Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
PHCA:scaffold_84952059580760312060.0
PHPA:scaffold_632446892452805936793e-173
PHSO:scaffold_1279358527941485696455e-164
PHRA:scaffold_561608781614365596329e-161
PHIF:NW_003303697.13948593954325755784e-146
PHKE:scaffold_9860430609154894891e-121
PLHA:NW_020189861.1184652818470425164191e-102
HYAP:scaffold_591611791617065313788e-92
PYVX:scaffold_275645269525053434e-82
PYUU:scaffold_2037130262113030134001341e-25
PYIR:scaffold_81070711075204551302e-24
PHRA:scaffold_10612940131782461161e-20
PYIW:scaffold_71110910112593651131e-19
PHRA:scaffold_267957498122471104e-19
PHSO:scaffold_351814818342204963e-15
PHSO:scaffold_14818832819026204963e-15
PHSO:scaffold_5682001682195204963e-15
PYIR:scaffold_224914401681244871e-12
PYIR:scaffold_5024289630351855e-12
PYIR:scaffold_4828350599256855e-12
PHIF:NW_003303730.1673483673683204742e-09
PHIF:NW_003303626.1267334267534204742e-09
PHCA:scaffold_67219360219566213739e-09
PHCA:scaffold_7904589904784201739e-09
PHPA:scaffold_22685604685836237729e-09
PYAP:scaffold_560128131289179681e-07
PHSO:scaffold_64381643823775674e-07
PHSO:scaffold_44365212436528575625e-06
PHSO:scaffold_1216193316202899612e-05
PYAR:scaffold_345922742553286602e-05
PHRA:scaffold_792568325883205585e-05
PHPA:scaffold_953848953855770572e-04
PHRA:scaffold_423839023841728562e-04
PHKE:scaffold_62234833685210547e-04
PHCA:scaffold_2417214217217837547e-04
PHSO:scaffold_112022640202268344530.002
PHRA:scaffold_28921524162299530.002
PHRA:scaffold_4948160825899530.002
PHRA:scaffold_3317106617116499530.002
PHRA:scaffold_123248222485938510.008
PHRA:scaffold_5210257010260738510.008
PYVX:scaffold_6392147218337490.028
PYIW:scaffold_19526500653637490.028
PYIW:scaffold_7121664170037490.028
SAPA:scaffold_3113307113309424480.028
PYVX:scaffold_50423504237829480.028
PHSO:scaffold_1655389055395163480.028
PHRA:scaffold_921813921817841480.028
APAS:scaffold_3312182812185124480.028
PYVX:scaffold_107063631470.099
PYIW:scaffold_11599027905731470.099
PYAP:scaffold_289144981453336470.099
PYAP:scaffold_187101971022731470.099
PHKE:scaffold_3541470114799100470.099
PHCA:scaffold_49249392496931470.099
SAPA:scaffold_1230637930640628460.099
SADI:scaffold_2444004644007328460.099
PYIR:scaffold_1552661268828460.099
PYIR:scaffold_462735276228460.099
PHPA:scaffold_19496174964933460.099
PHIF:NW_003303752.12062331206236838460.099
PHCA:scaffold_4010903810907033460.099
PYVX:scaffold_305155541560350450.35
PYUU:scaffold_202882146582149430450.35
PYIW:scaffold_270169491697830450.35
PHPA:scaffold_51068908106893730450.35
PHCA:scaffold_98813648139330450.35
SADI:scaffold_134584225844827440.35
PYVX:scaffold_496103451037127440.35
PYIW:scaffold_35421529156537440.35
PYIR:scaffold_573159411597737440.35
PYAR:scaffold_488742749066440.35
PYAP:scaffold_630121951223137440.35
PHSO:scaffold_81240750124080152440.35
PHRA:scaffold_2945347445350532440.35
PHRA:scaffold_570177970181436440.35
PHCA:scaffold_5013628013631132440.35
SAPA:scaffold_4420811020813324431.2
PYAP:scaffold_558197861980924431.2
PHSO:scaffold_22558639255867438431.2
PHKE:scaffold_2212443247129431.2
PHIF:NW_003303738.11105403110545251431.2
HYAP:scaffold_176421804220324431.2
PYVX:scaffold_469202762030126421.2
PYVX:scaffold_1317331735626421.2
PYIW:scaffold_4244775480026421.2
PYIR:scaffold_667176911771828421.2
PHSO:scaffold_1557966057968526421.2
PHKE:scaffold_781752178231421.2
PHIF:NW_003303747.12704506270452621421.2
APIN:scaffold_991078691081126421.2
SAPA:scaffold_1946477246479928414.2
PYVX:scaffold_8941470150233414.2
PYUU:scaffold_135479860979863123414.2
PYIW:scaffold_15356710673728414.2
PYIW:scaffold_1821698173033414.2
PHIF:NW_003304976.12247227428414.2
PHIF:NW_003303753.13795985379601228414.2
PHIF:NW_003303739.12032508203254033414.2
PHIF:NW_003303678.145008045010728414.2
PHCA:scaffold_2839722339725533414.2
APAS:scaffold_483230783233428414.2
SAPA:scaffold_283695483698330404.2
SADI:scaffold_5817015417017825404.2
PYVX:scaffold_5639903992725404.2
PYIR:scaffold_7285905593430404.2
PYAR:scaffold_802113316735404.2
PYAP:scaffold_83458114583525404.2
PHRA:scaffold_2338486038488930404.2
PHPA:scaffold_3915027615033864404.2
PHPA:scaffold_456884256887130404.2
PHCA:scaffold_14629632025404.2
APIN:scaffold_5632964332966220404.2
BLASTN 2.9.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= PHYCA_537323

Length=603
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

PHCA:scaffold_84 PHYCAscaffold_84                                     1088       0.0   
PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 ...  613        3e-173
PHSO:scaffold_1                                                       582        5e-164
PHRA:scaffold_56                                                      571        9e-161
PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 ge...  522        4e-146
PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercon...  442        1e-121
PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig:...  379        1e-102
HYAP:scaffold_59 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_5...  342        8e-92 
PYVX:scaffold_275 pve_scaffold_275 dna:supercontig supercontig:pv...  310        4e-82 
PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:p...  122        1e-25 
PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_sc...  118        2e-24 
PHRA:scaffold_106                                                     105        1e-20 
PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:pi...  103        1e-19 
PHRA:scaffold_267                                                     100        4e-19 
PHSO:scaffold_35                                                      87.8       3e-15 
PHSO:scaffold_14                                                      87.8       3e-15 
PHSO:scaffold_5                                                       87.8       3e-15 
PYIR:scaffold_2249 pir_scaffold_2249 dna:supercontig supercontig:...  79.7       1e-12 
PYIR:scaffold_5024 pir_scaffold_5024 dna:supercontig supercontig:...  77.9       5e-12 
PYIR:scaffold_4828 pir_scaffold_4828 dna:supercontig supercontig:...  77.9       5e-12 
PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 ge...  68.0       2e-09 
PHIF:NW_003303626.1 Phytophthora infestans T30-4 supercont1.133 g...  68.0       2e-09 
PHCA:scaffold_67 PHYCAscaffold_67                                     67.1       9e-09 
PHCA:scaffold_7 PHYCAscaffold_7                                       67.1       9e-09 
PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 ...  66.2       9e-09 
PYAP:scaffold_560 pag1_scaffold_560 dna:supercontig supercontig:p...  62.6       1e-07 
PHSO:scaffold_64                                                      61.7       4e-07 
PHSO:scaffold_4                                                       57.2       5e-06 
PHSO:scaffold_12                                                      56.3       2e-05 
PYAR:scaffold_3459 par_scaffold_3459 dna:supercontig supercontig:...  55.4       2e-05 
PHRA:scaffold_79                                                      53.6       5e-05 
PHPA:scaffold_9 NW_008648995.1 Phytophthora parasitica INRA-310 u...  52.7       2e-04 
PHRA:scaffold_4                                                       51.8       2e-04 
PHKE:scaffold_622 scf_22126_622.1 dna:supercontig supercontig:Phy...  50.0       7e-04 
PHCA:scaffold_24 PHYCAscaffold_24                                     50.0       7e-04 
PHSO:scaffold_11                                                      49.1       0.002 
PHRA:scaffold_2892                                                    49.1       0.002 
PHRA:scaffold_494                                                     49.1       0.002 
PHRA:scaffold_33                                                      49.1       0.002 
PHRA:scaffold_123                                                     47.3       0.008 
PHRA:scaffold_52                                                      47.3       0.008 
PYVX:scaffold_639 pve_scaffold_639 dna:supercontig supercontig:pv...  45.5       0.028 
PYIW:scaffold_1952 piw_scaffold_1952 dna:supercontig supercontig:...  45.5       0.028 
PYIW:scaffold_712 piw_scaffold_712 dna:supercontig supercontig:pi...  45.5       0.028 
SAPA:scaffold_31 supercont2.31 dna:supercontig supercontig:ASM151...  44.6       0.028 
PYVX:scaffold_50 pve_scaffold_50 dna:supercontig supercontig:pve_...  44.6       0.028 
PHSO:scaffold_16                                                      44.6       0.028 
PHRA:scaffold_9                                                       44.6       0.028 
APAS:scaffold_33 supercont1.33 dna:supercontig supercontig:Apha_a...  44.6       0.028 
PYVX:scaffold_1070 pve_scaffold_1070 dna:supercontig supercontig:...  43.7       0.099 
PYIW:scaffold_1159 piw_scaffold_1159 dna:supercontig supercontig:...  43.7       0.099 
PYAP:scaffold_289 pag1_scaffold_289 dna:supercontig supercontig:p...  43.7       0.099 
PYAP:scaffold_187 pag1_scaffold_187 dna:supercontig supercontig:p...  43.7       0.099 
PHKE:scaffold_354 scf_22126_354.1_contig_1 dna:supercontig superc...  43.7       0.099 
PHCA:scaffold_49 PHYCAscaffold_49                                     43.7       0.099 
SAPA:scaffold_12 supercont2.12 dna:supercontig supercontig:ASM151...  42.8       0.099 
SADI:scaffold_24 supercont1.24 dna:supercontig supercontig:Sap_di...  42.8       0.099 
PYIR:scaffold_155 pir_scaffold_155 dna:supercontig supercontig:pi...  42.8       0.099 
PYIR:scaffold_46 pir_scaffold_46 dna:supercontig supercontig:pir_...  42.8       0.099 
PHPA:scaffold_19 NW_008649005.1 Phytophthora parasitica INRA-310 ...  42.8       0.099 
PHIF:NW_003303752.1 Phytophthora infestans T30-4 supercont1.7 gen...  42.8       0.099 
PHCA:scaffold_40 PHYCAscaffold_40                                     42.8       0.099 
PYVX:scaffold_305 pve_scaffold_305 dna:supercontig supercontig:pv...  41.9       0.35  
PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:p...  41.9       0.35  
PYIW:scaffold_270 piw_scaffold_270 dna:supercontig supercontig:pi...  41.9       0.35  
PHPA:scaffold_5 NW_008648991.1 Phytophthora parasitica INRA-310 u...  41.9       0.35  
PHCA:scaffold_98 PHYCAscaffold_98                                     41.9       0.35  
SADI:scaffold_134 supercont1.134 dna:supercontig supercontig:Sap_...  41.0       0.35  
PYVX:scaffold_496 pve_scaffold_496 dna:supercontig supercontig:pv...  41.0       0.35  
PYIW:scaffold_3542 piw_scaffold_3542 dna:supercontig supercontig:...  41.0       0.35  
PYIR:scaffold_573 pir_scaffold_573 dna:supercontig supercontig:pi...  41.0       0.35  
PYAR:scaffold_4887 par_scaffold_4887 dna:supercontig supercontig:...  41.0       0.35  
PYAP:scaffold_630 pag1_scaffold_630 dna:supercontig supercontig:p...  41.0       0.35  
PHSO:scaffold_8                                                       41.0       0.35  
PHRA:scaffold_29                                                      41.0       0.35  
PHRA:scaffold_5                                                       41.0       0.35  
PHCA:scaffold_50 PHYCAscaffold_50                                     41.0       0.35  
SAPA:scaffold_44 supercont2.44 dna:supercontig supercontig:ASM151...  40.1       1.2   
PYAP:scaffold_558 pag1_scaffold_558 dna:supercontig supercontig:p...  40.1       1.2   
PHSO:scaffold_2                                                       40.1       1.2   
PHKE:scaffold_221 scf_22126_221.1 dna:supercontig supercontig:Phy...  40.1       1.2   
PHIF:NW_003303738.1 Phytophthora infestans T30-4 supercont1.21 ge...  40.1       1.2   
HYAP:scaffold_176 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  40.1       1.2   
PYVX:scaffold_469 pve_scaffold_469 dna:supercontig supercontig:pv...  39.2       1.2   
PYVX:scaffold_131 pve_scaffold_131 dna:supercontig supercontig:pv...  39.2       1.2   
PYIW:scaffold_424 piw_scaffold_424 dna:supercontig supercontig:pi...  39.2       1.2   
PYIR:scaffold_667 pir_scaffold_667 dna:supercontig supercontig:pi...  39.2       1.2   
PHSO:scaffold_15                                                      39.2       1.2   
PHKE:scaffold_78 scf_22126_78.1 dna:supercontig supercontig:PhyKe...  39.2       1.2   
PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 ge...  39.2       1.2   
APIN:scaffold_9 supercont1.9 dna:supercontig supercontig:Apha_inv...  39.2       1.2   
SAPA:scaffold_19 supercont2.19 dna:supercontig supercontig:ASM151...  38.3       4.2   
PYVX:scaffold_894 pve_scaffold_894 dna:supercontig supercontig:pv...  38.3       4.2   
PYUU:scaffold_1354 scf1117875581354 dna:supercontig supercontig:p...  38.3       4.2   
PYIW:scaffold_1535 piw_scaffold_1535 dna:supercontig supercontig:...  38.3       4.2   
PYIW:scaffold_182 piw_scaffold_182 dna:supercontig supercontig:pi...  38.3       4.2   
PHIF:NW_003304976.1 Phytophthora infestans T30-4 supercont1.3704 ...  38.3       4.2   
PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 gen...  38.3       4.2   
PHIF:NW_003303739.1 Phytophthora infestans T30-4 supercont1.20 ge...  38.3       4.2   
PHIF:NW_003303678.1 Phytophthora infestans T30-4 supercont1.81 ge...  38.3       4.2   
PHCA:scaffold_28 PHYCAscaffold_28                                     38.3       4.2   
APAS:scaffold_4 supercont1.4 dna:supercontig supercontig:Apha_ast...  38.3       4.2   
SAPA:scaffold_2 supercont2.2 dna:supercontig supercontig:ASM15154...  37.4       4.2   
SADI:scaffold_58 supercont1.58 dna:supercontig supercontig:Sap_di...  37.4       4.2   
PYVX:scaffold_563 pve_scaffold_563 dna:supercontig supercontig:pv...  37.4       4.2   
PYIR:scaffold_728 pir_scaffold_728 dna:supercontig supercontig:pi...  37.4       4.2   
PYAR:scaffold_8021 par_scaffold_8021 dna:supercontig supercontig:...  37.4       4.2   
PYAP:scaffold_83 pag1_scaffold_83 dna:supercontig supercontig:pag...  37.4       4.2   
PHRA:scaffold_23                                                      37.4       4.2   
PHPA:scaffold_39 NW_008649025.1 Phytophthora parasitica INRA-310 ...  37.4       4.2   
PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 u...  37.4       4.2   
PHCA:scaffold_146 PHYCAscaffold_146                                   37.4       4.2   
APIN:scaffold_56 supercont1.56 dna:supercontig supercontig:Apha_i...  37.4       4.2   

>PHCA:scaffold_84 PHYCAscaffold_84
Length=182275

 Score = 1088 bits (1206),  Expect = 0.0
 Identities = 603/603 (100%), Gaps = 0/603 (0%)
 Strand=Plus/Minus

Query  1      ATGAGGTTCTTACGTGGCAGCGctctcttctttcctcttcttcttctctcGCTGGTGCTG  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  95807  ATGAGGTTCTTACGTGGCAGCGCTCTCTTCTTTCCTCTTCTTCTTCTCTCGCTGGTGCTG  95748

Query  61     TGCGTCACTGGCCAACGCCGTCTGGACGCCGGACTGGGTGAGGGTCAAGTGGTGCAACAT  120
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  95747  TGCGTCACTGGCCAACGCCGTCTGGACGCCGGACTGGGTGAGGGTCAAGTGGTGCAACAT  95688

Query  121    CCTCCGCCCTTCTTCATCGTGGACGGTCTGGACTTCCAGGGGATGGCGCTCGCCTATTTA  180
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  95687  CCTCCGCCCTTCTTCATCGTGGACGGTCTGGACTTCCAGGGGATGGCGCTCGCCTATTTA  95628

Query  181    CAAGAGCAGGGAGTTAACACAAGCATCGAAGCTCAGAGCTGGATGGAGCAGCACGGCTAC  240
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  95627  CAAGAGCAGGGAGTTAACACAAGCATCGAAGCTCAGAGCTGGATGGAGCAGCACGGCTAC  95568

Query  241    ACGTCATTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGTGACGGAGGAAGCTATC  300
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  95567  ACGTCATTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGTGACGGAGGAAGCTATC  95508

Query  301    TTTGAGTGCGGCCTCACGAGTCCCAAGACCGAGACGCAGCCCATCCCGACCAACAACTCG  360
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  95507  TTTGAGTGCGGCCTCACGAGTCCCAAGACCGAGACGCAGCCCATCCCGACCAACAACTCG  95448

Query  361    TTCCAGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAA  420
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  95447  TTCCAGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAA  95388

Query  421    GTGTCTGCGGGCCGCAACTGCCACACCGAATTCCCGCAGGGTCAGCACCAGGTCGACTAC  480
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  95387  GTGTCTGCGGGCCGCAACTGCCACACCGAATTCCCGCAGGGTCAGCACCAGGTCGACTAC  95328

Query  481    AGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAA  540
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  95327  AGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAA  95268

Query  541    GGAATCTACTCGTGGCAAGTGTACAAGAACTGCGTGGGCCTCGGAACGGCTGCCACGGCC  600
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  95267  GGAATCTACTCGTGGCAAGTGTACAAGAACTGCGTGGGCCTCGGAACGGCTGCCACGGCC  95208

Query  601    TGA  603
              |||
Sbjct  95207  TGA  95205

 Score = 69.8 bits (76),  Expect = 7e-10
 Identities = 147/211 (70%), Gaps = 14/211 (7%)
 Strand=Plus/Plus

Query  373    GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
              || ||||| |  ||||| |||||||| || ||||||||||| || |  ||   ||| |  
Sbjct  93011  GGGTACACGCACGACGGTCCGTGCGAAGTGTGGCTGGACGATACGATGGT-CATGCAGTA  93069

Query  433    CG-CAACTGCCACACCGAATTC--CCGCAGGGTCAGCACCAGGTCGACTACAGCTCGTG-  488
              || |||||| |||   |   ||  | ||| || |  |||||  | |||||||| || || 
Sbjct  93070  CGACAACTGTCACGAGGCTATCAGCGGCAAGGACTACACCA--TAGACTACAGTTCTTGC  93127

Query  489    -CGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTC--GAAGGAAT  545
               || | |  |||||||||| |  |||| |||||||||  ||  |||| ||  ||| ||  
Sbjct  93128  ACGTCCA--CCTGCACGTTATACTGGTTCTGGCTCGGTGTCCGGTACCTCAAGAACGA--  93183

Query  546    CTACTCGTGGCAAGTGTACAAGAACTGCGTG  576
               |||||||||||  | ||||||  ||| |||
Sbjct  93184  GTACTCGTGGCAGATCTACAAGGCCTGTGTG  93214

 Score = 54.5 bits (59),  Expect = 5e-05
 Identities = 239/365 (65%), Gaps = 24/365 (7%)
 Strand=Plus/Minus

Query  220    TGGATGGAGC---AGCA-CGGCTACACGTCATTGCGTGCTATGCTGGACGATGAGTCGCT  275
              ||||||| ||   |||| |||||||| | |  |||| ||  |  |||||| ||   |   
Sbjct  94106  TGGATGGCGCCGTAGCAACGGCTACAAGACTCTGCGCGCCTTCATGGACGGTG---CCAA  94050

Query  276    GTACCAGGTGACGGAGGAAGCTATCTTTGAGTGCGGCCTCACGAGTCCCAAGACCGAGAC  335
              ||||   || || || | ||||  ||   | |||||| ||||||   ||||| | |   |
Sbjct  94049  GTACACTGTCACAGACGGAGCTGACTACTATTGCGGCTTCACGAACGCCAAGGCAGCTCC  93990

Query  336    GCAGCCCATCCCGACCA--ACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCG  393
              ||||||||| |||      ||||  |||||  |||  |||| ||||| |  || || |||
Sbjct  93989  GCAGCCCATTCCGGATGGCACAATGCGTTC--GAC--CGGG-TACACGCACGATGGTCCG  93935

Query  394    TGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCG-CAACTGCCACACCGAATT  452
              |||||||| ||||| |||  |||    ||  || | | | | ||||||||||      ||
Sbjct  93934  TGCGAGGTTTGGCTCGACTCCACGCGCGT-CCTCCAGTCGGACAACTGCCACGAGACGTT  93876

Query  453    CCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCG  510
              |||  ||| |    | || |  | |||||||||||||||   |  || |||| | ||   
Sbjct  93875  CCCGGGCAAG--ACGTACAACCTGGACTACAGCTCGTGCAAGGGCTCGTGCATGCTGCGT  93818

Query  511    TGGTACTGGCTCGGCATCAAGTACGTC--GAAGGAATCTACTCGTGGCAAGTGTACAAGA  568
              ||||||||| | || |     | | ||  ||| ||    |||||||||| ||||||||| 
Sbjct  93817  TGGTACTGGTTGGGAACGCGCTTCCTCAAGAACGA--GCACTCGTGGCAGGTGTACAAGG  93760

Query  569    ACTGC  573
               ||||
Sbjct  93759  CCTGC  93755

>PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.63, whole genome shotgun 
sequence
Length=342508

 Score = 613 bits (679),  Expect = 3e-173
 Identities = 493/593 (83%), Gaps = 8/593 (1%)
 Strand=Plus/Minus

Query  14      GTGGCAGCGctctcttctttcctcttcttcttct-ctcGCTGGTGCTG------TGCGTC  66
               |||||| | |||| |  | | ||   ||||| || ||||||  |||||      ||| ||
Sbjct  245280  GTGGCACCTCTCTGTGTTCTACTTCCCTTCTCCTGCTCGCTT-TGCTGGCCGCCTGCATC  245222

Query  67      ACTGGCCAACGCCGTCTGGACGCCGGACTGGGTGAGGGTCAAGTGGTGCAACATCCTCCG  126
                | ||||| || || |||||||| || ||||| |||||||| || ||||  || || |||
Sbjct  245221  GCCGGCCAGCGTCGGCTGGACGCGGGTCTGGGCGAGGGTCAGGTCGTGCTGCACCCGCCG  245162

Query  127     CCCTTCTTCATCGTGGACGGTCTGGACTTCCAGGGGATGGCGCTCGCCTATTTACAAGAG  186
               ||||||||| ||||||| ||||||||||| ||||| ||||| |||||||||||||| |||
Sbjct  245161  CCCTTCTTCGTCGTGGATGGTCTGGACTTTCAGGGCATGGCACTCGCCTATTTACAGGAG  245102

Query  187     CAGGGAGTTAACACAAGCATCGAAGCTCAGAGCTGGATGGAGCAGCACGGCTACACGTCA  246
               ||||| || ||||| ||||||||||| |||||||||||| |||||||||| ||||| || 
Sbjct  245101  CAGGGCGTCAACACGAGCATCGAAGCGCAGAGCTGGATGCAGCAGCACGGATACACTTCG  245042

Query  247     TTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGTGACGGAGGAAGCTATCTTTGAG  306
                ||||||| ||||||||||| ||||| |||||| ||||||||||||| || ||||| |||
Sbjct  245041  CTGCGTGCCATGCTGGACGACGAGTCCCTGTACAAGGTGACGGAGGAGGCCATCTTCGAG  244982

Query  307     TGCGGCCTCACGAGTCCCAAGACCGAGACGCAGCCCATCCCGACCAACAACTCGTTCCAG  366
               ||||| ||||| ||||||| ||| ||||||||||| |||||||| |||||||||||||||
Sbjct  244981  TGCGGACTCACAAGTCCCAGGACTGAGACGCAGCCTATCCCGACAAACAACTCGTTCCAG  244922

Query  367     ACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCT  426
               || ||||| || || ||||| ||||||||||||||||||||||||||||| || ||||| 
Sbjct  244921  ACGTCGGGATATACGCTGGATGGCCCGTGCGAGGTCTGGCTGGACGACACGAAGGTGTCC  244862

Query  427     GCGGGCCGCAACTGCCACACCGAATTCCCGCAGGGTCAGCACCAGGTCGACTACAGCTCG  486
                |||||||||||||||||||||||||||| || || |||||  |||||||||||||||| 
Sbjct  244861  TCGGGCCGCAACTGCCACACCGAATTCCCTCACGGCCAGCATGAGGTCGACTACAGCTCA  244802

Query  487     TGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATC  546
               |||||  || | |||||  | |||||||| ||||||||||| |||||| | || ||||||
Sbjct  244801  TGCGGGAAGGCGTGCACACTCTCGTGGTATTGGCTCGGCATTAAGTACATTGAGGGAATC  244742

Query  547     TACTCGTGGCAAGTGTACAAGAACTGCGTGGGCCTCGGAACGGCTGCCACGGC  599
               ||||||||||| || ||||||||||||||||| ||  | || ||  | |||||
Sbjct  244741  TACTCGTGGCAGGTCTACAAGAACTGCGTGGGGCTAAGCACAGCGCCAACGGC  244689

 Score = 57.2 bits (62),  Expect = 5e-06
 Identities = 145/212 (68%), Gaps = 18/212 (8%)
 Strand=Plus/Plus

Query  373     GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
               || ||||| |  ||||||||||| ||||| |||||||||||||| |  ||   ||| |  
Sbjct  242260  GGGTACACGCACGACGGCCCGTGTGAGGTGTGGCTGGACGACACCATGGT-CATGCAGTA  242318

Query  433     CG-CAACTGCCACACCGAATTCCCGCAGGGTC----AGCACCAGGTCGACTACAGCTCGT  487
               || |||||||||    |||  ||  ||| | |    |  ||  | ||||||| |||||||
Sbjct  242319  CGACAACTGCCA---TGAA-GCCATCAGTGGCAAATACTACACGATCGACTATAGCTCGT  242374

Query  488     G--CGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTAC--GTCGAAGGA  543
               |  || | |  |||||||  | |  |||| |||||| ||  ||   |||  |  ||| ||
Sbjct  242375  GCACGTCCA--CCTGCACACTCTATTGGTTCTGGCTGGGTGTCCGCTACCTGAAGAACGA  242432

Query  544     ATCTACTCGTGGCAAGTGTACAAGAACTGCGT  575
               |  |||||||||||  | ||||||  ||| ||
Sbjct  242433  A--TACTCGTGGCAGATTTACAAGGCCTGTGT  242462

 Score = 53.6 bits (58),  Expect = 5e-05
 Identities = 165/243 (68%), Gaps = 27/243 (11%)
 Strand=Plus/Minus

Query  337     CAGCCCATCCCGACC--AACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGT  394
               |||||||| |||  |  |||||  || ||||     |||| ||||| |  || || ||||
Sbjct  243267  CAGCCCATTCCGGACGGAACAATGCGCTCCA-----CGGGTTACACCCACGATGGTCCGT  243213

Query  395     GCGAGGTCTGGCTGGACGACACTAAA-GTGT-CTGCGGGCCG-CAACTGCCACACCGAAT  451
               | ||||| |||||   |||||| ||| | || || | | | | ||||||||||   ||  
Sbjct  243212  GTGAGGTTTGGCT---CGACACCAAACGCGTGCTCCAGTCGGACAACTGCCACGA-GA--  243159

Query  452     TCCCGCAGGGTCAGCACC----AGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTG  507
                ||  ||| | ||  ||     |  | |||||||||||||||   |   |||||||  | 
Sbjct  243158  -CCATCAGTGGCAAGACTTACAACCTTGACTACAGCTCGTGCACTGGTACCTGCACACT-  243101

Query  508     TCGT-GGTACTGGCTCGGCATCAAGTACGTCGAAGGAAT--CTACTCGTGGCAAGTGTAC  564
               |||| |||||||||| ||| |    ||| ||  | ||||  ||||||||||||  | |||
Sbjct  243100  TCGTTGGTACTGGCTGGGCGTACGCTACCTC--AAGAATGCCTACTCGTGGCAGATCTAC  243043

Query  565     AAG  567
               |||
Sbjct  243042  AAG  243040

>PHSO:scaffold_1
Length=13391543

 Score = 582 bits (645),  Expect = 5e-164
 Identities = 471/569 (83%), Gaps = 7/569 (1%)
 Strand=Plus/Minus

Query  37       cttcttcttctctcGCTGGTGCTGT--GCGTCACTGGCCAACGCCGTCTGGACGCCGGAC  94
                || || || ||| |||||||||||   |||||  | |||  |     |||||| | || |
Sbjct  2794148  CTGCTGCTCCTCGCGCTGGTGCTGCCGGCGTCGGTCGCCGGC-----CTGGACCCGGGCC  2794094

Query  95       TGGGTGAGGGTCAAGTGGTGCAACATCCTCCGCCCTTCTTCATCGTGGACGGTCTGGACT  154
                |||| ||||| || || ||||| || || ||||||||||||||||||||||| || ||||
Sbjct  2794093  TGGGCGAGGGCCAGGTCGTGCAGCACCCGCCGCCCTTCTTCATCGTGGACGGCCTCGACT  2794034

Query  155      TCCAGGGGATGGCGCTCGCCTATTTACAAGAGCAGGGAGTTAACACAAGCATCGAAGCTC  214
                ||||||| ||||||||||||||  | || |||||||| || || || ||||||||||| |
Sbjct  2794033  TCCAGGGCATGGCGCTCGCCTACCTGCAGGAGCAGGGCGTGAATACGAGCATCGAAGCGC  2793974

Query  215      AGAGCTGGATGGAGCAGCACGGCTACACGTCATTGCGTGCTATGCTGGACGATGAGTCGC  274
                ||||||||||| || ||||||||||| ||||  |||| || ||||||||||| |||||||
Sbjct  2793973  AGAGCTGGATGCAGGAGCACGGCTACGCGTCGCTGCGCGCCATGCTGGACGACGAGTCGC  2793914

Query  275      TGTACCAGGTGACGGAGGAAGCTATCTTTGAGTGCGGCCTCACGAGTCCCAAGACCGAGA  334
                | ||| ||||||||||||| ||  | || || |||||||||||||| |||||||||||||
Sbjct  2793913  TCTACAAGGTGACGGAGGAGGCGCTGTTCGACTGCGGCCTCACGAGCCCCAAGACCGAGA  2793854

Query  335      CGCAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGT  394
                ||||||||||||||| ||||| ||| || ||||| ||||||||||| ||||||||||| |
Sbjct  2793853  CGCAGCCCATCCCGAGCAACAGCTCCTTTCAGACGTCGGGCTACACGCTGGACGGCCCCT  2793794

Query  395      GCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCGCAACTGCCACACCGAATTCC  454
                |||||||||||||||||||||| || ||| |||| |||||||||||||||||  | ||||
Sbjct  2793793  GCGAGGTCTGGCTGGACGACACCAAGGTGGCTGCTGGCCGCAACTGCCACACGCAGTTCC  2793734

Query  455      CGCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGT  514
                |||| || |||||| || ||||||||||| ||||||| || || |||||| | | |||||
Sbjct  2793733  CGCACGGCCAGCACGAGATCGACTACAGCGCGTGCGGAGACTCGTGCACGCTCTGGTGGT  2793674

Query  515      ACTGGCTCGGCATCAAGTACGTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTGCG  574
                ||||||||||||||||||||||||| ||   |||||||||||| || |||||||||||||
Sbjct  2793673  ACTGGCTCGGCATCAAGTACGTCGAGGGCGCCTACTCGTGGCAGGTCTACAAGAACTGCG  2793614

Query  575      TGGGCCTCGGAACGGCTGCCACGGCCTGA  603
                | |  ||| | | | | || || || |||
Sbjct  2793613  TCGCGCTCAGCAAGACGGCGACCGCGTGA  2793585

 Score = 100 bits (110),  Expect = 4e-19
 Identities = 153/213 (72%), Gaps = 14/213 (7%)
 Strand=Plus/Minus

Query  371      CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGG  430
                |||||||||| |  |||||||||||||||||||||||||||  |||    ||| |||| |
Sbjct  2791615  CGGGCTACACGCACGACGGCCCGTGCGAGGTCTGGCTGGACACCACGCGCGTG-CTGCAG  2791557

Query  431      GCCG-CAACTGCCACACCGAATTCCCGCAGGGTCA----GCACCAGGTCGACTACAGCTC  485
                 ||| ||||||||||     |  ||  ||| | ||    | || |  |||||||||||||
Sbjct  2791556  TCCGACAACTGCCAC----GAGACCTTCAGCGGCAAGACGTACGACCTCGACTACAGCTC  2791501

Query  486      GTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTC--GAAGGA  543
                ||||   |  ||||||||  ||   ||||||||||| ||| |    | | ||  ||| ||
Sbjct  2791500  GTGCAAGGGCTCCTGCACCCTGCGCTGGTACTGGCTGGGCGTGCGCTTCCTCAAGAACGA  2791441

Query  544      ATCTACTCGTGGCAAGTGTACAAGAACTGCGTG  576
                |  ||||||||||| || ||||||   ||||||
Sbjct  2791440  A--TACTCGTGGCAGGTTTACAAGGCGTGCGTG  2791410

 Score = 84.2 bits (92),  Expect = 3e-14
 Identities = 171/248 (69%), Gaps = 16/248 (6%)
 Strand=Plus/Plus

Query  336      GCAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGTG  395
                ||||||||| |||  | ||||| |  | |   |  | |||||||| |  |||||||||||
Sbjct  2790579  GCAGCCCATTCCGGACGACAACGCTATGCGCTCCACAGGCTACACGCACGACGGCCCGTG  2790638

Query  396      CGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCG-CAACTGCCACACCGAATTC-  453
                |||||| ||||| |||||||| |  ||   ||| |  || |||||||||   ||| | | 
Sbjct  2790639  CGAGGTTTGGCTCGACGACACCATGGT-CATGCAGTACGACAACTGCCA---CGAGTCCA  2790694

Query  454      ----CCGCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTC  509
                    | ||| || |  |||||  |||||||||||||||||  |    | |||||| | | 
Sbjct  2790695  TCAGCGGCAAGGACTACACCA--TCGACTACAGCTCGTGCACCTCCACGTGCACGCTCTA  2790752

Query  510      GTGGTACTGGCTCGGCATCAAGTACGTC--GAAGGAATCTACTCGTGGCAAGTGTACAAG  567
                 |||| |||||| ||| |    ||| ||  ||| ||   |||||||||||  | ||||||
Sbjct  2790753  CTGGTTCTGGCTGGGCGTGCGCTACCTCAAGAACGA--GTACTCGTGGCAGATCTACAAG  2790810

Query  568      AACTGCGT  575
                   |||||
Sbjct  2790811  GCGTGCGT  2790818

 Score = 48.2 bits (52),  Expect = 0.002
 Identities = 29/31 (94%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  386      ACGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
                |||||||||||||||||||| | ||||||||
Sbjct  2592429  ACGGCCCGTGCGAGGTCTGGATCGACGACAC  2592459

 Score = 48.2 bits (52),  Expect = 0.002
 Identities = 29/31 (94%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  386      ACGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
                |||||||||||||||||||| | ||||||||
Sbjct  2595283  ACGGCCCGTGCGAGGTCTGGATCGACGACAC  2595253

>PHRA:scaffold_56
Length=334739

 Score = 571 bits (632),  Expect = 9e-161
 Identities = 463/559 (83%), Gaps = 9/559 (2%)
 Strand=Plus/Plus

Query  35      ctcttcttcttct-ctcGC--TGGTGCTGTGCG------TCACTGGCCAACGCCGTCTGG  85
               |||| ||||| || |||||  || |||||  ||      || | ||||| |||||  |||
Sbjct  160878  CTCTGCTTCTGCTGCTCGCAGTGCTGCTGCCCGCTTCGATCGCCGGCCAGCGCCGCTTGG  160937

Query  86      ACGCCGGACTGGGTGAGGGTCAAGTGGTGCAACATCCTCCGCCCTTCTTCATCGTGGACG  145
               |||| |||||||| ||||| ||  | ||||  || || ||||||||||||||||||||||
Sbjct  160938  ACGCAGGACTGGGCGAGGGCCAGATCGTGCTGCACCCGCCGCCCTTCTTCATCGTGGACG  160997

Query  146     GTCTGGACTTCCAGGGGATGGCGCTCGCCTATTTACAAGAGCAGGGAGTTAACACAAGCA  205
               | |||||||||||||| |||||||| |||||| | || |||||||| || ||||| ||||
Sbjct  160998  GCCTGGACTTCCAGGGCATGGCGCTGGCCTATCTGCAGGAGCAGGGCGTGAACACGAGCA  161057

Query  206     TCGAAGCTCAGAGCTGGATGGAGCAGCACGGCTACACGTCATTGCGTGCTATGCTGGACG  265
               |||| || ||| |||||||| |||||||||||||| ||||  ||||  | ||||||||||
Sbjct  161058  TCGAGGCCCAGGGCTGGATGCAGCAGCACGGCTACGCGTCGCTGCGCTCCATGCTGGACG  161117

Query  266     ATGAGTCGCTGTACCAGGTGACGGAGGAAGCTATCTTTGAGTGCGGCCTCACGAGTCCCA  325
               | |||||||||||||||||||||||||| || ||||| || ||||| |||||||| ||||
Sbjct  161118  ACGAGTCGCTGTACCAGGTGACGGAGGAGGCCATCTTCGACTGCGGACTCACGAGCCCCA  161177

Query  326     AGACCGAGACGCAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGG  385
               | || || ||||||| |||||||||||||| |||||||||| | ||||||||||| || |
Sbjct  161178  AAACTGAAACGCAGCTCATCCCGACCAACAGCTCGTTCCAGTCGTCGGGCTACACGCTCG  161237

Query  386     ACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCGCAACTGCCACA  445
               |||||||||| |||||||||||||||||||| || | | | |||||||||||||||||||
Sbjct  161238  ACGGCCCGTGTGAGGTCTGGCTGGACGACACCAAGGCGGCGGCGGGCCGCAACTGCCACA  161297

Query  446     CCGAATTCCCGCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGT  505
               |||| |||||||| || ||||||||| ||||||| ||| ||||||| |   | |||| | 
Sbjct  161298  CCGAGTTCCCGCACGGCCAGCACCAGATCGACTATAGCGCGTGCGGAGCCGCGTGCATGC  161357

Query  506     TGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATCTACTCGTGGCAAGTGTACA  565
               |   |||||||||||||||||||||||||||||||||    ||||||||||| || ||||
Sbjct  161358  TCCGGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGCGCGTACTCGTGGCAGGTCTACA  161417

Query  566     AGAACTGCGTGGGCCTCGG  584
               |||||||| | |  |||||
Sbjct  161418  AGAACTGCATCGCGCTCGG  161436

 Score = 80.6 bits (88),  Expect = 4e-13
 Identities = 148/210 (70%), Gaps = 8/210 (4%)
 Strand=Plus/Plus

Query  371     CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGG  430
               |||||||||| |  ||||||||||||||||||||||| |||  |||    |||    |  
Sbjct  162809  CGGGCTACACGCACGACGGCCCGTGCGAGGTCTGGCTCGACACCACGCGCGTGCTCACCC  162868

Query  431     GCCGCAACTGCCACACCGAATTC--CCGCAGGGTCAGCACCAGGTCGACTACAGCTCGTG  488
                |  ||||||||||   |   ||  | ||| || |  |||||  |||||||||| |||||
Sbjct  162869  ACGACAACTGCCACGAGGCCATCAGCGGCAAGGACTACACCA--TCGACTACAGTTCGTG  162926

Query  489     CGGCGAGT-CCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATC-  546
               |  || || |||||||  ||   ||||||||| | ||| |    ||| || ||| |  | 
Sbjct  162927  C-ACGGGTACCTGCACACTGCACTGGTACTGGATGGGCGTGCGCTACCTC-AAGAACGCG  162984

Query  547     TACTCGTGGCAAGTGTACAAGAACTGCGTG  576
               ||||| ||||| |||||||||  ||| |||
Sbjct  162985  TACTCCTGGCAGGTGTACAAGGCCTGTGTG  163014

 Score = 68.9 bits (75),  Expect = 2e-09
 Identities = 145/210 (69%), Gaps = 10/210 (5%)
 Strand=Plus/Minus

Query  371     CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGG  430
               |||||||||| |  ||||| |||||||||||||||||||||||||| |  ||   ||| |
Sbjct  163813  CGGGCTACACGCACGACGGTCCGTGCGAGGTCTGGCTGGACGACACCATGGT-CATGCAG  163755

Query  431     GCCG-CAACTGCCACACCGAATTC--CCGCAGGGTCAGCACCAGGTCGACTACAGCTCGT  487
                  |  |||||||||   |   ||  | ||| || |   ||||  |||||||||| || |
Sbjct  163754  TATGATAACTGCCACGAGGTCATCAGCGGCAAGGACTATACCA--TCGACTACAGTTCAT  163697

Query  488     G--CGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAAT  545
               |  || | |  |||||||| | |  |||| |||| | ||| |    ||| || |      
Sbjct  163696  GCACGTCCA--CCTGCACGCTTTACTGGTTCTGGATGGGCGTGCGCTACCTCAACAACGC  163639

Query  546     CTACTCGTGGCAAGTGTACAAGAACTGCGT  575
               |||||| ||||| |||||||||   |||||
Sbjct  163638  CTACTCCTGGCAGGTGTACAAGGCGTGCGT  163609

>PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 
genomic scaffold, whole genome shotgun sequence
Length=695754

 Score = 522 bits (578),  Expect = 4e-146
 Identities = 462/575 (80%), Gaps = 8/575 (1%)
 Strand=Plus/Minus

Query  14      GTGGCAGCGctctcttctttcctcttcttcttct-ctcGCTGGTGCTG------TGCGTC  66
               ||||||||  || ||  | | || ||||||| || ||||||  | |||      ||||||
Sbjct  395432  GTGGCAGCTTTCCCTGTTCTACTTTTCTTCTCCTGCTCGCTC-TCCTGCCCGCCTGCGTC  395374

Query  67      ACTGGCCAACGCCGTCTGGACGCCGGACTGGGTGAGGGTCAAGTGGTGCAACATCCTCCG  126
                | || || || || ||||| || || || || ||||| ||  | ||||  || || || 
Sbjct  395373  GCCGGTCAGCGACGACTGGATGCGGGTCTAGGCGAGGGCCAGATCGTGCTGCACCCGCCT  395314

Query  127     CCCTTCTTCATCGTGGACGGTCTGGACTTCCAGGGGATGGCGCTCGCCTATTTACAAGAG  186
               || |||||| ||||||| ||||||||||| ||||| ||||| ||||| ||  |||| |||
Sbjct  395313  CCTTTCTTCGTCGTGGATGGTCTGGACTTTCAGGGCATGGCACTCGCTTACCTACAGGAG  395254

Query  187     CAGGGAGTTAACACAAGCATCGAAGCTCAGAGCTGGATGGAGCAGCACGGCTACACGTCA  246
               |||||| | ||||| |||||||| || |||||||||||| | || || || ||||  || 
Sbjct  395253  CAGGGAATCAACACGAGCATCGAGGCACAGAGCTGGATGCAACAACAAGGATACAGTTCG  395194

Query  247     TTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGTGACGGAGGAAGCTATCTTTGAG  306
                |||| || |||||||| ||||| ||||| ||| ||||||| ||||| || ||||| |||
Sbjct  395193  CTGCGCGCCATGCTGGATGATGAATCGCTTTACAAGGTGACAGAGGAGGCCATCTTCGAG  395134

Query  307     TGCGGCCTCACGAGTCCCAAGACCGAGACGCAGCCCATCCCGACCAACAACTCGTTCCAG  366
               ||||| ||||| || || | ||| ||||| |||||||||||||| ||||||||||| |||
Sbjct  395133  TGCGGACTCACAAGCCCTAGGACTGAGACTCAGCCCATCCCGACGAACAACTCGTTTCAG  395074

Query  367     ACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCT  426
               || ||||||||||| |||||||||||||| ||| |||||||||||||||| || ||| | 
Sbjct  395073  ACGTCGGGCTACACGCTGGACGGCCCGTGTGAGATCTGGCTGGACGACACCAAGGTGGCC  395014

Query  427     GCGGGCCGCAACTGCCACACCGAATTCCCGCAGGGTCAGCACCAGGTCGACTACAGCTCG  486
                |||||||||||||||| ||||||||||| || || ||||||||||||||||||||||| 
Sbjct  395013  TCGGGCCGCAACTGCCATACCGAATTCCCACACGGCCAGCACCAGGTCGACTACAGCTCA  394954

Query  487     TGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATC  546
               |||||||  || |||    | || |||||||||||||||||||| |||||||| ||||||
Sbjct  394953  TGCGGCGGCTCGTGCCATCTATCTTGGTACTGGCTCGGCATCAAATACGTCGAGGGAATC  394894

Query  547     TACTCGTGGCAAGTGTACAAGAACTGCGTGGGCCT  581
               ||||| ||||| || ||||| ||||| ||||| ||
Sbjct  394893  TACTCTTGGCAGGTCTACAAAAACTGTGTGGGTCT  394859

 Score = 48.2 bits (52),  Expect = 0.002
 Identities = 35/41 (85%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  371     CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGAC  411
               ||||||||||||  || |||||||| ||||| ||||| |||
Sbjct  358899  CGGGCTACACACACGATGGCCCGTGTGAGGTTTGGCTCGAC  358859

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 38/50 (76%), Gaps = 0/50 (0%)
 Strand=Plus/Minus

Query  475     GACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGG  524
               |||||||||||||||   |   |||||||| |    ||||||||||| ||
Sbjct  358795  GACTACAGCTCGTGCAAGGGCACCTGCACGCTACGCTGGTACTGGCTTGG  358746

>PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_98.1_contig_1:1:103693:1 
REF
Length=103693

 Score = 442 bits (489),  Expect = 1e-121
 Identities = 392/489 (80%), Gaps = 6/489 (1%)
 Strand=Plus/Minus

Query  97     GGTGAGGGTCAAGTGGTGCAACATCCTCCGCCCTTCTTCATCGTGGACGGTCTGGACTTC  156
              |||||||||||| | ||||  || || || ||||||||||| ||||||||||||||||| 
Sbjct  60915  GGTGAGGGTCAAATTGTGCTCCAACCGCCACCCTTCTTCATTGTGGACGGTCTGGACTTT  60856

Query  157    CAGGGGATGGCGCTCGCCTATTTACAAGAGCAGGGAGTTAACACAAGCATCGAAGCTCAG  216
              ||||||||||| ||||||||  | || |||||||| || ||||| || || ||| | |||
Sbjct  60855  CAGGGGATGGCCCTCGCCTACCTCCAGGAGCAGGGGGTCAACACGAGTATTGAAACCCAG  60796

Query  217    AGCTGGATGGAGCAGCACGGCTACACGTCATTGCGTGCTATGCTGGACGATGAGTCGCTG  276
               |||||||| |    || ||||||   ||  | || || ||||||||||| ||| | || 
Sbjct  60795  GGCTGGATGAACTCCCATGGCTACGACTCCCTACGCGCCATGCTGGACGACGAGGCACTC  60736

Query  277    TACCAGGTGACGGAGGAAGCTATCTTTGAGTGCGGCCTCACGAGTCCCAAGACCGAGACG  336
              ||| |||| |||||||| ||| ||||||| ||||| |||||||| || ||||||||||||
Sbjct  60735  TACAAGGTAACGGAGGAGGCTCTCTTTGACTGCGGTCTCACGAGCCCAAAGACCGAGACG  60676

Query  337    CAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGTGC  396
              |||| |||||||||||||| | | ||||||||||| || |||||| ||||||| ||||| 
Sbjct  60675  CAGCTCATCCCGACCAACAGCACCTTCCAGACTTCAGGTTACACAATGGACGGACCGTGT  60616

Query  397    GAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCGCAACTGCCACACCGAATTCCCG  456
              ||||||||||| |||||||  |||||| | || || ||||| |||||||| |||||||| 
Sbjct  60615  GAGGTCTGGCTAGACGACAAGAAAGTGGCGGCTGGACGCAATTGCCACACGGAATTCCCT  60556

Query  457    CAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTAC  516
              || ||   ||||  | ||||||||||||| || ||  | || |||||||||| |||||| 
Sbjct  60555  CATGGGATGCACTCGATCGACTACAGCTCCTGTGGAAACTCGTGCACGTTGTGGTGGTAT  60496

Query  517    TGGCTCGGCATCAAGTA---CGTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTGC  573
              ||||||||  |||||||    | ||| |||   ||||||||||| || ||||||||||||
Sbjct  60495  TGGCTCGGTGTCAAGTATACGGACGAGGGA---TACTCGTGGCAGGTTTACAAGAACTGC  60439

Query  574    GTGGGCCTC  582
              || || |||
Sbjct  60438  GTCGGACTC  60430

 Score = 57.2 bits (62),  Expect = 5e-06
 Identities = 37/41 (90%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  371    CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGAC  411
              ||||||||||||  || || |||||||||||||||||||||
Sbjct  58915  CGGGCTACACACACGATGGTCCGTGCGAGGTCTGGCTGGAC  58875

 Score = 50.9 bits (55),  Expect = 7e-04
 Identities = 145/213 (68%), Gaps = 14/213 (7%)
 Strand=Plus/Plus

Query  371    CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGC-G  429
              |||| ||||| |  ||||| || |||||||| ||||||||||| || |  ||   ||| |
Sbjct  57764  CGGGTTACACGCATGACGGTCCCTGCGAGGTGTGGCTGGACGATACGATGGT-CATGCAG  57822

Query  430    GGCCGCAACTGCCAC-AC-CGAATTCCCGCAGGGTCAGCACCAGGTCGACTACAGCTCGT  487
                |  ||| |||||| || | |      ||| || |  ||| |  | |||||||||||||
Sbjct  57823  TACAACAATTGCCACGACTCCATCAGTGGCAAGGACTACACTA--TTGACTACAGCTCGT  57880

Query  488    G--CGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTC--GAAGGA  543
              |  || | |  | || ||| | |  |||| |||| | ||| ||   ||  ||  ||| ||
Sbjct  57881  GTACGTCTA--CTTGTACGCTCTACTGGTTCTGGATGGGCGTCCGCTATCTCAAGAACGA  57938

Query  544    ATCTACTCGTGGCAAGTGTACAAGAACTGCGTG  576
                 ||||||||||| |||||||||   ||||||
Sbjct  57939  --GTACTCGTGGCAGGTGTACAAGGCGTGCGTG  57969

>PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2956, whole genome shotgun sequence
Length=1921269

 Score = 379 bits (419),  Expect = 1e-102
 Identities = 395/516 (77%), Gaps = 2/516 (0%)
 Strand=Plus/Minus

Query  70       GGCCAACGCCGTCTGGACGCCGGACTGGGTGAGGGTCAAGTGGTGCAACATCCTCCGCCC  129
                ||| | || || ||||| |||||  |||| |||||||| || ||     | ||  | |||
Sbjct  1847042  GGCTATCGTCGGCTGGAGGCCGGTTTGGGCGAGGGTCAGGTCGTATTGTACCCGGCCCCC  1846983

Query  130      TTCTTCATCGTGGACGGTCTGGACTTCCAGGGGATGGCGCTCGCCTATTTACAAGAGCAG  189
                || | | |||| ||||||||||| || || || ||||| ||||| |||||| | || || 
Sbjct  1846982  TTTTACGTCGTAGACGGTCTGGATTTTCAAGGTATGGCACTCGCGTATTTAGAGGAACAA  1846923

Query  190      GGAGTTAACACAAGCATCGAAGCTCAGAGCTGGATGGAGCAGCACGGCTACACGTCATTG  249
                ||  | ||||| || ||||| |  |||||||||||| || | |||| ||| |  ||| ||
Sbjct  1846922  GGCATCAACACGAGTATCGAGGTGCAGAGCTGGATGAAGGATCACGCCTATAATTCACTG  1846863

Query  250      CGTGCTATGCTGGACGATGAGTCGCTGTACCAGGTGACGGAGGAAGCTATCTTTGAGTGC  309
                || || ||||||||||||||   | ||||| |||| ||||| || |||||||||||||| 
Sbjct  1846862  CGCGCCATGCTGGACGATGATATGTTGTACAAGGTAACGGAAGAGGCTATCTTTGAGTGT  1846803

Query  310      GGCCTCACGAGTCCCAAGACCGAGACGCAGCCCATCCCGACCAACAACTCGTTCCAGACT  369
                || || || || |||||||| ||||||||||| ||||| ||||| || |||||   ||||
Sbjct  1846802  GGGCTTACTAGCCCCAAGACGGAGACGCAGCCTATCCCAACCAATAATTCGTTTGTGACT  1846743

Query  370      TCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCG  429
                || ||||| || ||||| || || |||||||||||| || || | || |  ||     ||
Sbjct  1846742  TCAGGCTATACGCTGGATGGTCCTTGCGAGGTCTGGTTGAACAATACGATGGTTATCACG  1846683

Query  430      GGCCGCAACTGCCACACCGAATTCCCGCAGGGTCAGCACCAGGTCGACTACAGCTCGTGC  489
                || ||||| ||| |||||||||| ||  | ||||| || |||||||||||||||| ||| 
Sbjct  1846682  GGTCGCAATTGCTACACCGAATTTCCTAATGGTCATCATCAGGTCGACTACAGCTTGTGT  1846623

Query  490      GGCGAGTCCTGCACG-TTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATCTA  548
                ||  | || || | | |||| |||||||||||| || ||||||||||||||||| || ||
Sbjct  1846622  GGGAATTCATGTAAGCTTGT-GTGGTACTGGCTTGGAATCAAGTACGTCGAAGGGATTTA  1846564

Query  549      CTCGTGGCAAGTGTACAAGAACTGCGTGGGCCTCGG  584
                 || |||||||| ||||| |||||| |   ||||||
Sbjct  1846563  TTCATGGCAAGTCTACAAAAACTGCATCAACCTCGG  1846528

>HYAP:scaffold_59 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_59:1:376122:1 
REF
Length=376122

 Score = 342 bits (378),  Expect = 8e-92
 Identities = 395/531 (74%), Gaps = 6/531 (1%)
 Strand=Plus/Plus

Query  45      tctctcGCTGGTGCTGTGCGTCACTGGCCAACGCCGTCTGGACGCCGGACTGGGTGAGGG  104
               |||||| |||    | |||||||| ||||| || |   |   |  ||  ||| | || ||
Sbjct  161179  TCTCTCACTGTCCGTATGCGTCACAGGCCAGCGGC---TCACCAGCGATCTGAGCGAAGG  161235

Query  105     TCAAGTGGTGCAACATCCTCCGCCCTTCTTCATCGTGGACGGTCTGGACTTCCAGGGGAT  164
                ||||| ||||   | ||  ||||    ||||| |||||||  | |  | |||| || | 
Sbjct  161236  CCAAGTCGTGCTTTACCCGTCGCCTCATTTCATTGTGGACGACCCGACCATCCAAGGCAA  161295

Query  165     GGCGCTCGCCTATTTACAAGAGCAGGGAGTTAACACAAGCATCGAAGCTCAGAGCTGGAT  224
                || || |||||| |||| ||||| ||  |  |||| || || |||||||||||||||| 
Sbjct  161296  AGCACTTGCCTATCTACAGGAGCAAGGCATAGACACGAGTATTGAAGCTCAGAGCTGGAA  161355

Query  225     GGAGCAGCACGGCTACACGTCATTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGT  284
               | |  |||||||||||  |||||| || || |||||||||||| ||||||||||||| ||
Sbjct  161356  GCAAGAGCACGGCTACGTGTCATTACGCGCGATGCTGGACGATCAGTCGCTGTACCACGT  161415

Query  285     GACGGAGGAAGCTATCTTTGAGTGCGGCCTCACGAGTCCCAAGACCGAGAC---GCAGCC  341
               | |  | || ||||||||||| |||||| ||||||| |    | |||||||   ||||  
Sbjct  161416  GTCCAAAGACGCTATCTTTGACTGCGGCTTCACGAGCCTTCCGTCCGAGACTTGGCAGGA  161475

Query  342     CATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGT  401
               ||| ||||| ||   | |  |  |||  || |||||||| ||||||||||| || |||||
Sbjct  161476  CATTCCGACGAATGGCACACTTGAGAGCTCCGGCTACACGCTGGACGGCCCCTGTGAGGT  161535

Query  402     CTGGCTGGACGACACTAAAGTGTCTGCGGGCCGCAACTGCCACACCGAATTCCCGCAGGG  461
               |||| | || |||||  ||||| |  | || ||||| || | ||| ||||||||||| ||
Sbjct  161536  CTGGTTCGATGACACGCAAGTGACATCAGGGCGCAATTGTCGCACGGAATTCCCGCACGG  161595

Query  462     TCAGCACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCT  521
                ||||| ||||| ||||||||||||||||| || || |||||  |   ||||||||||||
Sbjct  161596  ACAGCATCAGGTGGACTACAGCTCGTGCGGAGACTCGTGCACCCTCCGGTGGTACTGGCT  161655

Query  522     CGGCATCAAGTACGTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTG  572
               ||||||  ||||| | || || |||||||||||||| ||||| ||||||||
Sbjct  161656  CGGCATTCAGTACATGGATGGTATCTACTCGTGGCAGGTGTATAAGAACTG  161706

>PYVX:scaffold_275 pve_scaffold_275 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_275:1:32274:1 
REF
Length=32274

 Score = 310 bits (343),  Expect = 4e-82
 Identities = 374/505 (74%), Gaps = 8/505 (2%)
 Strand=Plus/Plus

Query  73    CAACGCCGTCTGGACGCCGGACTGGGTGAGGGTCAAGTGGTGCAACATCCTCCGCCCTTC  132
             || || || |||||| | || ||||| ||||| || |||||||   | || ||||| |||
Sbjct  6452  CAGCGGCGGCTGGACTCGGGCCTGGGCGAGGGCCAGGTGGTGCTCTACCCGCCGCCGTTC  6511

Query  133   TTCATCGTGGACGGTCTGGACTTCCAGGGGATGGCGC-TCGCCTATTTACAAGAGCAGGG  191
             ||| | ||||||||  |||||| || | || | || | | || ||  |  |  |||||||
Sbjct  6512  TTCGTGGTGGACGGCATGGACTACC-GCGGCTCGCCCGTGGCGTACCTGGAGCAGCAGGG  6570

Query  192   AGTTAACACAAGCATCGAAGCTCAGAGCTGGATGGAGCAGCACGGCTACACGTCATTGCG  251
              ||  ||||   |||||| || |||| |||| ||| | ||| ||||||| || |  ||||
Sbjct  6571  CGTGCACACGGCCATCGAGGCGCAGACCTGGCTGGCGGAGCGCGGCTACGCGACGCTGCG  6630

Query  252   TGCTATGCTGGACGATGAGTCGCTGTACCAGGTGACGGAGGAAGCTATCTTTGAGTGCGG  311
              ||  |  ||||||| ||    || |||  ||| |||||||| |   |||| || |||||
Sbjct  6631  CGCGCTCATGGACGACGACGGACTCTACTCGGTCACGGAGGAGGGGCTCTTCGACTGCGG  6690

Query  312   CCTCACGAGTCCCAAGACCGAGACGCAGCCCATCCCGACCAACAACTCGTTCCAGACTTC  371
              || ||    || || || ||||||||||| ||||||||||||  |||||||   || ||
Sbjct  6691  ACTTACCTTCCCGAACACGGAGACGCAGCCGATCCCGACCAACGGCTCGTTCATCACATC  6750

Query  372   GGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGG  431
              |||||||| |||||||| ||||||||| ||||| | ||| ||||    | |   |||||
Sbjct  6751  CGGCTACACGCTGGACGGGCCGTGCGAGATCTGGATCGACAACACGCTGGCGCTGGCGGG  6810

Query  432   CCGCAACTGCCACACCGAATTCCCGCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGG  491
             ||||||||||||||| || |||||| |||| || |||  | |||||||||||  ||||||
Sbjct  6811  CCGCAACTGCCACACGGAGTTCCCGGAGGGCCACCACACGATCGACTACAGCGTGTGCGG  6870

Query  492   CGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTAC---GTCGAAGGAATCTA  548
             ||||  ||||    ||||||||| |||||||||||||||||||   | |||  |   |||
Sbjct  6871  CGAGAGCTGCCGCGTGTCGTGGTTCTGGCTCGGCATCAAGTACCAGGGCGAGCG---CTA  6927

Query  549   CTCGTGGCAAGTGTACAAGAACTGC  573
             ||||||||| || | ||||||||||
Sbjct  6928  CTCGTGGCAGGTCTTCAAGAACTGC  6952

 Score = 105 bits (116),  Expect = 1e-20
 Identities = 222/323 (69%), Gaps = 15/323 (5%)
 Strand=Plus/Plus

Query  260   TGGACGATGAGTCGCTGTACCAGGTGACGGAGGAAGCTATCTTTGAGTGCGGCCTCACGA  319
             ||||||| || ||||| |||  |||||  | |   ||   |||    |||||| ||||| 
Sbjct  7746  TGGACGACGACTCGCTCTACTCGGTGAACGCGTCCGCGGACTTCCGATGCGGCTTCACGG  7805

Query  320   GTCCCAAGACCGAGACGCAGCCCATCCCGACCAACA--ACTCGTTCCAGACTTCGGGCTA  377
               ||  |  ||| | |||||||||||||   |  ||  |  || ||||     |||| ||
Sbjct  7806  ACCCGGACGCCGCGCCGCAGCCCATCCCCGACGGCATTATGCGCTCCA-----CGGGGTA  7860

Query  378   CACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCG-CA  436
             ||| |  ||||||||||||||||||||||| ||||||||    ||| |||| |  || ||
Sbjct  7861  CACGCACGACGGCCCGTGCGAGGTCTGGCTCGACGACACGCGTGTG-CTGCAGCACGACA  7919

Query  437   ACTGCCACACCG--AATTCCCGCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGA  494
             |||||||    |  |  ||| |||    |   || |  | ||||||    |||||  || 
Sbjct  7920  ACTGCCATGAGGTCATCTCCGGCAAAACC--TACGACCTTGACTACTCGGCGTGCAACGG  7977

Query  495   GTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAA-TCTACTCGT  553
              || |||||| |||  ||||||||||||||| |    ||| || ||| || |||||||||
Sbjct  7978  CTCGTGCACGCTGTACTGGTACTGGCTCGGCGTGCGCTACCTC-AAGCAAGTCTACTCGT  8036

Query  554   GGCAAGTGTACAAGAACTGCGTG  576
             |||| |||||||||  |||||||
Sbjct  8037  GGCAGGTGTACAAGGCCTGCGTG  8059

 Score = 104 bits (114),  Expect = 3e-20
 Identities = 146/197 (74%), Gaps = 10/197 (5%)
 Strand=Plus/Minus

Query  385   GACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGC--GGGCCGCAACTGCC  442
             ||||| ||||||||| ||||||| |||||||||   |  ||| |  ||||  ||||||||
Sbjct  9060  GACGGTCCGTGCGAGATCTGGCTCGACGACACTC--GCATCTTCCAGGGCGACAACTGCC  9003

Query  443   AC-ACCGAAT-TCCCGCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTG  500
             || |  |  | ||| ||| || ||   ||  |||||||||   |||||| |||  || ||
Sbjct  9002  ACGAGAGCGTCTCCGGCAAGGACACGGCC--GTCGACTACTCGTCGTGCAGCGGCTCGTG  8945

Query  501   CACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATC-TACTCGTGGCAAG  559
             |||| |||  |||| |||| | ||  |    ||| | ||||| | | |||||||||||||
Sbjct  8944  CACGCTGTACTGGTTCTGGATGGGTGTGCGCTACCT-GAAGGGAGCGTACTCGTGGCAAG  8886

Query  560   TGTACAAGAACTGCGTG  576
             |||||||||||||||||
Sbjct  8885  TGTACAAGAACTGCGTG  8869

 Score = 88.7 bits (97),  Expect = 3e-15
 Identities = 153/213 (72%), Gaps = 16/213 (8%)
 Strand=Plus/Minus

Query  371    CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGG  430
              |||| ||||| |  | ||| ||||||||||||||||| |||||||| |  ||| |||| |
Sbjct  14660  CGGGGTACACGCACGTCGGTCCGTGCGAGGTCTGGCTCGACGACACGATGGTG-CTGCAG  14602

Query  431    GCCG-CAACTGCCAC-ACCGAAT-TCCCGCAGGGTCAGCACCAGGTCGACTACAGCTCGT  487
                || |||||||||| ||  ||| ||  ||| |  |   || |  |||||||   |||||
Sbjct  14601  TACGACAACTGCCACGACTCAATCTCTGGCAAGACC--TACGACCTCGACTA---CTCGT  14547

Query  488    GCGGCGAGTCC---TGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTC--GAAGG  542
               | ||  ||||   |||||| | |  |||| |||| | ||| ||   ||| ||   || |
Sbjct  14546  CCTGCACGTCCACGTGCACGCTCTACTGGTTCTGGATGGGCGTCCGCTACCTCAACAACG  14487

Query  543    AATCTACTCGTGGCAAGTGTACAAGAACTGCGT  575
              |   ||||||||||| |||||||||||||||||
Sbjct  14486  A--GTACTCGTGGCAGGTGTACAAGAACTGCGT  14456

 Score = 74.3 bits (81),  Expect = 6e-11
 Identities = 106/145 (73%), Gaps = 6/145 (4%)
 Strand=Plus/Plus

Query  435    CAACTGCCACACCG--AATTCCCGCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGC  492
              |||||||||| |||  | |||  ||| || ||   |||  ||||||||   ||||||   
Sbjct  12678  CAACTGCCACGCCGCCATTTCGGGCAAGGACACGGCCA--TCGACTACTCGTCGTGCAAG  12735

Query  493    GAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATC-TACTC  551
              |  || |||||| |||  ||||||||| | ||  |    ||| | ||||| | | |||||
Sbjct  12736  GGCTCGTGCACGCTGTACTGGTACTGGATGGGTGTGCGCTACCT-GAAGGGAGCGTACTC  12794

Query  552    GTGGCAAGTGTACAAGAACTGCGTG  576
              ||||||||||||||||||||| |||
Sbjct  12795  GTGGCAAGTGTACAAGAACTGTGTG  12819

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 30/31 (97%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  546    CTACTCGTGGCAAGTGTACAAGAACTGCGTG  576
              ||||||||||||||||||||||||||| |||
Sbjct  13994  CTACTCGTGGCAAGTGTACAAGAACTGTGTG  14024

>PYUU:scaffold_2037 scf1117875582037 dna:supercontig supercontig:pug:scf1117875582037:1:1414051:1 
REF
Length=1414051

 Score = 122 bits (134),  Expect = 1e-25
 Identities = 274/400 (69%), Gaps = 14/400 (4%)
 Strand=Plus/Minus

Query  184      GAGCAGGGAGTTAACACAAGCATCGAAG-CTCAGAGCTGGATGGAGCAGCACGGCTACAC  242
                ||||||||  | || || |||  ||| | ||| || ||  ||| ||||| | || ||  |
Sbjct  1303013  GAGCAGGGCATCAAGACGAGCGCCGACGTCTCGGA-CTTCATGAAGCAGAAGGGGTATGC  1302955

Query  243      GTCATTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGTGACGGAGGAAGCTATCTT  302
                |    | || || |||||||||||  ||  ||| ||| | ||||    ||| ||  ||  
Sbjct  1302954  GAACCTTCGCGCGATGCTGGACGACCAGAAGCTCTACAACGTGAACCCGGATGCGCTCGA  1302895

Query  303      TGAGTGCGGCCTCACGAGTCCCAAGACCGAGACGCAGCCCATCCCGACCAACAACTCGTT  362
                 ||||||||   ||||   || | |  |||| | ||||| |||||    | |||| | ||
Sbjct  1302894  CGAGTGCGGGTACACGGACCCGACGGTCGAGTCACAGCCGATCCCAGTGACCAACGCCTT  1302835

Query  363      CCAGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGT  422
                |    |  |||| |||    || | || ||||||||||| ||||| |||||| || ||| 
Sbjct  1302834  CATCTCCACGGGGTACGTCTTGAATGGACCGTGCGAGGTGTGGCTCGACGAC-CTCAAG-  1302777

Query  423      GTC-TG-CGGGCCGCAACTGCCACACCGAATTCCCGCAGGGTCAGCACCA---GGTCGAC  477
                ||| || ||| |   |||||||||||  | | |||    |||  | ||     | |||||
Sbjct  1302776  GTCATGTCGGACATGAACTGCCACACAAAGTACCCC---GGTACGAACTTTATGCTCGAC  1302720

Query  478      TACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTC  537
                ||||||||||||   |  || |||| | ||  ||||||||||||||||||| ||  ||| 
Sbjct  1302719  TACAGCTCGTGCAAGGGATCGTGCATGCTGCGGTGGTACTGGCTCGGCATCCAGCCCGT-  1302661

Query  538      GAAGGAATC-TACTCGTGGCAAGTGTACAAGAACTGCGTG  576
                ||| ||  | ||||||||||| |||||||||  |||||||
Sbjct  1302660  GAACGAGACGTACTCGTGGCAGGTGTACAAGGTCTGCGTG  1302621

 Score = 120 bits (132),  Expect = 5e-25
 Identities = 314/463 (68%), Gaps = 26/463 (6%)
 Strand=Plus/Plus

Query  126      GCCCTTCTTCATCGTGGACGGTCTGGACTTCCAGGGGATGGCGCTCGCCTATTTACAAGA  185
                ||| |||||| |||| |||||   ||||   ||  ||| | ||||||| |   |  |  |
Sbjct  1299516  GCCGTTCTTCCTCGTCGACGGCAAGGACGCACAATGGAAGCCGCTCGCATTCCTTGAGAA  1299575

Query  186      GCAGGGAGTTAACACAAGCATCGAAG-CTCAGAGCTGGATGGAGCAGCACGGCTACACGT  244
                 ||||| || ||||| ||    || | | | | | |  ||| ||||| | || ||| || 
Sbjct  1299576  CCAGGGCGTGAACACGAGTGCTGATGTCGCCGGGTTC-ATGAAGCAGAAGGGGTACGCGA  1299634

Query  245      CATTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGTGACGGAGGAAGCTATCTTTG  304
                  ||||| ||  || ||||||||||   ||| ||| | || |    ||| ||  ||||||
Sbjct  1299635  ACTTGCGCGCGTTGATGGACGATGAAAAGCTCTACGAAGTTAACACGGACGCGCTCTTTG  1299694

Query  305      AGTGCGGCCTCACGAGTCCCAA-GACCGAGACGCAGCCCATCCCGACCA-----ACAACT  358
                |||||||   |||| | ||||| |  |||| |||| || ||||| || |     || | |
Sbjct  1299695  AGTGCGGGTACACG-GACCCAACGTACGAGTCGCAACCGATCCCCACGACGGGAACCATT  1299753

Query  359      CGTTCCAGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTA  418
                || || |     |||| ||||| |  || || ||||| || || ||||| || |||  | 
Sbjct  1299754  CGCTCGA-----CGGGGTACACCCACGATGGGCCGTGTGAAGTGTGGCTCGATGACG-TC  1299807

Query  419      AAGTGTC-TG-CGGGCCGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTC  474
                ||| ||| || |||||  ||||||||||  | | |||||  ||| |  |  | |  | ||
Sbjct  1299808  AAG-GTCATGTCGGGCGACAACTGCCACGACAAGTTCCCAGGCAAGACCTTCCC--GCTC  1299864

Query  475      GACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTAC  534
                |||||||||||||||   |  || |||||| ||  |||||||||||||||| |    |||
Sbjct  1299865  GACTACAGCTCGTGCAAGGGTTCATGCACGCTGCGGTGGTACTGGCTCGGCGTGCGCTAC  1299924

Query  535      GTCGAAGGAATC--TACTCGTGGCAAGTGTACAAGAACTGCGT  575
                 | ||| ||| |  |||||||||||  | |||||| | |||||
Sbjct  1299925  CT-GAA-GAAGCGATACTCGTGGCAGATTTACAAGGAGTGCGT  1299965

 Score = 100 bits (110),  Expect = 4e-19
 Identities = 232/347 (67%), Gaps = 16/347 (5%)
 Strand=Plus/Plus

Query  235      GGCTACACGTCATTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGTGACGGAGGAA  294
                ||||||| |||  |||| ||  |  |||||||  ||  |  |||| |||| |    | | 
Sbjct  1298161  GGCTACAAGTCGCTGCGCGCGTTCATGGACGACAAGAAGGCGTACAAGGTCAACTCGAAC  1298220

Query  295      GCTATCTTTGAGTGCGGCCTCACGAGTCCCAAGACCGAGACGC---AGCCCATCCCGACC  351
                ||   ||| |||||||||  ||| |    ||||| ||   |||   | || |||||| ||
Sbjct  1298221  GCCGACTTCGAGTGCGGCTACACCAA---CAAGAACGGCGCGCGCCAACCGATCCCGGCC  1298277

Query  352      AACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGAC  411
                |||      ||||  ||  |||| ||||| |  ||||| ||||||||||| ||||| |||
Sbjct  1298278  AAC------TTCCGCACCACGGGGTACACGCACGACGGTCCGTGCGAGGTGTGGCTCGAC  1298331

Query  412      GACACTAAAGTGTCTGCGGGCCGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACC  469
                 |||| || || |   ||||   |||||| ||||  || |||||  ||| |  |  | ||
Sbjct  1298332  AACACCAAGGTCTTGTCGGGTTCCAACTGTCACAAGGACTTCCCCGGCAAGACCCACGCC  1298391

Query  470      AGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCA  529
                | |    ||||    |||||   |  || |||||||||   ||||||||| | |||||| 
Sbjct  1298392  ATGAG--CTACGCGGCGTGCAAGGGCTCGTGCACGTTGCGCTGGTACTGGATGGGCATCC  1298449

Query  530      AGTACGTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTGCGTG  576
                  | | || | || |   |||||||||||||||||||| | ||||||
Sbjct  1298450  GCTTCCTCAAGGGCAAGCACTCGTGGCAAGTGTACAAGGAGTGCGTG  1298496

 Score = 81.5 bits (89),  Expect = 4e-13
 Identities = 142/205 (69%), Gaps = 4/205 (2%)
 Strand=Plus/Plus

Query  373      GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
                || ||||| |  ||||| || |||||||| ||||| ||| ||||    |||     ||||
Sbjct  1288901  GGTTACACCCACGACGGTCCATGCGAGGTGTGGCTCGACAACACCCTTGTGATGAAGGGC  1288960

Query  433      CGCAACTGCCACACCGAATTCCCGCAGGGTCA--GCACCAGGTCGACTACAGCTCGTGCG  490
                  |||||||||| | || |||||  |||  |   |||| || ||   |||   |||||| 
Sbjct  1288961  AACAACTGCCACTCGGAGTTCCC--AGGCACGACGCACAAGATCAGTTACGCTTCGTGCA  1289018

Query  491      GCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATCTACT  550
                  |  || |||||| ||   ||||||||| | || ||    | | || | || |  ||||
Sbjct  1289019  AGGGCTCGTGCACGCTGCGCTGGTACTGGATGGGTATTCGCTTCCTCAAGGGCAAGTACT  1289078

Query  551      CGTGGCAAGTGTACAAGAACTGCGT  575
                ||||||| |||||||||||||||||
Sbjct  1289079  CGTGGCAGGTGTACAAGAACTGCGT  1289103

 Score = 79.7 bits (87),  Expect = 1e-12
 Identities = 142/205 (69%), Gaps = 2/205 (1%)
 Strand=Plus/Plus

Query  373      GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
                || ||||| |  ||||| || |||||||| ||||| |||  |||    |||     ||||
Sbjct  1296162  GGTTACACCCACGACGGTCCATGCGAGGTGTGGCTCGACAGCACGCGCGTGATGAAGGGC  1296221

Query  433      CGCAACTGCCACACCGAATTCCC-GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGG  491
                  ||||||||||||||| ||| | | |  | | ||||    ||||||||   ||||||  
Sbjct  1296222  AACAACTGCCACACCGAGTTCACTGGAACGAC-GCACACAATCGACTACTCGTCGTGCAA  1296280

Query  492      CGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATCTACTC  551
                 |  || |||||| ||   ||||||||| | || ||    | | || | ||    |||||
Sbjct  1296281  GGGCTCGTGCACGCTGCGCTGGTACTGGATGGGTATTCGCTTCCTCAAGGGCGAGTACTC  1296340

Query  552      GTGGCAAGTGTACAAGAACTGCGTG  576
                |||||| |||||||| |||||||||
Sbjct  1296341  GTGGCAGGTGTACAAAAACTGCGTG  1296365

 Score = 77.0 bits (84),  Expect = 5e-12
 Identities = 141/205 (69%), Gaps = 4/205 (2%)
 Strand=Plus/Plus

Query  373      GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
                || ||||| |  ||||| || |||||||| ||||| ||   |||    |||     ||||
Sbjct  1294625  GGTTACACCCACGACGGTCCATGCGAGGTGTGGCTCGATAGCACGCGCGTGATGAAGGGC  1294684

Query  433      CGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCG  490
                  |||||||||| | || |||||  ||| |  |  ||  |  ||||||||   |||||| 
Sbjct  1294685  AACAACTGCCACTCGGAGTTCCCAGGCACGACCTTCAAAA--TCGACTACTCGTCGTGCA  1294742

Query  491      GCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATCTACT  550
                  |  || |||||| ||   ||||||||| | || ||    | | || | || |  ||||
Sbjct  1294743  AGGGCTCGTGCACGCTGCGCTGGTACTGGATGGGTATTCGCTTCCTCAAGGGCAAGTACT  1294802

Query  551      CGTGGCAAGTGTACAAGAACTGCGT  575
                ||||||| |||||||||||||||||
Sbjct  1294803  CGTGGCAGGTGTACAAGAACTGCGT  1294827

 Score = 61.7 bits (67),  Expect = 4e-07
 Identities = 215/325 (66%), Gaps = 22/325 (7%)
 Strand=Plus/Plus

Query  260      TGGACGATGAGTCGCTGTACCAGGTGA---CGGAGGAAGCTATCTTTGAGTGCGGCCTCA  316
                |||||||  ||  ||| ||| |||| |   || | |  | || ||||   ||||||  ||
Sbjct  1301155  TGGACGACCAGAAGCTCTACAAGGTCAACTCGAACGCCGATAACTTTCTCTGCGGCTACA  1301214

Query  317      CGAGTCCCAAGACCGAGA---CGCAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGG  373
                || | |||  |||| ||    ||||||| ||||| |   ||| | |  | |  ||  | |
Sbjct  1301215  CG-GACCC--GACCAAGGGCTCGCAGCCGATCCCCAAAGACAGCACCATGCGCACGACCG  1301271

Query  374      GCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCC  433
                | ||||| |  |  |||||||| || |||||| | ||||||   || ||    || ||| 
Sbjct  1301272  GATACACCCACGTGGGCCCGTGTGAAGTCTGGATCGACGACGTCAAGGTCATCGCAGGCG  1301331

Query  434      GCAACTGCCACACCGAATTCCCGCAGGGTCAGCACCA-GGTCGACTACAGCTCGTGC---  489
                 ||||||||||    || |   |||    || ||||| ||| |||||||||   |||   
Sbjct  1301332  ACAACTGCCACGAACAAGTGA-GCAA---CACCACCAAGGTGGACTACAGCAACTGCAAG  1301387

Query  490      GGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGA-AGGAATCTA  548
                ||| |||   ||||| ||   ||||||||||||||  |    | | || | | |||  | 
Sbjct  1301388  GGCAAGT---GCACGATGCACTGGTACTGGCTCGGATTGCGCTTCCTCAAGAAGAAG-TG  1301443

Query  549      CTCGTGGCAAGTGTACAAGAACTGC  573
                 ||||||||||||||||||||||||
Sbjct  1301444  GTCGTGGCAAGTGTACAAGAACTGC  1301468

>PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_8:1:111390:1 
REF
Length=111390

 Score = 118 bits (130),  Expect = 2e-24
 Identities = 305/455 (67%), Gaps = 10/455 (2%)
 Strand=Plus/Plus

Query  126     GCCCTTCTTCATCGTGGACGGTCTGGACTTCCAGGGGATGGCGCTCGCCTATTTACAAGA  185
               ||| |||||| |||||||||| | |||| | ||| ||  | ||||||| |   | | |||
Sbjct  107071  GCCGTTCTTCCTCGTGGACGGCCAGGACATGCAGTGGCAGCCGCTCGCGTTCCT-CGAGA  107129

Query  186     GCAGGGAGTT-AACACAAGCATCGAAGCTCAGAGCTGGATGGAGCAGCACGGCTACACGT  244
                |  | || | ||||| |||  |||   |    |||   |  ||||| | || ||| |  
Sbjct  107130  ACCAGAAGATCAACACGAGCGCCGACTTTGCCGGCTTCCTCAAGCAGAAAGGGTACGCAA  107189

Query  245     CATTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGTGACGGAGGAAGCTATCTTTG  304
                  |||| || ||| ||||||| |||  ||| ||| ||||||     || ||  |||| |
Sbjct  107190  ACCTGCGCGCCATGATGGACGACGAGAAGCTCTACGAGGTGAACCTCGATGCGCTCTTCG  107249

Query  305     AGTGCGGCCTCACGAGTCCCAAGACCGAGACGCAGCCCATCCCGACCAACAACTCGTTCC  364
               | ||||||  ||||   || | |  |||| ||||||| ||||||||||||  |  | |||
Sbjct  107250  ACTGCGGCTACACGGACCCGACGTACGAGTCGCAGCCGATCCCGACCAACGGCCAGATCC  107309

Query  365     AGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGT  424
                  |  ||||||| || |  ||||||||||||||||| ||||| ||||||  | |||  |
Sbjct  107310  GCTCCACGGGCTATACGCACGACGGCCCGTGCGAGGTTTGGCTCGACGAC-GTCAAGGTT  107368

Query  425     CTG-CGGGCCGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACA  481
                || ||||    |||||||| ||||| || ||  ||| |    |  | || |||||||| 
Sbjct  107369  ATGTCGGGAGAGAACTGCCATACCGAGTTTCCGGGCAAG--ACGTTCAAGATCGACTACT  107426

Query  482     GCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAG  541
                  |||||   |  || |||||| ||   ||||||||| | ||| |    | | || |||
Sbjct  107427  CGACGTGCAAGGGATCGTGCACGCTGCGCTGGTACTGGATGGGCCTTCGCTTCCTC-AAG  107485

Query  542     GA-ATCTACTCGTGGCAAGTGTACAAGAACTGCGT  575
                | |  |  |||||||| ||||||||| | || ||
Sbjct  107486  AACAAGTGGTCGTGGCAGGTGTACAAGGAGTGTGT  107520

 Score = 86.0 bits (94),  Expect = 9e-15
 Identities = 225/336 (67%), Gaps = 12/336 (4%)
 Strand=Plus/Plus

Query  238     TACACGTCATTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGTGACGGAGGAAGCT  297
               ||||||||  |||||||  |  || || |   | |||| |||  ||| |  | |   || 
Sbjct  110600  TACACGTCGCTGCGTGCGTTCATGAACAACTCGACGCTCTACACGGTCAACGCGAGCGCG  110659

Query  298     ATCTTTGAGTGCGGCCTCACGAGTCCCAAGACCGAGACGCAGCCCATCCCGACCAACAAC  357
               | ||||| ||| ||| | ||||  | | |   ||||  |||||| |||||||| |||  |
Sbjct  110660  AACTTTGGGTGTGGCTTTACGAAGCTCGACGGCGAGCGGCAGCCAATCCCGACGAACGGC  110719

Query  358     TCGTTCCAGACTT--CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACA  415
                 | | |   |||  | || ||||| |  ||||| |||||||||  |||| || |||| |
Sbjct  110720  CAGATGCG--CTTGACCGGGTACACCCACGACGGTCCGTGCGAGACCTGGATGAACGATA  110777

Query  416     CTAAAGTGTCTGCGGGCCGCAACTGCCACACCGA-ATTCCCGCAGGGTCAGCACCAG-GT  473
               | || |||| ||| |||   ||||||||||| ||  | ||| ||   | |||  |||  |
Sbjct  110778  CCAAGGTGTTTGCCGGCGAGAACTGCCACACGGAGCTGCCCTCA--ATTAGCTACAGCAT  110835

Query  474     CGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTA  533
                ||||||    |||||   |  || ||||   ||    |||||||| | ||||||   ||
Sbjct  110836  GGACTACTCGGCGTGCAAGGGCTCGTGCATACTGCGCCGGTACTGGATGGGCATCCGCTA  110895

Query  534     CGTC--GAAGGAATCTACTCGTGGCAAGTGTACAAG  567
               ||||  ||| ||   ||||||||||| |||||||||
Sbjct  110896  CGTCAAGAACGA--GTACTCGTGGCAGGTGTACAAG  110929

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  550     TCGTGGCAAGTGTACAAGAACTGC  573
               |||||||| |||||||||||||||
Sbjct  109250  TCGTGGCAGGTGTACAAGAACTGC  109273

>PHRA:scaffold_106
Length=147471

 Score = 105 bits (116),  Expect = 1e-20
 Identities = 176/246 (72%), Gaps = 14/246 (6%)
 Strand=Plus/Minus

Query  335    CGCAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGT  394
              |||||||||| ||| || ||||| || | |   |  |||| ||||| |  ||||| ||||
Sbjct  13178  CGCAGCCCATTCCGGCCGACAACGCGATGCGTTCCACGGGATACACGCACGACGGTCCGT  13119

Query  395    GCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCGCAACTGCCACACCGAATTCC  454
              ||||||| ||||| |||||||| |  |||   |  |||   |||||||||    | ||||
Sbjct  13118  GCGAGGTGTGGCTCGACGACACGATGGTGCTCGACGGCGAGAACTGCCACGAGAAGTTCC  13059

Query  455    C--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGAG---TCCTGCACGTTGTC  509
              |  ||| || |  ||||  ||||||||   ||||| | || ||    | |||||| | ||
Sbjct  13058  CTGGCAAGGACTACACC--GTCGACTA---CTCGTCCTGCAAGGGCACGTGCACGCT-TC  13005

Query  510    G-TGGTACTGGCTCGGCATCAAGTACGTCGAAGG-AATCTACTCGTGGCAAGTGTACAAG  567
              | ||||||||| | ||  ||   | | | ||||| || ||||||||||||||||||||||
Sbjct  13004  GTTGGTACTGGATGGGTGTCCGATTCCT-GAAGGAAACCTACTCGTGGCAAGTGTACAAG  12946

Query  568    AACTGC  573
               | |||
Sbjct  12945  GAGTGC  12940

>PYIW:scaffold_711 piw_scaffold_711 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_711:1:15030:1 
REF
Length=15030

 Score = 103 bits (113),  Expect = 1e-19
 Identities = 252/365 (69%), Gaps = 33/365 (9%)
 Strand=Plus/Plus

Query  229    CAGCACGGCTACAC--GTCATTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGTGA  286
              ||| | |||||| |  |||  |||| || ||||||||||| ||| |||| ||| | || |
Sbjct  10910  CAGAAGGGCTACGCCAGTC--TGCGCGCCATGCTGGACGACGAGACGCTCTACGACGTCA  10967

Query  287    CGGAGGAAGCTATCTTTGAGTGCGGCCTCACGAGTCCCAAGACCGAGACGCAGCCCATCC  346
                   ||  | |||||||||||||||  ||||   || | |  |||| ||||||| ||||
Sbjct  10968  ACATCGACTCAATCTTTGAGTGCGGCTACACGGACCCGACGTACGAGTCGCAGCCTATCC  11027

Query  347    CGACCAAC----AACT-CGTTCCAGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGT  401
              |||| |||    | || |||| ||     | |||||||    |||||| ||||||||| |
Sbjct  11028  CGACAAACGGCAAGCTGCGTTTCA-----CAGGCTACATGAAGGACGGGCCGTGCGAGAT  11082

Query  402    CTGGCTGGACGACACTAAAG-TG-TCTGCGGGCCGCAACTGCCACACCGAATTCCCGCAG  459
              |||| | |||||| || ||| || ||| | |  || |||||| | |  || ||||||  |
Sbjct  11083  CTGGATCGACGAC-CTCAAGCTGCTCTCCAGTGCG-AACTGCAAGAAGGACTTCCCG--G  11138

Query  460    GGTC-AGCAC-CAGGTCGACTAC---AGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGT  514
              |  | |||||  |  ||||||||   ||||     ||||||   |||||| ||   ||||
Sbjct  11139  GCACGAGCACAAAACTCGACTACTCGAGCTGCAAGGGCGAG---TGCACGCTGCGCTGGT  11195

Query  515    ACTGGCT---CGGCATCAAGTACGTCGAAGGAATC-TACTCGTGGCAAGTGTACAAGAAC  570
              ||  |||   ||  | |||| ||| ||   |  || ||||||||| | || |||||||||
Sbjct  11196  ACGCGCTGAGCGTGAGCAAG-ACGACGGGCGGCTCGTACTCGTGGGAGGTCTACAAGAAC  11254

Query  571    TGCGT  575
              |||||
Sbjct  11255  TGCGT  11259

 Score = 67.1 bits (73),  Expect = 9e-09
 Identities = 144/208 (69%), Gaps = 17/208 (8%)
 Strand=Plus/Plus

Query  373   GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCG--G  430
             |||||||| |  |  |||||||||||||||||| | ||||||   |  |||||  ||  |
Sbjct  5452  GGCTACACGCACGTGGGCCCGTGCGAGGTCTGGATCGACGACG--AGCGTGTCATCGCCG  5509

Query  431   GCCGCAACTGCCACACCGAATTCCCGCAGGGTCAGCACCA-GGTCGACTACAGCTCGTGC  489
             ||  |||||| |||    |  || |  |    ||  |||| ||| |||||||||   |||
Sbjct  5510  GCGACAACTGTCACGAGCAGGTCTCCAA----CACGACCAAGGTGGACTACAGCAACTGC  5565

Query  490   ---GGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGA-AGGAAT  545
                |||||||   ||||  ||   ||||||||||||||| |    ||| || | | ||| 
Sbjct  5566  AAGGGCGAGT---GCACCATGCGCTGGTACTGGCTCGGCCTGCGCTACCTCAAGAAGAAG  5622

Query  546   CTACTCGTGGCAAGTGTACAAGAACTGC  573
              |  |||||||| |||||||||||||||
Sbjct  5623  -TGGTCGTGGCAGGTGTACAAGAACTGC  5649

>PHRA:scaffold_267
Length=29552

 Score = 100 bits (110),  Expect = 4e-19
 Identities = 175/247 (71%), Gaps = 16/247 (6%)
 Strand=Plus/Plus

Query  335   CGCAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGT  394
             |||||||||| ||| |    ||| || | |   |  |||| ||||| |  ||||| ||||
Sbjct  9574  CGCAGCCCATTCCGGCTGGTAACGCGATGCGTTCCACGGGATACACGCACGACGGTCCGT  9633

Query  395   GCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCGCAACTGCCACACCGAATTCC  454
             ||||||| ||||| |||||||| |  |||   |  |||  |||||| |||    | ||||
Sbjct  9634  GCGAGGTGTGGCTTGACGACACGATGGTGCTCGACGGCGACAACTGTCACGAGAAGTTCC  9693

Query  455   C--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGAG---TCCTGCACGTTGTC  509
             |  ||| || |  ||||  ||||||||   ||||| | || ||    | |||||| | ||
Sbjct  9694  CTGGCAAGGACTACACC--GTCGACTA---CTCGTCCTGCAAGGGCACGTGCACGCT-TC  9747

Query  510   G-TGGTACTGGCTCGGCATCAAGTACGTC--GAAGGAATCTACTCGTGGCAAGTGTACAA  566
             | ||||||||||| ||||||   | | ||  ||| ||  |||||||||||||||||||||
Sbjct  9748  GTTGGTACTGGCTGGGCATCCGTTTCCTCAAGAACGA--CTACTCGTGGCAAGTGTACAA  9805

Query  567   GAACTGC  573
             | | |||
Sbjct  9806  GGAGTGC  9812

>PHSO:scaffold_35
Length=32414

 Score = 87.8 bits (96),  Expect = 3e-15
 Identities = 146/204 (72%), Gaps = 18/204 (9%)
 Strand=Plus/Minus

Query  373    GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
              |||||||| |  ||||||||||||||||| ||||| |||||||| |  |||   |  |||
Sbjct  18342  GGCTACACCCACGACGGCCCGTGCGAGGTGTGGCTCGACGACACGATGGTGCTGGATGGC  18283

Query  433    CGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCG  490
                ||||||||||    | |||||  ||| || |  |||  ||| ||||||   |||||| 
Sbjct  18282  GACAACTGCCACGAGAAGTTCCCGGGCAAGGACTACAC--GGTGGACTACTCATCGTGCA  18225

Query  491    GCGAGTCCTGCACGTTGTCG-TGGTACTGGCTCGGCATCAAGTACG----TCGAAGGAAT  545
                |   | |||||| | ||| ||||||||||| ||     ||| ||    | ||| ||||
Sbjct  18224  AGGGCACGTGCACGCT-TCGCTGGTACTGGCTGGG-----AGTGCGTTTCTTGAA-GAAT  18172

Query  546    --CTACTCGTGGCAAGTGTACAAG  567
                |||||||||||| |||||||||
Sbjct  18171  GACTACTCGTGGCAGGTGTACAAG  18148

>PHSO:scaffold_14
Length=1806347

 Score = 87.8 bits (96),  Expect = 3e-15
 Identities = 146/204 (72%), Gaps = 18/204 (9%)
 Strand=Plus/Minus

Query  373     GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
               |||||||| |  ||||||||||||||||| ||||| |||||||| |  |||   |  |||
Sbjct  819026  GGCTACACCCACGACGGCCCGTGCGAGGTGTGGCTCGACGACACGATGGTGCTGGATGGC  818967

Query  433     CGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCG  490
                 ||||||||||    | |||||  ||| || |  |||  ||| ||||||   |||||| 
Sbjct  818966  GACAACTGCCACGAGAAGTTCCCGGGCAAGGACTACAC--GGTGGACTACTCATCGTGCA  818909

Query  491     GCGAGTCCTGCACGTTGTCG-TGGTACTGGCTCGGCATCAAGTACG----TCGAAGGAAT  545
                 |   | |||||| | ||| ||||||||||| ||     ||| ||    | ||| ||||
Sbjct  818908  AGGGCACGTGCACGCT-TCGCTGGTACTGGCTGGG-----AGTGCGTTTCTTGAA-GAAT  818856

Query  546     --CTACTCGTGGCAAGTGTACAAG  567
                 |||||||||||| |||||||||
Sbjct  818855  GACTACTCGTGGCAGGTGTACAAG  818832

 Score = 71.6 bits (78),  Expect = 2e-10
 Identities = 60/74 (81%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  371     CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGG  430
               |||| ||||| |  ||||||||||||||||| ||||| |||||||| || |||   | ||
Sbjct  814226  CGGGTTACACGCACGACGGCCCGTGCGAGGTGTGGCTCGACGACACGAAGGTGCTGGAGG  814285

Query  431     GCCGCAACTGCCAC  444
               ||  ||||||||||
Sbjct  814286  GCGACAACTGCCAC  814299

>PHSO:scaffold_5
Length=6830280

 Score = 87.8 bits (96),  Expect = 3e-15
 Identities = 146/204 (72%), Gaps = 18/204 (9%)
 Strand=Plus/Minus

Query  373     GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
               |||||||| |  ||||||||||||||||| ||||| |||||||| |  |||   |  |||
Sbjct  682195  GGCTACACCCACGACGGCCCGTGCGAGGTGTGGCTCGACGACACGATGGTGCTGGATGGC  682136

Query  433     CGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCG  490
                 ||||||||||    | |||||  ||| || |  |||  ||| ||||||   |||||| 
Sbjct  682135  GACAACTGCCACGAGAAGTTCCCGGGCAAGGACTACAC--GGTGGACTACTCATCGTGCA  682078

Query  491     GCGAGTCCTGCACGTTGTCG-TGGTACTGGCTCGGCATCAAGTACG----TCGAAGGAAT  545
                 |   | |||||| | ||| ||||||||||| ||     ||| ||    | ||| ||||
Sbjct  682077  AGGGCACGTGCACGCT-TCGCTGGTACTGGCTGGG-----AGTGCGTTTCTTGAA-GAAT  682025

Query  546     --CTACTCGTGGCAAGTGTACAAG  567
                 |||||||||||| |||||||||
Sbjct  682024  GACTACTCGTGGCAGGTGTACAAG  682001

>PYIR:scaffold_2249 pir_scaffold_2249 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_2249:1:3349:1 
REF
Length=3349

 Score = 79.7 bits (87),  Expect = 1e-12
 Identities = 165/244 (68%), Gaps = 4/244 (2%)
 Strand=Plus/Minus

Query  335   CGCAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGT  394
             ||||||| |||||| |   || | || | |   |  | |||||||| |  ||||| ||||
Sbjct  1681  CGCAGCCGATCCCGTCAGCCAGCACGGTGCGCTCCACAGGCTACACCCACGACGGTCCGT  1622

Query  395   GCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCGCAACTGCCACACCGAATTCC  454
             ||||||||||||| ||| | ||    |||     ||||  |||||||||| | || ||||
Sbjct  1621  GCGAGGTCTGGCTCGACAAGACCCGTGTGCTCAAGGGCACCAACTGCCACTCGGAGTTCC  1562

Query  455   C--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTG  512
             |  ||| |  |  ||  || |||||||    || |||   |  || |||  | ||   ||
Sbjct  1561  CGGGCACGACCTTCA--AGATCGACTATTCGTCTTGCAAGGGTTCGTGCGTGCTGCGCTG  1504

Query  513   GTACTGGCTCGGCATCAAGTACGTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTG  572
             ||||||| | ||||||   | | |  | ||    ||||| ||||| ||||||||||||||
Sbjct  1503  GTACTGGATGGGCATCCGCTTCCTTAAGGGCCAGTACTCATGGCAGGTGTACAAGAACTG  1444

Query  573   CGTG  576
             ||||
Sbjct  1443  CGTG  1440

>PYIR:scaffold_5024 pir_scaffold_5024 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_5024:1:718:1 
REF
Length=718

 Score = 77.9 bits (85),  Expect = 5e-12
 Identities = 232/351 (66%), Gaps = 18/351 (5%)
 Strand=Plus/Plus

Query  235  GGCTACACGTCATTGCGTGCTATGCTGGACGATGAGTCGCTGTACCAGGT-GACG--GAG  291
            ||||||| | |  | |||||  |  |||||||  ||  |   ||| |||| ||||  | |
Sbjct  289  GGCTACAAGACCCTTCGTGCGTTCATGGACGACAAGAAGGCATACAAGGTCGACGCGGCG  348

Query  292  GAAGCTATCTTTGAGTGCGGCCTCACGAGTCCCAAGACCGAGACGCAGCCCATCCCGACC  351
            |  || | |||||||||||||  ||| |    |||   | ||   ||||| |||||  | 
Sbjct  349  GGCGCCAACTTTGAGTGCGGCTACACCAACATCAACGGCAAGCGCCAGCCGATCCCAGCG  408

Query  352  A--ACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGG  409
               ||||  || |||| |     || ||||| |  ||||| ||||||||||||||||| |
Sbjct  409  GGCACAATCCGCTCCACA-----GGTTACACTCACGACGGTCCGTGCGAGGTCTGGCTTG  463

Query  410  ACGACACTAAAGTGTCTGCGGGCCGCAACTGCCACACCGAATTCCCGCAGGGTCAG---C  466
            || |||| || ||     |||||  ||||||| |||  || |||||   |||  ||   |
Sbjct  464  ACAACACCAAGGTCATGTCGGGCACCAACTGCAACAAGGACTTCCC---GGGAAAGACCC  520

Query  467  ACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCA  526
            ||  | ||  ||||   ||||||   | ||| |||||| ||   ||||||||| | ||| 
Sbjct  521  ACTCGATCAGCTACGCGTCGTGCAAGGGGTCGTGCACGCTGCGCTGGTACTGGATGGGCC  580

Query  527  TCAAGTACGTCGAAGGA-ATCTACTCGTGGCAAGTGTACAAGAACTGCGTG  576
            |    | | || ||| | |  |  |||||||| ||||||||| | ||||||
Sbjct  581  TTCGCTTCCTC-AAGAACAAGTGGTCGTGGCAGGTGTACAAGGAGTGCGTG  630

>PYIR:scaffold_4828 pir_scaffold_4828 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_4828:1:781:1 
REF
Length=781

 Score = 77.9 bits (85),  Expect = 5e-12
 Identities = 176/256 (69%), Gaps = 18/256 (7%)
 Strand=Plus/Plus

Query  330  CGAGACGCAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGGACGG  389
            |||| |||||||||| ||||  ||| ||  | |||  ||  | || ||||| |  || ||
Sbjct  350  CGAGCCGCAGCCCATTCCGAAGAACGACCAGATCCGCACCACTGGATACACGCACGAAGG  409

Query  390  CCCGTGCGAGGTCTGGCTGGACGACACTAAAGTG-TCTGCGGGCCGCAACTGCCACACCG  448
             ||||||||| ||||||||||||||   || ||| ||| | |||   |||||||||  ||
Sbjct  410  GCCGTGCGAGATCTGGCTGGACGACGTCAAGGTGTTCTAC-GGCAAGAACTGCCACTACG  468

Query  449  A-----ATTCCCGCAGGGTC-AGCACCAGGTCGACTACAGCTCGTGC---GGCGAGTCCT  499
            |       ||| ||| |  |   ||  || |||||| |||||| |||   ||| ||   |
Sbjct  469  ACGTGGCATCCGGCATGAACTTCCAGAAGCTCGACTTCAGCTCATGCGTGGGCAAG---T  525

Query  500  GCACGTTGTCGTGGTACTGGCTCGGCATC--AAGTACGTCGAAGGAATCTACTCGTGGCA  557
            ||||  |||  ||||||||| | ||||||    ||| || | | | | |  |||||||||
Sbjct  526  GCACCATGTACTGGTACTGGATGGGCATCCGCGGTA-GTGGCAAG-AGCGTCTCGTGGCA  583

Query  558  AGTGTACAAGAACTGC  573
            | | |||||| | |||
Sbjct  584  AATCTACAAGGAGTGC  599

>PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 
genomic scaffold, whole genome shotgun sequence
Length=2113949

 Score = 68.0 bits (74),  Expect = 2e-09
 Identities = 140/204 (69%), Gaps = 6/204 (3%)
 Strand=Plus/Plus

Query  373     GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
               || ||||| |  ||||| ||||||||||| ||||| |||||||  |  |||   |  |||
Sbjct  673483  GGTTACACGCACGACGGACCGTGCGAGGTGTGGCTCGACGACAAGATGGTGCTGGATGGC  673542

Query  433     CGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCG  490
                 |||||| |||    | |||||  ||| || |  |||   || ||||||   || ||| 
Sbjct  673543  GACAACTGTCACGAGAAGTTCCCAGGCAAGGACTACAC--TGTGGACTACTCGTCATGCA  673600

Query  491     GCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGA-ATCTAC  549
                 |   | |||||| ||   ||||||||||| ||||||   | | | |||| | |  |||
Sbjct  673601  AGGGCACGTGCACGCTGCGCTGGTACTGGCTGGGCATCCGCTTCCT-GAAGAACAAGTAC  673659

Query  550     TCGTGGCAAGTGTACAAGAACTGC  573
               |||||||| ||||| |||  ||||
Sbjct  673660  TCGTGGCAGGTGTATAAGGCCTGC  673683

 Score = 63.5 bits (69),  Expect = 1e-07
 Identities = 139/204 (68%), Gaps = 6/204 (3%)
 Strand=Plus/Plus

Query  373     GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
               || ||||| |  ||||| |||||||| || ||||| |||||||  |  |||   |  |||
Sbjct  697190  GGTTACACGCACGACGGACCGTGCGAAGTGTGGCTTGACGACAAGATGGTGCTGGATGGC  697249

Query  433     CGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCG  490
                 |||||| |||    | |||||  ||| || |  |||   || ||||||   || ||| 
Sbjct  697250  GACAACTGTCACGAGAAGTTCCCAGGCAAGGACTACACT--GTGGACTACTCGTCATGCA  697307

Query  491     GCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATC-TAC  549
                 |   | |||||| ||   ||||||||||| ||| |    | | | |||| | || |||
Sbjct  697308  AGGGCACGTGCACGCTGCGCTGGTACTGGCTGGGCGTGCGCTTCTT-GAAGAACTCGTAC  697366

Query  550     TCGTGGCAAGTGTACAAGAACTGC  573
               |||||||| |||||||||  ||||
Sbjct  697367  TCGTGGCAGGTGTACAAGGCCTGC  697390

>PHIF:NW_003303626.1 Phytophthora infestans T30-4 supercont1.133 
genomic scaffold, whole genome shotgun sequence
Length=313873

 Score = 68.0 bits (74),  Expect = 2e-09
 Identities = 140/204 (69%), Gaps = 6/204 (3%)
 Strand=Plus/Plus

Query  373     GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
               || ||||| |  ||||| ||||||||||| ||||| |||||||  |  |||   |  |||
Sbjct  267334  GGTTACACGCACGACGGACCGTGCGAGGTGTGGCTCGACGACAAGATGGTGCTGGATGGC  267393

Query  433     CGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCG  490
                 |||||| |||    | |||||  ||| || |  |||   || ||||||   || ||| 
Sbjct  267394  GACAACTGTCACGAGAAGTTCCCAGGCAAGGACTACAC--TGTGGACTACTCGTCATGCA  267451

Query  491     GCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGA-ATCTAC  549
                 |   | |||||| ||   ||||||||||| ||||||   | | | |||| | |  |||
Sbjct  267452  AGGGCACGTGCACGCTGCGCTGGTACTGGCTGGGCATCCGCTTCCT-GAAGAACAAGTAC  267510

Query  550     TCGTGGCAAGTGTACAAGAACTGC  573
               |||||||| ||||| |||  ||||
Sbjct  267511  TCGTGGCAGGTGTATAAGGCCTGC  267534

>PHCA:scaffold_67 PHYCAscaffold_67
Length=292061

 Score = 67.1 bits (73),  Expect = 9e-09
 Identities = 147/213 (69%), Gaps = 12/213 (6%)
 Strand=Plus/Minus

Query  367     ACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCT  426
               || ||||| |||||||  ||||||||||| ||| ||||| |||  ||||     |  |||
Sbjct  219566  ACGTCGGGGTACACACACGACGGCCCGTGTGAGATCTGGATGGGGGACAAGCTCG-CTCT  219508

Query  427     G-CGGGCCGCAACTGCCACACCGAATTCCCGCAGGGTC----AGCACCAGGTCGACTACA  481
               | ||  || |||||||||   |||| |||  || || |     |  | || |||||||||
Sbjct  219507  GTCGTACCTCAACTGCCA---CGAA-TCCATCACGGACCAGACGTTCAAGCTCGACTACA  219452

Query  482     GCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAG  541
               |    || || ||   |||||   |||  ||||||||||| ||  |    ||| || |||
Sbjct  219451  GTGGCTGTGGTGATAGCTGCATTCTGTACTGGTACTGGCTGGGAGTTCGCTACCTC-AAG  219393

Query  542     GA-ATCTACTCGTGGCAAGTGTACAAGAACTGC  573
                | |  ||||||||||||||||||||| | |||
Sbjct  219392  AAGAAGTACTCGTGGCAAGTGTACAAGGAGTGC  219360

 Score = 61.7 bits (67),  Expect = 4e-07
 Identities = 146/214 (68%), Gaps = 14/214 (7%)
 Strand=Plus/Minus

Query  367     ACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCT  426
               || ||||| ||||| |  || |||||||||||| ||||| |||  ||||     |  |||
Sbjct  220574  ACGTCGGGATACACGCACGATGGCCCGTGCGAGATCTGGATGGGGGACAAGCTCG-CTCT  220516

Query  427     G-CGGGCCGCAACTGCCAC--ACCGAATTCCC--GCAG--GGTCAGCACCAGGTCGACTA  479
               | ||  || ||||||||||  | || || |||  ||||  | |||     || |||||||
Sbjct  220515  GTCGTACCTCAACTGCCACGAATCG-ATCCCCGAGCAGACGTTCA-----AGCTCGACTA  220462

Query  480     CAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGA  539
               |||    || || ||   |||||  ||||  ||||||||||| ||  |     |  || |
Sbjct  220461  CAGTGGCTGTGGTGATAGCTGCATTTTGTACTGGTACTGGCTGGGAGTGCGTAAACTCAA  220402

Query  540     AGGAATCTACTCGTGGCAAGTGTACAAGAACTGC  573
                || |  ||||||||||| ||||||||| | |||
Sbjct  220401  GGGCAAGTACTCGTGGCAGGTGTACAAGGAGTGC  220368

>PHCA:scaffold_7 PHYCAscaffold_7
Length=1368812

 Score = 67.1 bits (73),  Expect = 9e-09
 Identities = 140/201 (70%), Gaps = 11/201 (5%)
 Strand=Plus/Plus

Query  373     GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
               || ||||| |  ||||| ||||| || || ||||| |||||||| |  |||   |  || 
Sbjct  904589  GGTTACACGCACGACGGTCCGTGTGAAGTGTGGCTTGACGACACGATGGTGCTGGATGGT  904648

Query  433     CGCAACTGCCACACCGAATTCCCGCAGGGTCAGCACCA---GGTCGACTACAGCTCGTGC  489
                 ||||||||||    |||| || |  ||| |  || |   ||| ||||||   || |||
Sbjct  904649  GACAACTGCCACGAGAAATTTCCCC--GGTAAAGACTACACGGTGGACTACTCGTCTTGC  904706

Query  490     GGCGAGTCCTGCACGTTGTCG-TGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATC--  546
                  |   | |||||| | ||| ||||||||||| ||||||   | | | |||| ||||  
Sbjct  904707  AAGGGCACGTGCACGCT-TCGCTGGTACTGGCTGGGCATCCGTTTCTT-GAAG-AATCAG  904763

Query  547     TACTCGTGGCAAGTGTACAAG  567
               ||||||||||| |||||||||
Sbjct  904764  TACTCGTGGCAGGTGTACAAG  904784

 Score = 57.2 bits (62),  Expect = 5e-06
 Identities = 159/237 (67%), Gaps = 8/237 (3%)
 Strand=Plus/Minus

Query  335     CGCAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGT  394
               |||||||||| ||| |   |||| |  | |   |  |||| ||||| |  || || ||||
Sbjct  905715  CGCAGCCCATTCCGGCGGGCAACGCCATGCGCTCCACGGGTTACACGCACGATGGTCCGT  905656

Query  395     GCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCGCAACTGCCACACCGAATTCC  454
               | || || ||||| |||||||| |  |||   |  ||   ||||||||||    |||| |
Sbjct  905655  GTGAAGTGTGGCTTGACGACACGATGGTGCTGGATGGTGACAACTGCCACGAGAAATTTC  905596

Query  455     C--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGT-  511
               |  ||| || |  |||  ||| ||||||   || |||   |   | |||||| | |||| 
Sbjct  905595  CCGGCAAGGACTACAC--GGTGGACTACTCGTCTTGCAAGGGCACGTGCACGCT-TCGTT  905539

Query  512     GGTACTGGCTCGGCATCAAGTACGTCGAAGGAATC-TACTCGTGGCAAGTGTACAAG  567
               |||||||||| ||  |    | | | |||| |  | ||||||||||| |||||||||
Sbjct  905538  GGTACTGGCTGGGTGTTCGCTTCTT-GAAGAACGCGTACTCGTGGCAGGTGTACAAG  905483

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 134/200 (67%), Gaps = 10/200 (5%)
 Strand=Plus/Minus

Query  373     GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
               || ||||| |  ||||| ||||| ||||| ||| | || ||||| |  |||   |  || 
Sbjct  876435  GGTTACACGCACGACGGTCCGTGTGAGGTGTGGATTGATGACACGATGGTGATGGAAGGT  876376

Query  433     CGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGC-  489
                 ||||||||||    | |||||  | | || |  |||||  ||||||||    | ||| 
Sbjct  876375  GACAACTGCCACGAGAAGTTCCCTGGTAAGGACTACACCA--TCGACTACTCGCCCTGCA  876318

Query  490     --GGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATCT  547
                 ||| |||   ||||| |||  ||||||||||| ||  |    | | || ||   |  |
Sbjct  876317  AGGGCAAGT---GCACGCTGTACTGGTACTGGCTGGGTGTGCGTTTCCTCAAAAACAGAT  876261

Query  548     ACTCGTGGCAAGTGTACAAG  567
               |||||||||| |||||||||
Sbjct  876260  ACTCGTGGCAGGTGTACAAG  876241

 Score = 54.5 bits (59),  Expect = 5e-05
 Identities = 138/202 (68%), Gaps = 10/202 (5%)
 Strand=Plus/Plus

Query  371     CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTG--C  428
               |||| ||||| |  || || ||||| ||||| ||||| ||||| || |  ||| |||  |
Sbjct  909016  CGGGTTACACGCATGATGGTCCGTGTGAGGTGTGGCTTGACGATACGATGGTG-CTGGAC  909074

Query  429     GGGCCGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCG  486
               ||   | ||||| |||    | |||||  | | || |  |||||  ||||||||   || 
Sbjct  909075  GGAGAG-AACTGTCACGAGAAGTTCCCTGGTAAGGGCTACACCA--TCGACTACTCGTCT  909131

Query  487     TGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAAT-  545
               |||   |   |||||||| |||  |||| |||||| ||  |    | | | |||| |   
Sbjct  909132  TGCAAGGGCACCTGCACGCTGTACTGGTTCTGGCTTGGTGTTCGCTTCCT-GAAGAACGA  909190

Query  546     CTACTCGTGGCAAGTGTACAAG  567
               |||||||||||| |||||||||
Sbjct  909191  CTACTCGTGGCAGGTGTACAAG  909212

 Score = 53.6 bits (58),  Expect = 5e-05
 Identities = 137/203 (67%), Gaps = 12/203 (6%)
 Strand=Plus/Plus

Query  371     CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGG  430
               |||| ||||| |  ||||| ||||| || || ||| | || ||||| |  |||   |  |
Sbjct  901694  CGGGTTACACGCACGACGGTCCGTGTGAAGTGTGGATTGATGACACGATGGTGATGGAAG  901753

Query  431     GCCGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTG  488
               ||   |||||||||    | |||||  | | || |  |||||  ||||||||    | ||
Sbjct  901754  GCGATAACTGCCACGAGAAGTTCCCTGGTAAGGGCTACACCA--TCGACTACTCGCCCTG  901811

Query  489     C---GGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAAT  545
               |   ||| |||   ||||| |||  ||||||||||| ||  |    | | | |||  | |
Sbjct  901812  CAAGGGCAAGT---GCACGCTGTACTGGTACTGGCTGGGTGTTCGCTTCCT-GAAAAACT  901867

Query  546     C-TACTCGTGGCAAGTGTACAAG  567
               | ||||||||||| |||||||||
Sbjct  901868  CGTACTCGTGGCAGGTGTACAAG  901890

>PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.22, whole genome shotgun 
sequence
Length=998868

 Score = 66.2 bits (72),  Expect = 9e-09
 Identities = 161/237 (68%), Gaps = 8/237 (3%)
 Strand=Plus/Plus

Query  335     CGCAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGT  394
               |||||||||| ||| |   |||| |  | |   |  | || ||||| |  || |||||||
Sbjct  685604  CGCAGCCCATTCCGGCGGGCAACGCCATGCGTTCCACCGGATACACGCACGATGGCCCGT  685663

Query  395     GCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCGCAACTGCCACACCGAATTCC  454
               | || || ||||| ||||| ||||  |||  ||  |||  |||||| |||    | ||||
Sbjct  685664  GTGAAGTGTGGCTCGACGATACTATGGTGCTTGACGGCGACAACTGTCACGAGAAGTTCC  685723

Query  455     C--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCG-T  511
               |  ||| || |  |||   || ||||||   ||||||   |  || || ||| | ||| |
Sbjct  685724  CTGGCAAGGACTACACT--GTGGACTACTCGTCGTGCAAGGGCTCGTGTACGCT-TCGCT  685780

Query  512     GGTACTGGCTCGGCATCAAGTACGTCGAAGGAATC-TACTCGTGGCAAGTGTACAAG  567
               |||||||||| ||  |    | | | |||| | || ||||||||||| |||||||||
Sbjct  685781  GGTACTGGCTGGGTGTGCGTTTCTT-GAAGAACTCGTACTCGTGGCAGGTGTACAAG  685836

 Score = 65.3 bits (71),  Expect = 3e-08
 Identities = 197/300 (66%), Gaps = 6/300 (2%)
 Strand=Plus/Minus

Query  277     TACCAGGTGACGGAGGAAGCTATCTTTGAGTGCGGCCTCACGAGTCCCAAGACCGAGACG  336
               |||| ||| || || |  |||  |||  | |||||  | |||   ||||||  |    ||
Sbjct  682705  TACCCGGTCACAGATGGTGCTGACTTCAAATGCGGTTTTACGGACCCCAAGGGCACCCCG  682646

Query  337     CAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGTGC  396
               |||||||| ||| |   |||| |  | |   |  | || ||||| |  || |||||||| 
Sbjct  682645  CAGCCCATTCCGGCGGGCAACGCCATGCGTTCCACCGGATACACGCACGATGGCCCGTGT  682586

Query  397     GAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCGCAACTGCCACACCGAATTCCC-  455
               || || ||||| ||||| ||||  |||  ||  |||  |||||| |||    | ||||| 
Sbjct  682585  GAAGTGTGGCTCGACGATACTATGGTGCTTGACGGCGACAACTGTCACGAGAAGTTCCCT  682526

Query  456     -GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGT  514
                ||| || |  |||   || ||||||   ||||||   |   | |||||| | |  ||||
Sbjct  682525  GGCAAGGACTACACT--GTGGACTACTCGTCGTGCAAGGGCACGTGCACGCTTTACTGGT  682468

Query  515     ACTGGCTCGGCATCAAGTACGTCGAAGGAAT-CTACTCGTGGCAAGTGTACAAGAACTGC  573
               ||||||| ||  |    | | | |||| |   ||||||||||||||| ||||||  ||||
Sbjct  682467  ACTGGCTAGGTGTGCGTTTCCT-GAAGAACGACTACTCGTGGCAAGTATACAAGGCCTGC  682409

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 134/199 (67%), Gaps = 8/199 (4%)
 Strand=Plus/Minus

Query  373     GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGC  432
               || ||||| |  ||||||||||| || || ||||| ||||| ||||  |||  ||  || 
Sbjct  686848  GGATACACGCACGACGGCCCGTGTGAAGTGTGGCTCGACGATACTATGGTGCTTGATGGT  686789

Query  433     CGCAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCGTGCG  490
                  ||||| |||    | |||||  ||| || |  |||   || ||||||   |||||| 
Sbjct  686788  GAAAACTGTCACGAGAAGTTCCCTGGCAAGGACTACAC--TGTGGACTACTCGTCGTGCA  686731

Query  491     GCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATC--TA  548
                 |   | |||||| |    ||||||||||| || ||    | | ||  | ||| |  ||
Sbjct  686730  AGGGCACGTGCACGCTCCGTTGGTACTGGCTGGGTATTCGCTTCCTC--AAGAACCAGTA  686673

Query  549     CTCGTGGCAAGTGTACAAG  567
               ||||||||| |||||||||
Sbjct  686672  CTCGTGGCAGGTGTACAAG  686654

>PYAP:scaffold_560 pag1_scaffold_560 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_560:1:21458:1 
REF
Length=21458

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 61/79 (77%), Gaps = 0/79 (0%)
 Strand=Plus/Plus

Query  335    CGCAGCCCATCCCGACCAACAACTCGTTCCAGACTTCGGGCTACACACTGGACGGCCCGT  394
              ||||||| ||||| || |||  |  |||||  || ||||| ||||| |  || |||||||
Sbjct  12813  CGCAGCCGATCCCAACGAACGGCGAGTTCCGCACATCGGGATACACGCACGAAGGCCCGT  12872

Query  395    GCGAGGTCTGGCTGGACGA  413
              ||||| ||||| | |||||
Sbjct  12873  GCGAGATCTGGATCGACGA  12891

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 37/44 (84%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  373   GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
             |||||||| |  |||||||| || ||||||||||| ||| ||||
Sbjct  8289  GGCTACACGCACGACGGCCCATGTGAGGTCTGGCTCGACAACAC  8246

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 35/44 (80%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  373    GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
              || ||||| |  ||||||||||| ||||| ||||| ||  ||||
Sbjct  11033  GGTTACACGCACGACGGCCCGTGTGAGGTTTGGCTCGATAACAC  10990

>PHSO:scaffold_64
Length=40116

 Score = 61.7 bits (67),  Expect = 4e-07
 Identities = 60/75 (80%), Gaps = 2/75 (3%)
 Strand=Plus/Plus

Query  371    CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGC-G  429
              |||||||||| |  || |||||||||||||||||| | ||| ||||    ||| |||| |
Sbjct  38164  CGGGCTACACCCACGATGGCCCGTGCGAGGTCTGGATCGACAACACGCGCGTG-CTGCAG  38222

Query  430    GGCCGCAACTGCCAC  444
              |||  ||||||||||
Sbjct  38223  GGCGACAACTGCCAC  38237

>PHSO:scaffold_4
Length=7609242

 Score = 57.2 bits (62),  Expect = 5e-06
 Identities = 59/75 (79%), Gaps = 2/75 (3%)
 Strand=Plus/Plus

Query  371      CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGC-G  429
                |||||||||| |  || || ||||||||||||||| | ||| ||||    ||| |||| |
Sbjct  4365212  CGGGCTACACCCACGATGGTCCGTGCGAGGTCTGGATCGACAACACGCGCGTG-CTGCAG  4365270

Query  430      GGCCGCAACTGCCAC  444
                |||  ||||||||||
Sbjct  4365271  GGCGACAACTGCCAC  4365285

 Score = 57.2 bits (62),  Expect = 5e-06
 Identities = 59/75 (79%), Gaps = 2/75 (3%)
 Strand=Plus/Minus

Query  371      CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGC-G  429
                |||||||||| |  || || ||||||||||||||| | ||| ||||    ||| |||| |
Sbjct  4374081  CGGGCTACACCCACGATGGTCCGTGCGAGGTCTGGATCGACAACACGCGCGTG-CTGCAG  4374023

Query  430      GGCCGCAACTGCCAC  444
                |||  ||||||||||
Sbjct  4374022  GGCGACAACTGCCAC  4374008

>PHSO:scaffold_12
Length=2105860

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 72/99 (73%), Gaps = 3/99 (3%)
 Strand=Plus/Minus

Query  475     GACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTAC  534
               ||||||||| ||||||| ||   ||||  |||||  ||||||||||| ||| |    | |
Sbjct  162028  GACTACAGCGCGTGCGGAGACAGCTGCGTGTTGTACTGGTACTGGCTGGGCGTGCGCTTC  161969

Query  535     GTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTGC  573
                || | || ||   ||||| ||| ||||||||| | |||
Sbjct  161968  ATCAAGGGCAT---CTCGTAGCAGGTGTACAAGGAGTGC  161933

 Score = 53.6 bits (58),  Expect = 5e-05
 Identities = 71/99 (72%), Gaps = 0/99 (0%)
 Strand=Plus/Minus

Query  475     GACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTAC  534
               |||||||||   || |||||   |||||| ||||  ||||||||||| ||| |    | |
Sbjct  168524  GACTACAGCGGATGTGGCGATAGCTGCACCTTGTACTGGTACTGGCTGGGCGTGCGCTTC  168465

Query  535     GTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTGC  573
                || |    |  ||||||||||| ||||||||| | |||
Sbjct  168464  CTCAACAACAAGTACTCGTGGCAGGTGTACAAGGAGTGC  168426

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 73/100 (73%), Gaps = 2/100 (2%)
 Strand=Plus/Minus

Query  475     GACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTAC  534
               |||||||||   ||||| ||   |||||   |||  ||||||||||| ||| |   ||| 
Sbjct  167223  GACTACAGCGGCTGCGGGGATAGCTGCATCCTGTACTGGTACTGGCTGGGCGTGC-GTAA  167165

Query  535     GTCGAAGGA-ATCTACTCGTGGCAAGTGTACAAGAACTGC  573
               |  |||||  |  | ||||||||||||||||||| | |||
Sbjct  167164  GCTGAAGGGCAAGTTCTCGTGGCAAGTGTACAAGGAGTGC  167125

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 34/39 (87%), Gaps = 0/39 (0%)
 Strand=Plus/Minus

Query  373     GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGAC  411
               |||||||| |  |||||||| |||||| |||||||||||
Sbjct  210251  GGCTACACCCGTGACGGCCCATGCGAGATCTGGCTGGAC  210213

 Score = 44.6 bits (48),  Expect = 0.028
 Identities = 39/49 (80%), Gaps = 0/49 (0%)
 Strand=Plus/Minus

Query  367     ACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACA  415
               || ||||||||||| |  |||||||| |||||| |||   ||| |||||
Sbjct  168632  ACGTCGGGCTACACCCACGACGGCCCCTGCGAGATCTACATGGGCGACA  168584

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 38/49 (78%), Gaps = 0/49 (0%)
 Strand=Plus/Minus

Query  367     ACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACA  415
               || ||||||||||| |  ||||| ||||| ||| |||   ||| |||||
Sbjct  167331  ACGTCGGGCTACACCCACGACGGACCGTGTGAGATCTACATGGGCGACA  167283

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  388    GGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTG  423
              || ||||| ||| |||||||||||||||  || |||
Sbjct  95363  GGTCCGTGTGAGATCTGGCTGGACGACAAGAAGGTG  95398

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  388    GGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTG  423
              || ||||| ||| |||||||||||||||  || |||
Sbjct  97775  GGTCCGTGTGAGATCTGGCTGGACGACAAGAAGGTG  97810

>PYAR:scaffold_3459 par_scaffold_3459 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_3459:1:3265:1 
REF
Length=3265

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 190/286 (66%), Gaps = 18/286 (6%)
 Strand=Plus/Plus

Query  300   CTTTGAGTGCGGCCTCACGAGTCCCAAGACCGA-GACGCAGCCCATCCCGACCAACAACT  358
             ||| || |||||| ||||| | ||||| | ||  | ||||||| || ||||   ||  | 
Sbjct  2274  CTTCGAATGCGGCTTCACG-GACCCAAAAGCGCCGGCGCAGCCGATTCCGAAGGACGGCG  2332

Query  359   CGTTCCAGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTA  418
             ||||||  || || || ||||| |  || ||||| |||||| ||||| | ||||||   |
Sbjct  2333  CGTTCCGCACGTCAGGGTACACGCATGAAGGCCCATGCGAGATCTGGATTGACGACGTCA  2392

Query  419   AAGTGTCT-GCGGGCCG-CAACTGCCACACCGAATTCCCGCAG-----GGTCAGC-ACCA  470
               | |||  ||  | || ||| ||||||  |||  |  || ||     | |||   || |
Sbjct  2393  --GGGTCAAGCACGGCGACAATTGCCACTTCGACATTTCGGAGACCGCGTTCACTGACAA  2450

Query  471   GGTCGACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAA  530
             | | ||||||    |||||   |   | |||| | |   |||||||||||| ||||||  
Sbjct  2451  GATTGACTACTCGGCGTGCAAGGGCACGTGCATGCTCAAGTGGTACTGGCTGGGCATC-C  2509

Query  531   GTACGTCG---AAGGAATCTACTCGTGGCAAGTGTACAAGAACTGC  573
             |  || ||   |||  | ||||||||||||  | ||||||  ||||
Sbjct  2510  GCCCGACGGGCAAG--AGCTACTCGTGGCAGATCTACAAGGCCTGC  2553

>PHRA:scaffold_79
Length=220511

 Score = 53.6 bits (58),  Expect = 5e-05
 Identities = 140/205 (68%), Gaps = 8/205 (4%)
 Strand=Plus/Minus

Query  373    GGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGC-GGG  431
              || ||||| |  ||||| ||||| ||||||||||| ||| | ||    ||| || | |||
Sbjct  25883  GGATACACGCACGACGGGCCGTGTGAGGTCTGGCTAGACAATACCCGTGTG-CTCCAGGG  25825

Query  432    CCGCAACTGCCAC-ACCGAATTCCCG-CAGGGTCAGCACCAGGTCGACTACAGCTCGTGC  489
              |  |||||| ||| | |   |||||| || || |  | |||  | |||||    || |||
Sbjct  25824  CGACAACTGTCACGAGCAGTTTCCCGACAAGGACTACCCCA--TTGACTATTCGTCCTGC  25767

Query  490    GGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATC-TA  548
                 |   |||| || |||   ||||||||| ||||  |    | | || ||| | || ||
Sbjct  25766  AAAGGCACCTGTACATTGCACTGGTACTGGATCGGAGTTCGCTTCCTC-AAGAACTCGTA  25708

Query  549    CTCGTGGCAAGTGTACAAGAACTGC  573
              ||||||||| ||||||||| | |||
Sbjct  25707  CTCGTGGCAGGTGTACAAGGAGTGC  25683

>PHPA:scaffold_9 NW_008648995.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.9, whole genome shotgun 
sequence
Length=1651025

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 55/70 (79%), Gaps = 2/70 (3%)
 Strand=Plus/Plus

Query  388     GGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTG-CGGGCCGCAACTGCCACAC  446
               || |||||||||||||||   ||||||||||| ||| |||   | |  | ||||||| ||
Sbjct  538489  GGTCCGTGCGAGGTCTGGTGCGACGACACTAAGGTG-CTGTTCGACTACGACTGCCAGAC  538547

Query  447     CGAATTCCCG  456
               | ||||||||
Sbjct  538548  CAAATTCCCG  538557

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  388     GGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGT  424
               || |||||||||||||||   |||||||| || ||||
Sbjct  524159  GGTCCGTGCGAGGTCTGGTGCGACGACACCAAGGTGT  524195

>PHRA:scaffold_4
Length=963095

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 28/28 (100%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  387     CGGCCCGTGCGAGGTCTGGCTGGACGAC  414
               ||||||||||||||||||||||||||||
Sbjct  238390  CGGCCCGTGCGAGGTCTGGCTGGACGAC  238417

 Score = 46.4 bits (50),  Expect = 0.008
 Identities = 28/30 (93%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  387     CGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
               ||| ||||||||| ||||||||||||||||
Sbjct  239935  CGGTCCGTGCGAGATCTGGCTGGACGACAC  239964

 Score = 44.6 bits (48),  Expect = 0.028
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  387     CGGCCCGTGCGAGGTCTGGCTGGACGACA  415
               ||||||||||||| ||||||| |||||||
Sbjct  235304  CGGCCCGTGCGAGATCTGGCTTGACGACA  235332

 Score = 43.7 bits (47),  Expect = 0.099
 Identities = 31/36 (86%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  388     GGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTG  423
               ||||| || ||| |||||||||||||||| || |||
Sbjct  333285  GGCCCCTGTGAGATCTGGCTGGACGACACGAAGGTG  333320

 Score = 41.9 bits (45),  Expect = 0.35
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  552     GTGGCAAGTGTACAAGAACTGCGTG  576
               |||||| ||||||||||||||||||
Sbjct  333473  GTGGCAGGTGTACAAGAACTGCGTG  333497

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  549     CTCGTGGCAAGTGTACAAGAACTGCGT  575
               || |||||| |||||||||||||||||
Sbjct  238576  CTGGTGGCAGGTGTACAAGAACTGCGT  238602

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  388     GGCCCGTGCGAGGTCTGGCTGGACGACAC  416
               ||||| || ||| ||||||||||||||||
Sbjct  331530  GGCCCCTGTGAGATCTGGCTGGACGACAC  331558

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  549     CTCGTGGCAAGTGTACAAGAACTGC  573
               || |||||| |||||||||||||||
Sbjct  236959  CTGGTGGCAGGTGTACAAGAACTGC  236983

>PHKE:scaffold_622 scf_22126_622.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_622.1:1:14582:1 
REF
Length=14582

 Score = 50.0 bits (54),  Expect = 7e-04
 Identities = 142/210 (68%), Gaps = 14/210 (7%)
 Strand=Plus/Minus

Query  371   CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGG  430
             |||| ||||| |  ||||| ||||||||||||||| | ||||| ||    | |  || | 
Sbjct  3685  CGGGATACACGCACGACGGACCGTGCGAGGTCTGGATCGACGATACCCTTGCG-ATGGGC  3627

Query  431   GCCG-CAACTGCCACACCGAATTCCC--GCAGGGTCAGCACCAGGTCGACTACAGCTCGT  487
                | ||||||||||   |  |||||  ||| || |  |||||  |||||||   |||| 
Sbjct  3626  AATGACAACTGCCACGAGGCGTTCCCCGGCAAGGACTACACCA--TCGACTA---CTCGG  3572

Query  488   GCGGCGAG---TCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAA  544
              | || ||    | |||||  |    ||||||||||| ||| |    | | || ||| | 
Sbjct  3571  CCTGCAAGGGCACGTGCACACTCCGTTGGTACTGGCTGGGCGTGCGTTTCCTC-AAGAAT  3513

Query  545   T-CTACTCGTGGCAAGTGTACAAGAACTGC  573
             | |||||||||||| || ||||||  ||||
Sbjct  3512  TCCTACTCGTGGCAGGTATACAAGGCCTGC  3483

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 49/65 (75%), Gaps = 4/65 (6%)
 Strand=Plus/Plus

Query  511  TGGTACTGGCTCGGCATCAAGTACGTCGAAGGAAT--CTACTCGTGGCAAGTGTACAAGA  568
            ||||||||||| ||| |    | | || |  ||||  |||||||||||| ||||||||| 
Sbjct  64   TGGTACTGGCTGGGCGTGCGTTTCCTCAA--GAATGCCTACTCGTGGCAGGTGTACAAGG  121

Query  569  ACTGC  573
             ||||
Sbjct  122  CCTGC  126

>PHCA:scaffold_24 PHYCAscaffold_24
Length=787421

 Score = 50.0 bits (54),  Expect = 7e-04
 Identities = 33/37 (89%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  387     CGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTG  423
               ||||||||||||| ||||||||||||| || || |||
Sbjct  172142  CGGCCCGTGCGAGATCTGGCTGGACGATACGAAGGTG  172178

>PHSO:scaffold_11
Length=2192408

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 37/44 (84%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  371      CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGAC  414
                |||| ||||| |  ||||||||||| ||| | ||||||||||||
Sbjct  2022683  CGGGTTACACCCATGACGGCCCGTGTGAGATTTGGCTGGACGAC  2022640

 Score = 42.8 bits (46),  Expect = 0.099
 Identities = 57/77 (74%), Gaps = 2/77 (3%)
 Strand=Plus/Minus

Query  498      CTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTACGTCGAAGGAATC-TACTCGTGGC  556
                ||||||| ||   ||||||||||||||  |    | | || ||| | || ||||||||||
Sbjct  2022561  CTGCACGATGCACTGGTACTGGCTCGGAGTGCGCTTCCTC-AAGAACTCGTACTCGTGGC  2022503

Query  557      AAGTGTACAAGAACTGC  573
                | || |||||| | |||
Sbjct  2022502  AGGTCTACAAGGAGTGC  2022486

>PHRA:scaffold_2892
Length=2014

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 70/99 (71%), Gaps = 0/99 (0%)
 Strand=Plus/Minus

Query  475   GACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTAC  534
             |||||||||   ||||| ||   |||||   |||  ||||||||||| ||       |||
Sbjct  1622  GACTACAGCGGATGCGGGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGCGCGATAC  1563

Query  535   GTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTGC  573
              |  | || | |||||||||||| ||||||||| | |||
Sbjct  1562  CTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGGAATGC  1524

>PHRA:scaffold_494
Length=11395

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 70/99 (71%), Gaps = 0/99 (0%)
 Strand=Plus/Minus

Query  475   GACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTAC  534
             |||||||||   ||||| ||   |||||   |||  ||||||||||| ||       |||
Sbjct  8258  GACTACAGCGGATGCGGGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGCGCGATAC  8199

Query  535   GTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTGC  573
              |  | || | |||||||||||| ||||||||| | |||
Sbjct  8198  CTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGGAATGC  8160

>PHRA:scaffold_33
Length=496317

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 70/99 (71%), Gaps = 0/99 (0%)
 Strand=Plus/Minus

Query  475     GACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTAC  534
               |||||||||   ||||| ||   |||||   |||  ||||||||||| ||       |||
Sbjct  171164  GACTACAGCGGATGCGGGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGCGCGATAC  171105

Query  535     GTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTGC  573
                |  | || | |||||||||||| ||||||||| | |||
Sbjct  171104  CTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGGAATGC  171066

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 70/99 (71%), Gaps = 0/99 (0%)
 Strand=Plus/Minus

Query  475     GACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTAC  534
               |||||||||   ||||| ||   |||||   |||  ||||||||||| ||       |||
Sbjct  175523  GACTACAGCGGATGCGGGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGCGCGATAC  175464

Query  535     GTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTGC  573
                |  | || | |||||||||||| ||||||||| | |||
Sbjct  175463  CTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGGAATGC  175425

 Score = 49.1 bits (53),  Expect = 0.002
 Identities = 70/99 (71%), Gaps = 0/99 (0%)
 Strand=Plus/Plus

Query  475     GACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTAC  534
               |||||||||   || || ||   |||||   |||  ||||||||||| ||  |    |||
Sbjct  370960  GACTACAGCGGATGTGGGGATAGCTGCATCCTGTACTGGTACTGGCTGGGTGTGCGATAC  371019

Query  535     GTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTGC  573
                |  | || | |||||||||||| ||||||||| | |||
Sbjct  371020  CTGAAGGGCAGCTACTCGTGGCAGGTGTACAAGGAATGC  371058

>PHRA:scaffold_123
Length=117378

 Score = 47.3 bits (51),  Expect = 0.008
 Identities = 33/38 (87%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  386    ACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTG  423
              |||| ||||||||||||||| | |||||||| || |||
Sbjct  24822  ACGGTCCGTGCGAGGTCTGGATTGACGACACCAAGGTG  24859

>PHRA:scaffold_52
Length=349176

 Score = 47.3 bits (51),  Expect = 0.008
 Identities = 33/38 (87%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  387     CGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGT  424
               ||||||||||||| ||||||| |||||||  || ||||
Sbjct  102607  CGGCCCGTGCGAGATCTGGCTTGACGACAAGAAGGTGT  102570

>PYVX:scaffold_639 pve_scaffold_639 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_639:1:17349:1 
REF
Length=17349

 Score = 45.5 bits (49),  Expect = 0.028
 Identities = 32/37 (86%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  387   CGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTG  423
             ||| ||||||||||| ||||| |||||||| || |||
Sbjct  2183  CGGGCCGTGCGAGGTGTGGCTCGACGACACCAAGGTG  2147

>PYIW:scaffold_1952 piw_scaffold_1952 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1952:1:6546:1 
REF
Length=6546

 Score = 45.5 bits (49),  Expect = 0.028
 Identities = 32/37 (86%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  388   GGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGT  424
             |||||||||||| ||||||| ||| |||| || ||||
Sbjct  6500  GGCCCGTGCGAGATCTGGCTCGACAACACCAAGGTGT  6536

>PYIW:scaffold_712 piw_scaffold_712 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_712:1:15016:1 
REF
Length=15016

 Score = 45.5 bits (49),  Expect = 0.028
 Identities = 32/37 (86%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  388   GGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGT  424
             |||||||||||| ||||||| ||| |||| || ||||
Sbjct  1700  GGCCCGTGCGAGATCTGGCTCGACAACACCAAGGTGT  1664

>SAPA:scaffold_31 supercont2.31 dna:supercontig supercontig:ASM15154v2:supercont2.31:1:358087:1 
REF
Length=358087

 Score = 44.6 bits (48),  Expect = 0.028
 Identities = 24/24 (100%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  552     GTGGCAAGTGTACAAGAACTGCGT  575
               ||||||||||||||||||||||||
Sbjct  133071  GTGGCAAGTGTACAAGAACTGCGT  133094

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  550     TCGTGGCAAGTGTACAAGAACTGCGTG  576
               ||||||||||||||||  |||||||||
Sbjct  135133  TCGTGGCAAGTGTACATCAACTGCGTG  135107

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  552     GTGGCAAGTGTACAAGAACTGCGT  575
               |||||| |||||||||||||||||
Sbjct  137826  GTGGCAGGTGTACAAGAACTGCGT  137849

>PYVX:scaffold_50 pve_scaffold_50 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_50:1:72629:1 
REF
Length=72629

 Score = 44.6 bits (48),  Expect = 0.028
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  388    GGCCCGTGCGAGGTCTGGCTGGACGACAC  416
              || ||||||||| ||||||||||||||||
Sbjct  42350  GGTCCGTGCGAGATCTGGCTGGACGACAC  42378

>PHSO:scaffold_16
Length=803425

 Score = 44.6 bits (48),  Expect = 0.028
 Identities = 49/63 (78%), Gaps = 2/63 (3%)
 Strand=Plus/Minus

Query  388     GGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCG-CAACTGCCACAC  446
               |||||||||||| ||||||| |||||||  || ||| |||   || | | ||||| ||| 
Sbjct  553951  GGCCCGTGCGAGTTCTGGCTCGACGACAAAAAGGTG-CTGTACGCGGACGACTGCTACAG  553893

Query  447     CGA  449
               |||
Sbjct  553892  CGA  553890

 Score = 44.6 bits (48),  Expect = 0.028
 Identities = 49/63 (78%), Gaps = 2/63 (3%)
 Strand=Plus/Plus

Query  388     GGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCG-CAACTGCCACAC  446
               |||||||||||| ||||||| |||||||  || ||| |||   || | | ||||| ||| 
Sbjct  557201  GGCCCGTGCGAGTTCTGGCTCGACGACAAAAAGGTG-CTGTACGCGGACGACTGCTACAG  557259

Query  447     CGA  449
               |||
Sbjct  557260  CGA  557262

>PHRA:scaffold_9
Length=727265

 Score = 44.6 bits (48),  Expect = 0.028
 Identities = 35/41 (85%), Gaps = 1/41 (2%)
 Strand=Plus/Plus

Query  387     CGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTG  427
               ||| ||||||||  |||||||||||||||| || || ||||
Sbjct  218139  CGGTCCGTGCGAAATCTGGCTGGACGACACGAAGGT-TCTG  218178

>APAS:scaffold_33 supercont1.33 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.33:1:657536:1 
REF
Length=657536

 Score = 44.6 bits (48),  Expect = 0.028
 Identities = 24/24 (100%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  552     GTGGCAAGTGTACAAGAACTGCGT  575
               ||||||||||||||||||||||||
Sbjct  121828  GTGGCAAGTGTACAAGAACTGCGT  121851

 Score = 44.6 bits (48),  Expect = 0.028
 Identities = 24/24 (100%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  552     GTGGCAAGTGTACAAGAACTGCGT  575
               ||||||||||||||||||||||||
Sbjct  125785  GTGGCAAGTGTACAAGAACTGCGT  125808

 Score = 43.7 bits (47),  Expect = 0.099
 Identities = 25/26 (96%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  550     TCGTGGCAAGTGTACAAGAACTGCGT  575
               ||||||||||||||||||||||| ||
Sbjct  140999  TCGTGGCAAGTGTACAAGAACTGTGT  141024

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  553     TGGCAAGTGTACAAGAACTGCGT  575
               ||||||||||| |||||||||||
Sbjct  108346  TGGCAAGTGTATAAGAACTGCGT  108368

>PYVX:scaffold_1070 pve_scaffold_1070 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_1070:1:7524:1 
REF
Length=7524

 Score = 43.7 bits (47),  Expect = 0.099
 Identities = 28/31 (90%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  386  ACGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
            ||||||||||||||||||||   ||||||||
Sbjct  36   ACGGCCCGTGCGAGGTCTGGTGCGACGACAC  6

>PYIW:scaffold_1159 piw_scaffold_1159 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1159:1:10681:1 
REF
Length=10681

 Score = 43.7 bits (47),  Expect = 0.099
 Identities = 28/31 (90%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  386   ACGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
             |||||||||||||| ||||| | ||||||||
Sbjct  9027  ACGGCCCGTGCGAGCTCTGGGTCGACGACAC  9057

>PYAP:scaffold_289 pag1_scaffold_289 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_289:1:35482:1 
REF
Length=35482

 Score = 43.7 bits (47),  Expect = 0.099
 Identities = 31/36 (86%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  387    CGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGT  422
              ||| ||||||||||||||||||||  |||| || ||
Sbjct  14498  CGGGCCGTGCGAGGTCTGGCTGGATAACACCAAGGT  14533

>PYAP:scaffold_187 pag1_scaffold_187 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_187:1:47143:1 
REF
Length=47143

 Score = 43.7 bits (47),  Expect = 0.099
 Identities = 28/31 (90%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  386    ACGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
              |||||||||||||||||||| | ||| ||||
Sbjct  10197  ACGGCCCGTGCGAGGTCTGGATCGACAACAC  10227

>PHKE:scaffold_354 scf_22126_354.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_354.1_contig_1:1:38044:1 
REF
Length=38044

 Score = 43.7 bits (47),  Expect = 0.099
 Identities = 71/100 (71%), Gaps = 2/100 (2%)
 Strand=Plus/Plus

Query  475    GACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCATCAAGTAC  534
              ||||||||| ||||||| ||   |||||  ||||  ||||| ||| | ||  |   | | 
Sbjct  14701  GACTACAGCGCGTGCGGGGACAGCTGCATCTTGTACTGGTATTGGTTGGGAGTGC-GCAA  14759

Query  535    GTCGAAGGAATC-TACTCGTGGCAAGTGTACAAGAACTGC  573
              |  |||||  || |||||||||||  | |||||| | |||
Sbjct  14760  GCTGAAGGGTTCGTACTCGTGGCAGATATACAAGGAGTGC  14799

>PHCA:scaffold_49 PHYCAscaffold_49
Length=508508

 Score = 43.7 bits (47),  Expect = 0.099
 Identities = 28/31 (90%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  386    ACGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
              |||||||||||||||||||| | ||||| ||
Sbjct  24939  ACGGCCCGTGCGAGGTCTGGATCGACGATAC  24969

>SAPA:scaffold_12 supercont2.12 dna:supercontig supercontig:ASM15154v2:supercont2.12:1:690970:1 
REF
Length=690970

 Score = 42.8 bits (46),  Expect = 0.099
 Identities = 26/28 (93%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  388     GGCCCGTGCGAGGTCTGGCTGGACGACA  415
               || ||||||||||| |||||||||||||
Sbjct  306406  GGGCCGTGCGAGGTGTGGCTGGACGACA  306379

>SADI:scaffold_24 supercont1.24 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.24:1:724546:1 
REF
Length=724546

 Score = 42.8 bits (46),  Expect = 0.099
 Identities = 26/28 (93%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  388     GGCCCGTGCGAGGTCTGGCTGGACGACA  415
               || ||||||||||| |||||||||||||
Sbjct  440046  GGTCCGTGCGAGGTATGGCTGGACGACA  440073

 Score = 42.8 bits (46),  Expect = 0.099
 Identities = 26/28 (93%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  388     GGCCCGTGCGAGGTCTGGCTGGACGACA  415
               || ||||||||||| |||||||||||||
Sbjct  452981  GGTCCGTGCGAGGTATGGCTGGACGACA  452954

>PYIR:scaffold_155 pir_scaffold_155 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_155:1:48358:1 
REF
Length=48358

 Score = 42.8 bits (46),  Expect = 0.099
 Identities = 26/28 (93%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  388   GGCCCGTGCGAGGTCTGGCTGGACGACA  415
             |||||||||||| ||||||| |||||||
Sbjct  2688  GGCCCGTGCGAGATCTGGCTCGACGACA  2661

>PYIR:scaffold_46 pir_scaffold_46 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_46:1:69731:1 
REF
Length=69731

 Score = 42.8 bits (46),  Expect = 0.099
 Identities = 26/28 (93%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  388   GGCCCGTGCGAGGTCTGGCTGGACGACA  415
             || || ||||||||||||||||||||||
Sbjct  2735  GGTCCCTGCGAGGTCTGGCTGGACGACA  2762

>PHPA:scaffold_19 NW_008649005.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.19, whole genome shotgun 
sequence
Length=1020763

 Score = 42.8 bits (46),  Expect = 0.099
 Identities = 29/33 (88%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  386    ACGGCCCGTGCGAGGTCTGGCTGGACGACACTA  418
              |||| ||||||||||| ||| | ||||||||||
Sbjct  49617  ACGGTCCGTGCGAGGTTTGGATCGACGACACTA  49649

>PHIF:NW_003303752.1 Phytophthora infestans T30-4 supercont1.7 
genomic scaffold, whole genome shotgun sequence
Length=4595942

 Score = 42.8 bits (46),  Expect = 0.099
 Identities = 32/38 (84%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  387      CGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGT  424
                ||| ||||| ||| | ||||| ||||||||||| ||||
Sbjct  2062368  CGGTCCGTGTGAGATTTGGCTTGACGACACTAAGGTGT  2062331

>PHCA:scaffold_40 PHYCAscaffold_40
Length=570383

 Score = 42.8 bits (46),  Expect = 0.099
 Identities = 29/33 (88%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  551     CGTGGCAAGTGTACAAGAACTGCGTGGGCCTCG  583
               |||||||||||||||  ||||||||||  ||||
Sbjct  109038  CGTGGCAAGTGTACATCAACTGCGTGGCTCTCG  109070

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 36/46 (78%), Gaps = 3/46 (7%)
 Strand=Plus/Plus

Query  551     CGTGGCAAGTGTACAAGAACTGCGTGGGCCT---CGGAACGGCTGC  593
               ||||||||||| ||   ||||| |||| |||   |||| |||||||
Sbjct  110692  CGTGGCAAGTGCACGTCAACTGTGTGGCCCTGGACGGATCGGCTGC  110737

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  551     CGTGGCAAGTGTACAAGAACTGCGT  575
               |||||||||||||||  ||||||||
Sbjct  112887  CGTGGCAAGTGTACATCAACTGCGT  112911

>PYVX:scaffold_305 pve_scaffold_305 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_305:1:30708:1 
REF
Length=30708

 Score = 41.9 bits (45),  Expect = 0.35
 Identities = 39/50 (78%), Gaps = 0/50 (0%)
 Strand=Plus/Minus

Query  370    TCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAA  419
              ||||||| ||| |    ||| |||||||||||||||   |||||||| ||
Sbjct  15603  TCGGGCTTCACGCACCCCGGTCCGTGCGAGGTCTGGTGCGACGACACCAA  15554

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 36/46 (78%), Gaps = 0/46 (0%)
 Strand=Plus/Minus

Query  370    TCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACA  415
              ||||||| ||| |  |  |||||||||||| |||||   |||||||
Sbjct  10429  TCGGGCTTCACCCACGCTGGCCCGTGCGAGTTCTGGTGCGACGACA  10384

>PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:pug:scf1117875582028:1:960197:1 
REF
Length=960197

 Score = 41.9 bits (45),  Expect = 0.35
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  386     ACGGCCCGTGCGAGGTCTGGCTGGACGACA  415
               |||||||||||||||||||| | ||| |||
Sbjct  821494  ACGGCCCGTGCGAGGTCTGGATCGACAACA  821465

>PYIW:scaffold_270 piw_scaffold_270 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_270:1:22416:1 
REF
Length=22416

 Score = 41.9 bits (45),  Expect = 0.35
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  386    ACGGCCCGTGCGAGGTCTGGCTGGACGACA  415
              |||||||||||||||||||| | ||| |||
Sbjct  16949  ACGGCCCGTGCGAGGTCTGGATCGACAACA  16978

>PHPA:scaffold_5 NW_008648991.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.5, whole genome shotgun 
sequence
Length=2147012

 Score = 41.9 bits (45),  Expect = 0.35
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  387      CGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
                ||| ||||| ||| ||||||||||||||||
Sbjct  1068908  CGGTCCGTGTGAGATCTGGCTGGACGACAC  1068937

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  387      CGGCCCGTGCGAGGTCTGGCTGGACGACA  415
                ||||||||||||| ||||||| || ||||
Sbjct  1016322  CGGCCCGTGCGAGATCTGGCTCGATGACA  1016350

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  380      CACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACA  415
                ||||  | ||||| || ||| |||||||||||||||
Sbjct  1010305  CACTACAGGGCCCCTGTGAGATCTGGCTGGACGACA  1010270

>PHCA:scaffold_98 PHYCAscaffold_98
Length=130742

 Score = 41.9 bits (45),  Expect = 0.35
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  387    CGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
              ||| || |||||| ||||||||||||||||
Sbjct  81364  CGGTCCATGCGAGATCTGGCTGGACGACAC  81393

>SADI:scaffold_134 supercont1.134 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.134:1:99377:1 
REF
Length=99377

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  550    TCGTGGCAAGTGTACAAGAACTGCGTG  576
              ||||||||||||||||  |||||||||
Sbjct  58448  TCGTGGCAAGTGTACATCAACTGCGTG  58422

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  552    GTGGCAAGTGTACAAGAACTGCGT  575
              ||||||||||||||| ||||||||
Sbjct  55338  GTGGCAAGTGTACAAAAACTGCGT  55315

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  552    GTGGCAAGTGTACAAGAACTGCGT  575
              ||||||||| ||||||||||||||
Sbjct  61038  GTGGCAAGTCTACAAGAACTGCGT  61061

>PYVX:scaffold_496 pve_scaffold_496 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_496:1:22231:1 
REF
Length=22231

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  388    GGCCCGTGCGAGGTCTGGCTGGACGAC  414
              || ||||||||||||||||| ||||||
Sbjct  10371  GGTCCGTGCGAGGTCTGGCTCGACGAC  10345

>PYIW:scaffold_3542 piw_scaffold_3542 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_3542:1:2951:1 
REF
Length=2951

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  386   ACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGT  422
             ||||||||||||||| |||| | ||| |||| || ||
Sbjct  1565  ACGGCCCGTGCGAGGGCTGGATCGACAACACCAAGGT  1529

>PYIR:scaffold_573 pir_scaffold_573 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_573:1:20947:1 
REF
Length=20947

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  386    ACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGT  422
              ||||||||||||||| |||| | ||| |||| || ||
Sbjct  15941  ACGGCCCGTGCGAGGGCTGGATCGACAACACCAAGGT  15977

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  386   ACGGCCCGTGCGAGGTCTGGCTGGACGACACTAA  419
             ||||||||||||| |||||| | ||| |||| ||
Sbjct  5573  ACGGCCCGTGCGAAGTCTGGATCGACAACACCAA  5606

>PYAR:scaffold_4887 par_scaffold_4887 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_4887:1:1921:1 
REF
Length=1921

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 49/66 (74%), Gaps = 2/66 (3%)
 Strand=Plus/Minus

Query  380  CACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCGCAACT  439
            ||||||  ||||||||||||||||||   ||| ||||    |||| ||  |  | |||||
Sbjct  490  CACTGG--GGCCCGTGCGAGGTCTGGTGCGACAACACGCGCGTGTTTGTCGATCCCAACT  433

Query  440  GCCACA  445
            ||| ||
Sbjct  432  GCCGCA  427

>PYAP:scaffold_630 pag1_scaffold_630 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_630:1:18565:1 
REF
Length=18565

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 31/37 (84%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  388    GGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGT  424
              ||||||||||||||||||   ||| |||| || ||||
Sbjct  12231  GGCCCGTGCGAGGTCTGGTGTGACAACACCAAGGTGT  12195

>PHSO:scaffold_8
Length=3549547

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 40/52 (77%), Gaps = 0/52 (0%)
 Strand=Plus/Plus

Query  371      CGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGT  422
                |||||| ||| |    ||| |||||||||||||||   |||||||| || ||
Sbjct  1240750  CGGGCTTCACGCACCCCGGTCCGTGCGAGGTCTGGTGTGACGACACCAAGGT  1240801

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  388      GGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTG  423
                || |||||||||||||||   |||||||| || |||
Sbjct  1238276  GGTCCGTGCGAGGTCTGGTGCGACGACACCAAGGTG  1238311

>PHRA:scaffold_29
Length=529199

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  385     GACGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
               ||||||||||||||| |||||   ||||||||
Sbjct  453474  GACGGCCCGTGCGAGATCTGGTGTGACGACAC  453505

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 47/62 (76%), Gaps = 2/62 (3%)
 Strand=Plus/Plus

Query  385     GACGGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGTGTCTGCGGGCCG-CAACTGCCA  443
               || |||||||||||||| |||   ||||||||    |||| | | || || |||||||| 
Sbjct  472695  GAGGGCCCGTGCGAGGTGTGGTGTGACGACACCCGTGTGT-TCCAGGACGACAACTGCCC  472753

Query  444     CA  445
               ||
Sbjct  472754  CA  472755

>PHRA:scaffold_5
Length=827719

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 31/36 (86%), Gaps = 2/36 (6%)
 Strand=Plus/Plus

Query  380     CACTGGACGG--CCCGTGCGAGGTCTGGCTGGACGA  413
               |||||||| |  ||||| ||||||||||||| ||||
Sbjct  701779  CACTGGACAGTCCCCGTTCGAGGTCTGGCTGAACGA  701814

>PHCA:scaffold_50 PHYCAscaffold_50
Length=475612

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  385     GACGGCCCGTGCGAGGTCTGGCTGGACGACAC  416
               || ||||||||||||||||||   ||||||||
Sbjct  136280  GAAGGCCCGTGCGAGGTCTGGTGCGACGACAC  136311

 Score = 41.0 bits (44),  Expect = 0.35
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  548     ACTCGTGGCAAGTGTACAAGAACTGCG  574
               || ||||||||||||||| ||||||||
Sbjct  136437  ACCCGTGGCAAGTGTACACGAACTGCG  136463

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  388     GGCCCGTGCGAGGTCTGGCTGGACGACAC  416
               ||||||||||||||||||   ||||||||
Sbjct  113076  GGCCCGTGCGAGGTCTGGTGCGACGACAC  113104

>SAPA:scaffold_44 supercont2.44 dna:supercontig supercontig:ASM15154v2:supercont2.44:1:280942:1 
REF
Length=280942

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  392     CGTGCGAGGTCTGGCTGGACGACA  415
               |||||||||| |||||||||||||
Sbjct  208110  CGTGCGAGGTGTGGCTGGACGACA  208133

>PYAP:scaffold_558 pag1_scaffold_558 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_558:1:21510:1 
REF
Length=21510

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  553    TGGCAAGTGTACAAGAACTGCGTG  576
              |||||||| |||||||||||||||
Sbjct  19786  TGGCAAGTCTACAAGAACTGCGTG  19809

>PHSO:scaffold_2
Length=11587142

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 32/38 (84%), Gaps = 2/38 (5%)
 Strand=Plus/Plus

Query  553      TGGCAAGTGTACAAGAACTGCGTGGGCCTCGGAACGGC  590
                ||||||||||||||||||||| |   |||| || ||||
Sbjct  2558639  TGGCAAGTGTACAAGAACTGCAT--CCCTCTGACCGGC  2558674

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 29/34 (85%), Gaps = 2/34 (6%)
 Strand=Plus/Minus

Query  382      CTGGAC--GGCCCGTGCGAGGTCTGGCTGGACGA  413
                ||||||  ||||| |||||| | |||||||||||
Sbjct  2543352  CTGGACAGGGCCCATGCGAGATTTGGCTGGACGA  2543319

>PHKE:scaffold_221 scf_22126_221.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_221.1:1:58736:1 
REF
Length=58736

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  388   GGCCCGTGCGAGGTCTGGCTGGACGACAC  416
             || ||||| ||| ||||||||||||||||
Sbjct  2471  GGTCCGTGTGAGATCTGGCTGGACGACAC  2443

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  388    GGCCCGTGCGAGGTCTGGCTGGACGACA  415
              || || |||||| |||||||||||||||
Sbjct  52952  GGTCCTTGCGAGATCTGGCTGGACGACA  52925

>PHIF:NW_003303738.1 Phytophthora infestans T30-4 supercont1.21 
genomic scaffold, whole genome shotgun sequence
Length=2319577

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 40/51 (78%), Gaps = 1/51 (2%)
 Strand=Plus/Plus

Query  365      AGACTTCGGGCTACACACTGGACGGCCCGTGCGAGGTCTGGCTGGACGACA  415
                ||||||||| |||| | |   | || |||||||||||||||   |||||||
Sbjct  1105403  AGACTTCGG-CTACTCCCACCAGGGACCGTGCGAGGTCTGGTGCGACGACA  1105452

>HYAP:scaffold_176 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_176:1:128177:1 
REF
Length=128177

 Score = 40.1 bits (43),  Expect = 1.2
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  551    CGTGGCAAGTGTACAAGAACTGCG  574
              ||||||||||||||| ||||||||
Sbjct  42203  CGTGGCAAGTGTACACGAACTGCG  42180

>PYVX:scaffold_469 pve_scaffold_469 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_469:1:23289:1 
REF
Length=23289

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  55     GTGCTGTGCGTCACTGGCCAACGCCG  80
              || |||||||||||||||| ||||||
Sbjct  20276  GTCCTGTGCGTCACTGGCCGACGCCG  20301

>PYVX:scaffold_131 pve_scaffold_131 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_131:1:48139:1 
REF
Length=48139

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  270   GTCGCTGTACCAGGTGACGGAGGAAG  295
             ||||||||||||||||| ||||| ||
Sbjct  7356  GTCGCTGTACCAGGTGAGGGAGGCAG  7331

>PYIW:scaffold_424 piw_scaffold_424 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_424:1:18839:1 
REF
Length=18839

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  513   GTACTGGCTCGGCATCAAGTACGTCG  538
             || |||||||||||||| ||||||||
Sbjct  4800  GTCCTGGCTCGGCATCATGTACGTCG  4775

>PYIR:scaffold_667 pir_scaffold_667 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_667:1:18341:1 
REF
Length=18341

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 26/28 (93%), Gaps = 1/28 (4%)
 Strand=Plus/Minus

Query  480    CAGCTCGTGCGGCGAGTCC-TGCACGTT  506
              |||||| |||||||||||| ||||||||
Sbjct  17718  CAGCTCCTGCGGCGAGTCCTTGCACGTT  17691

>PHSO:scaffold_15
Length=1143705

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  551     CGTGGCAAGTGTACAAGAACTGCGTG  576
               |||||||||||||||  |||||||||
Sbjct  579660  CGTGGCAAGTGTACATCAACTGCGTG  579685

>PHKE:scaffold_78 scf_22126_78.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_78.1:1:112491:1 
REF
Length=112491

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  346   CCGACCAACAACTCGTTCCAGACTTCGGGCT  376
             |||| |||||| || ||| ||||||||||||
Sbjct  1752  CCGAACAACAAATCTTTCAAGACTTCGGGCT  1782

>PHIF:NW_003303747.1 Phytophthora infestans T30-4 supercont1.12 
genomic scaffold, whole genome shotgun sequence
Length=3552875

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  547      TACTCGTGGCAAGTGTACAAG  567
                |||||||||||||||||||||
Sbjct  2704526  TACTCGTGGCAAGTGTACAAG  2704506

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 70/102 (69%), Gaps = 6/102 (6%)
 Strand=Plus/Minus

Query  475      GACTACAGCTCGTGCGGCGAGTCCTGCACGTTGTCGTGGTACTGGCTCGGCAT---CAAG  531
                |||||||||   ||||| ||   |||||   | |  ||||||||||| ||  |   ||||
Sbjct  2743283  GACTACAGCGGCTGCGGTGATAGCTGCATCATCTATTGGTACTGGCTGGGTGTGCGCAAG  2743224

Query  532      TACGTCGAAGGAATCTACTCGTGGCAAGTGTACAAGAACTGC  573
                    || | || |  ||||| ||||| ||||||||| | |||
Sbjct  2743223  ---CTCAAGGGCAAGTACTCCTGGCAGGTGTACAAGGAGTGC  2743185

>APIN:scaffold_9 supercont1.9 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.9:1:1715687:1 
REF
Length=1715687

 Score = 39.2 bits (42),  Expect = 1.2
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  550     TCGTGGCAAGTGTACAAGAACTGCGT  575
               ||||||||||||||||  ||||||||
Sbjct  910811  TCGTGGCAAGTGTACATCAACTGCGT  910786

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  553     TGGCAAGTGTACAAGAACTGCGT  575
               ||||| |||||||||||||||||
Sbjct  921716  TGGCAGGTGTACAAGAACTGCGT  921694

>SAPA:scaffold_19 supercont2.19 dna:supercontig supercontig:ASM15154v2:supercont2.19:1:569072:1 
REF
Length=569072

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  388     GGCCCGTGCGAGGTCTGGCTGGACGACA  415
               || ||||||||||||||||| ||| |||
Sbjct  464772  GGTCCGTGCGAGGTCTGGCTCGACAACA  464799

>PYVX:scaffold_894 pve_scaffold_894 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_894:1:10447:1 
REF
Length=10447

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  385   GACGGCCCGTGCGAGGTCTGGCTGGACGACACT  417
             || |||||||||||| |||||   |||||||||
Sbjct  1502  GAAGGCCCGTGCGAGATCTGGTGCGACGACACT  1470

>PYUU:scaffold_1354 scf1117875581354 dna:supercontig supercontig:pug:scf1117875581354:1:1199448:1 
REF
Length=1199448

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  216     GAGCTGGATGGAGCAGCACGGCT  238
               |||||||||||||||||||| ||
Sbjct  798631  GAGCTGGATGGAGCAGCACGTCT  798609

>PYIW:scaffold_1535 piw_scaffold_1535 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1535:1:8373:1 
REF
Length=8373

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  388   GGCCCGTGCGAGGTCTGGCTGGACGACA  415
             ||||||||||||||||||   |||||||
Sbjct  6737  GGCCCGTGCGAGGTCTGGTGCGACGACA  6710

>PYIW:scaffold_182 piw_scaffold_182 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_182:1:25962:1 
REF
Length=25962

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  387   CGGCCCGTGCGAGGTCTGGCTGGACGACACTAA  419
             |||||||||||||| |||| | ||| |||| ||
Sbjct  1698  CGGCCCGTGCGAGGCCTGGATCGACAACACCAA  1730

>PHIF:NW_003304976.1 Phytophthora infestans T30-4 supercont1.3704 
genomic scaffold, whole genome shotgun sequence
Length=2306

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  466   CACCAGGTCGACTACAGCTCGTGCGGCG  493
             ||| ||||||||||||| || |||||||
Sbjct  2247  CACGAGGTCGACTACAGATCATGCGGCG  2274

>PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 
genomic scaffold, whole genome shotgun sequence
Length=4722445

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  388      GGCCCGTGCGAGGTCTGGCTGGACGACA  415
                ||||| || ||| |||||||||||||||
Sbjct  3795985  GGCCCTTGTGAGATCTGGCTGGACGACA  3796012

>PHIF:NW_003303739.1 Phytophthora infestans T30-4 supercont1.20 
genomic scaffold, whole genome shotgun sequence
Length=2401636

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  263      ACGATGAGTCGCTGTACCAGGTGACGGAGGAAG  295
                |||||| | ||||||||||| ||| ||| ||||
Sbjct  2032508  ACGATGCGGCGCTGTACCAGCTGAAGGATGAAG  2032540

>PHIF:NW_003303678.1 Phytophthora infestans T30-4 supercont1.81 
genomic scaffold, whole genome shotgun sequence
Length=575650

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  466     CACCAGGTCGACTACAGCTCGTGCGGCG  493
               ||| ||||||||||||| || |||||||
Sbjct  450107  CACGAGGTCGACTACAGATCATGCGGCG  450080

>PHCA:scaffold_28 PHYCAscaffold_28
Length=757753

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  564     CAAGAACTGCGTGGGCCTCGGAACGGCTGCCAC  596
               |||| ||||  | ||||||||||| ||||||||
Sbjct  397223  CAAGCACTGGCTCGGCCTCGGAACTGCTGCCAC  397255

>APAS:scaffold_4 supercont1.4 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.4:1:1887962:1 
REF
Length=1887962

 Score = 38.3 bits (41),  Expect = 4.2
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  68      CTGGCCAACGCCGTCTGGACGCCGGACT  95
               |||||||||||| |||||| | ||||||
Sbjct  832334  CTGGCCAACGCCATCTGGATGACGGACT  832307

>SAPA:scaffold_2 supercont2.2 dna:supercontig supercontig:ASM15154v2:supercont2.2:1:1567649:1 
REF
Length=1567649

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  481     AGCTCGTGCGGCGAGTCCTGCACGTTGTCG  510
               ||||||||||||||||||  ||||  ||||
Sbjct  836983  AGCTCGTGCGGCGAGTCCCACACGGGGTCG  836954

>SADI:scaffold_58 supercont1.58 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.58:1:346940:1 
REF
Length=346940

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  502     ACGTTGTCGTGGTACTGGCTCGGCA  526
               ||||||||||||||||||| | |||
Sbjct  170178  ACGTTGTCGTGGTACTGGCGCCGCA  170154

>PYVX:scaffold_563 pve_scaffold_563 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_563:1:19577:1 
REF
Length=19577

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  551   CGTGGCAAGTGTACAAGAACTGCGT  575
             |||||||||||||||  ||||||||
Sbjct  9903  CGTGGCAAGTGTACATCAACTGCGT  9927

>PYIR:scaffold_728 pir_scaffold_728 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_728:1:17002:1 
REF
Length=17002

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  481   AGCTCGTGCGGCGAGTCCTGCACGTTGTCG  510
             ||||||| | ||| |||||||||||| |||
Sbjct  5905  AGCTCGTCCTGCGCGTCCTGCACGTTCTCG  5934

>PYAR:scaffold_8021 par_scaffold_8021 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_8021:1:822:1 
REF
Length=822

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  388  GGCCCGTGCGAGGTCTGGCTGGACGACACTAAAGT  422
            |||||||||||| |||||   ||| |||| |||||
Sbjct  167  GGCCCGTGCGAGATCTGGTGCGACAACACCAAAGT  133

>PYAP:scaffold_83 pag1_scaffold_83 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_83:1:71572:1 
REF
Length=71572

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  513    GTACTGGCTCGGCATCAAGTACGTC  537
              ||||| |||||||||||||||| ||
Sbjct  45811  GTACTTGCTCGGCATCAAGTACCTC  45835

>PHRA:scaffold_23
Length=570991

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  385     GACGGCCCGTGCGAGGTCTGGCTGGACGAC  414
               || ||||||||||||| |||| | ||||||
Sbjct  384860  GAAGGCCCGTGCGAGGCCTGGGTCGACGAC  384889

>PHPA:scaffold_39 NW_008649025.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.39, whole genome shotgun 
sequence
Length=634653

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 48/64 (75%), Gaps = 2/64 (3%)
 Strand=Plus/Plus

Query  511     TGGTACTGGCTCGGCATCAAGTACGTCGAAGGA-ATCTACTCGTGGCAAGTGTACAAGAA  569
               ||||||||||| ||| |   | | |  |||||  |  ||||||||||| ||||||||| |
Sbjct  150276  TGGTACTGGCTGGGCGTGC-GCAAGCTGAAGGGCAAGTACTCGTGGCAGGTGTACAAGGA  150334

Query  570     CTGC  573
                |||
Sbjct  150335  ATGC  150338

>PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.4, whole genome shotgun 
sequence
Length=2787191

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  385     GACGGCCCGTGCGAGGTCTGGCTGGACGAC  414
               ||||| |||||||||||||||   ||||||
Sbjct  568842  GACGGTCCGTGCGAGGTCTGGTGCGACGAC  568871

>PHCA:scaffold_146 PHYCAscaffold_146
Length=47772

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  551  CGTGGCAAGTGTACAAGAACTGCGT  575
            |||||||||||||||  ||||||||
Sbjct  296  CGTGGCAAGTGTACATCAACTGCGT  320

>APIN:scaffold_56 supercont1.56 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.56:1:399176:1 
REF
Length=399176

 Score = 37.4 bits (40),  Expect = 4.2
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  341     CCATCCCGACCAACAACTCG  360
               ||||||||||||||||||||
Sbjct  329662  CCATCCCGACCAACAACTCG  329643

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 741064754716

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2