Plus/Plus

Query  480    TCATCACGGTCGTCTCATGCGCaaaaaaaCTACGCAACACTGTCGTCTGTTGCCTAGTGT  539
              ||| || || || ||||| || || || || || || ||||| |||||  | ||||| ||
Sbjct  69008  TCAGCAGGGACGCCTCATTCGTAAGAAGACCACACAGCACTGCCGTCTTCTACCTAGCGT  69067

Query  540    CAACAAAACTGATCCAAGCGTACCAACTCCTGAATTGCGCGAGGAGGATGCCAAGCACGG  599
              ||||||| | || || || | ||| || |||||  |  |||||||||||||||   ||||
Sbjct  69068  CAACAAAGCCGACCCCAGTGCACCTACACCTGAGCTCTGCGAGGAGGATGCCAGATACGG  69127

Query  600    CGTTTTGAACTTGGTCACGCGCGGGTTTCTCCCTGCGTACGCAGATCTGACTCCAGTCTT  659
               || ||| |||| || ||||| || ||| | || || ||||| ||||| || || | |||
Sbjct  69128  GGTGTTGGACTTAGTGACGCGTGGATTTTTGCCGGCATACGCGGATCTCACACCGGCCTT  69187

Query  660    CA---------GTGGTACGAGCGATGGCTCTGGTGGTGGGGTGATGAAACAGCGTGCAAC  710
              |          |||| ||  | |||||  | |||||||| |  |||||||||||||||||
Sbjct  69188  CTCAGGCCCTGGTGGCACTCGAGATGGACCGGGTGGTGGTGCCATGAAACAGCGTGCAAC  69247

Query  711    CCGAATCTATAATCGCTCCGAACAAGTAGTTCGGTCGACTCCTTTTACTCAGTCCACAGG  770
               || || |||||||| || || ||| | |  ||| | ||||| ||||| |||||||| ||
Sbjct  69248  TCGGATATATAATCGTTCTGAGCAATTCGCACGGCCCACTCCATTTACGCAGTCCACGGG  69307

Query  771    CTATAATCTGGCATCATTGAAGTTCGATCTTCGAGCTCCACCAACGCCCCC  821
              ||| ||||| ||| |  | ||||| ||||| ||||  ||||| ||||| ||
Sbjct  69308  CTACAATCTTGCAGCGCTAAAGTTTGATCTCCGAGGACCACCGACGCCTCC  69358

>PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2956, whole genome shotgun sequence
Length=1921269

 Score = 1068 bits (1184),  Expect = 0.0
 Identities = 1232/1663 (74%), Gaps = 18/1663 (1%)
 Strand=Plus/Minus

Query  1138     AAAATTCGTGGTTACAACGAACTGCTGGATGTGTATAGTTTGCACCAGTTTCTGATTCAC  1197
                ||||| ||||  || ||||| ||  | ||||  ||||||||||||||| || ||||| | 
Sbjct  1843048  AAAATCCGTGAATATAACGATCTAGTAGATGCTTATAGTTTGCACCAGATTTTGATTTAT  1842989

Query  1198     AAAGGACGGACCATGAGAGACACACCCGAGTTTGTTTCGTTCCGTCGCGTTACACAGGAG  1257
                || || ||  | || |||||||| ||||| |||  ||||||||| || |||   || || 
Sbjct  1842988  AAGGGGCGTGCTATAAGAGACACGCCCGAATTTACTTCGTTCCGCCGGGTTGTTCACGAC  1842929

Query  1258     CTTTGGGGCAGTGTAGAAGAGGCTCTGCGAGCGCTGGAGACTCTGCTCGCGCAGTATTTT  1317
                |||||||| ||||| ||||| | ||| ||||| |||||  |  |  |    || ||||||
Sbjct  1842928  CTTTGGGGAAGTGTTGAAGAAGTTCTACGAGCACTGGAAGCAATTTTATTTCAATATTTT  1842869

Query  1318     GTACCTCTGGCTTACGTTGATGGCCAGCGACTGCTCGCACTCGCAGGTACAGGCCAACCT  1377
                || ||| ||||| | |||||||| |||||| || | |||||||||   |||  ||| |||
Sbjct  1842868  GTTCCTTTGGCTCATGTTGATGGTCAGCGATTGATAGCACTCGCATCAACAAACCAGCCT  1842809

Query  1378     CGATTCTCTAAGCGCGAACTGCTGTCCTGTATTGTGAATGAAGATCAAGTTATGTCGGTA  1437
                | ||| || |  || |||||  |||| |||||||| ||| |||| ||||| |||||||||
Sbjct  1842808  CAATTTTCAAGACGGGAACTTTTGTCTTGTATTGTAAATAAAGAGCAAGTGATGTCGGTA  1842749

Query  1438     CTGCGACGTCCAGGCCAACGGTATAAAGGGCGAGATCGTAAACGCCGTGCTGCTACTACA  1497
                 |||| || || || || || ||||| ||  | ||||| ||||  |||||||||||||||
Sbjct  1842748  TTGCGGCGCCCGGGTCAGCGATATAATGGAAGGGATCGCAAACATCGTGCTGCTACTACA  1842689

Query  1498     ATCGAAGCTTGTGTTCGTATGTGGCTAGTCCGTCGGAGGTACGCTCGCACTCGTGCCAGC  1557
                ||  |||| || |  ||||||||| | || | ||   | || |      |||||  ||||
Sbjct  1842688  ATACAAGCCTGCGCCCGTATGTGGATGGTACATCACCGATATGTAAAATCTCGTAGCAGC  1842629

Query  1558     GACTTCAATGCGAGCAAAATTCAGCTTGCGTGGCGAGCCTACAGTTGCCATACAAGTCTC  1617
                 |  |||| || |  |||||||||  ||| |  || ||||||||| ||  ||||   || 
Sbjct  1842628  AATATCAACGCAATAAAAATTCAGTCTGCTTTTCGTGCCTACAGTCGCTGTACAGCCCTT  1842569

Query  1618     AAAGCTCGACTACGAGAAGTCCACCTAGAAAAACTCGAGAAATGGGAGAAAAGGATGCAC  1677
                ||||||||| | |||||  | | |   ||||||   | ||||||||||  ||| ||| ||
Sbjct  1842568  AAAGCTCGATTGCGAGAGATTCGCTGCGAAAAAGCAGCGAAATGGGAGGCAAGAATGTAC  1842509

Query  1678     AATCTCAAGTCCCACTGGCCACAAATTGCTGGTCGCCGACGTGTTGTGGTCCACGTGCCG  1737
                 |  | ||||| || ||| |||| ||||| |  ||||| ||| ||||||| || ||||||
Sbjct  1842508  GAATTTAAGTCTCAATGGTCACAGATTGCAGCACGCCGGCGTATTGTGGTTCATGTGCCG  1842449

Query  1738     TCGTTATCGCTCGATGAACACTCACGTCTCGGTGCTGAGAACTTTGCCATACAACAGAAC  1797
                ||  | || ||||  || || |||||||||  |||||| || || ||  |||| ||||| 
Sbjct  1842448  TCAATGTCACTCGGAGAGCATTCACGTCTCAATGCTGAAAATTTCGCAGTACAGCAGAAT  1842389

Query  1798     CTCCAGCTGACGCGGGTATGCGCCGCTGCACTGGACTCTAACGTGGAACTGCTGCTTTAT  1857
                || || || || ||| |||| || |||||  |||| |   | ||||| |||||  | |||
Sbjct  1842388  CTTCAACTTACCCGGATATGTGCTGCTGCCTTGGATTTGCAAGTGGATCTGCTCGTATAT  1842329

Query  1858     GTGTCGCCTTTCGAGCTCACATCGGATGTTTCTCAGTACTTCCTCAAACTGCTGCAACTT  1917
                || || |||| |||||||||| | |||||||| |||||||| | ||||||| | ||||||
Sbjct  1842328  GTTTCACCTTACGAGCTCACAGCAGATGTTTCCCAGTACTTTCACAAACTGTTACAACTT  1842269

Query  1918     GGCGGTCTTGTTGACAGCAGACCTCGCGTCAAGTTAGTGTTTCCCGAGCAAACCACGCGC  1977
                 | |||| || ||||||| |||| ||||| ||||| |||| ||| |||||| |  |||| 
Sbjct  1842268  AGTGGTCCTGCTGACAGCCGACCACGCGTGAAGTTTGTGTATCCGGAGCAAGCTGCGCGG  1842209

Query  1978     TTTCCAGCCCATTTCTCGCTGTCATCGTTGTTACTCTACTCGCCTCATTGTCTGCGGCGC  2037
                |||||||| ||||| || || ||||||||  |||||||||||||  ||||||| || || 
Sbjct  1842208  TTTCCAGCTCATTTTTCACTCTCATCGTTAATACTCTACTCGCCCTATTGTCTTCGACGG  1842149

Query  2038     ATCCGACACTACACTACTGGCAAAGAGGCTTACCTTGTGATGGGGCTACCTGGAGCTGAG  2097
                ||||||||||||||| |||| || ||||| |||||||| |||||  | |||||  |||| 
Sbjct  1842148  ATCCGACACTACACTGCTGGTAACGAGGCGTACCTTGTAATGGGATTGCCTGGTCCTGAA  1842089

Query  2098     GATCAACGACTAGCGATGGCGTTGGATCTGCCAATCCTCGGTGCGCCGCCAGCTCAAGCT  2157
                |||||||| ||||| ||  || | || || || || || |||||||  ||  ||||||||
Sbjct  1842088  GATCAACGGCTAGCCATAACGCTAGACCTTCCGATACTTGGTGCGCTACCGTCTCAAGCT  1842029

Query  2158     CTGCCGCTGCTCACTCGCTCGGGTGGCAAGCGGTTGTTGATCCGAGCTGATGTAAATGTC  2217
                |||||  ||||||| || || ||||||||||| || ||||||| ||| ||  ||||||||
Sbjct  1842028  CTGCCATTGCTCACACGATCAGGTGGCAAGCGATTATTGATCCAAGCCGACATAAATGTC  1841969

Query  2218     CCCAATGGTACTTACGAGCTGTACGATGAACATGAAGTCTGTGCAGCGCTCGCCAAGCTT  2277
                |||| ||| ||||| ||| ||||||||||||||||| ||| || ||| || ||||| |||
Sbjct  1841968  CCCACTGGCACTTATGAGTTGTACGATGAACATGAAATCTCTGTAGCACTTGCCAAACTT  1841909

Query  2278     GCTATCGCTCACATGGATCAACCGAGGTGGTTAATTAAGCTGGACTACGATCCTCTTGAT  2337
                ||| ||||||| || || ||  |||  ||| | || ||||| |||||||||||||| | |
Sbjct  1841908  GCTGTCGCTCATATCGACCAGTCGAAATGGCTTATCAAGCTTGACTACGATCCTCTCGGT  1841849

Query  2338     GTGGGCGAAGCGGTCGTTGACCTGTCAAACATGCAAGCGATGCGTGAGCTGCGTCGAGAG  2397
                || |||||||||||||||||||| |||| ||||||||||||||||||  |||  || || 
Sbjct  1841848  GTAGGCGAAGCGGTCGTTGACCTTTCAAGCATGCAAGCGATGCGTGAATTGCACCGTGAA  1841789

Query  2398     AAGCGGACGCCCGAGTATTGGCGCCAACCAGGCCCTCGCGATGCAGCAGCAAAGCTGATT  2457
                ||||| || || || |||||||| ||||| ||  |||| || ||||| || || ||| ||
Sbjct  1841788  AAGCGTACACCAGAATATTGGCGACAACCTGGTACTCGGGACGCAGCTGCTAACCTGTTT  1841729

Query  2458     CTGGCAGAGCTAGAGCGTCCGGGAATGCTAGCGAGAATCGCGACTCCCATGCAAACCGAA  2517
                 || | ||  | ||||||||||| | ||||||  || |  |||| ||||| || ||||||
Sbjct  1841728  TTGACGGAATTTGAGCGTCCGGGCAAGCTAGCACGACTTACGACACCCATACACACCGAA  1841669

Query  2518     ATATTCCCAAAATGGCGGGAGTTTATCGATGCCGTCGGCCATTTCGGCTGTGTCGTTGAA  2577
                 |||  || |  ||||| || | |  ||  ||  | || ||||||||||||||  | |||
Sbjct  1841668  TTATATCCGACTTGGCGAGAATATGCCGCAGCTATTGGTCATTTCGGCTGTGTTATCGAA  1841609

Query  2578     GCTGTCCCTCCTACAGCCATTGCTGCCTCATCCGAGGCATCAACGGTGCTGGTAGAGCCT  2637
                ||||| ||||| ||||| | |||||| ||                  | |||  ||||| 
Sbjct  1841608  GCTGTTCCTCCAACAGCTAGTGCTGCTTC------------------GATGGAGGAGCCA  1841567

Query  2638     GCCTACGTGCGCGCGAATCTGTTTGTAGACCCGGATGGCTCCGTACACATCTCGTCGACG  2697
                 | ||| |||| || ||| | ||||| || ||| ||||  | ||||||||  ||||||||
Sbjct  1841566  ACTTACTTGCGAGCAAATATTTTTGTCGATCCGAATGGTACTGTACACATGACGTCGACG  1841507

Query  2698     CAGAATGTGCTGGCAGCTGGAGGTGGGGGGCTGAATAGGAAAACTGTGGCGTTCACGTTT  2757
                |||||||||||  || ||  | | || ||  | | | | ||  |||     ||  |||||
Sbjct  1841506  CAGAATGTGCTTACAACTACAAGGGGCGGATTAAGTCGAAAGTCTGAAATTTTTGCGTTT  1841447

Query  2758     CCTCAGACGGCTGCACCATATGAGGCAATTAAGGGTGCTTGCA  2800
                || || || |  || ||| ||| |||||| |||| |  |||||
Sbjct  1841446  CCGCAAACAGTGGCGCCACATGCGGCAATCAAGGTTTGTTGCA  1841404

 Score = 321 bits (355),  Expect = 2e-84
 Identities = 502/715 (70%), Gaps = 20/715 (3%)
 Strand=Plus/Minus

Query  2789     AGGGTGCTTGCAACGCCGCGGGAAAGCTACTAGTAGAGACGAATGTCTGGGGTTACGTCA  2848
                ||||||| ||||| || | ||||||||  ||||  || |||||||| ||||| || || |
Sbjct  1841348  AGGGTGCATGCAATGCTGTGGGAAAGCAGCTAGCCGAAACGAATGTTTGGGGCTATGTGA  1841289

Query  2849     GCTTGGATTTCGTGGTCTTTCAGGATGAAAAGAGCAATGATGCACCTCGATTGTGGGCTC  2908
                | || || || |||||||| || |||   |||   |||| ||||   ||| ||||||| |
Sbjct  1841288  GTTTAGACTTTGTGGTCTTCCAAGATATTAAGTCTAATGCTGCAGTACGACTGTGGGCCC  1841229

Query  2909     TCGCTGTACATCCGTTCCTCACAGATTCCGCTACCAGCTTCGCTTGTTTCCACCTGCTCG  2968
                | ||  |||| || ||  | ||| |||| ||| | | |||||| || || || |||||  
Sbjct  1841228  TTGCGATACACCCATTTTTAACAAATTCAGCTGCAACCTTCGCATGCTTTCATCTGCTGA  1841169

Query  2969     CTCGTGG-TGTGTTAGATACGAATTCAGGTGTCTACCGAGTGGCC------AACAAGTCA  3021
                |||| || ||| || ||  | || || ||| ||||||||||| |       || |||| |
Sbjct  1841168  CTCGCGGCTGT-TTGGACGCTAACTCCGGTATCTACCGAGTGCCTGGTACTAAAAAGTTA  1841110

Query  3022     CTGACTACAGCCAATTCAGGACGAAAAAGCGAAAGTGGCAGCGCTACGGACTTGCTGCTG  3081
                | |||| |    | | ||| ||   |||||| || |      || | |||||||||  | 
Sbjct  1841109  CAGACTGCGTGTACTGCAGAAC---AAAGCGGAAATCATGATGCCATGGACTTGCTATTA  1841053

Query  3082     CGTGAAGCTTTACTGGCCAAAAGTTCACTCGTAGGGGCTCGGCGTTGCTTCGTGGCGTGC  3141
                ||||||||||  ||  |||||     | |   ||| ||   ||| || |  |||| ||| 
Sbjct  1841052  CGTGAAGCTTCGCTAACCAAAGCCATATTTCAAGGTGCCACGCGCTGTTATGTGGTGTGT  1840993

Query  3142     TCGTACGTGTTCCACCCGCACGTGATCACTATGCAGTACACTGCTTTCTTCCACGCCTGC  3201
                ||||| ||||| || ||  |||||| | | | |||||| ||| | ||||||||   ||||
Sbjct  1840992  TCGTATGTGTTTCATCCAAACGTGACCGCGACGCAGTATACTACCTTCTTCCAAAACTGC  1840933

Query  3202     AGATTACACGGTGTGTGCTTTGACGTGGAGAGAACTCTAGGTACACTCTTCCTGCTCGCT  3261
                ||  | || |||||||| |||||||||    || || | |||||||||||  | || || 
Sbjct  1840932  AGGCTTCATGGTGTGTGTTTTGACGTGAGCCGAGCTTTGGGTACACTCTTTTTACTTGCC  1840873

Query  3262     GACAGTCTCACAGCTGGCGTCTTCGGTATCTTGAGTATTGGAGAAACCACAGAAGGAGCT  3321
                || ||||||||||||||||||||||| |||||||| || ||||| ||| |  |||  |||
Sbjct  1840872  GATAGTCTCACAGCTGGCGTCTTCGGCATCTTGAGCATAGGAGAGACCGCTCAAGACGCT  1840813

Query  3322     CTGGCATTTCTGCGGACTGCACTGGAAGTGATAGGCCGAGAAGCTGGCTCGACTATCAGT  3381
                 || | |   |||| |||||  |||| ||||| ||||| ||||||||| ||||||   | 
Sbjct  1840812  TTGTCGTACTTGCGAACTGCTTTGGAGGTGATCGGCCGTGAAGCTGGCGCGACTAAAGGC  1840753

Query  3382     GTGGCTTCATCTCCATCTCGATCCGTTGCCTCTCGTAGTGGCAACTTTGCTCAGATTTTG  3441
                 | | ||| ||  | |||||||| ||  |||        |||||||||||| |  | |||
Sbjct  1840752  ATAGTTTCTTCGTCTTCTCGATCAGT--CCT-------GGGCAACTTTGCTGATGTCTTG  1840702

Query  3442     TCTGCTATTCGAGTGTCCACAGGCGGCGGCAAGAGCGACAGACTAGGGAAAATGC  3496
                ||  || | |||| ||||||||| || ||||  ||| ||||||| ||  || |||
Sbjct  1840701  TCGACTGTCCGAGCGTCCACAGGTGGAGGCAGTAGCAACAGACTTGGTCAAGTGC  1840647

 Score = 208 bits (230),  Expect = 7e-51
 Identities = 255/347 (73%), Gaps = 6/347 (2%)
 Strand=Plus/Minus

Query  1        ATGGACAAGGTGCAGCAGCAACATCATGTGGAGGATGTGGGCCGGTTGTTGTTGCAGACA  60
                ||||| || ||||| |||||  ||||||| || ||||||||  ||||| || || |||| 
Sbjct  1844209  ATGGAGAAAGTGCAACAGCATTATCATGTAGAAGATGTGGGTAGGTTGCTGCTGGAGACG  1844150

Query  61       CAGGAGCAGCTTCGTGTGATGCGAGAGCAGATGACGGCAGCTGCAGCGGCCGTGGAGGCC  120
                || |||||||| || | |||||| ||||||||||| || || |||||  || ||||||||
Sbjct  1844149  CAAGAGCAGCTACGAGCGATGCGTGAGCAGATGACAGCGGCCGCAGCATCCATGGAGGCC  1844090

Query  121      AATGCATCGCCAATGCGCCACAACGCAATTGTGACAACAGCCGAAGTCCAAGCTTTCAAC  180
                ||   ||| || | ||| ||||   || |  | ||||  || || || || || ||  ||
Sbjct  1844089  AACAAATCACCCAAGCGTCACAGTTCAGTAATAACAAATGCTGAGGTGCAGGCCTTTCAC  1844030

Query  181      GCAATCTTGCAACAGACTGAGACAGAACTTCGGGCCAAAGCGGAACTTGTCCTCAATGGC  240
                ||  | ||||||||||||||| | |||||||| ||||| || || || ||  | ||||||
Sbjct  1844029  GCTTTATTGCAACAGACTGAGTCGGAACTTCGAGCCAAGGCAGAGCTCGTGTTGAATGGC  1843970

Query  241      ATGGTTAACAGCAGTAGCAGTGCACGAAATAATCAGGCTCAGAGCGGCACTCTTCTTCCT  300
                ||  | |||||||| | ||||| ||  ||||  |||| |||  ||   |||| ||| || 
Sbjct  1843969  ATAATCAACAGCAGCAACAGTGTACATAATAGCCAGGTTCAACGCAATACTCGTCTACCG  1843910

Query  301      GCTGTCACGGTTGCCGCTGCTCCTTCG---ATCATGCACCGAAGTGG  344
                |||||| | |||   ||||| ||||||   || | ||| ||||| ||
Sbjct  1843909  GCTGTCTCAGTT---GCTGCACCTTCGCCTATAAAGCATCGAAGGGG  1843866

 Score = 145 bits (160),  Expect = 7e-32
 Identities = 226/322 (70%), Gaps = 31/322 (10%)
 Strand=Plus/Minus

Query  410      AGCAATTTCGCAACAACAGCGTTGAGATTCGACAGTCTTT---------GCCTGAGCCGT  460
                |||||||||||||||| || || |||||||| ||||||||         ||||||    |
Sbjct  1843731  AGCAATTTCGCAACAATAGAGTAGAGATTCGGCAGTCTTTAATGACATCGCCTGAAAACT  1843672

Query  461      GGGAACGGCATTTTGGAATTCATCACGGTCGTCTCATGCGCaaaaaaaCTACGCAACACT  520
                ||   ||  |   ||||  ||      | ||| |   ||| |||||||||||||| ||||
Sbjct  1843671  GGCGGCGAAAAAGTGGAGCTC------GACGTGT---GCGTAAAAAAACTACGCAGCACT  1843621

Query  521      GTCGTCTGTTGCCTAGTGTCAACAAAACTGATCCAAGCGTACCAACTCCTGAATTGCGCG  580
                 |||||| |||||| |||| |||||| |||| ||||| | ||| || || ||  ||||||
Sbjct  1843620  ATCGTCTCTTGCCTTGTGTTAACAAAGCTGACCCAAGTGAACCGACACCAGATCTGCGCG  1843561

Query  581      AGGAGGATGCCAAGCACGGCGTTT--TGAACTTGGTCACGCGCGGGTTTCTCCCTGCGTA  638
                | || ||||| |  || |  || |  | ||||| ||||| ||||| ||||||||||||||
Sbjct  1843560  AAGAAGATGCTA--CATGTGGTCTACTAAACTTAGTCACACGCGGATTTCTCCCTGCGTA  1843503

Query  639      CGCAGATCTGACTCCAGTCTT--CAG-------TGGTACGAGCGATGGCTCTGGTGGTGG  689
                 |||||| ||||||| | |||  |||        || |  ||  |||||||||||||| |
Sbjct  1843502  TGCAGATTTGACTCCGGCCTTTGCAGGACCTAACGGAAAAAGTAATGGCTCTGGTGGTTG  1843443

Query  690      GGTGATGAAACAGCGTGCAACC  711
                 |   | ||||| || || |||
Sbjct  1843442  TGCTCTCAAACACCGAGCGACC  1843421

>PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_8:1:111390:1 
REF
Length=111390

 Score = 217 bits (240),  Expect = 1e-53
 Identities = 847/1306 (65%), Gaps = 38/1306 (3%)
 Strand=Plus/Minus

Query  1129   AATGTCGATAAAATTCGTGGTTACAACGAACTGCTGGATGTGTATAGTTTGCACCAGTTT  1188
              || || || || || || || || ||||| || |||||   ||| ||| |||| ||||| 
Sbjct  99786  AACGTGGAGAAGATCCGCGGGTATAACGAGCTCCTGGACACGTACAGTCTGCATCAGTTC  99727

Query  1189   CTGATTCACAAAGGACGGACCATGAGAGACACACCCGAGTTTGTTTCGTTCCGTCGCGTT  1248
               | |||||||| || ||| | ||| | || || |||||||| || ||||||   ||||| 
Sbjct  99726  ATCATTCACAAGGGTCGGGCGATGCGCGAGACGCCCGAGTTCGTGTCGTTCAAGCGCGTG  99667

Query  1249   ACACAGGAGCTTTGGGGCAGTGTAGAAGAGGCTCTGCGAGCGCTGGAGACTCTGCTCGCG  1308
               | |||||  | ||||| || || || ||||   |  | || || ||| | |||||| ||
Sbjct  99666  GCGCAGGAAGTCTGGGGGAGCGTCGAGGAGGTGATCAGGGCCCTTGAGGCGCTGCTCACG  99607

Query  1309   CAGTATTTTGTACCTCTGGCTTACGTTGATGGCCAGCGACTGCTCGCACTCGCAGGTACA  1368
              |  || || || || || || ||| | || |||||||||||  |  |  |||| |  |  
Sbjct  99606  CGCTACTTCGTGCCACTCGCGTACATCGACGGCCAGCGACTCATGACGGTCGCGGCGATG  99547

Query  1369   G-GCCAACCTCGATTCTCTAAGCGCGAACTGCTGTCCTGTATTGTGAATGAAGATCAAGT  1427
              | |    |  || |||   ||||||||  |||| || || || ||||| ||||| || ||
Sbjct  99546  GAGATGGCGGCG-TTCAGCAAGCGCGACTTGCTCTCGTGCATCGTGAACGAAGACCAGGT  99488

Query  1428   TATGTCGGTACTGCGACGTCCAGGCCAACGGTATAAAGGGCGAGATCGTAAACGCCGTGC  1487
                  ||| |  | ||||| || || || ||||| || ||   ||| || || ||||| ||
Sbjct  99487  CGGCTCGCTTATCCGACGCCCCGGACAGCGGTACAAGGGCAAAGACCGCAAGCGCCGCGC  99428

Query  1488   TGCTACTACAATCGAAG-CTTGTGTTCGTATGTGGCT-AGTCCGTCGGAGGTACGCTCGC  1545
               || |  || ||| ||  ||| | | || ||||||   | || |  | || ||| | |||
Sbjct  99427  CGCGATCACGATCCAAAACTTCT-TCCGCATGTGGTGGAATCAGAAGAAG-TACACCCGC  99370

Query  1546   ACTCGTGCCAGCGACTT-CAA----TGCGAGCAAAATTCAGCTTGCGTGGCGAGCCTACA  1600
                 ||  ||| |  ||  |||    || || ||   | ||||  |  ||||| || | | 
Sbjct  99369  TTCCG--CCACCATCTCGCAAGCGTTGTGACCA---TCCAGCGGGTATGGCGCGCGTTCG  99315

Query  1601   GTTGCCATACAAGTCTCAAAGCTCGACTACGAGAAGTCCACCTAG---AAAAACTCGAGA  1657
                 ||||   ||| ||||| || | |   | ||   |||| |  |   |  | | |||| 
Sbjct  99314  CGAGCCACGAAAGCCTCAA-GCGCAAGCTCAAGT--TCCAGCGCGCGCAGCAGCACGAGC  99258

Query  1658   AATGGGAGAAAAGGATGCACAATCTCAAGTCCCACTGGCCACAAATTGCTGG---TCGCC  1714
              ||||||||   | ||||||    ||||||  | ||||| | || ||    ||   |||||
Sbjct  99257  AATGGGAGGCCAAGATGCAGCGCCTCAAGCGCGACTGGACGCATATCAAGGGGAATCGCC  99198

Query  1715   GACGTGTTGTGGTCCACGTGCCGTCGTTATCGCTCGATGAACACTCACGTCTCGGTGCTG  1774
              | ||||  ||  |||||||||||||| | ||| | || || |  || ||  || | || |
Sbjct  99197  G-CGTG--GTCATCCACGTGCCGTCGCTCTCGATTGACGAGCGGTCTCGCATCAGCGCCG  99141

Query  1775   AGAACTTTGCCATACAACAGAACCTCCAGCTGACGCGGGTATGCGCCGCTGCACTGGACT  1834
              | || ||  |  |  | |||||  |||||||  ||||| | ||||    |    | ||| 
Sbjct  99140  ACAATTTCTCGGTCAAGCAGAATATCCAGCTCTCGCGGCTCTGCGGACTTA---TCGACC  99084

Query  1835   CTAACGTGGAACTGCTGCTTTATGTGTCGCCTTTCGAGCTCACATCGGATGTTTCTCAGT  1894
              | ||||| ||  |  || | || || ||||| || ||||||||  | || ||  | ||||
Sbjct  99083  CAAACGTCGACAT--TG-TCTACGTCTCGCCCTTTGAGCTCACGGCCGACGTGGCGCAGT  99027

Query  1895   ACTTCCTCAAACTGCTGCAACTTGGCGGTCTTGTTGACAGCAGACCTCGCGTCAAGTTAG  1954
              |||   | ||  ||||||| ||||| ||  |||  |||  |    | ||||| ||  | |
Sbjct  99026  ACTCGATGAAGTTGCTGCAGCTTGGAGGGATTGCGGACCCCGTCGCGCGCGTGAAACTCG  98967

Query  1955   TGTTTCCCGAGCAAACCACGCGCTTTCCAGCCCATTTCTCGCTGTCATCGTTGTTACTCT  2014
              ||| ||| |||||| |  |||| || ||||| || || |||||  |  || | ||  | |
Sbjct  98966  TGTATCCTGAGCAAGCGGCGCGGTTCCCAGCGCACTTTTCGCTCACGACGCTCTTGTTGT  98907

Query  2015   ACTCGCCTCATTGTCTGCGGCGCATCCGACACTACACTACTGGCAAAGAGGCTTACCTTG  2074
              ||||||| || ||||||||||| ||||  |  |||| ||    ||| ||||| ||| | |
Sbjct  98906  ACTCGCCGCACTGTCTGCGGCGTATCCAGCGGTACATTAGAAACAAGGAGGCGTACTTGG  98847

Query  2075   TGATGGGGCTACCTGGAGCTGAGGATCAACGACTAGCGATGGCGTTGGATCTGCCAATCC  2134
              | | |||| | || |||   || ||  | ||||| ||| |||||||| |  |||| ||||
Sbjct  98846  TCACGGGGATTCCCGGACGCGAAGACAAGCGACTCGCGGTGGCGTTGAACGTGCCGATCC  98787

Query  2135   TCGGTGCGCCGCCAGCTCA-AGCTCTGCCGCTGCTCACTCGCTCGGGTGGCAAGCGGTTG  2193
              ||||   |   ||| ||||  ||  |||| ||  | ||    |||||  ||||||| || 
Sbjct  98786  TCGGCATGGACCCA-CTCAGCGCATTGCCACTCATGACCAAGTCGGGCAGCAAGCGCTTC  98728

Query  2194   TTGATCCGAGCTGATGTAAATGTCCCCAATGGTACTTACGAGCTGTACGATGAACATGAA  2253
              || || || || ||||| || || ||||  || || || ||  | ||||| ||  | || 
Sbjct  98727  TTCATGCGCGCGGATGTGAACGTGCCCACGGGCACGTATGACATCTACGACGAGGACGAG  98668

Query  2254   GTC-TGTGCAGCGCTCGCCAAGCTTGCTATCGCTCACATGGATCAACCGAGGTGGTTAAT  2312
               || ||| |  |||||||||||||    ||  | ||||| || |||      ||| |  |
Sbjct  98667  CTCGTGTTC-TCGCTCGCCAAGCTCATCATGTCGCACATCGAGCAAAGCGTCTGGGTGCT  98609

Query  2313   TAAGCTGGACTACGATCCTCTTGATGTGGGCGAAGCGGTCGTTGACCTGTCAAACATGCA  2372
               ||| | || ||||| ||  | | |   |||   ||| |  | ||| | || | ||||  
Sbjct  98608  CAAGATCGATTACGACCCGTTCGGTACTGGCACGGCGCTACTCGACGTCTCGACCATGAC  98549

Query  2373   AGCGATGCGTGAGCTGCGTCGAGAGAAGCGGACGCCCGAGTATTGG  2418
              || | |||| ||| | || || ||||||  ||  || ||||| |||
Sbjct  98548  AGTGCTGCGCGAGATCCGCCGCGAGAAGAAGAGCCCTGAGTACTGG  98503

 Score = 97.8 bits (107),  Expect = 3e-17
 Identities = 112/151 (74%), Gaps = 0/151 (0%)
 Strand=Plus/Minus

Query  3144   GTACGTGTTCCACCCGCACGTGATCACTATGCAGTACACTGCTTTCTTCCACGCCTGCAG  3203
              |||| | ||||||||| ||||   ||| ||||| ||||  || ||||| ||| ||||  |
Sbjct  97665  GTACATTTTCCACCCGAACGTATCCACGATGCAATACAGCGCGTTCTTTCACACCTGTCG  97606

Query  3204   ATTACACGGTGTGTGCTTTGACGTGGAGAGAACTCTAGGTACACTCTTCCTGCTCGCTGA  3263
                | ||||| || ||||||||||| ||| |     | ||  |  | ||||||||||| ||
Sbjct  97605  GCTGCACGGCGTCTGCTTTGACGTCGAGCGCTGCGTCGGCTCCGTGTTCCTGCTCGCCGA  97546

Query  3264   CAGTCTCACAGCTGGCGTCTTCGGTATCTTG  3294
              ||||||||| || || |||||||| ||| ||
Sbjct  97545  CAGTCTCACCGCCGGGGTCTTCGGCATCATG  97515

 Score = 78.8 bits (86),  Expect = 8e-12
 Identities = 73/93 (78%), Gaps = 0/93 (0%)
 Strand=Plus/Minus

Query  1       ATGGACAAGGTGCAGCAGCAACATCATGTGGAGGATGTGGGCCGGTTGTTGTTGCAGACA  60
               |||||| |  | |||||||| || ||||||||||| ||||| ||| |  || ||||||| 
Sbjct  101023  ATGGACCAATTCCAGCAGCAGCACCATGTGGAGGACGTGGGGCGGATCCTGCTGCAGACC  100964

Query  61      CAGGAGCAGCTTCGTGTGATGCGAGAGCAGATG  93
               |||||||| || ||  | ||||| ||||| |||
Sbjct  100963  CAGGAGCAACTCCGCCTCATGCGCGAGCAAATG  100931

>PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:pug:scf1117875582037:1:1414051:1 
REF
Length=1414051

 Score = 202 bits (223),  Expect = 1e-48
 Identities = 359/521 (69%), Gaps = 6/521 (1%)
 Strand=Plus/Plus

Query  1727     TCCACGTGCCGTCGTTATCGCTCGATGAACACTCACGTCTCGGTGCTGAGAACTTTGCCA  1786
                |||||||||||||| | ||| |||| ||||  |  ||  || |||| || ||||| ||  
Sbjct  1310423  TCCACGTGCCGTCGCTGTCGATCGACGAACGGTTCCGCATCCGTGCCGACAACTTCGCGG  1310482

Query  1787     TACAACAGAACCTCCAGCTGACGCGGGTATGCGCCGCTGCACTGGACTCTAACGTGGAAC  1846
                |  | |||||||| |||||  ||||| | ||||  ||  || || || | || || ||  
Sbjct  1310483  TCAAGCAGAACCTGCAGCTCTCGCGGCTCTGCG--GCATCATTG-ACGCGAATGTCGACA  1310539

Query  1847     TGCTGCTTTATGTGTCGCCTTTCGAGCTCACATCGGATGTTTCTCAGTACTTCCTCAAAC  1906
                |  ||   || || ||||| || ||||| || || || ||    ||||||||  | || |
Sbjct  1310540  TTGTG---TACGTCTCGCCGTTTGAGCTGACGTCCGAGGTCGGCCAGTACTTTATGAAGC  1310596

Query  1907     TGCTGCAACTTGGCGGTCTTGTTGACAGCAGACCTCGCGTCAAGTTAGTGTTTCCCGAGC  1966
                |||| |||||||| ||  | |  |||  |    | || |||||  | |||||||||||||
Sbjct  1310597  TGCTACAACTTGGAGGCATCGCAGACCCCGTGACGCGAGTCAAACTGGTGTTTCCCGAGC  1310656

Query  1967     AAACCACGCGCTTTCCAGCCCATTTCTCGCTGTCATCGTTGTTACTCTACTCGCCTCATT  2026
                || | || || ||||| || |||||||||||  |  || || | || |||||||| ||||
Sbjct  1310657  AAGCGACTCGGTTTCCGGCGCATTTCTCGCTCACGACGGTGCTGCTGTACTCGCCGCATT  1310716

Query  2027     GTCTGCGGCGCATCCGACACTACACTACTGGCAAAGAGGCTTACCTTGTGATGGGGCTAC  2086
                ||||||| || |||||||  | |   |  |||||||| || ||||| || | |||| | |
Sbjct  1310717  GTCTGCGCCGTATCCGACGGTGCGTCAAGGGCAAAGAAGCGTACCTGGTCACGGGGATGC  1310776

Query  2087     CTGGAGCTGAGGATCAACGACTAGCGATGGCGTTGGATCTGCCAATCCTCGGTGCGCCGC  2146
                ||||    || ||  |||| || || |||||| || |  |||| || || ||   |   |
Sbjct  1310777  CTGGCCAAGAAGACAAACGGCTCGCTATGGCGCTGAACGTGCCCATTCTGGGGATGGACC  1310836

Query  2147     CAGCTCAAGCTCTGCCGCTGCTCACTCGCTCGGGTGGCAAGCGGTTGTTGATCCGAGCTG  2206
                ||  |    | |||||| || | ||    |||||  |||||||||| || || || || |
Sbjct  1310837  CACTTGCGACACTGCCGTTGATGACAAAGTCGGGCAGCAAGCGGTTCTTCATGCGGGCCG  1310896

Query  2207     ATGTAAATGTCCCCAATGGTACTTACGAGCTGTACGATGAA  2247
                | || ||||| ||||  || || |||||  | ||||| |||
Sbjct  1310897  ACGTCAATGTGCCCACGGGAACGTACGACATCTACGACGAA  1310937

 Score = 99.6 bits (109),  Expect = 9e-18
 Identities = 265/398 (67%), Gaps = 8/398 (2%)
 Strand=Plus/Plus

Query  1128     AAATGTCGATAAAATTCGTGGTTACAACGAACTGCTGGATGTGTATAGTTTGCACCAGTT  1187
                ||| ||||| || || || || ||||| || ||  ||||    || || |||||||||||
Sbjct  1309824  AAACGTCGAAAAGATCCGCGGATACAATGAGCTCTTGGACACCTACAGCTTGCACCAGTT  1309883

Query  1188     TCTGATTCACAAAGGACGGACCATGAGAGACACACCCGAGTTTGTTTCGTTCCGTCGCGT  1247
                  | || ||||||||   | | ||| | || || || |||||||| ||||||   |||||
Sbjct  1309884  CATCATCCACAAAGGGAAGGCGATGCGCGAGACGCCGGAGTTTGTGTCGTTCAAGCGCGT  1309943

Query  1248     TACACAGGAGCTTTGGGGCAGTGTAGAAGAGGCTCTGCGAGCGCTGGAGACTCTGCTCGC  1307
                  |||| ||| | |||||| | || ||||| |   |   |||||| ||||| ||  |  |
Sbjct  1309944  GGCACAAGAGATCTGGGGCGGCGTCGAAGAAGTGATCAAAGCGCTCGAGACGCTCTTGAC  1310003

Query  1308     GCAGTATTTTGTACCTCTGGCTTACGTTGATGGCCAGCGACTGCTCGCACTCGCAGGTAC  1367
                ||  || || || || || || || || || || || || ||| |  |  ||||  ||  
Sbjct  1310004  GCGCTACTTCGTTCCACTCGCGTATGTCGACGGGCAACGGCTGATGACTGTCGC--GTCG  1310061

Query  1368     A-GGCCA--ACCTCGATTCTCTAAGCGCGAACTGCTGTCCTGTATTGTGAATGAAGATCA  1424
                | ||  |   | ||| |||   || |  ||  |||| || || || ||||| ||||| ||
Sbjct  1310062  ATGGAGATGGCGTCG-TTCAGCAAACAGGATTTGCTCTCGTGCATCGTGAACGAAGACCA  1310120

Query  1425     AGTTATGTCGGTACTGCGACGTCCAGGCCAACGGTATAAAGGGCGAGATCGTAAACGCCG  1484
                ||||   ||  |  | || || || || || || ||||||||    || || || |||||
Sbjct  1310121  AGTTGGTTCACTCATTCGGCGACCGGGTCAGCGATATAAAGGCAAGGACCGAAAGCGCCG  1310180

Query  1485     TGCTGCTACTACAAT-CGAAGCTTGTGTTCGTATGTGG  1521
                 || || |  || || | || | ||| |||| ||||||
Sbjct  1310181  CGCCGCGATCACGATCCAAAACGTGT-TTCGAATGTGG  1310217

 Score = 89.7 bits (98),  Expect = 5e-15
 Identities = 154/224 (69%), Gaps = 0/224 (0%)
 Strand=Plus/Plus

Query  3145     TACGTGTTCCACCCGCACGTGATCACTATGCAGTACACTGCTTTCTTCCACGCCTGCAGA  3204
                ||| | ||||||||  |||||   || ||||||||||   | ||||||||  ||||  | 
Sbjct  1311924  TACATCTTCCACCCCAACGTGTCGACCATGCAGTACAGCTCGTTCTTCCATACCTGTCGT  1311983

Query  3205     TTACACGGTGTGTGCTTTGACGTGGAGAGAACTCTAGGTACACTCTTCCTGCTCGCTGAC  3264
                 | || || ||||| || ||||| ||| |     | || ||  ||||| |||| || || 
Sbjct  1311984  CTGCATGGGGTGTGTTTCGACGTCGAGCGCTGCTTTGGCACCATCTTCATGCTGGCAGAT  1312043

Query  3265     AGTCTCACAGCTGGCGTCTTCGGTATCTTGAGTATTGGAGAAACCACAGAAGGAGCTCTG  3324
                || ||||| ||||||||||| || ||| |  ||   ||||| ||  |    |  || |||
Sbjct  1312044  AGCCTCACGGCTGGCGTCTTTGGGATCATCTGTTGCGGAGACACGGCGAGCGCTGCGCTG  1312103

Query  3325     GCATTTCTGCGGACTGCACTGGAAGTGATAGGCCGAGAAGCTGG  3368
                |  ||||| ||||| || || ||||| || || || || | |||
Sbjct  1312104  GGTTTTCTTCGGACAGCGCTCGAAGTCATCGGACGCGAGGTTGG  1312147

 Score = 77.9 bits (85),  Expect = 3e-11
 Identities = 83/110 (75%), Gaps = 0/110 (0%)
 Strand=Plus/Plus

Query  1        ATGGACAAGGTGCAGCAGCAACATCATGTGGAGGATGTGGGCCGGTTGTTGTTGCAGACA  60
                |||||| |  | |||||||| || || ||||||||||| || ||  |  || ||||||| 
Sbjct  1308606  ATGGACCAAATCCAGCAGCAGCACCACGTGGAGGATGTCGGGCGCATCCTGCTGCAGACG  1308665

Query  61       CAGGAGCAGCTTCGTGTGATGCGAGAGCAGATGACGGCAGCTGCAGCGGC  110
                ||||||||| | ||  | ||||| ||||| ||| || || || |||| ||
Sbjct  1308666  CAGGAGCAGTTGCGCCTCATGCGCGAGCAAATGGCGTCAACTACAGCAGC  1308715

 Score = 48.2 bits (52),  Expect = 0.014
 Identities = 47/61 (77%), Gaps = 0/61 (0%)
 Strand=Plus/Plus

Query  2640     CTACGTGCGCGCGAATCTGTTTGTAGACCCGGATGGCTCCGTACACATCTCGTCGACGCA  2699
                |||| | ||||| ||| ||||||| || ||   ||||   || ||| |||||||||||||
Sbjct  1311285  CTACATCCGCGCCAATTTGTTTGTCGAGCCAAGTGGCGAGGTCCACGTCTCGTCGACGCA  1311344

Query  2700     G  2700
                |
Sbjct  1311345  G  1311345

>PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_711:1:15030:1 
REF
Length=15030

 Score = 178 bits (197),  Expect = 1e-41
 Identities = 478/720 (66%), Gaps = 12/720 (2%)
 Strand=Plus/Minus

Query  1713   CCGACGTGTTGTGGTCCACGTGCCGTCGTTATCGCTCGATGAACACTCACGTCTCGGTGC  1772
              ||| || || ||  | |||||||| || || ||  | || |||| ||  |||||| | ||
Sbjct  13820  CCGCCGCGTGGTCATTCACGTGCCATCCTTCTCAGTTGACGAACGCTTGCGTCTCAGCGC  13761

Query  1773   TGAGAACTTTGCCATACAACAGAACCTCCAGCTGACGCGGGTATGCGCCGCTGCACTGGA  1832
               || || ||  |  |  | ||||| ||||||||  ||||  | |||| |   |   | ||
Sbjct  13760  CGACAATTTCTCGGTCAAGCAGAATCTCCAGCTTTCGCGACTCTGCGGCCTCG---TCGA  13704

Query  1833   CTCTAACGTGGAACTGCTGCTTTATGTGTCGCCTTTCGAGCTCACATCGGATGTTTCTCA  1892
              ||| ||||| ||  |  || | ||||| || || || ||||||||  |||| ||    ||
Sbjct  13703  CTCGAACGTAGACAT--TG-TCTATGTCTCACCCTTTGAGCTCACGACGGACGTGGTGCA  13647

Query  1893   GTACTTCCTCAAACTGCTGCAACTTGGCGGTCTTGTTGACAGCAGACCTCGCGTCAAGTT  1952
               ||||   | || || || || ||||||||  | |  |||  |    ||||||| ||| |
Sbjct  13646  ATACTCAATGAAGCTTCTACAGCTTGGCGGCATCGCCGACCCCGTCGCTCGCGTGAAGCT  13587

Query  1953   AGTGTTTCCCGAGCAAACCACGCGCTTTCCAGCCCATTTCTCGCTGTCATCGTTGTTACT  2012
               || |||||||||||  |  |||| || ||  | || ||||||||  |  || | || ||
Sbjct  13586  CGTCTTTCCCGAGCATGCACCGCGGTTCCCGACACACTTCTCGCTCACGACGCTCTTGCT  13527

Query  2013   CTACTCGCCTCATTGTCTGCGGCGCATCCGACACTACACTACTGGCAAAGAGGCTTACCT  2072
               || || || || ||||| || || ||||  |  ||||  |    ||| ||||| |||||
Sbjct  13526  GTATTCCCCACACTGTCTTCGCCGTATCCAGCGGTACATCAAGAACAAGGAGGCGTACCT  13467

Query  2073   TGTGATGGGGCTACCTGGAGCTGAGGATCAACGACTAGCGATGGCGTTGGATCTGCCAAT  2132
               || | |||  | || ||  | |||||| | || || || |||||| |  || |||| ||
Sbjct  13466  GGTCACGGGCATGCCCGGTCCAGAGGATAAGCGTCTCGCCATGGCGCTCAATGTGCCGAT  13407

Query  2133   CCTCGGTGCGCCGCCAGCTCA-AGCTCTGCCGCTGCTCACTCGCTCGGGTGGCAAGCGGT  2191
              |||||||  |   || |||||  || ||||| ||  | ||    || ||||||||||| |
Sbjct  13406  CCTCGGTATGGATCC-GCTCAGCGCCCTGCCACTCATGACCAAGTCTGGTGGCAAGCGCT  13348

Query  2192   TGTTGATCCGAGCTGATGTAAATGTCCCCAATGGTACTTACGAGCTGTACGATGAACATG  2251
              | || || || || || || ||||| ||||  || || |||||  | ||||| ||  | |
Sbjct  13347  TCTTCATGCGCGCCGACGTGAATGTGCCCACGGGCACGTACGACATTTACGACGAGGACG  13288

Query  2252   AAGTC-TGTGCAGCGCTCGCCAAGCTTGCTATCGCTCACATGGATCA-ACCGAGGTGGTT  2309
              |  || ||| |  |||||||||||||     || | ||||| || || | ||  |||| |
Sbjct  13287  AGCTCGTGTTC-TCGCTCGCCAAGCTCATCGTCTCGCACATTGAGCAGAGCG-TGTGGGT  13230

Query  2310   AATTAAGCTGGACTACGATCCTCTTGATGTGGGCGAAGCGGTCGTTGACCTGTCAAACAT  2369
                | ||| | ||||| || ||  |       |||  |||| |  ||||| | |||| |||
Sbjct  13229  GCTCAAGATCGACTATGACCCGTTCAGCACAGGCACAGCGCTGCTTGACGTCTCAACCAT  13170

Query  2370   GCAAGCGATGCGTGAGCTGCGTCGAGAGAAGCGGACGCCCGAGTATTGGCGCCAACCAGG  2429
              |   ||  |||||||| | || || |||||| | |  |||||||| ||| | || || ||
Sbjct  13169  GGTGGCACTGCGTGAGATTCGACGCGAGAAGAGAAGTCCCGAGTACTGGAGGCAGCCTGG  13110

 Score = 135 bits (149),  Expect = 1e-28
 Identities = 188/263 (71%), Gaps = 3/263 (1%)
 Strand=Plus/Minus

Query  1090   GACAAGGACGAATACGC---CGAGATGGAGAAATTGGGGGCAAATGTCGATAAAATTCGT  1146
              || ||||||||  ||||   ||  |||||  | ||| |    |||||||| || || || 
Sbjct  14446  GAGAAGGACGACGACGCGAACGCCATGGACGAGTTGCGCAAGAATGTCGAGAAGATCCGC  14387

Query  1147   GGTTACAACGAACTGCTGGATGTGTATAGTTTGCACCAGTTTCTGATTCACAAAGGACGG  1206
              || |||||||| ||||||||   ||| ||| | ||||||||  | || |||||||| || 
Sbjct  14386  GGGTACAACGAGCTGCTGGACACGTACAGTCTCCACCAGTTCATCATCCACAAAGGCCGC  14327

Query  1207   ACCATGAGAGACACACCCGAGTTTGTTTCGTTCCGTCGCGTTACACAGGAGCTTTGGGGC  1266
               | ||| | || || || |||||||| || |||   |||||  | |||||| ||||||||
Sbjct  14326  GCGATGCGCGAGACGCCTGAGTTTGTGTCCTTCAAGCGCGTGGCGCAGGAGGTTTGGGGC  14267

Query  1267   AGTGTAGAAGAGGCTCTGCGAGCGCTGGAGACTCTGCTCGCGCAGTATTTTGTACCTCTG  1326
              || || || || |   |    || || ||| | |||||| |||  || || || ||||| 
Sbjct  14266  AGCGTCGATGAAGTGATCAAGGCACTCGAGGCGCTGCTCACGCGCTACTTCGTGCCTCTC  14207

Query  1327   GCTTACGTTGATGGCCAGCGACT  1349
              || ||||| || |||||||||||
Sbjct  14206  GCGTACGTCGACGGCCAGCGACT  14184

 Score = 49.1 bits (53),  Expect = 0.014
 Identities = 46/59 (78%), Gaps = 0/59 (0%)
 Strand=Plus/Minus

Query  2642   ACGTGCGCGCGAATCTGTTTGTAGACCCGGATGGCTCCGTACACATCTCGTCGACGCAG  2700
              ||||||| || ||||||||||| || ||   ||||   || ||  ||||||||||||||
Sbjct  12942  ACGTGCGTGCAAATCTGTTTGTCGAGCCCAGTGGCGAGGTGCATGTCTCGTCGACGCAG  12884

>PYAP:scaffold_162 pag1_scaffold_162 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_162:1:52209:1 
REF
Length=52209

 Score = 139 bits (153),  Expect = 1e-29
 Identities = 272/397 (69%), Gaps = 14/397 (4%)
 Strand=Plus/Plus

Query  1129   AATGTCGATAAAATTCGTGGTTACAACGAACTGCTGGATGTGTATAGTTTGCACCAGTTT  1188
              || || || || || || || ||||| || || || |||| ||||||  |||||||||| 
Sbjct  21875  AACGTGGAGAAGATACGAGGCTACAATGAGCTACTAGATGCGTATAGCCTGCACCAGTTC  21934

Query  1189   CTGATTCACAAAGGACGGACCATGAGAGACACACCCGAGTTTGTTTCGTTCCGTCGCGTT  1248
               | || || ||||| ||  || || ||||||||||||||||    || |||   || |||
Sbjct  21935  ATCATCCATAAAGGGCGCGCCTTGCGAGACACACCCGAGTTCCAGTCATTCAAGCGTGTT  21994

Query  1249   ACACAGGAGCTTTGGGGCAGTGTAGAAGAGGCTCTGCGAGCGCTGGAGACTCTGCTCGCG  1308
               | || ||| | ||||| ||  | |||||||   | |  || || ||||   ||||| | 
Sbjct  21995  GCTCAAGAGATCTGGGGAAGCATCGAAGAGGTCATCCAGGCTCTCGAGATCTTGCTCACA  22054

Query  1309   CAGTATTTTGTACCTCTGGCTTACGTTGATGGCCAGCG---ACTG---CTCGCACTCGCA  1362
              |  || ||||| || || |||||| |||| ||||| ||   | ||   |||||| || ||
Sbjct  22055  CGCTACTTTGTGCCCCTTGCTTACATTGACGGCCAACGTTTAATGACTCTCGCA-TC-CA  22112

Query  1363   GGTACA-GGCCAACCTCGATTCTCTAAGCGCGAACTGCTGTCCTGTATTGTGAATGAAGA  1421
               | | | |||||| |     |||| |   | ||||||||  | ||  ||||||| || ||
Sbjct  22113  TGGAGATGGCCAAGC-----TCTCGACTTGTGAACTGCTCACTTGCGTTGTGAACGAGGA  22167

Query  1422   TCAAGTTATGTCGGTACTGCGACGTCCAGGCCAACGGTATAAAGGGCGAGATCGTAAACG  1481
               ||||||   ||| |  | || || || || || || || |||||   ||| || |||||
Sbjct  22168  CCAAGTTGCATCGCTGATCCGCCGCCCGGGGCAGCGATACAAAGGCAAAGACCGCAAACG  22227

Query  1482   CCGTGCTGCTACTACAATCGAAGCTTGTGTTCGTATG  1518
              ||| |||||||| ||  || |||| | | | || |||
Sbjct  22228  CCGCGCTGCTACGACCCTCCAAGCCTTTTTCCGCATG  22264

 Score = 113 bits (125),  Expect = 4e-22
 Identities = 264/387 (68%), Gaps = 11/387 (3%)
 Strand=Plus/Plus

Query  1855   TATGTGTCGCCTTTCGAGCTCACATCGGATGTTTCTCAGTACTTCCTCAAACTGCTGCAA  1914
              || ||| |||| ||||||||  |  | || || || || |||||| |||| |||||||| 
Sbjct  22595  TACGTGACGCCGTTCGAGCTGTCGACTGAAGTGTCGCAATACTTCATCAAGCTGCTGCAG  22654

Query  1915   CTTGGCGGTCTTGTTGACA-GCAGACCTCGCGTCAAGTTAGTGTTTCCCGAGCAAACCAC  1973
              ||  ||||  | |   ||  ||| ||  || |||    |||||||||| |||||  |  |
Sbjct  22655  CTGAGCGGAATCGCCAACGCGCATACG-CGAGTCCGACTAGTGTTTCCAGAGCACGCAGC  22713

Query  1974   GCGCTTTCCAGCCCATTTCTCGCTGTC-ATCGTTGTTACTCTACTCGCCTCATTGTCTGC  2032
               |  |||||    || ||||||||  | | |  | | | ||||||| ||  | ||  | |
Sbjct  22714  TCAGTTTCCGCAGCACTTCTCGCTCGCGACCCATCTCA-TCTACTCCCCAAACTGCATAC  22772

Query  2033   GGCGCATCCGAC-ACTACACTACTGGCAAAGAGGCTTACCTTGTGATGGGGCTACCTGGA  2091
              | |||||||  | ||||  | |  |||||||| || ||| | ||||||||  |||| || 
Sbjct  22773  GTCGCATCCAGCGACTAGTCCAA-GGCAAAGAAGCCTACTTGGTGATGGGTGTACCCGGT  22831

Query  2092   GCTGAGGATCAACGACTAGCGATGGCGTTGGATCTGCCAATCCTCGG---TG-CGCCGCC  2147
               | || ||||||||||| ||  ||||  |  |  | || ||||| ||   ||  | | | 
Sbjct  22832  CCCGAAGATCAACGACTCGCAGTGGCTCTTCAAGTCCCCATCCTGGGGCCTGAAGACCCA  22891

Query  2148   AGCTCAAGCTCTGCCGCTGCTCACTCGCTCGGGTGGCAAGCGGTTGTTGATCCGAGCTGA  2207
              |  ||||  |||||||||  | |||||||| ||  |||||||||| || |||  ||| ||
Sbjct  22892  ACATCAA-TTCTGCCGCTCATGACTCGCTCAGGAAGCAAGCGGTTCTTCATCAAAGCGGA  22950

Query  2208   TGTAAATGTCCCCAATGGTACTTACGA  2234
              ||| ||||| || |  ||||| |||||
Sbjct  22951  TGTGAATGTGCCGACAGGTACCTACGA  22977

 Score = 45.5 bits (49),  Expect = 0.17
 Identities = 47/62 (76%), Gaps = 0/62 (0%)
 Strand=Plus/Plus

Query  13     CAGCAGCAACATCATGTGGAGGATGTGGGCCGGTTGTTGTTGCAGACACAGGAGCAGCTT  72
              |||||||  || || ||||||||||| || ||  |  | |||||||| ||||| || || 
Sbjct  20825  CAGCAGCGGCACCACGTGGAGGATGTCGGACGCATCCTCTTGCAGACGCAGGACCAACTA  20884

Query  73     CG  74
              ||
Sbjct  20885  CG  20886

>PYIW:scaffold_963 piw_scaffold_963 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_963:1:12226:1 
REF
Length=12226

 Score = 86.9 bits (95),  Expect = 6e-14
 Identities = 76/95 (80%), Gaps = 0/95 (0%)
 Strand=Plus/Plus

Query  1      ATGGACAAGGTGCAGCAGCAACATCATGTGGAGGATGTGGGCCGGTTGTTGTTGCAGACA  60
              |||||| || | |||||||| || ||||||||||| ||||||||  |  |  ||||||| 
Sbjct  12083  ATGGACCAGTTCCAGCAGCACCACCATGTGGAGGACGTGGGCCGCATCCTTCTGCAGACC  12142

Query  61     CAGGAGCAGCTTCGTGTGATGCGAGAGCAGATGAC  95
              ||||| ||||| ||  | ||||| |||||||||||
Sbjct  12143  CAGGAACAGCTCCGGCTCATGCGCGAGCAGATGAC  12177

>PYAR:scaffold_29 par_scaffold_29 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_29:1:42963:1 
REF
Length=42963

 Score = 70.7 bits (77),  Expect = 4e-09
 Identities = 92/125 (74%), Gaps = 2/125 (2%)
 Strand=Plus/Minus

Query  2153   AAGCTCTGCCGCTGCTCACTCGCTCGGGTGGCAAGCGGTTGTTGATCCGAGCTGATGTAA  2212
              |||||| |||||||||||| ||| | || | |||||| |||||  ||   || || || |
Sbjct  13371  AAGCTCGGCCGCTGCTCACGCGCGCTGGCGCCAAGCGCTTGTTCCTCAAGGCCGACGTCA  13312

Query  2213   ATGTCCCCAATGGTACTTACGAGCTGTACGATGAACATGAAGT-CTGTGCAGCGCTCGCC  2271
              | || ||||  || || ||||| || ||||| |   | ||  | |||| | |||||||||
Sbjct  13311  ACGTGCCCACGGGCACGTACGATCTCTACGACGTCGACGAGCTCCTGTTC-GCGCTCGCC  13253

Query  2272   AAGCT  2276
              |||||
Sbjct  13252  AAGCT  13248

 Score = 69.8 bits (76),  Expect = 4e-09
 Identities = 78/102 (76%), Gaps = 2/102 (2%)
 Strand=Plus/Minus

Query  1396   CTGCTGTCCTGTATTGTGAATGAAGATCAAGTTATGTCGGTACTGCGACGTCCAGGCCAA  1455
              ||||| || ||| | || |||||||| || ||   |||| | |||||||| || ||||| 
Sbjct  14170  CTGCTCTCGTGTGTGGTCAATGAAGACCAGGTCGCGTCGCTGCTGCGACGGCCCGGCCAG  14111

Query  1456   CGGTATAAAGGGCGAG-ATCGTAAACGCCGTGCTGCTACTAC  1496
              ||||| || |||| || | || || ||||||||||| || ||
Sbjct  14110  CGGTACAA-GGGCAAGGACCGCAAGCGCCGTGCTGCAACGAC  14070

 Score = 54.5 bits (59),  Expect = 3e-04
 Identities = 129/192 (67%), Gaps = 5/192 (3%)
 Strand=Plus/Minus

Query  1714   CGACGTGTTGTGGTCCACGTGCCGTCGTTATCGCTCGATGAACACTCACGTCTCGGTGCT  1773
              || || || || ||||||||||| ||  | |||||||| || ||| | || |  |  |||
Sbjct  13852  CGTCGCGTGGTCGTCCACGTGCCATCACTGTCGCTCGACGAGCACGCGCG-CGTGTCGCT  13794

Query  1774   -GAGAACTTTGCCATACAACAGAACCTCCAGCTGACGCGGGTATGCGCCGCTGCACTGGA  1832
               ||  |||||||  | || |||||||| |||||  ||||| ||   || || |   ||||
Sbjct  13793  CGACCACTTTGCGGTGCAGCAGAACCTGCAGCTCGCGCGGCTA---GCGGCCGTCGTGGA  13737

Query  1833   CTCTAACGTGGAACTGCTGCTTTATGTGTCGCCTTTCGAGCTCACATCGGATGTTTCTCA  1892
              | | | ||| ||     |  | || || ||||| || |||||  |  ||||  | || ||
Sbjct  13736  CGCGACCGTCGAGTACGTCGTCTACGTCTCGCCGTTTGAGCTGCCCACGGACCTCTCGCA  13677

Query  1893   GTACTTCCTCAA  1904
              |||| |  ||||
Sbjct  13676  GTACGTGGTCAA  13665

>APIN:scaffold_20 supercont1.20 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.20:1:1003253:1 
REF
Length=1003253

 Score = 53.6 bits (58),  Expect = 3e-04
 Identities = 71/99 (72%), Gaps = 0/99 (0%)
 Strand=Plus/Minus

Query  1173    TAGTTTGCACCAGTTTCTGATTCACAAAGGACGGACCATGAGAGACACACCCGAGTTTGT  1232
               |||||||||||||||  | || | ||||||   |||  ||   ||||| ||||| ||| |
Sbjct  379401  TAGTTTGCACCAGTTCATCATCCGCAAAGGCAAGACGCTGGCCGACACGCCCGAATTTAT  379342

Query  1233    TTCGTTCCGTCGCGTTACACAGGAGCTTTGGGGCAGTGT  1271
               ||||||||  ||   |||  | ||  | |||||||| ||
Sbjct  379341  TTCGTTCCAACGGACTACCGAAGACTTGTGGGGCAGCGT  379303

>APAS:scaffold_12 supercont1.12 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.12:1:1206637:1 
REF
Length=1206637

 Score = 50.9 bits (55),  Expect = 0.004
 Identities = 44/55 (80%), Gaps = 0/55 (0%)
 Strand=Plus/Plus

Query  1112    TGGAGAAATTGGGGGCAAATGTCGATAAAATTCGTGGTTACAACGAACTGCTGGA  1166
               || |||| ||| |   ||| ||||| ||||| ||||| |||||||||||||| ||
Sbjct  729326  TGTAGAACTTGCGCCGAAACGTCGAGAAAATACGTGGCTACAACGAACTGCTTGA  729380

>SAPA:scaffold_24 supercont2.24 dna:supercontig supercontig:ASM15154v2:supercont2.24:1:471063:1 
REF
Length=471063

 Score = 50.0 bits (54),  Expect = 0.004
 Identities = 75/107 (70%), Gaps = 0/107 (0%)
 Strand=Plus/Plus

Query  1714    CGACGTGTTGTGGTCCACGTGCCGTCGTTATCGCTCGATGAACACTCACGTCTCGGTGCT  1773
               || || || || |||||||||||||| || |||  ||| || | | | || |||      
Sbjct  427728  CGGCGGGTCGTCGTCCACGTGCCGTCCTTCTCGGCCGAAGAGCGCGCGCGGCTCAACATG  427787

Query  1774    GAGAACTTTGCCATACAACAGAACCTCCAGCTGACGCGGGTATGCGC  1820
               || |||||||| || |  ||||| || ||| || ||||  | |||||
Sbjct  427788  GACAACTTTGCGATTCGTCAGAATCTGCAGATGGCGCGTCTCTGCGC  427834

>PHRA:scaffold_37
Length=441994

 Score = 48.2 bits (52),  Expect = 0.014
 Identities = 29/31 (94%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  95      CGGCAGCTGCAGCGGCCGTGGAGGCCAATGC  125
               |||||||||||||||||| || |||||||||
Sbjct  355782  CGGCAGCTGCAGCGGCCGCGGGGGCCAATGC  355752

>PYVX:scaffold_1323 pve_scaffold_1323 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1323:1:4715:1 
REF
Length=4715

 Score = 46.4 bits (50),  Expect = 0.050
 Identities = 67/95 (71%), Gaps = 0/95 (0%)
 Strand=Plus/Plus

Query  3184  GCTTTCTTCCACGCCTGCAGATTACACGGTGTGTGCTTTGACGTGGAGAGAACTCTAGGT  3243
             |||||||||||  ||||| |  | ||||| |||||| | ||||||| |    | |  || 
Sbjct  276   GCTTTCTTCCAGACCTGCCGCCTGCACGGCGTGTGCCTCGACGTGGCGGCGGCGCGCGGC  335

Query  3244  ACACTCTTCCTGCTCGCTGACAGTCTCACAGCTGG  3278
              |  ||||||||||  | ||||| ||| | || ||
Sbjct  336   TCGGTCTTCCTGCTGCCCGACAGCCTCGCGGCCGG  370

>PHPA:scaffold_6 NW_008648992.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.6, whole genome shotgun 
sequence
Length=2202294

 Score = 42.8 bits (46),  Expect = 0.60
 Identities = 31/35 (89%), Gaps = 1/35 (3%)
 Strand=Plus/Minus

Query  1065     TGAGGAGCAGGAAAGCGATGAAAATGACAAGGACG  1099
                || |||||||||  |||||||| ||||||||||||
Sbjct  1911817  TGCGGAGCAGGAG-GCGATGAACATGACAAGGACG  1911784

>PHPA:scaffold_164 NW_008649150.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.164, whole genome 
shotgun sequence
Length=48161

 Score = 41.9 bits (45),  Expect = 2.1
 Identities = 40/49 (82%), Gaps = 2/49 (4%)
 Strand=Plus/Minus

Query  1018   GATACGGAAAACAATAGAGACCGATTCAGTGACGACGACATCTCCGATG  1066
              ||||||||||||||||||| | || ||||  |||| | ||||| | |||
Sbjct  34505  GATACGGAAAACAATAGAG-CAGAATCAGGTACGA-GTCATCTACAATG  34459

>PHIF:NW_003303749.1 Phytophthora infestans T30-4 supercont1.10 
genomic scaffold, whole genome shotgun sequence
Length=3761764

 Score = 41.9 bits (45),  Expect = 2.1
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  1043     TCAGTGACGACGACATCTCCGATGAGGAGC  1072
                |||||||||||| || ||||||||| ||||
Sbjct  1521546  TCAGTGACGACGGCAGCTCCGATGACGAGC  1521575

>SADI:scaffold_4 supercont1.4 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.4:1:1391842:1 
REF
Length=1391842

 Score = 41.0 bits (44),  Expect = 2.1
 Identities = 73/107 (68%), Gaps = 0/107 (0%)
 Strand=Plus/Minus

Query  1714    CGACGTGTTGTGGTCCACGTGCCGTCGTTATCGCTCGATGAACACTCACGTCTCGGTGCT  1773
               || || || || || ||||||||||| || |||  ||| || | | | || |||  |   
Sbjct  175285  CGGCGGGTCGTCGTGCACGTGCCGTCCTTCTCGGCCGAAGAGCGCACGCGGCTCAATATG  175226

Query  1774    GAGAACTTTGCCATACAACAGAACCTCCAGCTGACGCGGGTATGCGC  1820
               || |||||||| || |  |||||  | ||  || ||||  | |||||
Sbjct  175225  GACAACTTTGCAATTCGCCAGAATTTGCAAATGGCGCGTCTCTGCGC  175179

>PYIR:scaffold_795 pir_scaffold_795 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_795:1:15537:1 
REF
Length=15537

 Score = 41.0 bits (44),  Expect = 2.1
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  2600  CTGCCTCATCCGAGGCATCAACGGTGC  2626
             |||| |||||||||||| |||||||||
Sbjct  5392  CTGCTTCATCCGAGGCAACAACGGTGC  5366

>PYAR:scaffold_168 par_scaffold_168 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_168:1:27351:1 
REF
Length=27351

 Score = 41.0 bits (44),  Expect = 2.1
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  2380   CGTGAGCTGCGTCGAGAGAAGCGGACGCCCGA  2411
              |||| ||| ||||||||||| ||||||| |||
Sbjct  17851  CGTGTGCTCCGTCGAGAGAAACGGACGCACGA  17882

>PHIF:NW_003303743.1 Phytophthora infestans T30-4 supercont1.16 
genomic scaffold, whole genome shotgun sequence
Length=3114892

 Score = 41.0 bits (44),  Expect = 2.1
 Identities = 30/34 (88%), Gaps = 1/34 (3%)
 Strand=Plus/Minus

Query  3108     ACTCGTAG-GGGCTCGGCGTTGCTTCGTGGCGTG  3140
                |||||| | |||| ||||||||||| ||||||||
Sbjct  2418926  ACTCGTCGTGGGCACGGCGTTGCTTTGTGGCGTG  2418893

>PHIF:NW_003303734.1 Phytophthora infestans T30-4 supercont1.25 
genomic scaffold, whole genome shotgun sequence
Length=2165783

 Score = 41.0 bits (44),  Expect = 2.1
 Identities = 30/34 (88%), Gaps = 1/34 (3%)
 Strand=Plus/Plus

Query  3108    ACTCGTAG-GGGCTCGGCGTTGCTTCGTGGCGTG  3140
               |||||| | |||| ||||||||||| ||||||||
Sbjct  163150  ACTCGTCGTGGGCACGGCGTTGCTTTGTGGCGTG  163183

>PHIF:NW_003303633.1 Phytophthora infestans T30-4 supercont1.126 
genomic scaffold, whole genome shotgun sequence
Length=256833

 Score = 41.0 bits (44),  Expect = 2.1
 Identities = 30/34 (88%), Gaps = 1/34 (3%)
 Strand=Plus/Minus

Query  3108   ACTCGTAG-GGGCTCGGCGTTGCTTCGTGGCGTG  3140
              |||||| | |||| ||||||||||| ||||||||
Sbjct  44903  ACTCGTCGTGGGCACGGCGTTGCTTTGTGGCGTG  44870

>PYVX:scaffold_1055 pve_scaffold_1055 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1055:1:7711:1 
REF
Length=7711

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 29/33 (88%), Gaps = 2/33 (6%)
 Strand=Plus/Plus

Query  583   GAGGATGCCAAGCACGGCGTTTTGAACTTGGTC  615
             ||||||||||| ||| |||||||||  ||||||
Sbjct  4062  GAGGATGCCAATCACCGCGTTTTGA--TTGGTC  4092

>PYVX:scaffold_15 pve_scaffold_15 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_15:1:101917:1 
REF
Length=101917

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 31/36 (86%), Gaps = 1/36 (3%)
 Strand=Plus/Minus

Query  2134   CTCGGTGCGCCGCCAGCTCAAGCTCT-GCCGCTGCT  2168
              ||||| ||||||||||| | |||||| ||||| |||
Sbjct  97091  CTCGGAGCGCCGCCAGCGCGAGCTCTCGCCGCCGCT  97056

>PYAR:scaffold_2510 par_scaffold_2510 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_2510:1:4925:1 
REF
Length=4925

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 34/41 (83%), Gaps = 1/41 (2%)
 Strand=Plus/Plus

Query  1283  TGCGAGCGCTGGAGACTCTGCTCGCGC-AGTATTTTGTACC  1322
             ||||||||||||||| ||  ||||||| | || | ||||||
Sbjct  4614  TGCGAGCGCTGGAGATTCCTCTCGCGCGATTACTATGTACC  4654

>PYAP:scaffold_582 pag1_scaffold_582 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_582:1:20697:1 
REF
Length=20697

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 32/38 (84%), Gaps = 2/38 (5%)
 Strand=Plus/Minus

Query  2010   ACTCTACTCGCCTCATTGTCTGCGGCGCATCCGACACT  2047
              || ||||| |||  |||||| |||||||||||| ||||
Sbjct  13769  ACGCTACTGGCC--ATTGTCAGCGGCGCATCCGCCACT  13734

>PYAP:scaffold_110 pag1_scaffold_110 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_110:1:65312:1 
REF
Length=65312

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  2603   CCTCATCCGAGGCATCAACGGTGCTGGTA  2631
              |||||||| ||||| | ||||||||||||
Sbjct  44808  CCTCATCCAAGGCAGCTACGGTGCTGGTA  44780

>PLHA:NW_020187732.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_816, whole genome shotgun sequence
Length=2620190

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 39/50 (78%), Gaps = 3/50 (6%)
 Strand=Plus/Plus

Query  3376   ATCAGTGTGGCTTCATCTCCA---TCTCGATCCGTTGCCTCTCGTAGTGG  3422
              ||||||||||| |||||||||   |||| || | ||||  |  |||||||
Sbjct  49612  ATCAGTGTGGCATCATCTCCAGCGTCTCCATACTTTGCAACGGGTAGTGG  49661

>PHSO:scaffold_8
Length=3549547

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  1283     TGCGAGCGCTGGAGACTCTGCTCGCGCAGTATTT  1316
                |||| | ||||||||||||   ||||||||||||
Sbjct  2038272  TGCGCGAGCTGGAGACTCTCAACGCGCAGTATTT  2038239

 Score = 39.2 bits (42),  Expect = 7.4
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  2094    TGAGGATCAACGACTAGCGATGGCGTTGGAT  2124
               ||||||||||| ||| ||||||||  |||||
Sbjct  978206  TGAGGATCAACAACTTGCGATGGCTCTGGAT  978236

>PHPA:scaffold_16 NW_008649002.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.16, whole genome shotgun 
sequence
Length=1156373

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 36/45 (80%), Gaps = 3/45 (7%)
 Strand=Plus/Plus

Query  276     GGCTCAGAGCGGCACTCTTCTTCCTGCTGTCACGGTTGCCGCTGC  320
               ||||||||||| |   ||||||||||||||| |   ||| |||||
Sbjct  768545  GGCTCAGAGCGTCCGCCTTCTTCCTGCTGTCTC---TGCAGCTGC  768586

>PHKE:scaffold_7 scf_22126_7.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_7.1:1:289977:1 
REF
Length=289977

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  2431   CCTCGCGATGCAGCAGCAAAGCTG  2454
              |||||||||||||| |||||||||
Sbjct  86474  CCTCGCGATGCAGCGGCAAAGCTG  86451

>PHIF:NW_003303758.1 Phytophthora infestans T30-4 supercont1.1 
genomic scaffold, whole genome shotgun sequence
Length=6928287

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  2392     CGAGAGAAGCGGACGCCCGAGTATTGGCGCCAAC  2425
                |||||| |||  | |||||||| |||||||||||
Sbjct  2447711  CGAGAGCAGCACAGGCCCGAGTTTTGGCGCCAAC  2447744

>PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 
genomic scaffold, whole genome shotgun sequence
Length=3552875

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  1043     TCAGTGACGACGACATCTCCGATGAGGAG  1071
                |||||||||||| || ||||||||| |||
Sbjct  2313488  TCAGTGACGACGGCAGCTCCGATGACGAG  2313460

>PHIF:NW_003303717.1 Phytophthora infestans T30-4 supercont1.42 
genomic scaffold, whole genome shotgun sequence
Length=1446276

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  1043     TCAGTGACGACGACATCTCCGATGAGGAG  1071
                |||||||||||| || ||||||||| |||
Sbjct  1007336  TCAGTGACGACGGCAGCTCCGATGACGAG  1007308

>PHIF:NW_003303539.1 Phytophthora infestans T30-4 supercont1.220 
genomic scaffold, whole genome shotgun sequence
Length=173550

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  1043  TCAGTGACGACGACATCTCCGATGAGGAG  1071
             |||||||||||| || ||||||||| |||
Sbjct  9935  TCAGTGACGACGGCAGCTCCGATGACGAG  9963

>PHIF:NW_003303498.1 Phytophthora infestans T30-4 supercont1.261 
genomic scaffold, whole genome shotgun sequence
Length=113252

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  1043   TCAGTGACGACGACATCTCCGATGAGGAG  1071
              |||||||||||| || ||||||||| |||
Sbjct  53065  TCAGTGACGACGGCAGCTCCGATGACGAG  53093

>HYAP:scaffold_2530 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_2530:1:498:1 
REF
Length=498

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  2745  GGCGTTCACGTTTCCTCAGACGGC  2768
             ||||| ||||||||||||||||||
Sbjct  359   GGCGTGCACGTTTCCTCAGACGGC  382

>APIN:scaffold_37 supercont1.37 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.37:1:488699:1 
REF
Length=488699

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  2202    AGCTGATGTAAATGTCCCCAATGGTACTT  2230
               |||| || |||||||||||||||||| ||
Sbjct  173331  AGCTTATATAAATGTCCCCAATGGTAGTT  173359

>APIN:scaffold_1 supercont1.1 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.1:1:2817317:1 
REF
Length=2817317

 Score = 40.1 bits (43),  Expect = 7.4
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  62       AGGAGCAGCTTCGTGTGATGCGAGAGCAGATGAC  95
                ||||||||||||| ||| |||| |||||  ||||
Sbjct  2396397  AGGAGCAGCTTCGCGTGCTGCGGGAGCATGTGAC  2396430

>SAPA:scaffold_33 supercont2.33 dna:supercontig supercontig:ASM15154v2:supercont2.33:1:345601:1 
REF
Length=345601

 Score = 39.2 bits (42),  Expect = 7.4
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  1049    ACGACGACATCTCCGATGAGGAGCAGGAAAGCGATG  1084
               |||||||||||  ||| |  |||||||| |||||||
Sbjct  276268  ACGACGACATCGACGACGGCGAGCAGGACAGCGATG  276233

>PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:pug:scf1117875582028:1:960197:1 
REF
Length=960197

 Score = 39.2 bits (42),  Expect = 7.4
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  2601    TGCCTCATCCGAGGCATCAACGGTGC  2626
               ||| |||||||||||| |||||||||
Sbjct  622087  TGCTTCATCCGAGGCAACAACGGTGC  622112

>PHRA:scaffold_503
Length=11291

 Score = 39.2 bits (42),  Expect = 7.4
 Identities = 36/42 (86%), Gaps = 3/42 (7%)
 Strand=Plus/Plus

Query  2359  CTGTCAAACATGCAAGCGATGCGTGAGCTGCGTCGAGAGAAG  2400
             ||||| | |||||| |||||||||||||| | |||| |||||
Sbjct  5920  CTGTCGAGCATGCA-GCGATGCGTGAGCT-CATCGA-AGAAG  5958

>PHRA:scaffold_222
Length=38036

 Score = 39.2 bits (42),  Expect = 7.4
 Identities = 36/42 (86%), Gaps = 3/42 (7%)
 Strand=Plus/Plus

Query  2359  CTGTCAAACATGCAAGCGATGCGTGAGCTGCGTCGAGAGAAG  2400
             ||||| | |||||| |||||||||||||| | |||| |||||
Sbjct  58    CTGTCGAGCATGCA-GCGATGCGTGAGCT-CATCGA-AGAAG  96

>PHKE:scaffold_399 scf_22126_399.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_399.1:1:32365:1 
REF
Length=32365

 Score = 39.2 bits (42),  Expect = 7.4
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  572   AATTGCGCGAGGAGGATGCCAAGCACGGCGT  602
             || ||||||||||||||| || ||||| |||
Sbjct  7442  AAGTGCGCGAGGAGGATGGCATGCACGTCGT  7412

>PHKE:scaffold_46 scf_22126_46.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_46.1_contig_1:1:144213:1 
REF
Length=144213

 Score = 39.2 bits (42),  Expect = 7.4
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  1422   TCAAGTTATGTCGGTACTGCGACGTC  1447
              |||| |||||||| ||||||||||||
Sbjct  62004  TCAAATTATGTCGCTACTGCGACGTC  61979

>PHIF:NW_003303745.1 Phytophthora infestans T30-4 supercont1.14 
genomic scaffold, whole genome shotgun sequence
Length=3113719

 Score = 39.2 bits (42),  Expect = 7.4
 Identities = 33/39 (85%), Gaps = 4/39 (10%)
 Strand=Plus/Minus

Query  1535   GGTACGCTCGCACTCGTGCCAGCGACTTCAATGCGAGCA  1573
              |||| ||||||||||||| |||   ||||| ||||||||
Sbjct  38724  GGTA-GCTCGCACTCGTGACAG---CTTCATTGCGAGCA  38690

>PHCA:scaffold_5 PHYCAscaffold_5
Length=1593284

 Score = 39.2 bits (42),  Expect = 7.4
 Identities = 32/38 (84%), Gaps = 1/38 (3%)
 Strand=Plus/Plus

Query  1068     GGAGCAGGAAAGCGATGAAAATGACAAGGACGAATACG  1105
                |||||||||||  ||||||| ||| ||||| ||| |||
Sbjct  1452136  GGAGCAGGAAACGGATGAAACTGAGAAGGA-GAAGACG  1452172

>APIN:scaffold_5 supercont1.5 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.5:1:2674822:1 
REF
Length=2674822

 Score = 39.2 bits (42),  Expect = 7.4
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  2211     AAATGTCCCCAATGGTACTTA  2231
                |||||||||||||||||||||
Sbjct  1008172  AAATGTCCCCAATGGTACTTA  1008192

>APAS:scaffold_11 supercont1.11 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.11:1:1267871:1 
REF
Length=1267871

 Score = 39.2 bits (42),  Expect = 7.4
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  3116     GGGCTCGGCGTTGCTTCGTGGCGTGC  3141
                ||||||| ||| ||||||||||||||
Sbjct  1091903  GGGCTCGCCGTCGCTTCGTGGCGTGC  1091928

>APAS:scaffold_1 supercont1.1 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.1:1:2615878:1 
REF
Length=2615878

 Score = 39.2 bits (42),  Expect = 7.4
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  589      GCCAAGCACGGCGTTTTGAACTTGGTCACGC  619
                |||||| ||| ||| || |||||||||||||
Sbjct  1352178  GCCAAGGACGTCGTGTTCAACTTGGTCACGC  1352148

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 4506609729370

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2