Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
PHCA:scaffold_84984009915575615120.0
PHPA:scaffold_632483642491227598310.0
PHSO:scaffold_1279717727979327597290.0
PHRA:scaffold_561529091536647607031e-179
PHIF:NW_003303697.13983423990406997031e-179
PHRA:scaffold_1695269734527606981e-178
PHKE:scaffold_9865091657857023734e-90
PHRA:scaffold_512016262023717473402e-81
PHPA:scaffold_10145467814553246653152e-74
PHKE:scaffold_281328051334396382476e-56
PHCA:scaffold_443328143334376412442e-55
PHSO:scaffold_4463291346336297372373e-53
PHIF:NW_003303744.1221799722185785922256e-50
PHPA:scaffold_593065953071796011972e-42
PHRA:scaffold_72904842910155611815e-38
PHPA:scaffold_167797147803005991782e-37
PHSO:scaffold_11138276513832975611641e-33
PHKE:scaffold_44413589138652781634e-33
PHPA:scaffold_11148344486853711546e-31
PHPA:scaffold_12116657911669233451517e-30
PHIF:NW_003303619.11702181705623451517e-30
PHCA:scaffold_149961769965123611391e-26
PHRA:scaffold_213141293144052781381e-26
PHCA:scaffold_362581432586124841375e-26
PHIF:NW_003303754.1256118325615273451365e-26
PHIF:NW_003303731.1120797812086076571365e-26
PHSO:scaffold_5363792136382623641312e-24
PHSO:scaffold_3888366488839362731312e-24
PHRA:scaffold_969308695792771297e-24
PHCA:scaffold_14646149465484141297e-24
PHPA:scaffold_484076754079602891248e-23
PHKE:scaffold_8946026462972731233e-22
PHSO:scaffold_141869391871241861223e-22
PHPA:scaffold_6890385906532711211e-21
PHRA:scaffold_37813774141083601194e-21
PHRA:scaffold_196134816823601194e-21
PHRA:scaffold_436277330522831171e-20
PYVX:scaffold_88410023102972791161e-20
PHSO:scaffold_62889822892542781161e-20
PHRA:scaffold_981404441407202801161e-20
PHIF:NW_003307367.1433346773451161e-20
PHRA:scaffold_1755522558623671154e-20
PHRA:scaffold_602936562939302761144e-20
PHRA:scaffold_1409348237552771105e-19
PHKE:scaffold_27726709270263431105e-19
PHIF:NW_003303739.1156122715615683661092e-18
PHIF:NW_003303758.1407618640765323721082e-18
PHPA:scaffold_343262963265692771052e-17
PHSO:scaffold_3340509407802721042e-17
PHKE:scaffold_30942302425742751042e-17
PHCA:scaffold_871531281534032791042e-17
PHPA:scaffold_543590073592842801028e-17
PHSO:scaffold_74264154267503661013e-16
PHRA:scaffold_780719775383691013e-16
PHCA:scaffold_16287811673021013e-16
PYUU:scaffold_12974002954005712801003e-16
PHIF:NW_003303719.13318913321582741003e-16
PHSO:scaffold_16707400707647252991e-15
PHRA:scaffold_243320702346281991e-15
PHRA:scaffold_12604194604470281991e-15
PHIF:NW_003303717.1864454864782331991e-15
PHPA:scaffold_15123615123931342981e-15
PHPA:scaffold_71222957223223276973e-15
PHCA:scaffold_50198713199087391973e-15
HYAP:scaffold_71158439158663229963e-15
HYAP:scaffold_6413131537229963e-15
PHRA:scaffold_3191440814684281951e-14
PHRA:scaffold_31467462467733276951e-14
PHRA:scaffold_29382354382630281951e-14
PHPA:scaffold_11230738230976242951e-14
PHKE:scaffold_32361206394275951e-14
PHKE:scaffold_2422598126205231941e-14
PHKE:scaffold_52783358609277934e-14
PHRA:scaffold_2762346595253911e-13
PHKE:scaffold_5233470356293911e-13
PHPA:scaffold_8852675536270901e-13
PHPA:scaffold_36425270425609365895e-13
PHIF:NW_003303746.125012382501483255895e-13
PHKE:scaffold_1922399224352385862e-12
PHSO:scaffold_21004647210046749279856e-12
PLHA:NW_020189861.1322511322764258846e-12
PHRA:scaffold_2309475596122846e-12
PHCA:scaffold_1610136111013880273846e-12
PHIF:NW_003303757.15833033583311078817e-11
PHIF:NW_003303732.11051614105171198817e-11
PHRA:scaffold_1828444565122793e-10
PHCA:scaffold_51273861274084228793e-10
PHPA:scaffold_5221066221340282783e-10
PHKE:scaffold_219366083669689783e-10
PHPA:scaffold_627900427908481779e-10
PHIF:NW_003303741.1494967495112146779e-10
PHRA:scaffold_22582560263778769e-10
PHRA:scaffold_5168210828778769e-10
PHRA:scaffold_5123311078769e-10
PHRA:scaffold_1914952414960178769e-10
PHRA:scaffold_14151380145677743e-09
PHRA:scaffold_4077738781477743e-09
PHRA:scaffold_108938039387977743e-09
PHRA:scaffold_9114912814920477743e-09
PHIF:NW_003303734.11444954144503077743e-09
PHIF:NW_003303749.12342514234258774731e-08
PHRA:scaffold_213679587076721e-08
PHKE:scaffold_8993726379773721e-08
PHCA:scaffold_25234271234590347721e-08
PHCA:scaffold_11503763503888126721e-08
PHKE:scaffold_56236083751165714e-08
PYIR:scaffold_43255232824274704e-08
PHKE:scaffold_156211291401276704e-08
PHCA:scaffold_46434630434970367704e-08
PHRA:scaffold_6711402611410277691e-07
PHPA:scaffold_2476713076720677691e-07
PHKE:scaffold_2111165511914275691e-07
PHSO:scaffold_832159783216249280681e-07
PHRA:scaffold_159362603629839681e-07
PHKE:scaffold_1552700970277681e-07
PHIF:NW_003303745.112799412806976675e-07
PHIF:NW_003303722.177240277247776675e-07
PHKE:scaffold_36411771447274665e-07
HYAP:scaffold_149892608935495665e-07
PHCA:scaffold_53388729388992269652e-06
PHCA:scaffold_2713759013764960652e-06
PHSO:scaffold_2127601427609279636e-06
PHIF:NW_003303698.121612421620279636e-06
PHCA:scaffold_1720602120605434636e-06
PHPA:scaffold_3247782781736626e-06
PHIF:NW_003305543.11330140576626e-06
PHCA:scaffold_5478761146278626e-06
PHCA:scaffold_37141103141204123626e-06
PHPA:scaffold_4237687337691038612e-05
PHPA:scaffold_2250840850844538612e-05
PHIF:NW_003303150.11269312794105612e-05
PHCA:scaffold_7720745720749943612e-05
PHCA:scaffold_178978410032259602e-05
PHRA:scaffold_214356083564437597e-05
PHIF:NW_003303715.110544651054730271597e-05
PHRA:scaffold_66638286389669587e-05
PHKE:scaffold_495161434281587e-05
PHKE:scaffold_13891617165741572e-04
PHKE:scaffold_333405364060671572e-04
PHIF:NW_003303513.1554085544336572e-04
HYAP:scaffold_538657386748176572e-04
PHPA:scaffold_3431439150668562e-04
PHPA:scaffold_11825275182531238562e-04
PYIW:scaffold_26772657270650558e-04
PHPA:scaffold_886069186076677558e-04
PHKE:scaffold_104313303136940558e-04
PHIF:NW_003303696.1107686107810125558e-04
HYAP:scaffold_7325092425099875558e-04
PHPA:scaffold_60931879326377548e-04
PHRA:scaffold_14055055725224530.003
PHIF:NW_003303713.139243639251479530.003
PHCA:scaffold_1395650573384530.003
HYAP:scaffold_7812620912624234530.003
PHKE:scaffold_9932853288836520.003
PHKE:scaffold_8197410745041520.003
PHKE:scaffold_56473176131520.003
PHCA:scaffold_3845007945011436520.003
PYUU:scaffold_1981956359568450500.010
PHRA:scaffold_2713311335545500.010
PHIF:NW_003306740.11488156780500.010
PHIF:NW_003303458.1499785002245500.010
PLHA:NW_020187575.11739283173935977490.036
PLHA:NW_020187213.11300527130057651490.036
PHRA:scaffold_7513612213621392490.036
PHPA:scaffold_3305759582567490.036
PHPA:scaffold_933452133458767490.036
PHPA:scaffold_71078040107811677490.036
PYIW:scaffold_335918772196341480.036
PHPA:scaffold_41066128106616639480.036
PHKE:scaffold_183553475539651480.036
SAPA:scaffold_104611996123539460.13
PYVX:scaffold_177181031812523460.13
PYAR:scaffold_14018620864425450.44
PLHA:NW_020187243.11561913156194230450.44
PHKE:scaffold_5631389313992100450.44
SADI:scaffold_77508035083129440.44
PYVX:scaffold_36030733327440.44
PYUU:scaffold_124271657371660129440.44
PYIW:scaffold_934108151084329440.44
PHKE:scaffold_893961100747440.44
PHKE:scaffold_6568882893352440.44
PHIF:NW_003303721.115448131544914102440.44
PHIF:NW_003303555.1801188019477440.44
SAPA:scaffold_14256662568924431.5
SAPA:scaffold_438124738128034431.5
SAPA:scaffold_395712795715731431.5
PYVX:scaffold_7425795583238431.5
PYVX:scaffold_174215462156924431.5
PYVX:scaffold_168196981973540431.5
PYUU:scaffold_202891089891092124431.5
PYAP:scaffold_116138644459431.5
PYAP:scaffold_50237122373524431.5
SADI:scaffold_84328153284935421.5
PYVX:scaffold_108341863421631421.5
PYVX:scaffold_27356183563821421.5
PYUU:scaffold_20391542856154287621421.5
PYIW:scaffold_14692987300721421.5
PYIW:scaffold_6856284631128421.5
PHRA:scaffold_8112606912608921421.5
PHPA:scaffold_4939014239016221421.5
PHCA:scaffold_3681318134326421.5
APAS:scaffold_5315808615811126421.5
PYVX:scaffold_2819611823415.3
PYUU:scaffold_203538854138856323415.3
PYUU:scaffold_202347626047628223415.3
PYIW:scaffold_7863746376823415.3
PYIW:scaffold_5604240426223415.3
PYIR:scaffold_257173351735723415.3
PYAR:scaffold_1409382940423415.3
PLHA:NW_020189964.12982082298210423415.3
PHSO:scaffold_131426075142609925415.3
PHRA:scaffold_77975319755323415.3
PHPA:scaffold_120519935201725415.3
PHKE:scaffold_106834258344723415.3
PHIF:NW_003303753.14629109462913628415.3
PHIF:NW_003303730.140175340177523415.3
PHIF:NW_003303725.110456510459228415.3
PHIF:NW_003303718.11339704133973128415.3
PHIF:NW_003303690.111336911339628415.3
PHIF:NW_003302786.17927795428415.3
ALLA:FR8246606889691123415.3
SAPA:scaffold_3768469850032405.3
SAPA:scaffold_3626370726372620405.3
PYVX:scaffold_8984262428120405.3
PYVX:scaffold_78240943830405.3
PYVX:scaffold_6825018504225405.3
PYVX:scaffold_5615028504720405.3
PYVX:scaffold_407233122333625405.3
PYVX:scaffold_352143681438720405.3
PYUU:scaffold_138113276813278720405.3
PYIW:scaffold_29941217124630405.3
PYIW:scaffold_29713302333332405.3
PYIW:scaffold_8735216523520405.3
PYIW:scaffold_955416544025405.3
PYIR:scaffold_18413677370125405.3
PYIR:scaffold_10220923325405.3
PYIR:scaffold_16573545737320405.3
PYAR:scaffold_43381817184125405.3
PYAR:scaffold_9151427145227405.3
PYAR:scaffold_6956245626420405.3
PYAR:scaffold_5808717874125405.3
PYAR:scaffold_143268712689020405.3
PYAP:scaffold_325233142335644405.3
PYAP:scaffold_35448434486725405.3
PHPA:scaffold_61274222744625405.3
PHKE:scaffold_147368033682927405.3
PHIF:NW_003303755.14179947417997125405.3
PHIF:NW_003303708.186860086862627405.3
PHCA:scaffold_4735784435787027405.3
APIN:scaffold_131112322111234827405.3
BLASTN 2.9.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= PHYCA_129485

Length=756
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

PHCA:scaffold_84 PHYCAscaffold_84                                     1364       0.0   
PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 ...  750        0.0   
PHSO:scaffold_1                                                       658        0.0   
PHRA:scaffold_56                                                      635        1e-179
PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 ge...  635        1e-179
PHRA:scaffold_1695                                                    630        1e-178
PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercon...  337        4e-90 
PHRA:scaffold_51                                                      307        2e-81 
PHPA:scaffold_10 NW_008648996.1 Phytophthora parasitica INRA-310 ...  285        2e-74 
PHKE:scaffold_28 scf_22126_28.1 dna:supercontig supercontig:PhyKe...  224        6e-56 
PHCA:scaffold_44 PHYCAscaffold_44                                     221        2e-55 
PHSO:scaffold_4                                                       214        3e-53 
PHIF:NW_003303744.1 Phytophthora infestans T30-4 supercont1.15 ge...  204        6e-50 
PHPA:scaffold_59 NW_008649045.1 Phytophthora parasitica INRA-310 ...  178        2e-42 
PHRA:scaffold_7                                                       164        5e-38 
PHPA:scaffold_16 NW_008649002.1 Phytophthora parasitica INRA-310 ...  161        2e-37 
PHSO:scaffold_11                                                      149        1e-33 
PHKE:scaffold_444 scf_22126_444.1 dna:supercontig supercontig:Phy...  148        4e-33 
PHPA:scaffold_111 NW_008649097.1 Phytophthora parasitica INRA-310...  140        6e-31 
PHPA:scaffold_12 NW_008648998.1 Phytophthora parasitica INRA-310 ...  137        7e-30 
PHIF:NW_003303619.1 Phytophthora infestans T30-4 supercont1.140 g...  137        7e-30 
PHCA:scaffold_14 PHYCAscaffold_14                                     126        1e-26 
PHRA:scaffold_21                                                      125        1e-26 
PHCA:scaffold_36 PHYCAscaffold_36                                     124        5e-26 
PHIF:NW_003303754.1 Phytophthora infestans T30-4 supercont1.5 gen...  123        5e-26 
PHIF:NW_003303731.1 Phytophthora infestans T30-4 supercont1.28 ge...  123        5e-26 
PHSO:scaffold_5                                                       119        2e-24 
PHSO:scaffold_3                                                       119        2e-24 
PHRA:scaffold_9                                                       117        7e-24 
PHCA:scaffold_146 PHYCAscaffold_146                                   117        7e-24 
PHPA:scaffold_48 NW_008649034.1 Phytophthora parasitica INRA-310 ...  113        8e-23 
PHKE:scaffold_89 scf_22126_89.1 dna:supercontig supercontig:PhyKe...  112        3e-22 
PHSO:scaffold_14                                                      111        3e-22 
PHPA:scaffold_68 NW_008649054.1 Phytophthora parasitica INRA-310 ...  110        1e-21 
PHRA:scaffold_378                                                     108        4e-21 
PHRA:scaffold_196                                                     108        4e-21 
PHRA:scaffold_436                                                     106        1e-20 
PYVX:scaffold_884 pve_scaffold_884 dna:supercontig supercontig:pv...  105        1e-20 
PHSO:scaffold_6                                                       105        1e-20 
PHRA:scaffold_98                                                      105        1e-20 
PHIF:NW_003307367.1 Phytophthora infestans T30-4 supercont1.1021 ...  105        1e-20 
PHRA:scaffold_17                                                      104        4e-20 
PHRA:scaffold_60                                                      104        4e-20 
PHRA:scaffold_1409                                                    100        5e-19 
PHKE:scaffold_277 scf_22126_277.1_contig_1 dna:supercontig superc...  100        5e-19 
PHIF:NW_003303739.1 Phytophthora infestans T30-4 supercont1.20 ge...  99.6       2e-18 
PHIF:NW_003303758.1 Phytophthora infestans T30-4 supercont1.1 gen...  98.7       2e-18 
PHPA:scaffold_34 NW_008649020.1 Phytophthora parasitica INRA-310 ...  96.0       2e-17 
PHSO:scaffold_33                                                      95.1       2e-17 
PHKE:scaffold_309 scf_22126_309.1 dna:supercontig supercontig:Phy...  95.1       2e-17 
PHCA:scaffold_87 PHYCAscaffold_87                                     95.1       2e-17 
PHPA:scaffold_54 NW_008649040.1 Phytophthora parasitica INRA-310 ...  93.3       8e-17 
PHSO:scaffold_7                                                       92.4       3e-16 
PHRA:scaffold_780                                                     92.4       3e-16 
PHCA:scaffold_162 PHYCAscaffold_162                                   92.4       3e-16 
PYUU:scaffold_1297 scf1117875581297 dna:supercontig supercontig:p...  91.5       3e-16 
PHIF:NW_003303719.1 Phytophthora infestans T30-4 supercont1.40 ge...  91.5       3e-16 
PHSO:scaffold_16                                                      90.6       1e-15 
PHRA:scaffold_2433                                                    90.6       1e-15 
PHRA:scaffold_12                                                      90.6       1e-15 
PHIF:NW_003303717.1 Phytophthora infestans T30-4 supercont1.42 ge...  90.6       1e-15 
PHPA:scaffold_15 NW_008649001.1 Phytophthora parasitica INRA-310 ...  89.7       1e-15 
PHPA:scaffold_71 NW_008649057.1 Phytophthora parasitica INRA-310 ...  88.7       3e-15 
PHCA:scaffold_50 PHYCAscaffold_50                                     88.7       3e-15 
HYAP:scaffold_71 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_7...  87.8       3e-15 
HYAP:scaffold_64 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_6...  87.8       3e-15 
PHRA:scaffold_319                                                     86.9       1e-14 
PHRA:scaffold_31                                                      86.9       1e-14 
PHRA:scaffold_29                                                      86.9       1e-14 
PHPA:scaffold_11 NW_008648997.1 Phytophthora parasitica INRA-310 ...  86.9       1e-14 
PHKE:scaffold_323 scf_22126_323.1_contig_1 dna:supercontig superc...  86.9       1e-14 
PHKE:scaffold_242 scf_22126_242.1 dna:supercontig supercontig:Phy...  86.0       1e-14 
PHKE:scaffold_527 scf_22126_527.1 dna:supercontig supercontig:Phy...  85.1       4e-14 
PHRA:scaffold_2762                                                    83.3       1e-13 
PHKE:scaffold_523 scf_22126_523.1 dna:supercontig supercontig:Phy...  83.3       1e-13 
PHPA:scaffold_88 NW_008649074.1 Phytophthora parasitica INRA-310 ...  82.4       1e-13 
PHPA:scaffold_36 NW_008649022.1 Phytophthora parasitica INRA-310 ...  81.5       5e-13 
PHIF:NW_003303746.1 Phytophthora infestans T30-4 supercont1.13 ge...  81.5       5e-13 
PHKE:scaffold_192 scf_22126_192.1 dna:supercontig supercontig:Phy...  78.8       2e-12 
PHSO:scaffold_2                                                       77.9       6e-12 
PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig:...  77.0       6e-12 
PHRA:scaffold_2309                                                    77.0       6e-12 
PHCA:scaffold_16 PHYCAscaffold_16                                     77.0       6e-12 
PHIF:NW_003303757.1 Phytophthora infestans T30-4 supercont1.2 gen...  74.3       7e-11 
PHIF:NW_003303732.1 Phytophthora infestans T30-4 supercont1.27 ge...  74.3       7e-11 
PHRA:scaffold_1828                                                    72.5       3e-10 
PHCA:scaffold_51 PHYCAscaffold_51                                     72.5       3e-10 
PHPA:scaffold_5 NW_008648991.1 Phytophthora parasitica INRA-310 u...  71.6       3e-10 
PHKE:scaffold_219 scf_22126_219.1 dna:supercontig supercontig:Phy...  71.6       3e-10 
PHPA:scaffold_6 NW_008648992.1 Phytophthora parasitica INRA-310 u...  70.7       9e-10 
PHIF:NW_003303741.1 Phytophthora infestans T30-4 supercont1.18 ge...  70.7       9e-10 
PHRA:scaffold_2258                                                    69.8       9e-10 
PHRA:scaffold_516                                                     69.8       9e-10 
PHRA:scaffold_512                                                     69.8       9e-10 
PHRA:scaffold_19                                                      69.8       9e-10 
PHRA:scaffold_1415                                                    68.0       3e-09 
PHRA:scaffold_407                                                     68.0       3e-09 
PHRA:scaffold_108                                                     68.0       3e-09 
PHRA:scaffold_91                                                      68.0       3e-09 
PHIF:NW_003303734.1 Phytophthora infestans T30-4 supercont1.25 ge...  68.0       3e-09 
PHIF:NW_003303749.1 Phytophthora infestans T30-4 supercont1.10 ge...  67.1       1e-08 
PHRA:scaffold_2136                                                    66.2       1e-08 
PHKE:scaffold_899 scf_22126_899.1_contig_1 dna:supercontig superc...  66.2       1e-08 
PHCA:scaffold_25 PHYCAscaffold_25                                     66.2       1e-08 
PHCA:scaffold_11 PHYCAscaffold_11                                     66.2       1e-08 
PHKE:scaffold_562 scf_22126_562.1 dna:supercontig supercontig:Phy...  65.3       4e-08 
PYIR:scaffold_4 pir_scaffold_4 dna:supercontig supercontig:pir_sc...  64.4       4e-08 
PHKE:scaffold_1562 scf_22126_1562.1 dna:supercontig supercontig:P...  64.4       4e-08 
PHCA:scaffold_46 PHYCAscaffold_46                                     64.4       4e-08 
PHRA:scaffold_67                                                      63.5       1e-07 
PHPA:scaffold_24 NW_008649010.1 Phytophthora parasitica INRA-310 ...  63.5       1e-07 
PHKE:scaffold_211 scf_22126_211.1_contig_1 dna:supercontig superc...  63.5       1e-07 
PHSO:scaffold_8                                                       62.6       1e-07 
PHRA:scaffold_159                                                     62.6       1e-07 
PHKE:scaffold_1552 scf_22126_1552.1_contig_1 dna:supercontig supe...  62.6       1e-07 
PHIF:NW_003303745.1 Phytophthora infestans T30-4 supercont1.14 ge...  61.7       5e-07 
PHIF:NW_003303722.1 Phytophthora infestans T30-4 supercont1.37 ge...  61.7       5e-07 
PHKE:scaffold_364 scf_22126_364.1 dna:supercontig supercontig:Phy...  60.8       5e-07 
HYAP:scaffold_149 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_...  60.8       5e-07 
PHCA:scaffold_53 PHYCAscaffold_53                                     59.9       2e-06 
PHCA:scaffold_27 PHYCAscaffold_27                                     59.9       2e-06 
PHSO:scaffold_21                                                      58.1       6e-06 
PHIF:NW_003303698.1 Phytophthora infestans T30-4 supercont1.61 ge...  58.1       6e-06 
PHCA:scaffold_17 PHYCAscaffold_17                                     58.1       6e-06 
PHPA:scaffold_324 NW_008649310.1 Phytophthora parasitica INRA-310...  57.2       6e-06 
PHIF:NW_003305543.1 Phytophthora infestans T30-4 supercont1.3127 ...  57.2       6e-06 
PHCA:scaffold_547 PHYCAscaffold_547                                   57.2       6e-06 
PHCA:scaffold_37 PHYCAscaffold_37                                     57.2       6e-06 
PHPA:scaffold_42 NW_008649028.1 Phytophthora parasitica INRA-310 ...  56.3       2e-05 
PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 ...  56.3       2e-05 
PHIF:NW_003303150.1 Phytophthora infestans T30-4 supercont1.629 g...  56.3       2e-05 
PHCA:scaffold_77 PHYCAscaffold_77                                     56.3       2e-05 
PHCA:scaffold_178 PHYCAscaffold_178                                   55.4       2e-05 
PHRA:scaffold_214                                                     54.5       7e-05 
PHIF:NW_003303715.1 Phytophthora infestans T30-4 supercont1.44 ge...  54.5       7e-05 
PHRA:scaffold_66                                                      53.6       7e-05 
PHKE:scaffold_495 scf_22126_495.1_contig_1 dna:supercontig superc...  53.6       7e-05 
PHKE:scaffold_1389 scf_22126_1389.1_contig_1 dna:supercontig supe...  52.7       2e-04 
PHKE:scaffold_333 scf_22126_333.1 dna:supercontig supercontig:Phy...  52.7       2e-04 
PHIF:NW_003303513.1 Phytophthora infestans T30-4 supercont1.246 g...  52.7       2e-04 
HYAP:scaffold_53 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_5...  52.7       2e-04 
PHPA:scaffold_343 NW_008649329.1 Phytophthora parasitica INRA-310...  51.8       2e-04 
PHPA:scaffold_1 NW_008634126.1 Phytophthora parasitica INRA-310 u...  51.8       2e-04 
PYIW:scaffold_2677 piw_scaffold_2677 dna:supercontig supercontig:...  50.9       8e-04 
PHPA:scaffold_8 NW_008648994.1 Phytophthora parasitica INRA-310 u...  50.9       8e-04 
PHKE:scaffold_104 scf_22126_104.1 dna:supercontig supercontig:Phy...  50.9       8e-04 
PHIF:NW_003303696.1 Phytophthora infestans T30-4 supercont1.63 ge...  50.9       8e-04 
HYAP:scaffold_73 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_7...  50.9       8e-04 
PHPA:scaffold_60 NW_008649046.1 Phytophthora parasitica INRA-310 ...  50.0       8e-04 
PHRA:scaffold_140                                                     49.1       0.003 
PHIF:NW_003303713.1 Phytophthora infestans T30-4 supercont1.46 ge...  49.1       0.003 
PHCA:scaffold_139 PHYCAscaffold_139                                   49.1       0.003 
HYAP:scaffold_78 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_7...  49.1       0.003 
PHKE:scaffold_993 scf_22126_993.1 dna:supercontig supercontig:Phy...  48.2       0.003 
PHKE:scaffold_819 scf_22126_819.1 dna:supercontig supercontig:Phy...  48.2       0.003 
PHKE:scaffold_564 scf_22126_564.1 dna:supercontig supercontig:Phy...  48.2       0.003 
PHCA:scaffold_38 PHYCAscaffold_38                                     48.2       0.003 
PYUU:scaffold_1981 scf1117875581981 dna:supercontig supercontig:p...  46.4       0.010 
PHRA:scaffold_271                                                     46.4       0.010 
PHIF:NW_003306740.1 Phytophthora infestans T30-4 supercont1.1923 ...  46.4       0.010 
PHIF:NW_003303458.1 Phytophthora infestans T30-4 supercont1.301 g...  46.4       0.010 
PLHA:NW_020187575.1 Plasmopara halstedii genome assembly, contig:...  45.5       0.036 
PLHA:NW_020187213.1 Plasmopara halstedii genome assembly, contig:...  45.5       0.036 
PHRA:scaffold_75                                                      45.5       0.036 
PHPA:scaffold_330 NW_008649316.1 Phytophthora parasitica INRA-310...  45.5       0.036 
PHPA:scaffold_9 NW_008648995.1 Phytophthora parasitica INRA-310 u...  45.5       0.036 
PHPA:scaffold_7 NW_008648993.1 Phytophthora parasitica INRA-310 u...  45.5       0.036 
PYIW:scaffold_3359 piw_scaffold_3359 dna:supercontig supercontig:...  44.6       0.036 
PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 u...  44.6       0.036 
PHKE:scaffold_183 scf_22126_183.1_contig_1 dna:supercontig superc...  44.6       0.036 
SAPA:scaffold_104 supercont2.104 dna:supercontig supercontig:ASM1...  42.8       0.13  
PYVX:scaffold_177 pve_scaffold_177 dna:supercontig supercontig:pv...  42.8       0.13  
PYAR:scaffold_1401 par_scaffold_1401 dna:supercontig supercontig:...  41.9       0.44  
PLHA:NW_020187243.1 Plasmopara halstedii genome assembly, contig:...  41.9       0.44  
PHKE:scaffold_563 scf_22126_563.1_contig_1 dna:supercontig superc...  41.9       0.44  
SADI:scaffold_77 supercont1.77 dna:supercontig supercontig:Sap_di...  41.0       0.44  
PYVX:scaffold_360 pve_scaffold_360 dna:supercontig supercontig:pv...  41.0       0.44  
PYUU:scaffold_1242 scf1117875581242 dna:supercontig supercontig:p...  41.0       0.44  
PYIW:scaffold_934 piw_scaffold_934 dna:supercontig supercontig:pi...  41.0       0.44  
PHKE:scaffold_893 scf_22126_893.1_contig_1 dna:supercontig superc...  41.0       0.44  
PHKE:scaffold_656 scf_22126_656.1 dna:supercontig supercontig:Phy...  41.0       0.44  
PHIF:NW_003303721.1 Phytophthora infestans T30-4 supercont1.38 ge...  41.0       0.44  
PHIF:NW_003303555.1 Phytophthora infestans T30-4 supercont1.204 g...  41.0       0.44  
SAPA:scaffold_14 supercont2.14 dna:supercontig supercontig:ASM151...  40.1       1.5   
SAPA:scaffold_4 supercont2.4 dna:supercontig supercontig:ASM15154...  40.1       1.5   
SAPA:scaffold_3 supercont2.3 dna:supercontig supercontig:ASM15154...  40.1       1.5   
PYVX:scaffold_742 pve_scaffold_742 dna:supercontig supercontig:pv...  40.1       1.5   
PYVX:scaffold_174 pve_scaffold_174 dna:supercontig supercontig:pv...  40.1       1.5   
PYVX:scaffold_168 pve_scaffold_168 dna:supercontig supercontig:pv...  40.1       1.5   
PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:p...  40.1       1.5   
PYAP:scaffold_1161 pag1_scaffold_1161 dna:supercontig supercontig...  40.1       1.5   
PYAP:scaffold_50 pag1_scaffold_50 dna:supercontig supercontig:pag...  40.1       1.5   
SADI:scaffold_84 supercont1.84 dna:supercontig supercontig:Sap_di...  39.2       1.5   
PYVX:scaffold_108 pve_scaffold_108 dna:supercontig supercontig:pv...  39.2       1.5   
PYVX:scaffold_27 pve_scaffold_27 dna:supercontig supercontig:pve_...  39.2       1.5   
PYUU:scaffold_2039 scf1117875582039 dna:supercontig supercontig:p...  39.2       1.5   
PYIW:scaffold_1469 piw_scaffold_1469 dna:supercontig supercontig:...  39.2       1.5   
PYIW:scaffold_685 piw_scaffold_685 dna:supercontig supercontig:pi...  39.2       1.5   
PHRA:scaffold_81                                                      39.2       1.5   
PHPA:scaffold_49 NW_008649035.1 Phytophthora parasitica INRA-310 ...  39.2       1.5   
PHCA:scaffold_368 PHYCAscaffold_368                                   39.2       1.5   
APAS:scaffold_53 supercont1.53 dna:supercontig supercontig:Apha_a...  39.2       1.5   
PYVX:scaffold_281 pve_scaffold_281 dna:supercontig supercontig:pv...  38.3       5.3   
PYUU:scaffold_2035 scf1117875582035 dna:supercontig supercontig:p...  38.3       5.3   
PYUU:scaffold_2023 scf1117875582023 dna:supercontig supercontig:p...  38.3       5.3   
PYIW:scaffold_786 piw_scaffold_786 dna:supercontig supercontig:pi...  38.3       5.3   
PYIW:scaffold_560 piw_scaffold_560 dna:supercontig supercontig:pi...  38.3       5.3   
PYIR:scaffold_257 pir_scaffold_257 dna:supercontig supercontig:pi...  38.3       5.3   
PYAR:scaffold_140 par_scaffold_140 dna:supercontig supercontig:pa...  38.3       5.3   
PLHA:NW_020189964.1 Plasmopara halstedii genome assembly, contig:...  38.3       5.3   
PHSO:scaffold_13                                                      38.3       5.3   
PHRA:scaffold_77                                                      38.3       5.3   
PHPA:scaffold_120 NW_008649106.1 Phytophthora parasitica INRA-310...  38.3       5.3   
PHKE:scaffold_106 scf_22126_106.1_contig_1 dna:supercontig superc...  38.3       5.3   
PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 gen...  38.3       5.3   
PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 ge...  38.3       5.3   
PHIF:NW_003303725.1 Phytophthora infestans T30-4 supercont1.34 ge...  38.3       5.3   
PHIF:NW_003303718.1 Phytophthora infestans T30-4 supercont1.41 ge...  38.3       5.3   
PHIF:NW_003303690.1 Phytophthora infestans T30-4 supercont1.69 ge...  38.3       5.3   
PHIF:NW_003302786.1 Phytophthora infestans T30-4 supercont1.1099 ...  38.3       5.3   
ALLA:FR824660 dna:supercontig supercontig:ENA1:FR824660:1:8039:1 REF  38.3       5.3   
SAPA:scaffold_376 supercont2.376 dna:supercontig supercontig:ASM1...  37.4       5.3   
SAPA:scaffold_36 supercont2.36 dna:supercontig supercontig:ASM151...  37.4       5.3   
PYVX:scaffold_898 pve_scaffold_898 dna:supercontig supercontig:pv...  37.4       5.3   
PYVX:scaffold_782 pve_scaffold_782 dna:supercontig supercontig:pv...  37.4       5.3   
PYVX:scaffold_682 pve_scaffold_682 dna:supercontig supercontig:pv...  37.4       5.3   
PYVX:scaffold_561 pve_scaffold_561 dna:supercontig supercontig:pv...  37.4       5.3   
PYVX:scaffold_407 pve_scaffold_407 dna:supercontig supercontig:pv...  37.4       5.3   
PYVX:scaffold_352 pve_scaffold_352 dna:supercontig supercontig:pv...  37.4       5.3   
PYUU:scaffold_1381 scf1117875581381 dna:supercontig supercontig:p...  37.4       5.3   
PYIW:scaffold_2994 piw_scaffold_2994 dna:supercontig supercontig:...  37.4       5.3   
PYIW:scaffold_2971 piw_scaffold_2971 dna:supercontig supercontig:...  37.4       5.3   
PYIW:scaffold_873 piw_scaffold_873 dna:supercontig supercontig:pi...  37.4       5.3   
PYIW:scaffold_95 piw_scaffold_95 dna:supercontig supercontig:piw_...  37.4       5.3   
PYIR:scaffold_1841 pir_scaffold_1841 dna:supercontig supercontig:...  37.4       5.3   
PYIR:scaffold_102 pir_scaffold_102 dna:supercontig supercontig:pi...  37.4       5.3   
PYIR:scaffold_16 pir_scaffold_16 dna:supercontig supercontig:pir_...  37.4       5.3   
PYAR:scaffold_4338 par_scaffold_4338 dna:supercontig supercontig:...  37.4       5.3   
PYAR:scaffold_915 par_scaffold_915 dna:supercontig supercontig:pa...  37.4       5.3   
PYAR:scaffold_695 par_scaffold_695 dna:supercontig supercontig:pa...  37.4       5.3   
PYAR:scaffold_580 par_scaffold_580 dna:supercontig supercontig:pa...  37.4       5.3   
PYAR:scaffold_143 par_scaffold_143 dna:supercontig supercontig:pa...  37.4       5.3   
PYAP:scaffold_325 pag1_scaffold_325 dna:supercontig supercontig:p...  37.4       5.3   
PYAP:scaffold_35 pag1_scaffold_35 dna:supercontig supercontig:pag...  37.4       5.3   
PHPA:scaffold_61 NW_008649047.1 Phytophthora parasitica INRA-310 ...  37.4       5.3   
PHKE:scaffold_147 scf_22126_147.1 dna:supercontig supercontig:Phy...  37.4       5.3   
PHIF:NW_003303755.1 Phytophthora infestans T30-4 supercont1.4 gen...  37.4       5.3   
PHIF:NW_003303708.1 Phytophthora infestans T30-4 supercont1.51 ge...  37.4       5.3   
PHCA:scaffold_47 PHYCAscaffold_47                                     37.4       5.3   
APIN:scaffold_13 supercont1.13 dna:supercontig supercontig:Apha_i...  37.4       5.3   
APAS:scaffold_1 supercont1.1 dna:supercontig supercontig:Apha_ast...  37.4       5.3   
ALLA:FR824132 dna:supercontig supercontig:ENA1:FR824132:1:86971:1...  37.4       5.3   

>PHCA:scaffold_84 PHYCAscaffold_84
Length=182275

 Score = 1364 bits (1512),  Expect = 0.0
 Identities = 756/756 (100%), Gaps = 0/756 (0%)
 Strand=Plus/Minus

Query  1      ATGAACTTTCGGATCGTCCTCCTCGTCCTCGTCGCTTCGCTTGCAGGAGCCCAGGCTCAA  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  99155  ATGAACTTTCGGATCGTCCTCCTCGTCCTCGTCGCTTCGCTTGCAGGAGCCCAGGCTCAA  99096

Query  61     GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGAC  120
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  99095  GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGAC  99036

Query  121    AAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCT  180
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  99035  AAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCT  98976

Query  181    GCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC  240
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  98975  GCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC  98916

Query  241    GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  98915  GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  98856

Query  301    GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCT  360
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  98855  GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCT  98796

Query  361    CTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGAC  420
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  98795  CTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGAC  98736

Query  421    AACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTAC  480
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  98735  AACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTAC  98676

Query  481    GCTAGCCAGACGCCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGAGTAC  540
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  98675  GCTAGCCAGACGCCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGAGTAC  98616

Query  541    TACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAATTC  600
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  98615  TACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAATTC  98556

Query  601    CAGGACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCACACA  660
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  98555  CAGGACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCACACA  98496

Query  661    GACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGGGGTG  720
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  98495  GACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGGGGTG  98436

Query  721    TTCCAGGAGCTACTAGACAAGGCATGGCCGTTTTAG  756
              ||||||||||||||||||||||||||||||||||||
Sbjct  98435  TTCCAGGAGCTACTAGACAAGGCATGGCCGTTTTAG  98400

>PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.63, whole genome shotgun 
sequence
Length=342508

 Score = 750 bits (831),  Expect = 0.0
 Identities = 622/759 (82%), Gaps = 3/759 (0%)
 Strand=Plus/Minus

Query  1       ATGAACTTTCGGATCGTCCTCCTCGTCCTCGTCGCTTCGCTTGCAGGAGCCC---AGGCT  57
               ||||||| ||||   |||||| |||   | |||||||| ||||| |  |      |||  
Sbjct  249122  ATGAACTATCGGGCTGTCCTCATCGCTGTAGTCGCTTCACTTGCTGCGGTTGTTGAGGGC  249063

Query  58      CAAGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCC  117
               ||||||||||| ||| |||||||||||||||| ||| ||||| |||| || ||| | || 
Sbjct  249062  CAAGTCATCGGACACAACCAGGTTCGGCCATTTCCGGAGCCAGAGCCTGTTACCTTTTCT  249003

Query  118     GACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTAC  177
                | ||||| || ||||||| |||||| || || || ||||  ||||| || || ||||||
Sbjct  249002  CAAAAGGCCGCCGTAAAGTATAAACCCCAACTCAAGATCGAGGACGGATGCCATCCGTAC  248943

Query  178     CCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGAC  237
               || || || |||||||| |||||||||| ||| || |||||||||||||| || ||||| 
Sbjct  248942  CCCGCTGTCCAGAAGGACGGCTCCATTAGCGGCGGACTCAAGTGGAGTGGCCCCCAGGAT  248883

Query  238     GGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAAT  297
               |||||||| ||||| |||||| | |||||||||||||| ||||| |||  ||||||||| 
Sbjct  248882  GGCGAATGTACAGGTTCGAAGTTGGGCTCTCAGATCTATGCTCGGTCCAAGTGGGTGAAC  248823

Query  298     GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTT  357
               || || ||||| || |||||||| |||||||||||||||||| |||||||||| ||  | 
Sbjct  248822  GATGTATGGGCAATTATGTACGCTTGGTATTTCCCGAAAGGCCGAGGGGCAGTGCCCGTA  248763

Query  358     CCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATC  417
               || || ||    || || ||||| |||||||| |||||||||||||  || || ||||||
Sbjct  248762  CCGCTCATTCTTCGACTCTTCGGTCACCGTCACAACTGGGAGTACGCTATCGTCTGGATC  248703

Query  418     GACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGG  477
               ||||||||  ||    ||||||| |||||||| |||||||||||||| |||   ||||| 
Sbjct  248702  GACAACCCTGAGCTTGAAAACTCTACCATTCTAGGCGTATCGATGTCTGCTAGTGTCGGC  248643

Query  478     TACGCTAGCCAGACGCCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGAG  537
               || || |||||||| ||||||||| ||| |||||||||||||||||| ||||||||| | 
Sbjct  248642  TATGCGAGCCAGACACCCCCTGAAACGAGGTATGTGGATGGCGACAGCGTCAAGCTCAAA  248583

Query  538     TACTACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAA  597
               |||||||| ||||| || ||||| |||||||| ||||||||||| |||| ||| || |||
Sbjct  248582  TACTACTATAACCACCTTTTAGGAAGCACATCGCTGCAGCTCACAGAAGCCACCGGCGAA  248523

Query  598     TTCCAGGACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCAC  657
               |||||||| |||||||| ||||| || |||||||||||||| || |||||||| ||||||
Sbjct  248522  TTCCAGGATCTCATTACGTGGGATGAGCTCTCGAAGCTGGCGCGGTACTCTCTAAACCAC  248463

Query  658     ACAGACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGGG  717
               |||||||||||||||||||||||  |||||||||| || |||||||||||||||||||| 
Sbjct  248462  ACAGACTGGGACGAGACTCTGTTTAACTTGGCAGGACTTAAGATGCCGCTGAAGGACGGC  248403

Query  718     GTGTTCCAGGAGCTACTAGACAAGGCATGGCCGTTTTAG  756
               |||||  | ||||||||  | ||||| ||||||||||||
Sbjct  248402  GTGTTTGACGAGCTACTGAATAAGGCCTGGCCGTTTTAG  248364

>PHSO:scaffold_1
Length=13391543

 Score = 658 bits (729),  Expect = 0.0
 Identities = 602/759 (79%), Gaps = 6/759 (1%)
 Strand=Plus/Minus

Query  1        ATGAACTTTCGGATCGTCCTCCTCGTCCTCG---TCGCTTCGCTTGCAGGAGCCCAGGCT  57
                |||||||||   |||| |||| ||||   ||   |||| ||| | || |  || ||||| 
Sbjct  2797932  ATGAACTTT---ATCGCCCTCATCGTGGCCGCTTTCGCGTCGTTCGCTGCGGCACAGGCG  2797876

Query  58       CAAGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCC  117
                || || |||  |||| ||| ||| ||||||||||||||||| ||||||||||||||||| 
Sbjct  2797875  CAGGTGATCAACCACAACCTGGTGCGGCCATTCCCGCAGCCGAAGCCCGTCACCGTCTCG  2797816

Query  118      GACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTAC  177
                || ||||| ||||| | ||| ||||| ||||| || ||||  |||||||| |||||||||
Sbjct  2797815  GAAAAGGCCGCAGTCAGGTTCAAACCGCAGCTCAAGATCGATGACGGGTGCCACCCGTAC  2797756

Query  178      CCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGAC  237
                || |||||||||||||| |||||||||| ||| || ||||||||| | || |||||||||
Sbjct  2797755  CCCGCCGTTCAGAAGGACGGCTCCATTAGCGGCGGACTCAAGTGGGGCGGGCCGCAGGAC  2797696

Query  238      GGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAAT  297
                ||||| |||||||| || ||| | ||||| ||| | ||||||||||| |  |||||||| 
Sbjct  2797695  GGCGAGTGCACAGGTTCCAAGTTTGGCTCGCAGGTGTACGCTCGCTCGGGCTGGGTGAAC  2797636

Query  298      GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTT  357
                ||||||||||||||||| ||||||||||| ||||| || ||| |||| || || || || 
Sbjct  2797635  GACGTGTGGGCCATCATATACGCCTGGTACTTCCCCAAGGGCCGAGGCGCCGTGCCCCTG  2797576

Query  358      CCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATC  417
                || || |||   || || ||||||||||| || ||||||||||||| ||| || ||||||
Sbjct  2797575  CCGCTGATCCTTCGACTGTTCGGACACCGGCACAACTGGGAGTACGCCATCGTCTGGATC  2797516

Query  418      GACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGG  477
                ||||||||| |     | ||| |||| || || |||   || ||||| ||    ||||| 
Sbjct  2797515  GACAACCCCGACCTGGAGAACGCGACGATCCTAGGCACCTCCATGTCCGCGAGTGTCGGC  2797456

Query  478      TACGCTAGCCAGACGCCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGAG  537
                ||| |||||||||||||||  ||  ||  ||| || || |||   || |||||| |||| 
Sbjct  2797455  TACTCTAGCCAGACGCCCCTGGAGTCGCGGTACGTCGACGGCTCGAGCGTCAAGGTCGAA  2797396

Query  538      TACTACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAA  597
                ||||||||| |||| ||  | |||| |||  | |||| ||||||||||||| | || || 
Sbjct  2797395  TACTACTACGACCACCTGCTCGGCAACACGGCGCTGCGGCTCACGGAAGACGCCGGCGAG  2797336

Query  598      TTCCAGGACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCAC  657
                ||||||||||| ||||| |||||  | ||||| |||||||| || ||||| |||||||||
Sbjct  2797335  TTCCAGGACCTAATTACGTGGGAGCAGCTCTCCAAGCTGGCGCGGTACTCGCTGAACCAC  2797276

Query  658      ACAGACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGGG  717
                || |||||||||||||| | |||| ||  ||||||| |||||||||| ||| ||||||| 
Sbjct  2797275  ACGGACTGGGACGAGACCCCGTTCAACGCGGCAGGCGTCAAGATGCCCCTGCAGGACGGC  2797216

Query  718      GTGTTCCAGGAGCTACTAGACAAGGCATGGCCGTTTTAG  756
                |||||| ||||  | || |||||||| ||||||||||||
Sbjct  2797215  GTGTTCGAGGAATTGCTGGACAAGGCGTGGCCGTTTTAG  2797177

 Score = 116 bits (128),  Expect = 7e-24
 Identities = 257/381 (67%), Gaps = 31/381 (8%)
 Strand=Plus/Minus

Query  53       AGGCTCAAGTC-ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACC  111
                |||| |||||  |||| ||||||||||||   ||| ||| |||||||  ||||||| || 
Sbjct  9164784  AGGC-CAAGTGGATCGACCACGACCAGGTCAAGCCGTTCGCGCAGCCTGAGCCCGTGACG  9164726

Query  112      GTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCAC  171
                 | ||||| ||||| ||||| ||||| ||||| ||| |  | ||| |  |||| || |||
Sbjct  9164725  ATTTCCGAGAAGGCCGCAGTCAAGTTCAAACCTCAGATGCACATCACGAACGGATGCCAC  9164666

Query  172      CCGTACCCTGCCGTTCAGAAGGATGGCTCCATTAC---CGGAGGTCTCAAGTGGAGTGGA  228
                ||||||||||| ||   ||| || | |      ||   ||| |||||||||  ||  || 
Sbjct  9164665  CCGTACCCTGCGGT---GAACGAAGCCGGAGAGACGGGCGGCGGTCTCAAGACGAAGGGC  9164609

Query  229      CCGCAGGACGGCGAATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGC  287
                 | |    ||  |  ||||  |||||   |||  || || ||| ||||||  |||||  |
Sbjct  9164608  GCCCCTAGCGCTGGCTGCAAGGGCTC-TGGCTGGGGGTCGCAGGTCTACGGCCGCTCGAC  9164550

Query  288      GTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGC  347
                 |||     || ||| ||||||||||||||| | ||||| ||||| ||        || |
Sbjct  9164549  CTGGTACCGTGGCGTCTGGGCCATCATGTACTCGTGGTACTTCCCCAA--------GGAC  9164498

Query  348      AGTCCCTCTTCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCAT  407
                   || || |           | | |   | || ||||||||  |||||||| |||||||
Sbjct  9164497  TCGCCGTCGT-----------CGGGC--CTGGGCCACCGTCACGACTGGGAGCACGTCAT  9164451

Query  408      TGTGTGGATCGACAACCCCAA  428
                 ||||||||||||||||| ||
Sbjct  9164450  CGTGTGGATCGACAACCCGAA  9164430

 Score = 87.8 bits (96),  Expect = 3e-15
 Identities = 93/123 (76%), Gaps = 0/123 (0%)
 Strand=Plus/Minus

Query  63       CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
                ||| | ||||||||||||   ||| ||| |||||||  || |||| ||  |||| || ||
Sbjct  9249290  CATTGACCACGACCAGGTCAAGCCGTTCGCGCAGCCCGAGTCCGTTACGATCTCGGAGAA  9249231

Query  123      GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
                ||| ||||| ||||| || ||||||||| | ||| || |||| || ||  | ||||| ||
Sbjct  9249230  GGCCGCAGTGAAGTTCAAGCCACAGCTTCATATCACCAACGGATGCCATGCATACCCGGC  9249171

Query  183      CGT  185
                 ||
Sbjct  9249170  AGT  9249168

 Score = 69.8 bits (76),  Expect = 9e-10
 Identities = 192/288 (67%), Gaps = 10/288 (3%)
 Strand=Plus/Plus

Query  52        CAGGCTCAAGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACC  111
                 ||||| | | ||||||  |||||| |||| | ||| ||    |||||  | || ||||||
Sbjct  12058920  CAGGCGCTA-TCATCGATCACGACAAGGTGCAGCCGTTTGTACAGCCCGAACCGGTCACC  12058978

Query  112       GTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGG--TGTC  169
                 || ||| | || || || || ||||| || ||| |  |     ||  | | ||   || |
Sbjct  12058979  GTATCCAAAAACGCTGCCGTGAAGTTCAAGCCAAACGTCCTGGTC--CTATGGACATGCC  12059036

Query  170       ACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGA--GTGG  227
                 | | | ||||||| ||  |    |  |||   |  | ||||||||||||  | |  | ||
Sbjct  12059037  ATCTGAACCCTGCTGTCAATGCTGCGGGCGATACGAGCGGAGGTCTCAAAGGAACGGGGG  12059096

Query  228       ACCGCAGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGC  287
                 | |||    ||||   |||| ||| |||   |||||||| ||  |||||| |||  | | 
Sbjct  12059097  AGCGCGATTCGGCC--TGCA-AGGGTCGGTTCTCGGCTCGCAAGTCTACGGTCGAGCTGG  12059153

Query  288       GTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                  |||    | ||| ||||||||||||||||||| ||||||||||| ||
Sbjct  12059154  ATGGTACCAGGACATGTGGGCCATCATGTACGCGTGGTATTTCCCCAA  12059201

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 64/84 (76%), Gaps = 0/84 (0%)
 Strand=Plus/Plus

Query  250       GGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCC  309
                 || ||||| ||||| |||||  | ||||  ||||| || |||   | |||  ||||||  
Sbjct  12186552  GGTTCGAATCTCGGATCTCAAGTGTACGGGCGCTCGGCCTGGTACATTGATATGTGGGGG  12186611

Query  310       ATCATGTACGCCTGGTATTTCCCG  333
                 ||||||||||| ||||| ||||||
Sbjct  12186612  ATCATGTACGCTTGGTACTTCCCG  12186635

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 43/55 (78%), Gaps = 0/55 (0%)
 Strand=Plus/Plus

Query  280       CGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGA  334
                 ||||| ||||||    |  ||| |||||| ||||||||||| |||||  ||||||
Sbjct  11756031  CGCTCTGCGTGGACACACAACGCGTGGGCGATCATGTACGCATGGTACCTCCCGA  11756085

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  393       CTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
                 ||||||| || || | ||||||||||| |||||
Sbjct  12186674  CTGGGAGAACATCGTCGTGTGGATCGATAACCC  12186706

>PHRA:scaffold_56
Length=334739

 Score = 635 bits (703),  Expect = 1e-179
 Identities = 599/760 (79%), Gaps = 8/760 (1%)
 Strand=Plus/Plus

Query  1       ATGAACTTTCGGATCGTCCTCCTCGTCCTCG-TCGCTTCGCTTGCAGGAGCCCAGGCTCA  59
               |||||||||||   |||| || ||| |  || | ||||||||||| | ||| ||||| ||
Sbjct  152909  ATGAACTTTCGCGCCGTCTTCGTCG-CTGCGATGGCTTCGCTTGCTGTAGCGCAGGCCCA  152967

Query  60      AGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGA  119
               |||||||||||||||||||||||| || |||||||||||| | |||||||| || ||  |
Sbjct  152968  AGTCATCGGCCACGACCAGGTTCGACCGTTCCCGCAGCCAGACCCCGTCACGGTTTCTCA  153027

Query  120     CAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCC  179
                ||| | || || || || || || ||||| || || | || ||| || |||||||||||
Sbjct  153028  AAAGACGGCCGTCAAATTCAAGCCCCAGCTCAAGATTGACGCCGGATGCCACCCGTACCC  153087

Query  180     TGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGG  239
                ||||| || ||||| |||||||| | ||| || ||||||||||| || || ||||||||
Sbjct  153088  CGCCGTCCAAAAGGACGGCTCCATGAGCGGCGGACTCAAGTGGAGCGGCCCTCAGGACGG  153147

Query  240     CGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGA  299
                || ||||||||||||| ||| |||||||||||||||||||| || |||||||| |||||
Sbjct  153148  AGAGTGCACAGGCTCGAGGCTGGGCTCTCAGATCTACGCTCGTTCGGCGTGGGTCAATGA  153207

Query  300     CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGG---CAGTCCCTCT  356
               ||| ||||||||||||||||| |||||||||||||||||| |||  |   |||||||   
Sbjct  153208  CGTCTGGGCCATCATGTACGCTTGGTATTTCCCGAAAGGCCGAGCAGCCACAGTCCC---  153264

Query  357     TCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGAT  416
                ||   | ||   ||  ||||||| ||||| || ||||||||||||||| | || |||||
Sbjct  153265  CCCGGATTTCCTTCGGTTTTTCGGCCACCGCCACAACTGGGAGTACGTCGTCGTTTGGAT  153324

Query  417     CGACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGG  476
                |||||||||     | | ||| | ||| |||| || || || ||||| ||     ||||
Sbjct  153325  TGACAACCCCGGTCTCGAGAACGCCACCGTTCTAGGTGTGTCAATGTCTGCAAGTATCGG  153384

Query  477     GTACGCTAGCCAGACGCCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGA  536
               |||| | |  ||| | ||| | || | || ||||||||| ||   |||||| ||| | | 
Sbjct  153385  GTACTCGAAGCAGGCTCCCACGGACGTGAAGTATGTGGACGGAACCAGTGTGAAGGTTGC  153444

Query  537     GTACTACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGA  596
                |||||||||||||| ||| | |||| |||  ||||||||||||| |||||||| || ||
Sbjct  153445  ATACTACTACAACCACCTCCTGGGCAACACGGCCCTGCAGCTCACCGAAGACACCGGCGA  153504

Query  597     ATTCCAGGACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCA  656
                |||||||||||||||  ||||||| | || ||||  ||||| || |||||| |||||||
Sbjct  153505  GTTCCAGGACCTCATTCAATGGGACCAGCTTTCGAGCCTGGCGCGGTACTCTTTGAACCA  153564

Query  657     CACAGACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGG  716
               ||| ||||||||| ||||| |||||| |||||| || |||||||||||||||||||| ||
Sbjct  153565  CACGGACTGGGACCAGACTTTGTTCGGCTTGGCGGGACTCAAGATGCCGCTGAAGGATGG  153624

Query  717     GGTGTTCCAGGAGCTACTAGACAAGGCATGGCCGTTTTAG  756
                || ||  ||||||| || || ||| | |||||||| |||
Sbjct  153625  CGTATTTGAGGAGCTGCTCGATAAGACGTGGCCGTTCTAG  153664

 Score = 220 bits (243),  Expect = 8e-55
 Identities = 450/661 (68%), Gaps = 26/661 (4%)
 Strand=Plus/Plus

Query  70      CACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCA  129
               ||||||||||| | ||||||  ||||||| ||  |  |||| |||||| | || || || 
Sbjct  156107  CACGACCAGGTCCAGCCATTTGCGCAGCCGAATTCAATCACGGTCTCCCAAAAAGCCGCC  156166

Query  130     GTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAG  189
               || ||||| || || ||||| || | |   ||||| ||  |||| |||||||| ||||||
Sbjct  156167  GTCAAGTTCAAGCCCCAGCTCAAGACCTTGGACGGATGCTACCCATACCCTGCTGTTCAG  156226

Query  190     AAGGATGGCTCCATTACCGGAGGTCTCAAGTGGA-----GTGGACCGCAGGACGGCGAAT  244
                 ||| || |||| ||  || ||||||| |||||     ||||  |  |||  || || |
Sbjct  156227  GCGGACGGATCCACTAGTGGTGGTCTCAGGTGGACTGTCGTGGGTCAAAGG--GGGGATT  156284

Query  245     GCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGT  304
               |||||| | |    || ||||| || ||||||||||| ||| | |||      || || |
Sbjct  156285  GCACAGACCCACCACTGGGCTCGCAAATCTACGCTCGATCCACCTGGTACCGCGATGTCT  156344

Query  305     GGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTA  364
               |||| ||||||||| ||||||| ||||| || |||   |   | |||           ||
Sbjct  156345  GGGCTATCATGTACACCTGGTACTTCCCAAAGGGCTCTGAAAC-GTC-----AGGAGGTA  156398

Query  365     TCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACC  424
               |   ||      |||| || || || |||||||||| |||  | || |||||||||||||
Sbjct  156399  TTGGCC------TCGGCCATCGGCACAACTGGGAGTTCGTTGTCGTTTGGATCGACAACC  156452

Query  425     CCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTAC-GCT  483
               ||     | | ||||||||||| || |||||||||||||| ||| |  |||| ||| || 
Sbjct  156453  CCGCTCTCGACAACTCGACCATCCTGGGCGTATCGATGTCTGCTTCTATCGGCTACAGCA  156512

Query  484     AGCCAGACGCCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGAGTACTAC  543
               ||| || | || ||  || ||| |||| | |||||    ||||| ||| ||   || | |
Sbjct  156513  AGCGAG-CTCCTCCCAAATCGAAGTATATAGATGGAACAAGTGTGAAGGTCAGCTATTTC  156571

Query  544     TACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAATTCCAG  603
               || | |  | | || |||| |||  | ||| | || || || ||  | || ||    || 
Sbjct  156572  TATAGCATTGTTTTCGGCAACACGGCGCTGGAACTTACTGAGGATGCAGGAGAGACTCAA  156631

Query  604     GACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCACACAGAC  663
               |||||||| |  |||||  | ||| |  |  |||| ||| |  || |||   |||| |||
Sbjct  156632  GACCTCATCATGTGGGATCAGCTCCCCGACGTGGCTCGAGATGCTTTGA---ACACTGAC  156688

Query  664     TGGGACGAGACTCTGTTCGACTT-GGCAGGCCTCAAGATGCCGCTGAAGGACGGGGTGTT  722
               ||||||  ||||||||   | || ||||   ||||| |||||  |||||||||  || ||
Sbjct  156689  TGGGACACGACTCTGTGGAATTTGGGCAACGCTCAA-ATGCCTTTGAAGGACGACGTTTT  156747

Query  723     C  723
               |
Sbjct  156748  C  156748

 Score = 119 bits (131),  Expect = 2e-24
 Identities = 132/175 (75%), Gaps = 1/175 (1%)
 Strand=Plus/Plus

Query  127     GCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTT  186
               || || || || || || ||||| || |  | |||||| || ||||||||||| |||| |
Sbjct  155263  GCCGTCAAATTCAAGCCCCAGCTCAAGACTGACGACGGATGCCACCCGTACCCCGCCGCT  155322

Query  187     CAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGC  246
               || ||| | |||||||| | ||| |  ||||| || || || || |||   || || |||
Sbjct  155323  CAAAAG-ACGGCTCCATGAGCGGCGAACTCAAATGAAGCGGCCCTCAGTTTGGAGAGTGC  155381

Query  247     ACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACG  301
               |||| ||||| ||| |||||||||||||| ||||| ||   ||||||  ||||||
Sbjct  155382  ACAGACTCGAGGCTGGGCTCTCAGATCTAAGCTCGTTCGATGTGGGTCGATGACG  155436

>PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 
genomic scaffold, whole genome shotgun sequence
Length=695754

 Score = 635 bits (703),  Expect = 1e-179
 Identities = 560/699 (80%), Gaps = 0/699 (0%)
 Strand=Plus/Minus

Query  58      CAAGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCC  117
               ||||||||||| ||| |||||||||||||||| | | ||||| ||||||||||| | || 
Sbjct  399040  CAAGTCATCGGACACAACCAGGTTCGGCCATTTCTGGAGCCAGAGCCCGTCACCTTTTCT  398981

Query  118     GACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTAC  177
                | |||||||| ||||| |  || || || ||||| ||||  |||||||| || ||||||
Sbjct  398980  CAAAAGGCAGCCGTAAAATACAAGCCCCAACTTAAGATCGAGGACGGGTGCCATCCGTAC  398921

Query  178     CCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGAC  237
               ||||| || |||||||| ||||| || | ||| || |||||||||||||| || ||||| 
Sbjct  398920  CCTGCTGTCCAGAAGGACGGCTCTATCAGCGGTGGACTCAAGTGGAGTGGGCCCCAGGAT  398861

Query  238     GGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAAT  297
               |||||||| ||||| |||||||| || ||||||||||||||||| ||   |||||| || 
Sbjct  398860  GGCGAATGTACAGGATCGAAGCTGGGTTCTCAGATCTACGCTCGTTCGAAGTGGGTAAAC  398801

Query  298     GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTT  357
               || || ||||| || |||||||| |||||||| ||||||||| |||||||||| |||   
Sbjct  398800  GATGTTTGGGCAATTATGTACGCATGGTATTTTCCGAAAGGCCGAGGGGCAGTGCCTGCA  398741

Query  358     CCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATC  417
               || || ||    || || || || ||||| || ||||||||||||| ||| || ||||||
Sbjct  398740  CCGCTCATTCTTCGGCTCTTTGGCCACCGCCACAACTGGGAGTACGCCATCGTCTGGATC  398681

Query  418     GACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGG  477
               ||||||||  ||  | |||| || |||||||| || || || || || ||     || | 
Sbjct  398680  GACAACCCTGAGCTCGAAAATTCCACCATTCTAGGTGTGTCAATATCCGCAAGTATCAGC  398621

Query  478     TACGCTAGCCAGACGCCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGAG  537
               ||||| ||| |||||||||||||||| |   ||||||||||||| || ||||||||||| 
Sbjct  398620  TACGCAAGCGAGACGCCCCCTGAAGCAAACCATGTGGATGGCGAAAGCGTCAAGCTCGAA  398561

Query  538     TACTACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAA  597
               |||||||| ||||| || || ||||||||||| ||||||||||| ||||| || || || 
Sbjct  398560  TACTACTATAACCACCTTTTTGGCAGCACATCGCTGCAGCTCACCGAAGATACTGGTGAG  398501

Query  598     TTCCAGGACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCAC  657
               || ||||||||| |||| |||||  | ||| | ||| |||| || |||||| | ||| ||
Sbjct  398500  TTTCAGGACCTCGTTACGTGGGATCAGCTCACAAAGTTGGCGCGGTACTCTTTAAACAAC  398441

Query  658     ACAGACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGGG  717
               || ||||||||||||||||||||  | |||||||||||||||||||| ||||||||||| 
Sbjct  398440  ACGGACTGGGACGAGACTCTGTTTAATTTGGCAGGCCTCAAGATGCCACTGAAGGACGGC  398381

Query  718     GTGTTCCAGGAGCTACTAGACAAGGCATGGCCGTTTTAG  756
               | |||  | ||||||||  | || || ||||| ||||||
Sbjct  398380  GAGTTTGACGAGCTACTGAATAAAGCCTGGCCATTTTAG  398342

>PHRA:scaffold_1695
Length=3961

 Score = 630 bits (698),  Expect = 1e-178
 Identities = 598/760 (79%), Gaps = 8/760 (1%)
 Strand=Plus/Minus

Query  1     ATGAACTTTCGGATCGTCCTCCTCGTCCTCG-TCGCTTCGCTTGCAGGAGCCCAGGCTCA  59
             |||||||||||    ||| || ||| |  || | ||||||||||| | ||| ||||| ||
Sbjct  3452  ATGAACTTTCGCGCGGTCTTCGTCG-CTGCGATGGCTTCGCTTGCTGTAGCGCAGGCCCA  3394

Query  60    AGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGA  119
             |||||||||||||||||||||||| || |||||||||||| | |||||||| || ||  |
Sbjct  3393  AGTCATCGGCCACGACCAGGTTCGACCGTTCCCGCAGCCAGACCCCGTCACGGTTTCTCA  3334

Query  120   CAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCC  179
              ||| | || || || || || || ||||| || || | || ||| || |||||||||||
Sbjct  3333  AAAGACGGCCGTCAAATTCAAGCCCCAGCTCAAGATTGACGCCGGATGCCACCCGTACCC  3274

Query  180   TGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGG  239
              ||||| || ||||| |||||||| | ||| || ||||||||||| || || ||||||||
Sbjct  3273  CGCCGTCCAAAAGGACGGCTCCATGAGCGGCGGACTCAAGTGGAGCGGCCCTCAGGACGG  3214

Query  240   CGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGA  299
              || ||||||||||||| ||| |||||||||||||||||||| || |||||||| |||||
Sbjct  3213  AGAGTGCACAGGCTCGAGGCTGGGCTCTCAGATCTACGCTCGTTCGGCGTGGGTCAATGA  3154

Query  300   CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGG---CAGTCCCTCT  356
             ||| ||||||||||||||||| |||||||||||||||||| |||  |   |||||||   
Sbjct  3153  CGTCTGGGCCATCATGTACGCTTGGTATTTCCCGAAAGGCCGAGCAGCCACAGTCCC---  3097

Query  357   TCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGAT  416
              ||   | ||   ||  ||||||| ||||| || ||||||||||||||| | || |||||
Sbjct  3096  CCCGGATTTCCTTCGGTTTTTCGGCCACCGCCACAACTGGGAGTACGTCGTCGTTTGGAT  3037

Query  417   CGACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGG  476
              |||||||||     | | ||| | ||| |||| || || || ||||| ||     ||||
Sbjct  3036  TGACAACCCCGGTCTCGAGAACGCCACCGTTCTAGGTGTGTCAATGTCTGCAAGTATCGG  2977

Query  477   GTACGCTAGCCAGACGCCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGA  536
             |||| | |  ||| | ||| | || | || ||||||||| ||   |||||| ||| | | 
Sbjct  2976  GTACTCGAAGCAGGCTCCCACGGACGTGAAGTATGTGGACGGAACCAGTGTGAAGGTTGC  2917

Query  537   GTACTACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGA  596
              |||||||||||||| ||| | |||| |||  ||||||||||||| |||||||| || ||
Sbjct  2916  ATACTACTACAACCACCTCCTGGGCAACACGGCCCTGCAGCTCACCGAAGACACCGGCGA  2857

Query  597   ATTCCAGGACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCA  656
              |||||||||||||||  ||||||| | || ||||  ||||| || |||||| |||||||
Sbjct  2856  GTTCCAGGACCTCATTCAATGGGACCAGCTTTCGAGCCTGGCGCGGTACTCTTTGAACCA  2797

Query  657   CACAGACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGG  716
             ||| ||||||||| ||||| |||||| |||||| || |||||||||||||||||||| ||
Sbjct  2796  CACGGACTGGGACCAGACTTTGTTCGGCTTGGCGGGACTCAAGATGCCGCTGAAGGATGG  2737

Query  717   GGTGTTCCAGGAGCTACTAGACAAGGCATGGCCGTTTTAG  756
              || ||  ||||||| || || ||| | |||||||| |||
Sbjct  2736  CGTATTTGAGGAGCTGCTCGATAAGACGTGGCCGTTCTAG  2697

 Score = 119 bits (131),  Expect = 2e-24
 Identities = 132/175 (75%), Gaps = 1/175 (1%)
 Strand=Plus/Minus

Query  127  GCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTT  186
            || || || || || || ||||| || |  | |||||| || ||||||||||| |||| |
Sbjct  966  GCCGTCAAATTCAAGCCCCAGCTCAAGACTGACGACGGATGCCACCCGTACCCCGCCGCT  907

Query  187  CAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGC  246
            || ||| | |||||||| | ||| |  ||||| || || || || |||   || || |||
Sbjct  906  CAAAAG-ACGGCTCCATGAGCGGCGAACTCAAATGAAGCGGCCCTCAGTTTGGAGAGTGC  848

Query  247  ACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACG  301
            |||| ||||| ||| |||||||||||||| ||||| ||   ||||||  ||||||
Sbjct  847  ACAGACTCGAGGCTGGGCTCTCAGATCTAAGCTCGTTCGATGTGGGTCGATGACG  793

>PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_98.1_contig_1:1:103693:1 
REF
Length=103693

 Score = 337 bits (373),  Expect = 4e-90
 Identities = 501/702 (71%), Gaps = 14/702 (2%)
 Strand=Plus/Minus

Query  62     TCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACA  121
              ||||||||||| ||  ||| ||||| ||  |||||||  ||||||||||| |||| || |
Sbjct  65785  TCATCGGCCACAACTTGGTGCGGCCCTTTGCGCAGCCTGAGCCCGTCACCATCTCGGAAA  65726

Query  122    AGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTG  181
              | || ||  | ||||| ||||| ||||| |||||| | ||||| || |||||||||||||
Sbjct  65725  AAGCGGCCATCAAGTTCAAACCCCAGCTCAAAATCTCGGACGGATGCCACCCGTACCCTG  65666

Query  182    CCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCG  241
              | ||||| || |||||  |  ||| ||| |||||||| ||||||||  ||||||| || |
Sbjct  65665  CAGTTCAAAAAGATGGTGCAGTTAGCGGCGGTCTCAAATGGAGTGGCTCGCAGGATGGAG  65606

Query  242    AATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACG  301
              | |||   || ||  || | || |||||| ||||| |||| ||||| ||||| || ||||
Sbjct  65605  AGTGCGGGGGTTCAGAGTTAGGTTCTCAGGTCTACTCTCGTTCCGCTTGGGTCAACGACG  65546

Query  302    TGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTC  361
              | ||||||||||||||||| ||||| || || |||||  |  | |||| | |||  || |
Sbjct  65545  TCTGGGCCATCATGTACGCTTGGTACTTTCC-AAAGG--GCCGCGCAGCCACTCCACCGC  65489

Query  362    TTATC--AC-CCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCG  418
               | ||  ||  || ||||| || || || || |||||||||||||  ||||| ||||| |
Sbjct  65488  CTCTCCTACTTCGGCTTTTTGGTCATCGCCACAACTGGGAGTACGCTATTGTTTGGATTG  65429

Query  419    ACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGT  478
              |||||||||| | | | ||| ||||  |  | ||  | || ||||| ||    || || |
Sbjct  65428  ACAACCCCAACAACGAGAACGCGACTGTGTTGGGTTTGTCCATGTCTGCGAGCGTTGGTT  65369

Query  479    ACGCTAGCCAGACGCCCCCTGAAGCGATGTATGTGGATGGCGA---CAGTGTCAAGCTCG  535
              |||  | |||    || || || ||||  ||  |     ||||    || || ||  |||
Sbjct  65368  ACGAGAACCAAGTCCCACCGGAGGCGAGCTACCT---AAGCGATTCGAGCGTGAAAATCG  65312

Query  536    AGTACTACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTC-ACGGAAGACACGGGG  594
              | ||||||||||| | |||  | || | |||| | ||  || || || |||||| | || 
Sbjct  65311  ATTACTACTACAATCTTCTTGTGGGTAACACAGCACT-AAGGTCAACCGAAGACGCTGGC  65253

Query  595    GAATTCCAGGACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAAC  654
              |||||||| |||||||||   |||||  |||| ||| |  ||| |||  |  |  |||| 
Sbjct  65252  GAATTCCAAGACCTCATTCAGTGGGATCAACTATCGGACTTGGGACGGAAAGCGTTGAAT  65193

Query  655    CACACAGACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGAC  714
               |||| ||||||||||| |||||  || |   ||||    | ||||||||  |||| || 
Sbjct  65192  AACACGGACTGGGACGAAACTCTTCTCAATGCGGCAAATGTGAAGATGCCCTTGAAAGAT  65133

Query  715    GGGGTGTTCCAGGAGCTACTAGACAAGGCATGGCCGTTTTAG  756
              || |||||   | ||   || ||   ||| ||||| ||||||
Sbjct  65132  GGCGTGTTTAGGAAGACGCTCGATCGGGCCTGGCCATTTTAG  65091

 Score = 241 bits (266),  Expect = 2e-61
 Identities = 485/711 (68%), Gaps = 24/711 (3%)
 Strand=Plus/Minus

Query  52     CAGGCTCAAGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACC  111
              |||||| |   ||||  |||| || |||| | ||| ||   ||||||  | |||||||||
Sbjct  64619  CAGGCTGATACCATC--CCAC-ACGAGGTGCAGCCTTTTGTGCAGCCGGATCCCGTCACC  64563

Query  112    GTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCAC  171
              |||||||| || || || || ||||| ||||| ||||| |||||| | ||| | || |||
Sbjct  64562  GTCTCCGAGAAAGCGGCCGTCAAGTTCAAACCCCAGCTCAAAATCTCGGACAGCTGCCAC  64503

Query  172    CCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGT-GGACC  230
              || || |||||||| ||   |||||| || |||| ||| || |||||||||| |   | |
Sbjct  64502  CCATATCCTGCCGTCCAAGCGGATGGTTCGATTAGCGGTGGCCTCAAGTGGACTCTCATC  64443

Query  231    G--CAGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCG  288
              |  |||  | |  | |||  ||||||   | | ||||| ||||||||| | || ||||| 
Sbjct  64442  GGCCAGAGCAGTTAGTGCGAAGGCTCCTCGTTAGGCTCCCAGATCTACTCCCGTTCCGCC  64383

Query  289    TGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCA  348
              |||   |||||||| || || ||||||||||| ||||||||||| |||||  |  |   |
Sbjct  64382  TGGCACAATGACGTCTGAGCTATCATGTACGCATGGTATTTCCC-AAAGG--GTCGTAAA  64326

Query  349    GTCCCTCTTCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATT  408
               |  |      |       |  |||||   || ||||| || |||||||||||||  || 
Sbjct  64325  ATAACCGGAGGT------GCTGGTCTT---GGCCACCGCCACAACTGGGAGTACGCTATC  64275

Query  409    GTGTGGATCGACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCT  468
              || ||||| |||||||||     | | |||||||||||  | || || || ||||| || 
Sbjct  64274  GTCTGGATTGACAACCCCGCTCTCGACAACTCGACCATCTTGGGTGTGTCAATGTCCGCA  64215

Query  469    GCAGTCGGGTACGCTAGCCAGA---CGCCCCCTGAAGCGATGTATGTGGATGGCGACAGT  525
               |  |||| |||   ||| |||   | || ||  |||| | | | |||||||||  ||| 
Sbjct  64214  TCTTTCGGTTAC---AGCAAGAGTTCACCTCCGAAAGCAAAGCACGTGGATGGCTCCAGC  64158

Query  526    GTCAAGCTCGAGTACTACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAA  585
              || || ||||| |||||||||| |  | ||   ||||  ||| | || | |  ||| || 
Sbjct  64157  GTGAAACTCGACTACTACTACAGCGTTATCCGCGGCAATACAGCGCTACGGTACACCGAG  64098

Query  586    GACACGGGGGAATTCCAGGACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATAC  645
              |||   || ||   ||||||||| || || |||||  | ||  ||    |||| |   ||
Sbjct  64097  GACGTCGGCGAGACCCAGGACCTTATCACGTGGGATCAGCTGCCGGTAGTGGCTCAGGAC  64038

Query  646    TCTCTGAACCACACAGACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCG  705
               | |||||  | || |||||||||   |||||||   || ||   | | |||||||||| 
Sbjct  64037  GCACTGAATAATACGGACTGGGACACAACTCTGTGGAACATGTGCGACGTCAAGATGCCT  63978

Query  706    CTGAAGGACGGGGTGTTCCAGGAGCTACTAGACAAGGCATGGCCGTTTTAG  756
               | |||||||| | |||   | ||      || ||||| ||||| ||||||
Sbjct  63977  TTAAAGGACGGAGAGTTTACGAAGAAGTGTGAAAAGGCCTGGCCCTTTTAG  63927

>PHRA:scaffold_51
Length=360848

 Score = 307 bits (340),  Expect = 2e-81
 Identities = 517/747 (69%), Gaps = 11/747 (1%)
 Strand=Plus/Plus

Query  1       ATGAACTTTCGGATCGTCCTCCTCGTCCTCGTCGCTTCGCTTGCAGGAGCCCAGGCTCAA  60
               ||||| || ||   ||||||| |||   |||| || || ||||| |  | ||| ||| ||
Sbjct  201626  ATGAATTTCCGCGCCGTCCTCATCGCTGTCGTTGCGTCTCTTGCTGCCGTCCACGCTGAA  201685

Query  61      G---------TCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACC  111
                         |||||   ||||||   ||   ||||||  ||||||| |  ||    || 
Sbjct  201686  CGCACCATCATCATCCCGCACGACACCGTCGAGCCATTTGCGCAGCCCAGACCGAAGACT  201745

Query  112     GTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCAC  171
               | | |||| || || || || ||||  ||||| | |||     | |  |||||||| |||
Sbjct  201746  GACGCCGAAAAAGCCGCCGTCAAGTACAAACCCCGGCTATTGGTTGAGGACGGGTGCCAC  201805

Query  172     CCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCG  231
               |||||| |||||||||||   |||||  |||||| ||| || ||  ||||||| || |||
Sbjct  201806  CCGTACGCTGCCGTTCAGGCTGATGGAGCCATTAGCGGTGGCCTTGAGTGGAGCGGCCCG  201865

Query  232     CAGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGG  291
               || || || ||||||  ||| ||   | | ||||||||  ||||||||||||    |  |
Sbjct  201866  CAAGATGGAGAATGCCGAGGGTCCCCGTTGGGCTCTCAAGTCTACGCTCGCTGGATGAAG  201925

Query  292     GTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTC  351
               || || ||||||||||||||||||||||||||||| ||||| || ||  |||   |  | 
Sbjct  201926  GTCAAGGACGTGTGGGCCATCATGTACGCCTGGTACTTCCCCAAGGGACGAGCTCCGTTG  201985

Query  352     CCTCTTCCTCTTATCAC-CCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGT  410
               ||  |||| | | ||||  ||  ||||||| |||||  |    ||||||||||   ||||
Sbjct  201986  CCGGTTCC-CCTCTCACTTCGCTTTTTCGGCCACCGCAACGGATGGGAGTACGCAGTTGT  202044

Query  411     GTGGATCGACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGC  470
               |||| |||||||||  ||   ||||||||||||| |||| | |   ||  | || |||||
Sbjct  202045  GTGGCTCGACAACCTGAATGCCAAAAACTCGACCGTTCTGGCCACGTCCTTATCTGCTGC  202104

Query  471     AGTCGGGTACGCTAGCCAGACGCCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAA  530
                || || |   | |   || | || ||  | | || |||  | || ||    ||| | | 
Sbjct  202105  TGTGGGCTGGTCAAAAGAGGCCCCGCCCAAGGAGAAGTACTTTGACGGAACGAGTCTGAT  202164

Query  531     GCTCGAGTACTACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACAC  590
               | ||  |||||||||||||||  |||| || | |||  |  |  ||  |||||| ||| |
Sbjct  202165  GGTCTCGTACTACTACAACCACATCTTTGGTAACACGGCGGTCAAGTACACGGAGGACGC  202224

Query  591     GGGGGAATTCCAGGACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCT  650
                |||||||| |||  |||||| ||||||||  | ||| || | ||||||||  |  | ||
Sbjct  202225  TGGGGAATTTCAGCCCCTCATCACATGGGATCAGCTCCCGGACCTGGCACGTAAAGCGCT  202284

Query  651     GAACCACACAGACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAA  710
               |||| |||| || |||||||  |||| ||   || ||||  || ||||||||||| ||||
Sbjct  202285  GAACAACACGGATTGGGACGCAACTCCGTCTAACGTGGCTCGCGTCAAGATGCCGATGAA  202344

Query  711     GGACGGGGTGTTCCAGGAGCTACTAGA  737
               |||||| ||||||  ||||  ||| ||
Sbjct  202345  GGACGGCGTGTTCTTGGAGAAACTCGA  202371

>PHPA:scaffold_10 NW_008648996.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.10, whole genome shotgun 
sequence
Length=1634506

 Score = 285 bits (315),  Expect = 2e-74
 Identities = 463/665 (70%), Gaps = 20/665 (3%)
 Strand=Plus/Minus

Query  61       GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGAC  120
                ||||||   |||| | ||||||| || || || || | ||  ||||||||||   || | 
Sbjct  1455324  GTCATCCTGCACGGCGAGGTTCGACCGTTTCCACAACAAATCCCCGTCACCGATGCCCAA  1455265

Query  121      AAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCT  180
                ||||| |   | || |  || || || || || || |  ||||| |||||||||||||| 
Sbjct  1455264  AAGGCTGTTCTCAACTACAAGCCCCAACTCAAGATTGAGGACGGTTGTCACCCGTACCCG  1455205

Query  181      GCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC  240
                || || |||||||||||| | | ||  || |||||||  ||||||||  | || ||||||
Sbjct  1455204  GCAGTCCAGAAGGATGGCGCTACTAGTGGTGGTCTCAGTTGGAGTGGTTCTCAAGACGGC  1455145

Query  241      GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
                ||||||| ||| | ||        |||||  ||||||||||  |  ||||||| || |||
Sbjct  1455144  GAATGCAAAGGTTGGA-------TTCTCAAGTCTACGCTCGGACAACGTGGGTCAAGGAC  1455092

Query  301      GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCT  360
                  ||||||||||||||||||||||| ||||||  |||||    |  | || ||   ||||
Sbjct  1455091  AAGTGGGCCATCATGTACGCCTGGTTTTTCCC-TAAGGCGCGTGCTCCGTTCCCGGTCCT  1455033

Query  361      CTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGAC  420
                         ||| |  |||| ||||| ||   |||||| |||| ||| |||||| | |||
Sbjct  1455032  --------TCGTTTCCTCGGCCACCGCCACGGCTGGGAATACGCCATCGTGTGGCTAGAC  1454981

Query  421      AACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTAC  480
                || |||||     | ||||| |||||||| ||||| ||  | || |||||||  || |  
Sbjct  1454980  AAACCCAACGCTGATAACTCAACCATTCTCGGCGTGTCCGTATCAGCTGCAGCTGGTTGG  1454921

Query  481      GCTAGCCAGACGCCC--CCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGAGT  538
                ||  |  ||| ||||  ||    | || |||  |||||||| ||||  | ||| | |  |
Sbjct  1454920  GC--GAAAGAAGCCCCTCCGCCGGAGAAGTACCTGGATGGCAACAGCTTGAAGGTGGCCT  1454863

Query  539      ACTACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAAT  598
                |||||||||||||  |||  |||| |||  |  || ||  ||| || || || || || |
Sbjct  1454862  ACTACTACAACCACATCTACGGCAACACCGCGGTGAAGTACACCGACGAGACAGGCGAGT  1454803

Query  599      TCCAGGACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCACA  658
                | || |||||||| || ||| || | |||||| | || || ||    | ||| ||| | |
Sbjct  1454802  TTCAAGACCTCATCACTTGGAACCAGCTCTCGGATCTCGCCCGGAGTTATCTAAACAATA  1454743

Query  659      CAGACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGGGG  718
                |||| ||||| ||||| | | || |   ||||   || ||||||||| ||||||| || |
Sbjct  1454742  CAGATTGGGATGAGACGCCGCTCAATGCGGCACTACTTAAGATGCCGATGAAGGATGGCG  1454683

Query  719      TGTTC  723
                |||||
Sbjct  1454682  TGTTC  1454678

>PHKE:scaffold_28 scf_22126_28.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_28.1:1:184739:1 
REF
Length=184739

 Score = 224 bits (247),  Expect = 6e-56
 Identities = 437/638 (68%), Gaps = 6/638 (1%)
 Strand=Plus/Plus

Query  95      AGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAA  154
               ||||  | ||||| ||||||||||| || || ||||| |||||||| || |||||| |  
Sbjct  132805  AGCCTGACCCCGTTACCGTCTCCGATAAAGCTGCAGTCAAGTTTAAGCCGCAGCTTCACC  132864

Query  155     TCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTC  214
               ||   || || || |||||||| || ||||| ||  ||||||||||  | | ||| || |
Sbjct  132865  TCAAAGAAGGCTGCCACCCGTATCCCGCCGTACAAGAGGATGGCTCAGTAAGCGGTGGAC  132924

Query  215     TCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCT  274
               | ||||||   ||   ||||| |||||| |||| |||||| ||| | ||||| ||| |||
Sbjct  132925  TGAAGTGGGCGGGCAAGCAGGGCGGCGACTGCAAAGGCTCCAAGTTGGGCTCCCAGGTCT  132984

Query  275     ACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGA  334
               ||||||||||| | ||| |   |||||| ||||||||||||||||| ||||| ||||| |
Sbjct  132985  ACGCTCGCTCCACTTGGTTTGGTGACGTATGGGCCATCATGTACGCTTGGTACTTCCCTA  133044

Query  335     AAGGCAGAGGGGCAGTCCCTCTTC-CTCTTATCACCCGTCTTTTCGGACACCGTCATAAC  393
               | ||| | |  || ||  |  | | | | || | |  |  | ||||| ||||| || |||
Sbjct  133045  AGGGCCGTGAAGCTGTTTCCATGCACCCGTA-CGCAAGGTTCTTCGGTCACCGCCACAAC  133103

Query  394     TGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAACTCGACCATTCTTGGC  453
               |||||||| |  || || |||||||||||||||       |  || || | ||  | || 
Sbjct  133104  TGGGAGTATGCTATCGTTTGGATCGACAACCCCGCTCTTGATGACCCGGCAATCTTGGGT  133163

Query  454     GTATCGATGTCGGCTGCAGTCGGGTACGCTAGCCAGACGCCCCCTGAAGCGATGTATGTG  513
               || |||||||| || ||     | |||  ||  | | | |||||    ||||  ||  | 
Sbjct  133164  GTGTCGATGTCTGCAGCTACTAGCTACAGTAAACGGGCACCCCCGATGGCGAAATACCTC  133223

Query  514     GATGGCGACAGTGTCAAGCTCGAGTACTACTACAACCATCTCTTAGGCAGCACATCCCTG  573
               || || |||||  | ||  |||| || ||   |||     |  | | ||||||  | |||
Sbjct  133224  GACGGTGACAGCTTGAAAGTCGAATATTATAGCAATGCCGTTGTCGCCAGCACGGCGCTG  133283

Query  574     CAGCTCACGGAAGAC-ACGGGGGAATTCCAGGACCTCATTACATGGGACGAACTCTC-GA  631
               |   | ||  ||||| | ||| || || |||||| |  | || |||||| | ||| | ||
Sbjct  133284  CGTTTGAC-CAAGACTAAGGGCGAGTTTCAGGACTTGGTCACGTGGGACCAGCTCCCGGA  133342

Query  632     AGCTGGCACGATACTCTCTGAACCACACAGACTGGGACGAGACTCTGTTCGACTTGGCAG  691
                ||| ||| |  |  |||| | | |||| |||||||||  ||| || ||| ||   || |
Sbjct  133343  TGCT-GCAAGGAATGCTCTCATCGACACCGACTGGGACACGACACTTTTCAACACTGCGG  133401

Query  692     GCCTCAAGATGCCGCTGAAGGACGGGGTGTTCCAGGAG  729
               |    ||| | || ||||| ||||| || ||| | |||
Sbjct  133402  GAGCGAAGTTCCCTCTGAAAGACGGTGTCTTCAATGAG  133439

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 29/32 (91%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  304    TGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
              |||||||||||||||||  |||||||||| ||
Sbjct  23322  TGGGCCATCATGTACGCAAGGTATTTCCCAAA  23291

>PHCA:scaffold_44 PHYCAscaffold_44
Length=536020

 Score = 221 bits (244),  Expect = 2e-55
 Identities = 439/641 (68%), Gaps = 22/641 (3%)
 Strand=Plus/Minus

Query  121     AAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCT  180
               || || || || ||||   | || || ||| | || |  ||||| || ||||||||  ||
Sbjct  333437  AAAGCGGCCGTCAAGTACCATCCCCAACTTCACATTGAAGACGGTTGCCACCCGTATGCT  333378

Query  181     GCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC  240
               || || ||   ||||||  | |||| ||  || |||||||||||||| ||||| ||||| 
Sbjct  333377  GCTGTCCAAGCGGATGGAGCTATTAGCGACGGGCTCAAGTGGAGTGGTCCGCAAGACGGA  333318

Query  241     GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
               |  ||||  || ||   | | || |||||| |||||||||| ||  | ||||| || |  
Sbjct  333317  GCGTGCAAGGGTTCTCCGTTGGGATCTCAGGTCTACGCTCGTTCGACTTGGGTTAAGGGT  333258

Query  301     GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCT  360
                 |||||||||||||||||| ||||| ||||| |  ||   ||   | |||||||   | 
Sbjct  333257  AAGTGGGCCATCATGTACGCTTGGTACTTCCCTATGGGTCAAGCCCCGGTCCCTC---CC  333201

Query  361     CTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGAC  420
                ||       | |||   ||||| ||  ||  ||||||||||| | || | ||| | |||
Sbjct  333200  GTTG------GACTT---GGACATCGCAATGGCTGGGAGTACGCCGTTATCTGGCTGGAC  333150

Query  421     AACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTAC  480
                 ||| |    | | ||||||||| |||| ||||| ||  |||| ||||| || || |  
Sbjct  333149  CGCCCTACTGCCGACAACTCGACCCTTCTGGGCGTTTCCTTGTCTGCTGCTGTGGGATGG  333090

Query  481     GCTAGCCAGACGCCCCCTG--AAGC-GATGTATGTGGATGGCGACAGTGTCAAGCTCGAG  537
                | |   ||  | ||||||  |||| ||  |   |||| ||  ||||| ||||| ||  |
Sbjct  333089  TCGA---AGGAGGCCCCTGCAAAGCAGAAATGGATGGACGGAAACAGTCTCAAGGTCTCG  333033

Query  538     TACTACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAA  597
               |||||||||||  |  ||||  ||| |||  |  |  ||  |||||| || |  || |||
Sbjct  333032  TACTACTACAATAACATCTTCCGCAACACTGCAGTCAAGTACACGGAGGAGAAAGGTGAA  332973

Query  598     TTCCAGGACCTCATTACATGGGACGAACTCTC-GAAGCTGGCACGATACTCTCTGAACCA  656
               ||||||   |||||||| |||||| | ||| | || || | | ||| || |||| |   |
Sbjct  332972  TTCCAGACGCTCATTACGTGGGACCAGCTCCCAGACGCCG-CTCGAAACGCTCTCATTAA  332914

Query  657     CACAGACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGG  716
                || ||||||||||| ||||  ||| || ||||  || |||| |||||  ||||||||||
Sbjct  332913  TACGGACTGGGACGAAACTCCATTCAACGTGGCTCGCGTCAAAATGCCTATGAAGGACGG  332854

Query  717     GGTGTTCCAGGAGCTACTAGACAAG-GCATGGCCGTTTTAG  756
                || |||  ||||  |||  ||| | || |  |||||||||
Sbjct  332853  TGTCTTCATGGAGAAACT-CACAGGAGCGTACCCGTTTTAG  332814

 Score = 212 bits (234),  Expect = 1e-52
 Identities = 438/641 (68%), Gaps = 22/641 (3%)
 Strand=Plus/Plus

Query  121     AAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCT  180
               || || || || ||||   | || || ||| | || |  ||||| || ||||||||  ||
Sbjct  339810  AAAGCGGCCGTCAAGTACCATCCCCAACTTCACATTGAAGACGGTTGCCACCCGTATGCT  339869

Query  181     GCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC  240
               ||||| ||   ||||||  |||||| ||  || ||||||||||| || ||||| ||||| 
Sbjct  339870  GCCGTCCAAGCGGATGGAGCCATTAGCGACGGGCTCAAGTGGAGCGGTCCGCATGACGGA  339929

Query  241     GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
               |  ||||  || ||     | || |||||| |||||||||| ||  | ||||| || | |
Sbjct  339930  GCGTGCAAGGGTTCTCCATTGGGATCTCAGGTCTACGCTCGTTCGACTTGGGTTAAGGGC  339989

Query  301     GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCT  360
                 |||||||||||||||||| ||||| ||||| |  ||   ||   | |||||||  || 
Sbjct  339990  AAGTGGGCCATCATGTACGCTTGGTACTTCCCTATGGGTCAAGCCCCGGTCCCTC--CCG  340047

Query  361     CTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGAC  420
                |        | |||   ||||| ||  ||  ||||||||||| | |  | ||| | |||
Sbjct  340048  TT-------GGACTT---GGACATCGCAATGGCTGGGAGTACGCCGTCATCTGGCTGGAC  340097

Query  421     AACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTAC  480
                 ||| |    | | ||||||||| |||| ||||| ||  |||| ||||| ||  || | 
Sbjct  340098  CGCCCTACTGCCGACAACTCGACCCTTCTGGGCGTTTCCTTGTCTGCTGCTGT--GGGAT  340155

Query  481     GCTAGCCAGACGCCCCCTG--AAGC-GATGTATGTGGATGGCGACAGTGTCAAGCTCGAG  537
               | | |  ||  | ||||||  |||| ||  |   |||| ||  ||||| ||||| ||  |
Sbjct  340156  GGTCG-AAGGAGGCCCCTGCAAAGCAGAAATGGATGGACGGAAACAGTCTCAAGGTCTCG  340214

Query  538     TACTACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAA  597
               |||||||||||  |  ||||   || |||  |  |  ||  |||||| || |  || |||
Sbjct  340215  TACTACTACAATAACATCTTCCACAACACTGCAGTCAAGTACACGGAGGAGAAAGGTGAA  340274

Query  598     TTCCAGGACCTCATTACATGGGACGAACTCTC-GAAGCTGGCACGATACTCTCTGAACCA  656
               ||||||   |||||||| |||||| | ||| | || ||  || ||| || |||| |   |
Sbjct  340275  TTCCAGACGCTCATTACGTGGGACCAGCTCCCAGACGC-CGCTCGAAACGCTCTCATTAA  340333

Query  657     CACAGACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGG  716
                || ||||||||||| ||||  ||| || ||||  || | || |||||  ||||||||||
Sbjct  340334  TACGGACTGGGACGAAACTCCATTCAACGTGGCCCGCGTAAAAATGCCTATGAAGGACGG  340393

Query  717     GGTGTTCCAGGAGCTACTAGACAAG-GCATGGCCGTTTTAG  756
                || |||  ||||  |||  ||| | || |  |||||||||
Sbjct  340394  TGTCTTCATGGAGAAACT-CACAGGAGCTTACCCGTTTTAG  340433

>PHSO:scaffold_4
Length=7609242

 Score = 214 bits (237),  Expect = 3e-53
 Identities = 492/737 (67%), Gaps = 28/737 (4%)
 Strand=Plus/Plus

Query  1        ATGAACTTTCGGATCGTCCTCCTCGTCCTCGTCGCTTCGCTTGCAGGAGCCCAGGCT--C  58
                |||||||| ||   ||||||| |||   |||| || ||  | || |  ||||| ||   |
Sbjct  4632913  ATGAACTTCCGCGCCGTCCTCATCGCTGTCGTGGCGTCTTTCGCCGCTGCCCAAGCCGGC  4632972

Query  59       AA-GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCC  117
                || || |||    ||||| |||| |  |||||| |||||||   ||||||||| | |   
Sbjct  4632973  AACGTGATCCCTTACGACGAGGTGCACCCATTCGCGCAGCCTGCGCCCGTCACGGACCTT  4633032

Query  118      GACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTAC  177
                 ||||| |     | ||||  || || || || ||||||   || ||||| |||||||||
Sbjct  4633033  CACAAGACCATGCTCAAGTACAAGCCCCACCTGAAAATCAAGGAGGGGTGCCACCCGTAC  4633092

Query  178      CCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGAC  237
                |||||||| |||||| | ||   ||| | ||| || ||| |||||||  | ||   ||||
Sbjct  4633093  CCTGCCGTCCAGAAGAACGGAGACATCAGCGGCGGCCTCGAGTGGAGCAGCCCCACGGAC  4633152

Query  238      ---GGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
                   | ||| || |  |||||    || ||||| ||| ||||||| || ||  ||||||| 
Sbjct  4633153  AATGCCGAGTGTAAGGGCTCCCCTCTGGGCTCGCAGGTCTACGCGCGTTCGTCGTGGGTC  4633212

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCT  354
                || | |   |  |||||||||||||||||||| |||||        || |||  || |  
Sbjct  4633213  AAGGGCAAATTCGCCATCATGTACGCCTGGTACTTCCC--------GATGGGTCGTGC--  4633262

Query  355      CTTCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGG  414
                  ||| ||      || ||  ||||| |||||  ||   |||||||||| ||| ||||||
Sbjct  4633263  --TCCGCT------CCTTCCCTTCGGCCACCGCAATGGTTGGGAGTACGCCATCGTGTGG  4633314

Query  415      ATCGACAACCCCAAGAGCAAAAACTCGACCATTCTTGG--CGTATCGATGTCGGCTGCAG  472
                 | |||| |     |  ||  |||||||| ||||| ||  ||| ||  |||||||||| |
Sbjct  4633315  CTGGACAGCGTGTCGTCCACGAACTCGACTATTCTGGGGACGTCTC--TGTCGGCTGCTG  4633372

Query  473      TCGGGTACGCTAGCCAGACGCCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGC  532
                | || |  || |   ||  ||| |   |   || |||  |||| ||  |||   ||||| 
Sbjct  4633373  TGGGCTGGGCGAAGGAGGTGCCTCGCAACAGGAAGTACCTGGACGGAAACAACCTCAAGG  4633432

Query  533      TCGAGTACTACTACAACCATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGG  592
                ||| |||||||| |||||    | |  || ||||  || |  ||  |||||| || |  |
Sbjct  4633433  TCGCGTACTACTTCAACCGCGACGTGCGCTGCACGGCCGTCGAGTACACGGAGGAAATCG  4633492

Query  593      GGGAATTCCAGGACCTCATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGA  652
                | || ||||||||| |||| || |||||| | ||  ||   | | | ||  | || || |
Sbjct  4633493  GCGAGTTCCAGGACGTCATCACTTGGGACCAGCTGCCGGCACCGACTCGCGATTCGCTCA  4633552

Query  653      ACCACACAGACTGGGACGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGG  712
                   |||| ||||||||| | || | |||  || ||||    || ||||||||  ||||||
Sbjct  4633553  GTAACACGGACTGGGACCACACGCCGTTTAACGTGGCGCTGCTGAAGATGCCCATGAAGG  4633612

Query  713      ACGGGGTGTTCCAGGAG  729
                |||| || |||||||||
Sbjct  4633613  ACGGCGTCTTCCAGGAG  4633629

 Score = 95.1 bits (104),  Expect = 2e-17
 Identities = 184/272 (68%), Gaps = 0/272 (0%)
 Strand=Plus/Minus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                |||| ||||||| |||| | ||| ||  |||||||  |||| |||||||| ||||| || 
Sbjct  5852680  ATCGACCACGACAAGGTACAGCCGTTTGCGCAGCCCGAGCCAGTCACCGTGTCCGAGAAA  5852621

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                 | || ||||| || |||||    ||  | |||| || ||| || |||||||||||||| 
Sbjct  5852620  ACCGCTGTAAAATTCAAACCGAGTCTCCAGATCGTCGGCGGATGCCACCCGTACCCTGCT  5852561

Query  184      GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
                ||  |    |  ||    |  | ||  || || ||  | || |||||  | ||||| |||
Sbjct  5852560  GTCAACGCTGCGGGTGAAACGAGCGCGGGGCTAAAAGGAAGAGGACCTAAAGACGGGGAA  5852501

Query  244      TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
                ||||  || ||    |||||||| ||  | || |  ||  |    |||   || ||  | 
Sbjct  5852500  TGCAAGGGGTCCGCTCTCGGCTCGCAAGTGTATGGACGAGCTATATGGTACAAGGATCTC  5852441

Query  304      TGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                ||||||||| |||||| |||||| ||||| ||
Sbjct  5852440  TGGGCCATCGTGTACGGCTGGTACTTCCCCAA  5852409

 Score = 86.0 bits (94),  Expect = 1e-14
 Identities = 92/122 (75%), Gaps = 0/122 (0%)
 Strand=Plus/Minus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                |||| ||||||| |||| | ||| ||  |||||||  |||| |||||||| ||||| || 
Sbjct  6046797  ATCGACCACGACAAGGTACAGCCGTTTGCGCAGCCCGAGCCAGTCACCGTGTCCGAGAAA  6046738

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                 | || ||||| || |||||    ||  | ||||  ||||| || |||||||||||||| 
Sbjct  6046737  ACCGCTGTAAAATTCAAACCGAGTCTCCACATCGTTGACGGATGCCACCCGTACCCTGCT  6046678

Query  184      GT  185
                ||
Sbjct  6046677  GT  6046676

>PHIF:NW_003303744.1 Phytophthora infestans T30-4 supercont1.15 
genomic scaffold, whole genome shotgun sequence
Length=3093265

 Score = 204 bits (225),  Expect = 6e-50
 Identities = 403/592 (68%), Gaps = 11/592 (2%)
 Strand=Plus/Plus

Query  139      AAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGC  198
                || || || |||||  | |  || || |||||||||||||| || || |||| | | || 
Sbjct  2217997  AAGCCTCAACTTAAGGTTGAGGAGGGATGTCACCCGTACCCCGCAGTCCAGAGGAACGGT  2218056

Query  199      TCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGAAG  258
                  ||||| | | |||||||  |||||||| ||  |||||  || |||||  ||||||   
Sbjct  2218057  GACATTAGCAGCGGTCTCAGATGGAGTGGTCCCGAGGACATCGGATGCAAGGGCTCGTCT  2218116

Query  259      CTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTAC  318
                 | |||||||| ||||||||||||||    | | | || |||  ||||||  ||||||||
Sbjct  2218117  TTGGGCTCTCAAATCTACGCTCGCTCAAAATTGTTCAAGGACAAGTGGGCTGTCATGTAC  2218176

Query  319      GCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCACCCGTCTTTTC  378
                 | ||||| || ||||| ||| | |   |  ||||   ||    || | | | ||    |
Sbjct  2218177  ACTTGGTACTTTCCGAAGGGCCGTGCACCGATCCCGGGTC----TA-CGCTCCTC----C  2218227

Query  379      GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAA-  437
                || ||||| ||   |||||| ||||   | |||||| | ||||  | | |  ||||| | 
Sbjct  2218228  GGCCACCGCCACGGCTGGGAATACGCAGTCGTGTGGCTGGACAGACTCGAC-GCAAACAG  2218286

Query  438      CTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTACGCTAGCCAGACGCCCCC  497
                |||||| || || |||   ||  |||||||||| || || |  || |   || | ||  |
Sbjct  2218287  CTCGACTATCCTGGGCACGTCTCTGTCGGCTGCTGTTGGTTGGGCGAAGGAGTCCCCTAC  2218346

Query  498      TGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGAGTACTACTACAACCATCTCTT  557
                |  |  |  |||  |||||||  ||||| | ||| ||| ||||||||  ||| |    ||
Sbjct  2218347  TCCAAAGGAGTACCTGGATGGTCACAGTTTGAAGGTCGCGTACTACTTTAACGACGATTT  2218406

Query  558      AGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAATTCCAGGACCTCATTACATG  617
                  ||| |||  || || ||  |||  | ||    || |  ||||| ||||||||   |||
Sbjct  2218407  CAGCAACACCGCCGTGAAGTACACACAGGATGGTGGTGCGTTCCAAGACCTCATCCAATG  2218466

Query  618      GGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCACACAGACTGGGACGAGACTCT  677
                |||| |||||||| | |  || ||   |||||||| | ||||||| ||||||||||| ||
Sbjct  2218467  GGACCAACTCTCGGACCCCGCTCGGGCCTCTCTGATCAACACAGATTGGGACGAGACGCT  2218526

Query  678      GTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGGGGTGTTCCAGGAG  729
                 ||  |  ||||  |  | ||||||||| ||||||| || |||||| |||||
Sbjct  2218527  TTTTAATGTGGCTCGTGTGAAGATGCCGATGAAGGATGGCGTGTTCGAGGAG  2218578

>PHPA:scaffold_59 NW_008649045.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.59, whole genome shotgun 
sequence
Length=367746

 Score = 178 bits (197),  Expect = 2e-42
 Identities = 403/601 (67%), Gaps = 20/601 (3%)
 Strand=Plus/Minus

Query  133     AAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAG  192
               ||||  ||||| || ||||||||||  || || || ||||||||||| || || ||||||
Sbjct  307179  AAGTACAAACCGCAACTTAAAATCGAGGAGGGATGCCACCCGTACCCAGCAGTCCAGAAG  307120

Query  193     GATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGGC  252
               || || |||||||   | ||||| ||||||||||| ||  |  ||   | |||||  |||
Sbjct  307119  GACGGTTCCATTAGTAGCGGTCTTAAGTGGAGTGGTCCAGACAACATTGGATGCAAGGGC  307060

Query  253     TCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATC  312
               ||     | || |||||  |||| |||||  |  ||||| |||| | |  ||||||| | 
Sbjct  307059  TCACCTTTGGGTTCTCAAGTCTATGCTCGTGCAACGTGGTTGAAAGGCAAGTGGGCCGTA  307000

Query  313     ATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCACCCGT  372
               |||||||| ||||| ||||| || ||| ||| | || |||  |  ||      ||| | |
Sbjct  306999  ATGTACGCTTGGTACTTCCCCAAGGGCCGAGCGCCAATCC--CGGCC-----CCACGC-T  306948

Query  373     CTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGC  432
               |  | ||||||||| |||  |||||||||||   | |||||| | |||||  ||   |||
Sbjct  306947  C-GTACGGACACCGCCATGGCTGGGAGTACGCGGTCGTGTGGCTGGACAAAGCC---AGC  306892

Query  433     AAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTACGCTAGCCAGACG  492
                  || || ||| ||||||||   || ||||| || ||  |||| |  || |   |  | 
Sbjct  306891  GCCAATTCCACCCTTCTTGGCACTTCCATGTCAGCAGCCATCGGATGGGCGAAGGAATCC  306832

Query  493     CCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGAGTACTACTACAACCA-  551
               ||  ||  |  |   ||  | |||||  ||||| | ||| | | |||||||| |||| | 
Sbjct  306831  CCTACTCCAAAGGAATACCTCGATGGTAACAGTTTGAAGGTTGCGTACTACTTCAACGAC  306772

Query  552     ---TCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAATTCCAGGACCT  608
                  ||| |    || |||  |  |  ||  |||  | ||| | || || ||||| |||||
Sbjct  306771  GATTCTAT----CAACACCGCGGTCAAGTACACTCAGGACGCTGGTGAGTTCCAAGACCT  306716

Query  609     CATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCACACAGACTGGGA  668
               ||| |  |||||| | ||  || |  | || ||  |  |||||  | |||| || |||||
Sbjct  306715  CATCATCTGGGACCAGCTACCGGATGTCGCTCGGAATGCTCTGGTCAACACTGATTGGGA  306656

Query  669     CGAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGGGGTGTTCCAGGA  728
                ||||| |   |  |  ||||  |  ||||||||||| ||||||| || ||||||  |||
Sbjct  306655  TGAGACGCCTCTTAATGTGGCTCGTGTCAAGATGCCGATGAAGGATGGCGTGTTCATGGA  306596

Query  729     G  729
               |
Sbjct  306595  G  306595

>PHRA:scaffold_7
Length=787762

 Score = 164 bits (181),  Expect = 5e-38
 Identities = 373/561 (66%), Gaps = 34/561 (6%)
 Strand=Plus/Minus

Query  69      CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
               |||||||| ||| |  |||||| | ||||| |  |||||||||| |||  | ||| | ||
Sbjct  291015  CCACGACCTGGTGCAACCATTCGCTCAGCCTACCCCCGTCACCGACTCGCAGAAGTCTGC  290956

Query  129     AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
                || |||| ||| || |||||  | ||| |  |||| || |||||||||||||||||| |
Sbjct  290955  TGTCAAGTATAAGCCTCAGCTCTACATCTCGTACGGTTGCCACCCGTACCCTGCCGTTGA  290896

Query  189     GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCAC  248
               |    |||| |    || ||| |||||  |||||   || ||| | |||||||| |||| 
Sbjct  290895  GGCCAATGGTTATGCTAGCGGTGGTCTGGAGTGGTCCGGCCCGAATGACGGCGACTGCAA  290836

Query  249     AGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGC  308
                ||||| |  || ||||| ||| | ||| | ||||| |  |||    | ||   ||||||
Sbjct  290835  GGGCTCTAGTCTGGGCTCGCAGGTGTACTCGCGCTCGGACTGGTACCACGAAAAGTGGGC  290776

Query  309     CATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCAC  368
               |||||||||||||||||| ||||| || ||| ||   |  ||  ||              
Sbjct  290775  CATCATGTACGCCTGGTACTTCCCCAAGGGCCGATACGGCGTGACT--------------  290730

Query  369     CCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAA  428
                         || |||||  |  ||||||||||||  || |||||||  |||| | |   
Sbjct  290729  ----------GGCCACCGCAACTACTGGGAGTACGCTATCGTGTGGACAGACAGCACTTC  290680

Query  429     GAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTACG-CTAGCC  487
               |  | | ||||||||| | || ||||| |||||||| ||||  || ||  ||| | || |
Sbjct  290679  GCCCGACAACTCGACCCTCCTCGGCGTGTCGATGTCCGCTGGTGTTGGCCACGACAAGAC  290620

Query  488     AGACGCCCCCTGAAGC-GATGTATGTGGATGGCGACAGTGTCAAGCTCGAGTACTACTAC  546
               | || || ||  | ||  | |||  || | ||    ||||| |||||   | |||   ||
Sbjct  290619  A-ACTCCTCC-CATGCTCAAGTACATGAACGGGTCGAGTGTGAAGCT---GAACTCTCAC  290565

Query  547     AACCATCTCTTAGGCAGCA---CATCCCTGCAGCTCACGGAAGACACGGGGGAATTCCAG  603
                 |  |||  | || ||||   |  ||||| |||||||| |  |   ||| || ||||||
Sbjct  290564  TTCAGTCTGCTTGGAAGCAAGGCCGCCCTGGAGCTCACGAAGAAGGAGGGAGAGTTCCAG  290505

Query  604     GACCTCATTACATGGGACGAA  624
               |||||||| || |||||| ||
Sbjct  290504  GACCTCATCACTTGGGACCAA  290484

 Score = 152 bits (168),  Expect = 1e-34
 Identities = 288/420 (69%), Gaps = 18/420 (4%)
 Strand=Plus/Plus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               |||| |||||||   || |  || ||| | |||||| | ||   ||||| |||||| |||
Sbjct  281857  ATCGACCACGACACCGTCCAACCGTTCGCTCAGCCAGAACCTACCACCGACTCCGAGAAG  281916

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                | || || ||||| || || |||||  | ||  |  |||| ||||||||||||||||||
Sbjct  281917  ACTGCCGTCAAGTTCAAGCCGCAGCTCCACATTTCGTACGGATGTCACCCGTACCCTGCC  281976

Query  184     GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
               ||| |   | |||| ||| ||| ||  || || ||||||  |||   |   ||||| || 
Sbjct  281977  GTTAATGCGAATGGTTCCGTTAACGCGGGGCTGAAGTGGGCTGGCTGGGCCGACGGAGAC  282036

Query  244     TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
               ||||  |||||    || ||||| ||  | ||| | ||||| |  | |   || |||  |
Sbjct  282037  TGCAAGGGCTCTGGCCTGGGCTCGCAAGTGTACTCACGCTCGGACTCGTACAAGGACAAG  282096

Query  304     TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCT-CT  362
               ||||| ||||||||||||||||| ||||| || ||| ||    |||| |   ||| |   
Sbjct  282097  TGGGCTATCATGTACGCCTGGTACTTCCCCAAGGGCCGA----CAGTAC--ATTCATAAG  282150

Query  363     TATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAA  422
               ||||||       | ||| ||||| ||  |||||  ||| |  || |||||||  |||| 
Sbjct  282151  TATCAC-------TCCGGCCACCGCCACTACTGGTCGTATGGAATCGTGTGGACTGACAG  282203

Query  423     CCC--CAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTAC  480
               | |  ||   |  | |||||||||||||| || || |||||||| || |  ||||| |||
Sbjct  282204  CTCGTCACCTG--ATAACTCGACCATTCTGGGTGTGTCGATGTCTGCCGGTGTCGGCTAC  282261

 Score = 151 bits (167),  Expect = 3e-34
 Identities = 280/408 (69%), Gaps = 16/408 (4%)
 Strand=Plus/Minus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               |||| |||||||   || |  || ||| | |||||| |||||  ||||| |||||| |||
Sbjct  461500  ATCGACCACGACACCGTCCAACCGTTCGCTCAGCCAGAGCCCACCACCGACTCCGAGAAG  461441

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                | || || ||||| || || |||||  | ||  |  |||| || |||||||||||||| 
Sbjct  461440  ACTGCCGTCAAGTTCAAGCCGCAGCTCCACATTTCGTACGGATGCCACCCGTACCCTGCA  461381

Query  184     GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
               ||  |   | |||||||  ||| ||  || || ||||||  |||   | | ||||| || 
Sbjct  461380  GTAAATGCGAATGGCTCTGTTAACGCGGGACTGAAGTGGGCTGGCTGGGACGACGGAGAC  461321

Query  244     TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
               ||||  |||||   ||| ||||| ||  | ||| | ||||| |  |||   || |||   
Sbjct  461320  TGCAAGGGCTCTGGGCTGGGCTCACAAGTGTACTCGCGCTCGGACTGGTACAAGGACAAA  461261

Query  304     TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTT  363
               ||||| ||||||||||||||||| ||||| || ||| ||    ||||  | ||||  | |
Sbjct  461260  TGGGCTATCATGTACGCCTGGTACTTCCCCAAGGGCCGA----CAGT-ACACTTCTGCGT  461206

Query  364     ATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAAC  423
               | | | ||       || ||||| ||  |||||  ||| |  || |||||||  |||| |
Sbjct  461205  ACCGCACG-------GGCCACCGCCACTACTGGTCGTATGGAATCGTGTGGACTGACAGC  461153

Query  424     CC--CAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTG  469
                |  ||   |  | |||||||||||||| || || || ||||| ||||
Sbjct  461152  TCGTCACCTG--ATAACTCGACCATTCTGGGTGTGTCAATGTCCGCTG  461107

 Score = 147 bits (162),  Expect = 4e-33
 Identities = 279/408 (68%), Gaps = 16/408 (4%)
 Strand=Plus/Minus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               |||| |||||||   || | ||| ||| | |||||| ||||   ||||| |||||| || 
Sbjct  292798  ATCGACCACGACACCGTCCAGCCGTTCGCTCAGCCAGAGCCTACCACCGACTCCGAGAAA  292739

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                | || || ||||| || || |||||  | ||  |  |||| ||||||||||||||||||
Sbjct  292738  ACTGCCGTCAAGTTCAAGCCGCAGCTCCACATTTCGTACGGATGTCACCCGTACCCTGCC  292679

Query  184     GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
               ||| |   | |||||||| ||| ||  || || ||||||  |||   |   ||||| || 
Sbjct  292678  GTTGATGCGAATGGCTCCGTTAACGCGGGGCTGAAGTGGGCTGGCTGGGCCGACGGAGAC  292619

Query  244     TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
               ||||  |||||   | | ||||| ||  | ||| | ||||| |  |||   || |||  |
Sbjct  292618  TGCAAGGGCTCTGCGATGGGCTCGCAAGTGTACTCGCGCTCGGACTGGTACAAGGACAAG  292559

Query  304     TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTT  363
               ||||| ||||||||||| ||||| ||||| || ||| ||    |||| |     | ||| 
Sbjct  292558  TGGGCTATCATGTACGCTTGGTACTTCCCCAAGGGCCGA----CAGTAC----ACTTCTA  292507

Query  364     ATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAAC  423
               |  ||    | |   || ||||| ||  |||||  |||||  || |||||||  |||| |
Sbjct  292506  AGTAC----CGTGCGGGTCACCGCCACTACTGGTCGTACGGAATCGTGTGGACTGACAGC  292451

Query  424     CC--CAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTG  469
                |  ||   |  | ||||| |||||||| || || || ||||| ||||
Sbjct  292450  TCGTCACCTG--ATAACTCAACCATTCTGGGTGTGTCAATGTCTGCTG  292405

 Score = 127 bits (140),  Expect = 4e-27
 Identities = 197/279 (71%), Gaps = 2/279 (1%)
 Strand=Plus/Plus

Query  63      CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
               ||||| ||||||||| || |  |||||  |  ||||| | ||    |||| |||||| ||
Sbjct  562816  CATCGACCACGACCAAGTCCAACCATTTGCTGAGCCAGAACCGACGACCGACTCCGAGAA  562875

Query  123     GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
               ||| || || ||||| || || |||||     || || |||| ||  ||||||| || ||
Sbjct  562876  GGCCGCCGTGAAGTTCAAGCCCCAGCTCTTGGTCTCCTACGGATGCTACCCGTATCCGGC  562935

Query  183     CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACC-GCAGGACGGCG  241
               ||| ||    ||||| ||  | | ||  ||||||||| |   ||| || |||| | || |
Sbjct  562936  CGTCCAAGCTGATGGGTCAGTCAGCGCCGGTCTCAAGGGATCTGGCCCAGCAG-ATGGAG  562994

Query  242     AATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACG  301
               | ||||| ||||| |  |||||||| ||  | ||  |||| || |  |||    | ||| 
Sbjct  562995  AGTGCACGGGCTCAAGTCTCGGCTCGCAAGTGTATTCTCGTTCGGACTGGTACGAGGACA  563054

Query  302     TGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                |||||| ||||||||||| |||||| |||| |||||||
Sbjct  563055  AGTGGGCTATCATGTACGCTTGGTATCTCCCTAAAGGCA  563093

 Score = 79.7 bits (87),  Expect = 2e-12
 Identities = 260/402 (65%), Gaps = 28/402 (7%)
 Strand=Plus/Minus

Query  63      CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
               ||||| ||||||| | || |  |||||  |  ||||| | ||  | |||| ||| || ||
Sbjct  274809  CATCGACCACGACAAAGTCCAACCATTTGCTGAGCCAGAACCGATGACCGACTCGGAGAA  274750

Query  123     GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
               ||| || || ||||| || || |||||     || || |||| ||  ||||||| || ||
Sbjct  274749  GGCCGCCGTGAAGTTCAAGCCCCAGCTCTTGGTCTCCTACGGATGCTACCCGTATCCGGC  274690

Query  183     CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAG-TGGACC-GCAGGACGGC  240
               ||| ||    ||||| ||| | | ||  ||||| ||| |||  ||| || |||| | || 
Sbjct  274689  CGTCCAAGCTGATGGATCCGTCAGCGCTGGTCT-AAGGGGATCTGGTCCAGCAG-ATGGA  274632

Query  241     GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
               || ||||  || || |  |||||||| ||  | ||| |||| || |  |||    | |||
Sbjct  274631  GAGTGCAGGGGATCAAGTCTCGGCTCGCAAGTGTACTCTCGTTCGGACTGGTACGAGGAC  274572

Query  301     GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCT  360
                 |||||| ||||||||| | |||||  |||| |||||  |      ||| ||       
Sbjct  274571  AAGTGGGCTATCATGTACACTTGGTACCTCCCTAAAGGACGT-----AGTACCCGA----  274521

Query  361     CTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGAC  420
                    |||| |  |          || ||   |||||||  ||   |||| |||||||||
Sbjct  274520  -----CACCAGCGT----------CGCCACTTCTGGGAGACCGCGGTTGTCTGGATCGAC  274476

Query  421     AACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATG  462
                ||||      |   |||||||| ||||||||||| || |||
Sbjct  274475  GACCCTGCTCTCGCCAACTCGACGATTCTTGGCGTGTCAATG  274434

 Score = 75.2 bits (82),  Expect = 2e-11
 Identities = 259/402 (64%), Gaps = 28/402 (7%)
 Strand=Plus/Plus

Query  63      CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
               ||||| ||||||| | || | ||||||  |  ||||| | ||    |||| ||| || ||
Sbjct  266541  CATCGACCACGACAAAGTCCAGCCATTTGCTGAGCCAGAACCGACGACCGACTCGGAGAA  266600

Query  123     GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
               ||| || || ||||| || || |||||     || || |||| ||  |||| || || ||
Sbjct  266601  GGCCGCCGTGAAGTTCAAGCCCCAGCTCTTGGTCACCTACGGATGCTACCCATATCCGGC  266660

Query  183     CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAG-TGGACC-GCAGGACGGC  240
               ||| ||    ||||| ||| | | ||  ||||| ||| |||  ||| || |||| | || 
Sbjct  266661  CGTCCAAGCTGATGGATCCGTCAGCGCTGGTCT-AAGGGGATCTGGTCCAGCAG-ATGGA  266718

Query  241     GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
               || ||||  || || |  |||||||| ||  | ||  |||| ||||  |||    | |||
Sbjct  266719  GAGTGCAGGGGATCAAGTCTCGGCTCGCAAGTGTATTCTCGTTCCGACTGGTATGAGGAC  266778

Query  301     GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCT  360
                 |||||| ||||||||| | |||||  |||| |||||  |      ||| ||       
Sbjct  266779  AAGTGGGCTATCATGTACACGTGGTACCTCCCTAAAGGACGT-----AGTACCCGA----  266829

Query  361     CTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGAC  420
                    |||| |  |          || ||   |||||||  ||   |||| |||||||||
Sbjct  266830  -----CACCAGCGT----------CGCCACTTCTGGGAGACCGCGGTTGTCTGGATCGAC  266874

Query  421     AACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATG  462
                ||||      |   |||||||| ||||||||||| || |||
Sbjct  266875  GACCCTGCTCTCGCCAACTCGACGATTCTTGGCGTGTCAATG  266916

>PHPA:scaffold_16 NW_008649002.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.16, whole genome shotgun 
sequence
Length=1156373

 Score = 161 bits (178),  Expect = 2e-37
 Identities = 401/599 (67%), Gaps = 15/599 (3%)
 Strand=Plus/Minus

Query  133     AAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAG  192
               ||||  || || || || ||| | |  || || || | ||| ||||| ||||| ||| | 
Sbjct  780300  AAGTACAAGCCTCAACTCAAAGTTGAGGAAGGATGCCGCCCATACCCGGCCGTCCAGCAA  780241

Query  193     GATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGGC  252
               || ||  ||||||   | |||||||  |||||||| ||| |||||   |  ||||  |||
Sbjct  780240  GACGGTGCCATTAGTAGTGGTCTCAGATGGAGTGGTCCGGAGGACATAGGGTGCAAGGGC  780181

Query  253     TCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATC  312
               ||    |  |||||||| ||||| ||||||||      | | || |||  ||||||  ||
Sbjct  780180  TCACTTCGGGGCTCTCAAATCTATGCTCGCTCAAAACTGTTCAAGGACAAGTGGGCTGTC  780121

Query  313     ATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCACCCGT  372
               |||||| | ||||| ||||| || ||   | | |||   ||  ||||   |  ||| |  
Sbjct  780120  ATGTACACTTGGTACTTCCCTAAGGG---ACGTGCA---CCGATTCCGGGTC-CACGCTC  780068

Query  373     CTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGC  432
               || |  || ||||| ||   |||||| ||||   | |||||| | ||||| | ||   ||
Sbjct  780067  CTCT--GGTCACCGCCACGGCTGGGAATACGCTGTCGTGTGGTTGGACAAGCTCACT-GC  780011

Query  433     AAA-AACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTACGCTAGCCAGAC  491
               | | || ||||||||||| |||   ||  |||| ||||||||||| |  || |   |  |
Sbjct  780010  AGACAATTCGACCATTCTGGGCACGTCCCTGTCAGCTGCAGTCGGTTGGGCGAAGGAATC  779951

Query  492     GCC--CCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGAGTACTACTACAAC  549
                ||  | | |||  || |||  |||||||  ||||| | ||| ||| |||||||| ||||
Sbjct  779950  CCCTACTCCGAA-AGA-GTACCTGGATGGTAACAGTTTGAAGGTCGCGTACTACTTCAAC  779893

Query  550     CATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAATTCCAGGACCTC  609
                |    ||    | |||  |  || ||  |||  | |     || |  ||||| ||||||
Sbjct  779892  GACGATTTCAAAAACACTGCTGTGAAGTACACACAGGCTGGTGGTGCGTTCCAAGACCTC  779833

Query  610     ATTACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCACACAGACTGGGAC  669
               || |  |||||| | |||||| |  | || ||    ||||||| | ||||||| ||||||
Sbjct  779832  ATCATCTGGGACCAGCTCTCGGATGTTGCCCGGGCTTCTCTGAGCAACACAGATTGGGAC  779773

Query  670     GAGACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGGGGTGTTCCAGGA  728
               ||||| |  ||  |  ||||  |  ||||||||||| ||||||| || |||||| ||||
Sbjct  779772  GAGACGCCTTTTAATGTGGCTCGTGTCAAGATGCCGATGAAGGATGGCGTGTTCGAGGA  779714

>PHSO:scaffold_11
Length=2192408

 Score = 149 bits (164),  Expect = 1e-33
 Identities = 369/561 (66%), Gaps = 32/561 (6%)
 Strand=Plus/Plus

Query  63       CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
                ||||  |||||||||||| | |||  |  | ||||| | ||||||||| | | || | ||
Sbjct  1382765  CATCAACCACGACCAGGTGCAGCCGATGGCCCAGCCCACGCCCGTCACGGACGCCCAGAA  1382824

Query  123      GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
                |   || || ||||  || || |||||     || |  |||| || ||||||||||| ||
Sbjct  1382825  GCTCGCTGTCAAGTACAAGCCGCAGCTCCGCGTCTCGTACGGATGCCACCCGTACCCCGC  1382884

Query  183      CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
                ||| |||    | |||||| | | ||| || ||  | |||  ||| ||    || |||||
Sbjct  1382885  CGTCCAGGCCAACGGCTCCGTCAGCGGCGGCCTGGAATGGTCTGGCCCCGCTGATGGCGA  1382944

Query  243      ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
                 |||   ||||| |  |||||||| ||| | ||||||||||| |  ||| | || |||  
Sbjct  1382945  CTGCGAGGGCTCTAGCCTCGGCTCGCAGGTGTACGCTCGCTCGGACTGGTTCAAGGACAA  1383004

Query  303      GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCT  362
                |||||| |  |||||| | ||||| ||||| || ||| ||    |||  |          
Sbjct  1383005  GTGGGCTACGATGTACACTTGGTACTTCCCCAAGGGCCGA----CAGGAC----------  1383050

Query  363      TATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAA  422
                           | |  || ||||| ||   ||||||||||| |||  | ||||  |||  
Sbjct  1383051  ----------GTGTGGGGCCACCGCCACTTCTGGGAGTACGCCATCATCTGGACGGACTC  1383100

Query  423      CCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTACGC  482
                 ||   |  | | ||||||||  | || ||| | || ||||| || |  |||||  ||| 
Sbjct  1383101  GCCTTCGCCCGACAACTCGACGTTCCTCGGCATCTCCATGTCCGCCGGTGTCGGTCACGG  1383160

Query  483      TAGCCAGACGCCCCCTGAAGC-GATGTATGTGGATGGCGACAGTGTCAAGCTCGAGTACT  541
                 |  |||||| ||| ||  ||  | |||  || | ||| |||| |||||||||||||   
Sbjct  1383161  AAAGCAGACG-CCCGTGCTGCTCAAGTACATGAACGGCAACAGCGTCAAGCTCGAGTCGC  1383219

Query  542      ACTACAACCATCTCTTAGGCAGCA---CATCCCTGCAGCTCACGGAAGACACGGGGGAAT  598
                |||||| |    |  | |||| ||   |  | || ||||||||| | ||| |||| || |
Sbjct  1383220  ACTACAGC---GTGCTGGGCAACAAGGCCGCTCTCCAGCTCACGAAGGACTCGGGCGACT  1383276

Query  599      TCCAGGACCTCATTACATGGG  619
                ||||||||||||| || ||||
Sbjct  1383277  TCCAGGACCTCATCACGTGGG  1383297

 Score = 145 bits (160),  Expect = 1e-32
 Identities = 289/426 (68%), Gaps = 13/426 (3%)
 Strand=Plus/Minus

Query  57       TCAAG-TCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCT  115
                ||||| | |||  |||||||   || | ||||||| | |||||  | |||  ||| |  |
Sbjct  1381202  TCAAGATGATCAACCACGACACCGTGCAGCCATTCGCCCAGCCTGAACCCACCACGGATT  1381143

Query  116      CCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGT  175
                |||| ||| | || || ||||| || || |||||  | ||| |  |||| || || ||||
Sbjct  1381142  CCGAGAAGACTGCGGTCAAGTTCAAGCCCCAGCTACACATCTCGTACGGATGCCATCCGT  1381083

Query  176      ACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGG  235
                | || |||||  ||    | |||||| | |  |  || || |||||||  |||  |   |
Sbjct  1381082  ATCCAGCCGTGGAGGCCAACGGCTCCGTCAGTGCCGGGCTGAAGTGGACGGGATGGGCTG  1381023

Query  236      ACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGA  295
                ||||||| ||||  |||||    |||||||| ||  | ||  | || ||||  |||   |
Sbjct  1381022  ACGGCGACTGCAAGGGCTCTGGTCTCGGCTCCCAAGTGTATTCGCGGTCCGACTGGTACA  1380963

Query  296      ATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTC  355
                | |||  |||||||||||||||||||||||| ||||| || |||     ||||||  | |
Sbjct  1380962  AGGACAAGTGGGCCATCATGTACGCCTGGTACTTCCCCAAGGGC----CGGCAGT-ACGC  1380908

Query  356      TTCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGA  415
                 |||   ||||   ||       || ||||| ||   ||||   || | |||||| ||||
Sbjct  1380907  GTCCCAGTATCGATCG-------GGTCACCGCCACTTCTGGTCCTATGCCATTGTCTGGA  1380855

Query  416      TCGACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCG  475
                 ||||| |  ||||  | | ||||| ||||| |  ||||| |||||||| || |  ||||
Sbjct  1380854  CCGACAGCGACAAGCCCGACAACTCAACCATCCAAGGCGTCTCGATGTCCGCGGGTGTCG  1380795

Query  476      GGTACG  481
                | ||||
Sbjct  1380794  GCTACG  1380789

 Score = 140 bits (154),  Expect = 6e-31
 Identities = 202/284 (71%), Gaps = 1/284 (0%)
 Strand=Plus/Minus

Query  57       TCAAG-TCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCT  115
                ||||| | |||  |||||||   |||| |||  || | |||||  |||||   || |  |
Sbjct  1413205  TCAAGATGATCAACCACGACACCGTTCAGCCCGTCGCTCAGCCTGAGCCCACGACGGATT  1413146

Query  116      CCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGT  175
                |||| ||| | || || ||||  || || |||||  | ||| |  |||| || |||||||
Sbjct  1413145  CCGAGAAGACTGCGGTCAAGTACAAGCCGCAGCTCCACATCTCGTACGGATGCCACCCGT  1413086

Query  176      ACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGG  235
                ||||||| ||||||   || |||||| | |  |  ||||||||||||  ||||  |    
Sbjct  1413085  ACCCTGCGGTTCAGGCCGACGGCTCCGTCAGTGCCGGTCTCAAGTGGTCTGGATGGGCCA  1413026

Query  236      ACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGA  295
                ||||| | ||||  |||||   ||| ||||| ||| | ||| | ||||| |  |||   |
Sbjct  1413025  ACGGCAAGTGCAAGGGCTCTGGGCTGGGCTCGCAGGTGTACTCGCGCTCGGACTGGTACA  1412966

Query  296      ATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
                | | |  |||||||||||||||||||||||| ||||| || |||
Sbjct  1412965  AGGGCAAGTGGGCCATCATGTACGCCTGGTACTTCCCCAAGGGC  1412922

 Score = 138 bits (152),  Expect = 2e-30
 Identities = 279/412 (68%), Gaps = 13/412 (3%)
 Strand=Plus/Plus

Query  57       TCAAG-TCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCT  115
                ||||| | |||  |||||||   |||| |||  || | |||||  |||||   || |  |
Sbjct  1415846  TCAAGATGATCAACCACGACACCGTTCAGCCCGTCGCTCAGCCTGAGCCCACGACGGATT  1415905

Query  116      CCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGT  175
                |||| ||| | || || ||||  || || |||||  | ||| |  |||| || |||||||
Sbjct  1415906  CCGAGAAGACTGCGGTCAAGTACAAGCCGCAGCTCCACATCTCGTACGGATGCCACCCGT  1415965

Query  176      ACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGG  235
                |||| ||||| ||    || |||||| | |  |  ||||||||||||  ||||  |    
Sbjct  1415966  ACCCCGCCGTGCAAGCCGACGGCTCCGTCAGTGCCGGTCTCAAGTGGTCTGGATGGGCCA  1416025

Query  236      ACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGA  295
                ||||| | ||||  |||||    |||||||| ||| | ||| | ||||| |  |||   |
Sbjct  1416026  ACGGCAAGTGCAAGGGCTCTGGTCTCGGCTCGCAGGTGTACTCGCGCTCGGACTGGTACA  1416085

Query  296      ATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTC  355
                | | |  ||||||||||||||| |||||||| ||||| || |||     |||||| | | 
Sbjct  1416086  AGGGCAAGTGGGCCATCATGTATGCCTGGTACTTCCCCAAGGGC----CGGCAGTACGT-  1416140

Query  356      TTCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGA  415
                 |||   |||| |  |       || ||||| ||   ||||   || | |||||| ||||
Sbjct  1416141  GTCCAAGTATCGCAAG-------GGCCACCGCCACTTCTGGTCCTATGCCATTGTCTGGA  1416193

Query  416      TCGACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGC  467
                  |||| |  ||||  | | ||||||||||| |  ||||| || ||||| ||
Sbjct  1416194  CTGACAGCGACAAGCCCGACAACTCGACCATCCAGGGCGTCTCCATGTCTGC  1416245

 Score = 121 bits (133),  Expect = 6e-25
 Identities = 199/286 (70%), Gaps = 6/286 (2%)
 Strand=Plus/Minus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                |||||||||||||| || | ||| ||| | |||||  |||||  ||| |  ||||| || 
Sbjct  1375170  ATCGGCCACGACCAAGTGCAGCCGTTCGCTCAGCCCGAGCCCACCACTGAGTCCGAGAAA  1375111

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                 | || || ||||  || || |||||  | ||| |  |||| |||||||||||||| || 
Sbjct  1375110  TCCGCCGTCAAGTACAAGCCTCAGCTCCACATCTCGTACGGATGTCACCCGTACCCCGCG  1375051

Query  184      GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGA----GTGGAC--CGCAGGAC  237
                || |||   ||||||||  ||| ||| ||  | |||||||     ||| |   |   |||
Sbjct  1375050  GTCCAGGCTGATGGCTCGGTTAACGGCGGCTTGAAGTGGACTTTCTGGTCTTGGGCTGAC  1374991

Query  238      GGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAAT  297
                 |||| ||||  |||||    || ||||| ||  | ||| | ||||| |  |||   |  
Sbjct  1374990  AGCGACTGCAAGGGCTCCGGTCTGGGCTCCCAAGTGTACTCGCGCTCGGACTGGCACAGG  1374931

Query  298      GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAG  343
                | |  |||||||||  ||||||||||||| ||||| || ||| |||
Sbjct  1374930  GGCAAGTGGGCCATTGTGTACGCCTGGTACTTCCCCAAGGGCCGAG  1374885

 Score = 108 bits (119),  Expect = 4e-21
 Identities = 194/281 (69%), Gaps = 2/281 (1%)
 Strand=Plus/Minus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                |||| ||||||||| || | | | |||||||||||  |||| |||||||  | ||| |||
Sbjct  1378461  ATCGACCACGACCAAGTGCAGTCGTTCCCGCAGCCTGAGCCAGTCACCGATTTCGAGAAG  1378402

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                   || || ||||  || || |||||  | ||| |  | || || |||||||||||||| 
Sbjct  1378401  TTCGCCGTCAAGTACAAGCCTCAGCTCCACATCTCGAATGGATGCCACCCGTACCCTGCG  1378342

Query  184      GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
                || |||   ||||| ||  |    |  ||  | ||||||  ||| ||  || | ||| | 
Sbjct  1378341  GTGCAGGCCGATGGTTCGGTAGGTGCCGGCTTGAAGTGGTCTGGGCCCGAGAAAGGCAAG  1378282

Query  244      TGCACAGGCTCGAAGCTCG-GCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
                ||||  |||||   ||| | | || ||  | ||| | |||||||  |||   |  | |  
Sbjct  1378281  TGCAGGGGCTC-TGGCTTGTGATCCCAAGTGTACTCGCGCTCCGACTGGTACAGGGGCAA  1378223

Query  303      GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAG  343
                 ||| ||||||||||||||||||| ||||| || ||| |||
Sbjct  1378222  ATGGACCATCATGTACGCCTGGTACTTCCCCAAGGGCCGAG  1378182

 Score = 104 bits (114),  Expect = 4e-20
 Identities = 186/272 (68%), Gaps = 0/272 (0%)
 Strand=Plus/Minus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               |||| ||||||| |||| | ||| ||| |||||||    |||| ||| || ||||| |||
Sbjct  710348  ATCGACCACGACAAGGTGCAGCCGTTCGCGCAGCCCGCACCCGCCACTGTGTCCGAGAAG  710289

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
               || || || || || || |||   ||  |||||  |||||| || ||||||||||| || 
Sbjct  710288  GCCGCCGTCAAATTCAAGCCAAGTCTCCAAATCATCGACGGATGCCACCCGTACCCCGCA  710229

Query  184     GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
               ||  |    |  |||   |  |  || ||  | |||   |  || |||   |||||  ||
Sbjct  710228  GTGAACGCCGCGGGCGAGACGAGTGGGGGATTGAAGCACACCGGTCCGGTAGACGGGAAA  710169

Query  244     TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
               ||||  || ||    |||||||| ||  | ||||  ||||| |  |||   || ||| | 
Sbjct  710168  TGCAAGGGTTCAGGACTCGGCTCGCAAGTGTACGGCCGCTCTGGCTGGTACAAGGACCTC  710109

Query  304     TGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
               ||||||||||||||| | ||||||||||| ||
Sbjct  710108  TGGGCCATCATGTACTCGTGGTATTTCCCCAA  710077

 Score = 104 bits (114),  Expect = 4e-20
 Identities = 186/272 (68%), Gaps = 0/272 (0%)
 Strand=Plus/Plus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               |||| ||||||| |||| | ||| ||| |||||||    |||| ||| || ||||| |||
Sbjct  716517  ATCGACCACGACAAGGTGCAGCCGTTCGCGCAGCCCGCACCCGCCACTGTGTCCGAGAAG  716576

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
               || || || || || || |||   ||  |||||  |||||| || ||||||||||| || 
Sbjct  716577  GCCGCCGTCAAATTCAAGCCAAGTCTCCAAATCATCGACGGATGCCACCCGTACCCCGCA  716636

Query  184     GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
               ||  |    |  |||   |  |  || ||  | |||   |  || |||   |||||  ||
Sbjct  716637  GTGAACGCCGCGGGCGAGACGAGTGGGGGATTGAAGCACACCGGTCCGGTAGACGGGAAA  716696

Query  244     TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
               ||||  || ||    |||||||| ||  | ||||  ||||| |  |||   || ||| | 
Sbjct  716697  TGCAAGGGTTCAGGACTCGGCTCGCAAGTGTACGGCCGCTCTGGCTGGTACAAGGACCTC  716756

Query  304     TGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
               ||||||||||||||| | ||||||||||| ||
Sbjct  716757  TGGGCCATCATGTACTCGTGGTATTTCCCCAA  716788

 Score = 103 bits (113),  Expect = 2e-19
 Identities = 188/273 (69%), Gaps = 12/273 (4%)
 Strand=Plus/Plus

Query  69       CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
                ||||||| | || | ||| |||||  |||   |||| |||  ||  ||||| ||||| ||
Sbjct  1438965  CCACGACGAAGTCCAGCCGTTCCCTGAGCTGGAGCCTGTCGGCGCTTCCGAGAAGGCCGC  1439024

Query  129      AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
                ||| ||||| || || |||||  | ||| || |||| | |||  | |||||||| |||| 
Sbjct  1439025  AGTCAAGTTCAAGCCGCAGCTGCAGATCTCCTACGGATTTCATACTTACCCTGCAGTTCG  1439084

Query  189      ----GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAAT  244
                    || |||  | ||  | ||    ||||| || ||| | ||   ||  ||||| ||||
Sbjct  1439085  CCGTGACGGAGCGGTCAGTAAC----GGTCTGAAATGGGGCGGCAAGCCCGACGGGGAAT  1439140

Query  245      GCACAGGCTCGAAGCTCGG--CTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
                |||  || ||   ||| ||  ||| ||  ||||| |||| || |  |||    | | |  
Sbjct  1439141  GCAAGGGATCT--GCTTGGGGCTCGCAAGTCTACACTCGATCGGACTGGTACCAGGGCAA  1439198

Query  303      GTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                |||||||||||||||||| ||||| ||||||||
Sbjct  1439199  GTGGGCCATCATGTACGCATGGTACTTCCCGAA  1439231

 Score = 97.8 bits (107),  Expect = 7e-18
 Identities = 196/288 (68%), Gaps = 6/288 (2%)
 Strand=Plus/Plus

Query  69       CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
                ||||||||| || | ||| ||| |||||||  |||| |  |||| ||| || |  || ||
Sbjct  1450026  CCACGACCAAGTGCAGCCGTTCGCGCAGCCCGAGCCTGCGACCGACTCGGAGACAGCCGC  1450085

Query  129      AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
                ||| ||||| || ||    ||  |  |  || |||| ||| | ||||| ||||| |||  
Sbjct  1450086  AGTCAAGTTCAAGCCCTTTCTCGAGGTTTCCTACGGATGTGAGCCGTATCCTGCAGTTTC  1450145

Query  189      GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCAC  248
                |    |||| ||  | |  |   | || || |||| |||   | | || ||||| |||  
Sbjct  1450146  GGCCAATGGATCGGTCAGTGCGAGCCTGAAATGGACTGGCAAGAACGATGGCGACTGCGA  1450205

Query  249      AGGCTCGAAGCTC--GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGG  306
                ||| ||  ||||   ||||| ||| | ||| | ||||| |  |||   || |||  ||||
Sbjct  1450206  AGGATC--AGCTTTAGGCTCGCAGGTGTACTCGCGCTCGGACTGGTACAAGGACAAGTGG  1450263

Query  307      GCCATCATGTACGCCTGGTATTTCCCGAAAGGCAG--AGGGGCAGTCC  352
                ||||| |||||||||||||| ||||| || ||| |  |||||  ||||
Sbjct  1450264  GCCATGATGTACGCCTGGTACTTCCCCAAGGGCTGGCAGGGGGCGTCC  1450311

 Score = 95.1 bits (104),  Expect = 2e-17
 Identities = 180/264 (68%), Gaps = 1/264 (0%)
 Strand=Plus/Plus

Query  63       CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
                ||||  ||||||||| ||   ||||||||| || |||| |||    ||||  || ||   
Sbjct  1455439  CATCAACCACGACCAAGTCGAGCCATTCCCTCAACCAA-GCCGAAGACCGCGTCTGAGCG  1455497

Query  123      GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
                 || ||||| ||||  || || || ||  |  |  ||  ||| || ||||||||||||||
Sbjct  1455498  AGCTGCAGTCAAGTACAAGCCTCAACTCCACGTTTCCTTCGGATGCCACCCGTACCCTGC  1455557

Query  183      CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
                 |||||     | |||||  | |  |  ||||| ||  |||| ||      |||||||||
Sbjct  1455558  GGTTCAAGCTAACGGCTCTGTGAGTGCGGGTCTGAAAGGGAGCGGGTTTTCGGACGGCGA  1455617

Query  243      ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
                 ||||  ||||| |   | ||||| ||  | ||||| ||||| |  |||   || |||  
Sbjct  1455618  GTGCAAGGGCTCCAGCTTGGGCTCGCAAGTGTACGCGCGCTCGGACTGGTACAACGACAA  1455677

Query  303      GTGGGCCATCATGTACGCCTGGTA  326
                |||||||||||||||||| |||||
Sbjct  1455678  GTGGGCCATCATGTACGCGTGGTA  1455701

 Score = 86.9 bits (95),  Expect = 1e-14
 Identities = 181/270 (67%), Gaps = 0/270 (0%)
 Strand=Plus/Plus

Query  69       CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
                |||||| || || |  || ||| | |||    |||| |||| || |||||| ||||| ||
Sbjct  1454259  CCACGATCAAGTCCACCCGTTCGCTCAGGTTGAGCCTGTCAACGCCTCCGATAAGGCTGC  1454318

Query  129      AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
                  | ||||| || ||  ||||  | ||| || |||| ||||| || ||||| || || ||
Sbjct  1454319  GATCAAGTTCAAGCCGAAGCTGCAGATCTCCTACGGCTGTCATCCTTACCCCGCAGTCCA  1454378

Query  189      GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCAC  248
                    || ||  |  | |  |  || || |||||| | ||   ||  || ||  |||| | 
Sbjct  1454379  AGCCGACGGAGCTGTCAGTGACGGCCTGAAGTGGGGCGGCAAGCCCGATGGAAAATGTAA  1454438

Query  249      AGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGC  308
                ||| ||     | ||||| ||| | ||| ||||||| |  |||    | |    ||||||
Sbjct  1454439  AGGTTCCGGTTTGGGCTCGCAGGTGTACTCTCGCTCGGACTGGTACCAGGGTAAGTGGGC  1454498

Query  309      CATCATGTACGCCTGGTATTTCCCGAAAGG  338
                |||||||||||||||||| || || |||||
Sbjct  1454499  CATCATGTACGCCTGGTACTTTCCCAAAGG  1454528

 Score = 82.4 bits (90),  Expect = 1e-13
 Identities = 180/270 (67%), Gaps = 0/270 (0%)
 Strand=Plus/Minus

Query  69       CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
                |||||| || || |  || ||| | |||    |||| |||| || |||||| ||||| ||
Sbjct  1457324  CCACGATCAAGTCCACCCGTTCGCTCAGGTTGAGCCTGTCAACGCCTCCGATAAGGCTGC  1457265

Query  129      AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
                  | ||||| || ||  ||||  | ||| || |||| ||||| || ||||| || || ||
Sbjct  1457264  GATCAAGTTCAAGCCGAAGCTGCAGATCTCCTACGGCTGTCATCCTTACCCCGCAGTCCA  1457205

Query  189      GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCAC  248
                    || ||  |  | |  |  ||||| ||||||   ||   |   |||||  | || | 
Sbjct  1457204  AGCCGACGGAGCTGTCAGTGATGGTCTGAAGTGGGCCGGCAAGGCCGACGGGAAGTGTAA  1457145

Query  249      AGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGC  308
                 |||||    || ||||| ||| | ||| | || || || ||| |  | | |  ||  ||
Sbjct  1457144  GGGCTCTGGCCTGGGCTCGCAGGTGTACTCGCGTTCGGCTTGGTTCGAGGGCAAGTTTGC  1457085

Query  309      CATCATGTACGCCTGGTATTTCCCGAAAGG  338
                |||||||||||||||||| || || |||||
Sbjct  1457084  CATCATGTACGCCTGGTACTTTCCCAAAGG  1457055

 Score = 76.1 bits (83),  Expect = 2e-11
 Identities = 171/255 (67%), Gaps = 3/255 (1%)
 Strand=Plus/Plus

Query  84       GCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACC  143
                ||||||||| || |||| |||    ||||  || ||    || ||||| ||||  || ||
Sbjct  1464488  GCCATTCCCTCAACCAA-GCCGAAGACCGCGTCTGAGCGAGCTGCAGTCAAGTACAAGCC  1464546

Query  144      ACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCAT  203
                 || ||  |  |  ||  ||| || |||||||||||||| |||||     | |||||  |
Sbjct  1464547  TCAACTCCACGTTTCCTTCGGATGCCACCCGTACCCTGCGGTTCAAGCTAACGGCTC--T  1464604

Query  204      TACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGAAGCTCGG  263
                 |  |  ||||| ||  |||| ||      ||||||||| |||   ||||| |   | ||
Sbjct  1464605  GAGTGCGGGTCTGAAAGGGAGCGGGTTTTCGGACGGCGAGTGCGAGGGCTCCAGCTTGGG  1464664

Query  264      CTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTG  323
                ||| ||  | ||||| ||||| |  |||   || |||  ||||| |||||||||||| | 
Sbjct  1464665  CTCGCAAGTGTACGCGCGCTCAGACTGGTACAACGACAAGTGGGTCATCATGTACGCGTA  1464724

Query  324      GTATTTCCCGAAAGG  338
                |||| | || |||||
Sbjct  1464725  GTATCTGCCCAAAGG  1464739

 Score = 74.3 bits (81),  Expect = 7e-11
 Identities = 78/103 (76%), Gaps = 0/103 (0%)
 Strand=Plus/Minus

Query  378      CGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAA  437
                ||| |||| |||  |||||  ||||| ||| || ||||||||||| |||||     | ||
Sbjct  1409688  CGGCCACCATCACTACTGGTCGTACGCCATCGTCTGGATCGACAATCCCAACCCGGACAA  1409629

Query  438      CTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTAC  480
                ||||||||| || || || || |||||||| |  ||||| |||
Sbjct  1409628  CTCGACCATCCTCGGTGTGTCCATGTCGGCCGGTGTCGGCTAC  1409586

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 194/292 (66%), Gaps = 5/292 (2%)
 Strand=Plus/Plus

Query  48       AGCCCAGGCTCAAGTC-ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCG  106
                |||| ||| |||| |  |||  ||||||||| || |  || ||| | |||    || |||
Sbjct  1461611  AGCCAAGG-TCAACTGGATCAACCACGACCAAGTCCACCCGTTCGCTCAGGTCGAGGCCG  1461669

Query  107      TCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGT  166
                 || ||  || || ||||| ||  | ||||| || || |||||  | ||| || |||| |
Sbjct  1461670  CCAACGCTTCTGAGAAGGCCGCGATCAAGTTCAAGCCGCAGCTGCAGATCTCCTACGGTT  1461729

Query  167      GTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTG  226
                | || || ||||| ||||||||    || ||  |  | |  |  ||||| |||||| |||
Sbjct  1461730  GCCATCCTTACCCCGCCGTTCAAGCCGACGGAGCAGTCAGTGATGGTCTGAAGTGGGGTG  1461789

Query  227      GACCGCAGGACGGCGAATGCACAGG-CTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCC  285
                |   ||  ||||| |||    |||| |||     | ||||| ||  | ||| |  |||| 
Sbjct  1461790  GTAAGCCTGACGG-GAAGTATCAGGGCTCCGGTTTGGGCTCGCAAGTGTACTCG-GCTCG  1461847

Query  286      GCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
                || |||    | |    | | || ||||||||||||||||| ||||| ||||
Sbjct  1461848  GCCTGGTACGAGGGTAAGAGAGCGATCATGTACGCCTGGTACTTCCCTAAAG  1461899

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 52/64 (81%), Gaps = 0/64 (0%)
 Strand=Plus/Minus

Query  274     TACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCG  333
               ||||  || || ||||||   ||  |||||||||||| ||||||||||||||| ||||| 
Sbjct  354931  TACGTGCGTTCGGCGTGGCAAAAGAACGTGTGGGCCACCATGTACGCCTGGTACTTCCCC  354872

Query  334     AAAG  337
               ||||
Sbjct  354871  AAAG  354868

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 140/212 (66%), Gaps = 2/212 (1%)
 Strand=Plus/Minus

Query  410      TGTGGATCGACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTG  469
                ||||||||||||||||  ||| | | ||| |  | || |||||||| | | |     | |
Sbjct  1456995  TGTGGATCGACAACCCTGAGAACGAGAACCCAGCGATCCTTGGCGTGTGGCTACGCACAG  1456936

Query  470      CAGTCGGGTACGCTAGCCAGACGCCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCA  529
                | | |||  |||   |||  || || || || |||| ||   | || ||    ||  | |
Sbjct  1456935  CTGGCGGAAACGAGCGCCGCACTCCTCCGGACGCGAAGTTCCTCGACGGTTCGAGCCTGA  1456876

Query  530      AGCTCGAGTACTACTACAAC-CATCTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGAC  588
                || |||| |||||| | | | | |  | | ||||  ||     | ||||| |||||  ||
Sbjct  1456875  AGGTCGACTACTACAAGAGCTCGTGGCAT-GGCAAGACGGGGATCCAGCTAACGGAGAAC  1456817

Query  589      ACGGGGGAATTCCAGGACCTCATTACATGGGA  620
                 |||| || |||||||||||||| || |||||
Sbjct  1456816  CCGGGCGAGTTCCAGGACCTCATCACTTGGGA  1456785

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 40/49 (82%), Gaps = 0/49 (0%)
 Strand=Plus/Plus

Query  578      TCACGGAAGACACGGGGGAATTCCAGGACCTCATTACATGGGACGAACT  626
                |||||||  | | |||||| |||||||||||||| || |||||  ||||
Sbjct  1455927  TCACGGAGAAGAGGGGGGAGTTCCAGGACCTCATCACGTGGGAGCAACT  1455975

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 40/49 (82%), Gaps = 0/49 (0%)
 Strand=Plus/Plus

Query  578      TCACGGAAGACACGGGGGAATTCCAGGACCTCATTACATGGGACGAACT  626
                |||||||  | | |||||| |||||||||||||| || |||||  ||||
Sbjct  1464955  TCACGGAGAAGAGGGGGGAGTTCCAGGACCTCATCACGTGGGAGCAACT  1465003

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 29/32 (91%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  589     ACGGGGGAATTCCAGGACCTCATTACATGGGA  620
               ||||||||| |||||||||||||||  |||||
Sbjct  709797  ACGGGGGAACTCCAGGACCTCATTATGTGGGA  709766

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 29/32 (91%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  589     ACGGGGGAATTCCAGGACCTCATTACATGGGA  620
               ||||||||| |||||||||||||||  |||||
Sbjct  717069  ACGGGGGAACTCCAGGACCTCATTATGTGGGA  717100

 Score = 41.9 bits (45),  Expect = 0.44
 Identities = 39/50 (78%), Gaps = 0/50 (0%)
 Strand=Plus/Plus

Query  571      CTGCAGCTCACGGAAGACACGGGGGAATTCCAGGACCTCATTACATGGGA  620
                ||||| || ||| | |||| ||| || |||||||||||  | || |||||
Sbjct  1462119  CTGCAACTGACGAAGGACAAGGGCGAGTTCCAGGACCTGGTCACGTGGGA  1462168

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 37/47 (79%), Gaps = 0/47 (0%)
 Strand=Plus/Plus

Query  574      CAGCTCACGGAAGACACGGGGGAATTCCAGGACCTCATTACATGGGA  620
                ||||| |||||  || |||| || |||||||||||  | || |||||
Sbjct  1454739  CAGCTAACGGAGAACCCGGGCGAGTTCCAGGACCTGGTCACTTGGGA  1454785

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 84/123 (68%), Gaps = 2/123 (2%)
 Strand=Plus/Minus

Query  63      CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
               |||| |||||||| | || |  |||| | ||||| |  || |  ||| | |||| || ||
Sbjct  356534  CATCAGCCACGACGATGT-CAACCAT-CACGCAGTCTGAGGCGATCAGCCTCTCTGAAAA  356477

Query  123     GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
                || || ||    || || || || |||   || | | |||| ||  || ||||||||||
Sbjct  356476  AGCCGCCGTCCGCTTCAAGCCCCAACTTCTCATTGGCAACGGATGCAACACGTACCCTGC  356417

Query  183     CGT  185
               |||
Sbjct  356416  CGT  356414

>PHKE:scaffold_444 scf_22126_444.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_444.1:1:28542:1 
REF
Length=28542

 Score = 148 bits (163),  Expect = 4e-33
 Identities = 201/278 (72%), Gaps = 2/278 (1%)
 Strand=Plus/Minus

Query  64     ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
              |||||||||||| |||||| ||| || || |||||  | || |||||||||||||| |||
Sbjct  13865  ATCGGCCACGACAAGGTTCAGCCGTTTCCACAGCCTGACCCTGTCACCGTCTCCGAGAAG  13806

Query  124    GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
               ||||||| ||||| || |||   ||    |||| |  |||||||||| | |||||||| 
Sbjct  13805  ACAGCAGTCAAGTTCAAGCCATCACTCCGCATCGACAGCGGGTGTCACTCCTACCCTGCT  13746

Query  184    GTTCA-GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
              ||  | |  | || ||   || | ||| || |||||  |||  |||    | ||||||||
Sbjct  13745  GTCAATGCTGCAT-GCGAAATCAGCGGGGGCCTCAAAGGGACAGGAAGCGATGACGGCGA  13687

Query  243    ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
               ||||| || ||||  || || || ||  | |||| |||  |||  |||   || ||  |
Sbjct  13686  TTGCACCGGGTCGAGCCTGGGTTCCCAAGTGTACGGTCGAGCCGTTTGGTACAACGATCT  13627

Query  303    GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
              ||||||||| |||||| | ||||||||||| |||| ||
Sbjct  13626  GTGGGCCATTATGTACTCGTGGTATTTCCCTAAAGACA  13589

>PHPA:scaffold_111 NW_008649097.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.111, whole genome 
shotgun sequence
Length=101658

 Score = 140 bits (154),  Expect = 6e-31
 Identities = 257/371 (69%), Gaps = 37/371 (10%)
 Strand=Plus/Plus

Query  64     ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
              |||| ||||||||| |||  ||| |||||||| ||| ||||||||||| | || || |||
Sbjct  48344  ATCGACCACGACCAAGTTAAGCCGTTCCCGCAACCAGAGCCCGTCACCATTTCGGAGAAG  48403

Query  124    GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
              |||||||| ||||| || || ||| || | ||| |  |||| ||||||||||||||||| 
Sbjct  48404  GCAGCAGTCAAGTTCAAGCCTCAGATTCACATCACGAACGGATGTCACCCGTACCCTGCG  48463

Query  184    GTTCA-GAAG--GATGGCTCCATTACCGGAGGTCTCAA---GTGGAGTGGACCGCAGGAC  237
              ||  | ||||  | ||   ||| |   || ||||||||   |  | |||  || |||  |
Sbjct  48464  GTGAACGAAGCCGGTGAAACCAGT---GGCGGTCTCAAAACGAAGGGTGCTCC-CAG--C  48517

Query  238    GGCGAATGCACAGG--CTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGA  295
              |   ||||||  ||  || || |   || |||||| | ||||  || ||  |||||||  
Sbjct  48518  GCTAAATGCAAGGGATCTGGATG--GGGTTCTCAGGTGTACGGCCGATCTACGTGGGTCC  48575

Query  296    ATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTC  355
              | | | | ||||||||||||||  | ||||| ||||| ||          | | || | |
Sbjct  48576  AGGGCATCTGGGCCATCATGTATTCGTGGTACTTCCCCAA----------GGACTCGC-C  48624

Query  356    TTCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGA  415
               |||||    |          | || ||||||||  |||||||| ||||||| |||||||
Sbjct  48625  GTCCTCGGGAC----------TGGGCCACCGTCACGACTGGGAGCACGTCATCGTGTGGA  48674

Query  416    TCGACAACCCC  426
              |||||||||||
Sbjct  48675  TCGACAACCCC  48685

 Score = 82.4 bits (90),  Expect = 1e-13
 Identities = 244/370 (66%), Gaps = 35/370 (9%)
 Strand=Plus/Plus

Query  63     CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
              ||||| ||||||||| ||   ||| || || || ||  ||||||||||  |||| || ||
Sbjct  43963  CATCGACCACGACCAAGTAAAGCCGTTTCCACAACCTCAGCCCGTCACAATCTCTGAAAA  44022

Query  123    GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
              ||| ||||| ||||| |||||||| ||  | ||| |  | || |||||  |||| || ||
Sbjct  44023  GGCTGCAGTCAAGTTCAAACCACAACTCCACATCACGAATGGATGTCATTCGTATCCAGC  44082

Query  183    CGTTCA-GAAGGATGGCT--CCATTACCGGAGGTCTCAAGTGGAGTGGACCGC--AGGAC  237
               ||| | ||||   | |   ||| |   || ||||||||    |  ||| | |  ||  |
Sbjct  44083  AGTTGATGAAGCCGGACAGACCAGT---GGTGGTCTCAAAACAAAAGGAGCCCCTAGTGC  44139

Query  238    GGCGAATGCACAGGCTC--GAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGA  295
               | |  ||||  || ||  || |   || || ||  |||||| ||| ||    |||    
Sbjct  44140  TGGG--TGCAAGGGATCCGGATGG--GGTTCGCAAGTCTACGGTCGATCTAGTTGGTATC  44195

Query  296    ATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTC  355
              | |  || |||||||||||||||   ||||||||||| |||||  |||       || ||
Sbjct  44196  AGGGAGTTTGGGCCATCATGTACTGTTGGTATTTCCC-AAAGGACGAG-------CCGTC  44247

Query  356    TTCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGA  415
                        |||| |  ||   || || || ||  |||||||| ||||||| |||||||
Sbjct  44248  ----------CACCGGAATT---GGCCATCGCCACGACTGGGAGCACGTCATCGTGTGGA  44294

Query  416    TCGACAACCC  425
              ||||||||||
Sbjct  44295  TCGACAACCC  44304

>PHPA:scaffold_12 NW_008648998.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.12, whole genome shotgun 
sequence
Length=1504206

 Score = 137 bits (151),  Expect = 7e-30
 Identities = 238/345 (69%), Gaps = 6/345 (2%)
 Strand=Plus/Plus

Query  1        ATGAACTTTCGGATCGTCCTCCTCGTCCTCGTCGCTTCGCTTGCAGGAGCCCAGGCTCAA  60
                |||||| | ||   | ||||| |||    | |||||||| | || |  | | | ||| ||
Sbjct  1166579  ATGAACCTCCGCGCCTTCCTCGTCGCAGCCATCGCTTCGTTCGCCGCCGTCAACGCTAAA  1166638

Query  61       GTCA-TCGG-----CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTC  114
                |||| |||      ||||||| | || | ||| ||| | ||||   ||||  |||| | |
Sbjct  1166639  GTCAGTCGCGTTAACCACGACAAAGTGCAGCCGTTCGCCCAGCTGCAGCCGATCACTGAC  1166698

Query  115      TCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCG  174
                ||  | ||| | || || ||||  |||||||||||  | ||| |  | || || ||||||
Sbjct  1166699  TCACAGAAGTCTGCTGTCAAGTACAAACCACAGCTCCACATCTCGTATGGATGCCACCCG  1166758

Query  175      TACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAG  234
                ||||||||||||||     |||||||   ||  || |||||  |||||  ||||||    
Sbjct  1166759  TACCCTGCCGTTCAAGCCAATGGCTCGGCTAGTGGCGGTCTGGAGTGGTCTGGACCTGTT  1166818

Query  235      GACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
                || || || ||||| || |||  | | ||||| ||  | ||| |||| || || |||   
Sbjct  1166819  GATGGAGACTGCACGGGTTCGCCGTTGGGCTCGCAAGTGTACTCTCGTTCGGCCTGGTAC  1166878

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
                || ||   |||||| ||||||||||| ||||| ||||| ||||||
Sbjct  1166879  AAGGAGAAGTGGGCTATCATGTACGCTTGGTACTTCCCTAAAGGC  1166923

 Score = 130 bits (143),  Expect = 1e-27
 Identities = 181/254 (71%), Gaps = 0/254 (0%)
 Strand=Plus/Plus

Query  85       CCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCA  144
                || ||| | ||||| || ||   ||||| |||||| ||||| || || || |  || || 
Sbjct  1187348  CCGTTCGCTCAGCCCAAACCTACCACCGACTCCGAGAAGGCTGCCGTCAAATACAAGCCG  1187407

Query  145      CAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATT  204
                ||  || |  || || |||| || |||||||||||||||||||||   ||||| ||  ||
Sbjct  1187408  CAATTTCATGTCTCCTACGGTTGCCACCCGTACCCTGCCGTTCAGGCCGATGGATCAGTT  1187467

Query  205      ACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGAAGCTCGGC  264
                | ||  || || ||  | ||||| ||   |||||| ||||||  ||||||    || |||
Sbjct  1187468  AGCGCTGGGCTTAAAGGAAGTGGGCCTATGGACGGGGAATGCGAAGGCTCACCTCTGGGC  1187527

Query  265      TCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGG  324
                |||||  | ||| |||| || |  |||    | ||| ||||||| |||||||| || |||
Sbjct  1187528  TCTCAAGTATACTCTCGTTCGGGCTGGTACGAGGACATGTGGGCTATCATGTATGCTTGG  1187587

Query  325      TATTTCCCGAAAGG  338
                ||  | ||||||||
Sbjct  1187588  TACCTTCCGAAAGG  1187601

 Score = 83.3 bits (91),  Expect = 1e-13
 Identities = 160/233 (69%), Gaps = 5/233 (2%)
 Strand=Plus/Plus

Query  108      CACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTG  167
                ||| | ||| || ||| | ||  | ||||  || || || ||  | ||| | ||||| ||
Sbjct  1141145  CACAGACTCGGAGAAGTCTGCTATCAAGTACAAGCCGCAACTGCATATCTCAGACGGTTG  1141204

Query  168      TCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGG  227
                 |||||||||||||  || ||    || |||||| | | ||  ||| | || |||   ||
Sbjct  1141205  CCACCCGTACCCTGTTGTCCAAGCTGACGGCTCCGTGAGCGCTGGTTTGAAATGGTCAGG  1141264

Query  228      ACCG--CAGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCC  285
                   |  ||| |  | |  |||| ||||||  |  | || || ||| ||||  |||| |||
Sbjct  1141265  CAGGTACAGAA--GTGGCTGCAAAGGCTCCGACTTGGGGTCCCAGGTCTATTCTCGATCC  1141322

Query  286      GCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                || |||   || | |  |||||||||||||||||| ||||||||||| |||||
Sbjct  1141323  GCCTGGTACAAGGGCAAGTGGGCCATCATGTACGCTTGGTATTTCCC-AAAGG  1141374

 Score = 77.0 bits (84),  Expect = 6e-12
 Identities = 129/186 (69%), Gaps = 12/186 (6%)
 Strand=Plus/Plus

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCT  354
                || |||  |||||||||||||||||||||||| ||||| || ||  ||    |||| | |
Sbjct  1180287  AAGGACAAGTGGGCCATCATGTACGCCTGGTACTTCCCCAAGGGTCGA----CAGTACAT  1180342

Query  355      CTTCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGG  414
                   |   |    ||| ||||    || ||||||||  |||||  |||||  || || |||
Sbjct  1180343  TCGCAAGT----ACCGGTCT----GGCCACCGTCACTACTGGTCGTACGCTATCGTTTGG  1180394

Query  415      ATCGACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTC  474
                |  ||||| || ||   | | ||||||||||| || || || ||||||||  | |  |||
Sbjct  1180395  ACGGACAATCCGAACCCCGACAACTCGACCATCCTCGGTGTGTCGATGTCCTCCGGTGTC  1180454

Query  475      GGGTAC  480
                || |||
Sbjct  1180455  GGCTAC  1180460

 Score = 67.1 bits (73),  Expect = 1e-08
 Identities = 119/173 (69%), Gaps = 12/173 (7%)
 Strand=Plus/Minus

Query  308      CCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCA  367
                ||||||||||||||||||| ||||| || ||  ||    |||| | |   |   |    |
Sbjct  1174582  CCATCATGTACGCCTGGTACTTCCCCAAGGGTCGA----CAGTACATTCGCAAGT----A  1174531

Query  368      CCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCA  427
                || ||||    || ||||||||  |||||  |||||  || || ||||  ||||| || |
Sbjct  1174530  CCGGTCT----GGCCACCGTCACTACTGGTCGTACGCTATCGTTTGGACGGACAATCCGA  1174475

Query  428      AGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTAC  480
                |   | | ||||||||||| || || || ||||||||  | |  ||||| |||
Sbjct  1174474  ACCCCGACAACTCGACCATCCTCGGTGTGTCGATGTCCTCCGGTGTCGGCTAC  1174422

 Score = 64.4 bits (70),  Expect = 4e-08
 Identities = 120/174 (69%), Gaps = 2/174 (1%)
 Strand=Plus/Minus

Query  163      GGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGG  222
                || ||||||||||| ||||| ||||||   ||||||||  | |  |  || || ||| | 
Sbjct  1283652  GGATGTCACCCGTATCCTGCTGTTCAGGCTGATGGCTCGGTCAGTGCTGGGCTTAAGGGA  1283593

Query  223      AGTGGACCGCAGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGC  282
                  ||| ||  | |  ||||| ||    || |||   || || |||||  | |||  ||| 
Sbjct  1283592  TCTGGGCCAGATGGTGGCGAGTGTGGCGGTTCGGCTCTTGGTTCTCAAGTGTACTATCGT  1283533

Query  283      TCCGCGTGGGTGAATGA-CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                || |  ||| || | || |  |||||||||||||||||| |||||  |||||||
Sbjct  1283532  TCAGACTGG-TGTAGGAACAAGTGGGCCATCATGTACGCTTGGTACCTCCCGAA  1283480

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 63/81 (78%), Gaps = 1/81 (1%)
 Strand=Plus/Minus

Query  258      GCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTA  317
                ||| |||||||||||||||| |||  | || ||    || |   |||||||||| || ||
Sbjct  1280566  GCTAGGCTCTCAGATCTACGGTCGAGCTGCATGAAACAAGGTTCTGTGGGCCAT-ATATA  1280508

Query  318      CGCCTGGTATTTCCCGAAAGG  338
                ||| ||||| |||||||||||
Sbjct  1280507  CGCTTGGTACTTCCCGAAAGG  1280487

 Score = 43.7 bits (47),  Expect = 0.13
 Identities = 160/247 (65%), Gaps = 8/247 (3%)
 Strand=Plus/Plus

Query  379      GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAAC  438
                || || |||||  | ||||||||||  || || ||||  |||| | |||     |  |||
Sbjct  1166939  GGCCATCGTCACTATTGGGAGTACGCGATCGTATGGACAGACAGCGCCACCTCGACCAAC  1166998

Query  439      TCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTACGCTAGCCAGACGCCCCCT  498
                ||| |||| |  ||||| || ||||| || |  || ||  |||| |     || ||||| 
Sbjct  1166999  TCGTCCATCCAGGGCGTGTCAATGTCCGCGGGTGTTGGTCACGCGAAGGCTACTCCCCC-  1167057

Query  499      GAAGCG-ATGTATGTGGATGGCGACAGTGTCAAGCTCGAGTACTACTACAACCATCTCTT  557
                || ||  | ||| || || ||    ||| |||| ||||| |  || | ||    | |  |
Sbjct  1167058  GATGCTCAAGTACGTTGACGGGTCGAGTATCAAACTCGACTCGTATTTCAG---TTTTAT  1167114

Query  558      AGGCAGCA---CATCCCTGCAGCTCACGGAAGACACGGGGGAATTCCAGGACCTCATTAC  614
                 |||| ||   |  |  ||||||||||| | ||    || ||   |||||||||||| ||
Sbjct  1167115  GGGCAACAAGGCGGCGTTGCAGCTCACGAAGGAGCATGGTGAGACCCAGGACCTCATCAC  1167174

Query  615      ATGGGAC  621
                 ||||||
Sbjct  1167175  TTGGGAC  1167181

>PHIF:NW_003303619.1 Phytophthora infestans T30-4 supercont1.140 
genomic scaffold, whole genome shotgun sequence
Length=293189

 Score = 137 bits (151),  Expect = 7e-30
 Identities = 237/345 (69%), Gaps = 6/345 (2%)
 Strand=Plus/Minus

Query  1       ATGAACTTTCGGATCGTCCTCCTCGTCCTCGTCGCTTCGCTTGCAGGAGCCCAGGCTCAA  60
               |||||| | ||   | ||||| ||| |  ||||||||| || || | |||| | ||| ||
Sbjct  170562  ATGAACCTCCGCGCCTTCCTCATCGCCGCCGTCGCTTCCCTAGCTGTAGCCAATGCTAAA  170503

Query  61      GTCATCGG------CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTC  114
               |||| | |      ||||||  | || | ||| ||| | |||||    ||  |||||| |
Sbjct  170502  GTCAGCCGAGACAACCACGATGAAGTGCAGCCGTTCACCCAGCCGCTACCGATCACCGAC  170443

Query  115     TCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCG  174
               ||  | ||| | || || ||||  ||||| |||||| | ||  |  | || |||||||||
Sbjct  170442  TCACAGAAGTCTGCTGTCAAGTACAAACCCCAGCTTCACATATCGTATGGATGTCACCCG  170383

Query  175     TACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAG  234
               |||||||| ||  ||    | |||||   ||  || |||||| | |||  ||||||    
Sbjct  170382  TACCCTGCTGTCGAGCCCAACGGCTCTGCTAGTGGCGGTCTCGAATGGTCTGGACCTGCT  170323

Query  235     GACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
               || || || ||||| |||||    || ||||| ||  | ||| |||| || |  |||   
Sbjct  170322  GATGGAGACTGCACGGGCTCCCCACTGGGCTCACAAGTGTACTCTCGTTCGGATTGGTAC  170263

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
               ||  ||  |||||||||||||||||| ||||| ||||| ||||||
Sbjct  170262  AAGAACAAGTGGGCCATCATGTACGCTTGGTACTTCCCCAAAGGC  170218

 Score = 96.0 bits (105),  Expect = 2e-17
 Identities = 227/344 (66%), Gaps = 12/344 (3%)
 Strand=Plus/Minus

Query  121     AAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCT  180
               ||| | || || ||||  ||||| |||||  | ||| |  |||| || ||||||||||||
Sbjct  148146  AAGTCTGCTGTCAAGTACAAACCTCAGCTCCATATCTCGTACGGCTGCCACCCGTACCCT  148087

Query  181     GCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC  240
               || || ||  | |||||||| || | ||  ||| | ||||||   ||   ||   |||| 
Sbjct  148086  GCGGTACAAGAAGATGGCTCAATCAGCGCTGGTTTGAAGTGGGCCGGGTGGCCCAACGGA  148027

Query  241     GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
               || ||||  || ||     | ||||| ||  | ||| | |||||||  |||   || |  
Sbjct  148026  GACTGCAAGGGTTCTGCTTTAGGCTCACAAGTTTACTCGCGCTCCGACTGGTACAAGGGT  147967

Query  301     GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCT  360
                 |||||||||||||||||||||||| || || ||  || ||    || | | ||     
Sbjct  147966  AAGTGGGCCATCATGTACGCCTGGTACTTTCCCAAGAGCCGA----CAATACGTC-----  147916

Query  361     CTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGAC  420
                    ||    ||  || || || |||||| |||||  |||||  || || ||||   ||
Sbjct  147915  ---GACAAATATCGATTTGGCCATCGTCATTACTGGTCGTACGCTATCGTCTGGACAAAC  147859

Query  421     AACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTC  464
               || || ||     | ||||||||||| || ||||| || |||||
Sbjct  147858  AATCCGAACCCAGACAACTCGACCATCCTCGGCGTGTCCATGTC  147815

 Score = 86.9 bits (95),  Expect = 1e-14
 Identities = 154/225 (68%), Gaps = 0/225 (0%)
 Strand=Plus/Minus

Query  114     CTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCC  173
               ||| || ||  | || || |||||||||||||| ||| |  |  |    || ||||||||
Sbjct  127323  CTCGGATAAATCTGCTGTCAAGTTTAAACCACAACTTCACGTTTCTCGGGGATGTCACCC  127264

Query  174     GTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCA  233
                |||||||| ||||||    | || || || |  |||||| | ||||||  |||||  | 
Sbjct  127263  TTACCCTGCAGTTCAGGCTAACGGATCGATCAGTGGAGGTTTAAAGTGGTCTGGACGTCC  127204

Query  234     GGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGT  293
                 |||| || |||| | |  |     | || ||||| |||||| | || || |  ||| |
Sbjct  127203  CAACGGTGACTGCAAAAGTCCTGCTTTAGGGTCTCAAATCTACTCGCGATCGGACTGGTT  127144

Query  294     GAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                || |     |||||||| |||||||| |||||  ||||||||||
Sbjct  127143  CAAGGGGAAATGGGCCATTATGTACGCTTGGTACCTCCCGAAAGG  127099

 Score = 44.6 bits (48),  Expect = 0.036
 Identities = 72/104 (69%), Gaps = 0/104 (0%)
 Strand=Plus/Minus

Query  379     GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAAC  438
               || ||||||||| |||||||||||||| | || |||   |||| | | | |   |  | |
Sbjct  170202  GGCCACCGTCATTACTGGGAGTACGTCGTCGTCTGGGCAGACAGCTCTACGTCTACCAGC  170143

Query  439     TCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTACGC  482
               ||  | || |  ||||| || ||||| || |  |||||  ||||
Sbjct  170142  TCATCAATCCAGGGCGTGTCCATGTCTGCGGGTGTCGGTCACGC  170099

>PHCA:scaffold_14 PHYCAscaffold_14
Length=1100894

 Score = 126 bits (139),  Expect = 1e-26
 Identities = 246/361 (68%), Gaps = 27/361 (7%)
 Strand=Plus/Minus

Query  69      CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
               ||||||||| || | |||||||  ||| ||  | |||||||| |||||||| ||||| ||
Sbjct  996512  CCACGACCAAGTCCAGCCATTCAAGCAACCTGATCCCGTCACAGTCTCCGAAAAGGCCGC  996453

Query  129     AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
               ||||||||| || || ||| |  | ||  |  ||||||| ||||||||||| | || | |
Sbjct  996452  AGTAAAGTTCAAGCCGCAGATCCACATTACGAACGGGTGCCACCCGTACCCCG-CGGTAA  996394

Query  189     GAAGGATGGCT-CCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCA  247
                  ||  || |   | || ||| || || |||  ||  ||  | |    ||  | |||||
Sbjct  996393  CCTGGTGGGGTGAGACTAGCGGTGGCCTGAAGACGAAGGGGGCTCCTAGCGCTGGATGCA  996334

Query  248     CAGGCTC--GAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTG  305
                ||| ||  || |   || || ||| | |||| ||| ||  | ||||| || | ||||||
Sbjct  996333  AAGGGTCCGGATG--GGGGTCGCAGGTATACGGTCGGTCAACCTGGGTAAAGGGCGTGTG  996276

Query  306     GGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTAT  365
               ||| ||||||||| | |||||||| || ||          | | |||| | ||| ||  |
Sbjct  996275  GGCTATCATGTACTCGTGGTATTTTCCCAA----------GGATTCCC-CGTCCACTGGT  996227

Query  366     CACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               |          | || ||||||||  |||||||  | |||||||||||||||||||||||
Sbjct  996226  C----------TGGGCCACCGTCACGACTGGGAACATGTCATTGTGTGGATCGACAACCC  996177

Query  426     C  426
               |
Sbjct  996176  C  996176

 Score = 117 bits (129),  Expect = 7e-24
 Identities = 257/379 (68%), Gaps = 31/379 (8%)
 Strand=Plus/Minus

Query  53      AGGCTCAAGTC-ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACC  111
               |||| |||||  || | ||||||||| ||   ||| ||  | |||||  | |||||||| 
Sbjct  993087  AGGC-CAAGTGGATTGACCACGACCAAGTAAAGCCGTTTGCTCAGCCTGAACCCGTCACG  993029

Query  112     GTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCAC  171
                |||| || ||||| || || ||||  ||||| ||| || | ||||   |||| || |||
Sbjct  993028  ATCTCTGAAAAGGCCGCTGTTAAGTACAAACCCCAGATTCATATCGTAAACGGTTGCCAC  992969

Query  172     CCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGA--C  229
               |||||||| |||||  |  | |  |||   | || ||| ||||| |||   |  |||  |
Sbjct  992968  CCGTACCCAGCCGTGAACGAAGCCGGCGAAACTAGCGGCGGTCTGAAGACCAAGGGAGCC  992909

Query  230     CGCAGGACGGCGAATGCACAGGCTC--GAAGCTCGGCTCTCAGATCTACGCTCGCTCCGC  287
               | |||  ||  | |||||  || ||  || |   || || ||| | ||||  |||||  |
Sbjct  992908  CCCAG--CGCTGGATGCAAGGGGTCCGGATG--GGGGTCGCAGGTATACGGCCGCTCTAC  992853

Query  288     GTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGC  347
               ||||||   ||  || ||||| ||||||||| | ||||||||||| ||          | 
Sbjct  992852  GTGGGTCCGTGGTGTTTGGGCTATCATGTACTCGTGGTATTTCCCCAA----------GG  992803

Query  348     AGTCCCTCTTCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCAT  407
               | |||| | || |       || |||   |||| ||||||||  |||||||| |||| ||
Sbjct  992802  ATTCCC-CGTCGT-------CCGGTC---TCGGCCACCGTCACGACTGGGAGCACGTTAT  992754

Query  408     TGTGTGGATCGACAACCCC  426
                ||||||||||| ||||||
Sbjct  992753  CGTGTGGATCGATAACCCC  992735

 Score = 72.5 bits (79),  Expect = 3e-10
 Identities = 241/368 (65%), Gaps = 33/368 (9%)
 Strand=Plus/Minus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               |||| ||| ||||| ||    |||||| |||| ||  | || |||||  |||| || || 
Sbjct  998267  ATCGACCATGACCAAGTGAAACCATTCGCGCAACCTGAACCTGTCACTATCTCTGAAAAA  998208

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                |||| || ||||| ||||| |||||  | ||| |  |||| |||||  ||||||| || 
Sbjct  998207  ACAGCGGTCAAGTTCAAACCGCAGCTCCACATCACGAACGGATGTCATTCGTACCCCGCA  998148

Query  184     GTTCA-GAAG--GATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGC--AGGACG  238
               ||  | ||||  | ||   ||  |   || |||||||||  ||  ||| | |  ||  | 
Sbjct  998147  GTGGACGAAGCCGGTGAAACCGGT---GGCGGTCTCAAGACGAAGGGAGCTCCAAGTGCA  998091

Query  239     GCGAATGCACAGGCTCGAAGCTCGGCT-CTCAGATCTACGCTCGCTCCGCGTGGGTGAAT  297
               | |  ||||  || ||   ||| || | ||||  | || |  || || |  |||    | 
Sbjct  998090  GGG--TGCAAGGGTTCTG-GCTGGGGTTCTCAAGTGTATGGACGTTCGGGTTGGTACCAG  998034

Query  298     GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTT  357
               || || ||||| |||||||||  |||||||||||| || |    | |  |       |||
Sbjct  998033  GATGTCTGGGCGATCATGTACTGCTGGTATTTCCCTAAGG----ATGAAC-------CTT  997985

Query  358     CCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATC  417
               ||||       | || ||   ||||| || ||  |||||||| | || ||||||||||||
Sbjct  997984  CCTC-------CGGTATT---GGACATCGCCACGACTGGGAGCATGTTATTGTGTGGATC  997935

Query  418     GACAACCC  425
               ||||||||
Sbjct  997934  GACAACCC  997927

>PHRA:scaffold_21
Length=583437

 Score = 125 bits (138),  Expect = 1e-26
 Identities = 196/278 (71%), Gaps = 2/278 (1%)
 Strand=Plus/Minus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               |||| ||||||| |||| |  |||||| |||| ||  |||| |||||| ||||||| |||
Sbjct  314405  ATCGACCACGACAAGGTGCAACCATTCGCGCAACCCGAGCCTGTCACCATCTCCGAGAAG  314346

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
               || || ||  | ||||| ||   |||  | |||  ||  || || |||||||||||||| 
Sbjct  314345  GCCGCCGTCCAATTTAAGCCGAGGCTGCAGATCTTCGGTGGTTGCCACCCGTACCCTGCT  314286

Query  184     GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
               ||  |    | |||    |  |  | |||||| ||| |||  ||  | || || || || 
Sbjct  314285  GTCAATGCTGCTGGTGAGACCAGTGCAGGTCTAAAGGGGACAGGTACTCATGATGGAGAT  314226

Query  244     TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGG-GTGAATGACGT  302
               ||||   | ||||   | ||||| ||| | ||||  || ||||  |||  || | ||| |
Sbjct  314225  TGCATGAGGTCGAGATTGGGCTCGCAGGTGTACGGCCGATCCGTCTGGTATGGA-GACCT  314167

Query  303     GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
               ||||| |||||||||||| |||||||||||||||| ||
Sbjct  314166  GTGGGGCATCATGTACGCGTGGTATTTCCCGAAAGACA  314129

 Score = 65.3 bits (71),  Expect = 4e-08
 Identities = 238/366 (65%), Gaps = 29/366 (8%)
 Strand=Plus/Plus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               || || |||||  ||||    || || || || ||| | || |||||  ||||||| || 
Sbjct  510195  ATTGGTCACGATGAGGTCGTCCCGTTTCCTCAACCAGAACCTGTCACGATCTCCGAAAAA  510254

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
               || || || | ||| || ||  || || | ||| || |||| |||||||| ||||| || 
Sbjct  510255  GCGGCCGTCAGGTTCAAGCCTGAGATTCACATCACCAACGGATGTCACCCATACCCCGCT  510314

Query  184     GTTCA-GAAGGATGGCTCCATTACCGGAGGTCT-CAAG-TGGAGTGGACCGCAGGACGGC  240
               ||    ||||   || |  |  |  || || || |||| |   |  | || |||  |  |
Sbjct  510315  GTGAGCGAAGCGGGGATG-ACAAGTGGTGGGCTTCAAGCTACCGGAGGCCCCAGTTC--C  510371

Query  241     GAATGCACAGGCTCGAAGCTCGGCT-CTCAGATCTACGCTCGCTCCGCGTGGGTGAATGA  299
                |||||| ||| ||   ||| || | | ||||| ||||  || ||  | |||   | || 
Sbjct  510372  AAATGCAAAGGTTCTG-GCTGGGGTTCGCAGATGTACGGCCGTTCTACTTGGTATAGTGG  510430

Query  300     CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCC  359
                |||||||| ||||||||| ||||||| |||||||||| |      || ||||       
Sbjct  510431  TGTGTGGGCTATCATGTACACCTGGTACTTCCCGAAAGACTC----GCCGTCC-------  510479

Query  360     TCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGA  419
                      || || ||    |||||||| ||  |||||||| | ||  | |||||||||||
Sbjct  510480  -------ACGCGCCTG---GGACACCGCCACGACTGGGAGCATGTTGTCGTGTGGATCGA  510529

Query  420     CAACCC  425
                |||||
Sbjct  510530  TAACCC  510535

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  19     CTCCTCGTCCTCGTCGCTTCGCTTGCAGGAGCCCAGGC  56
              |||||||||||||  ||  | ||| |||||||||| ||
Sbjct  88235  CTCCTCGTCCTCGAGGCCCCACTTCCAGGAGCCCACGC  88198

>PHCA:scaffold_36 PHYCAscaffold_36
Length=679425

 Score = 124 bits (137),  Expect = 5e-26
 Identities = 324/484 (67%), Gaps = 19/484 (4%)
 Strand=Plus/Minus

Query  69      CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
               ||||||||| || | ||| ||| | |||||  ||||    |||   || || ||  | ||
Sbjct  258612  CCACGACCAAGTGCAGCCGTTCGCCCAGCCTGAGCCAACAACCAATTCAGAGAAATCCGC  258553

Query  129     AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
                || || |  || || || ||  | ||  | ||||| |||||||||||||||||||||||
Sbjct  258552  TGTTAAATACAAGCCCCAACTCCACATTTCGGACGGATGTCACCCGTACCCTGCCGTTCA  258493

Query  189     GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGG-ACCGCAGGACGGCGAATGCA  247
               |  ||| ||  || |||  |  ||  | ||||||  ||| || ||  |  ||  ||||||
Sbjct  258492  GGCGGACGGAGCCGTTAGTGCTGGATTGAAGTGGGCTGGTACAGCTAG-TGGTCAATGCA  258434

Query  248     CAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGG  307
                 |||||    || || |||||  | ||  | || ||||  |||   ||  ||  |||||
Sbjct  258433  AGGGCTCCGGACTGGGATCTCAAGTGTATTCACGTTCCGACTGGTACAAGAACAAGTGGG  258374

Query  308     CCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCA  367
               | ||||||||||||||||| ||||| |||||  ||    |||| | || |||   ||   
Sbjct  258373  CGATCATGTACGCCTGGTACTTCCCTAAAGGTCGA----CAGTACATC-TCCAAGTA---  258322

Query  368     CCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCA  427
                ||| ||||  || ||||||||   ||||  ||| |  ||||||||||| ||||      
Sbjct  258321  -CCG-CTTT--GGTCACCGTCACTTCTGGTCGTATGCTATTGTGTGGATGGACAGTGATG  258266

Query  428     AGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTAC-GCTAGC  486
                |  | | |||||||||||||| || || || ||||| ||||  || || ||| || || 
Sbjct  258265  TGCCCGACAACTCGACCATTCTCGGGGTCTCTATGTCTGCTGGTGTTGGCTACAGCAAG-  258207

Query  487     CAGACGCCCCCTGAAGCGATGTA---TGTGGATGGCGACAGTGTCAAGCTCGAGTACTAC  543
                | ||||| ||  |  | | |||   ||| ||||||   | ||| ||| || |||  |||
Sbjct  258206  GAAACGCCTCCAAAGTCCAAGTACGTTGTTGATGGCACTACTGTTAAGTTCAAGTCGTAC  258147

Query  544     TACA  547
                |||
Sbjct  258146  CACA  258143

 Score = 123 bits (136),  Expect = 5e-26
 Identities = 366/561 (65%), Gaps = 34/561 (6%)
 Strand=Plus/Plus

Query  69      CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
               ||||||||| || | ||| ||  | || ||  ||||  | |||| |||  | ||| | ||
Sbjct  238350  CCACGACCAAGTGCAGCCTTTTGCCCAACCGGAGCCAATTACCGACTCGCAAAAGTCGGC  238409

Query  129     AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
                || ||||  || || |||||  | ||| |  |||| || ||||||||  |||| |||||
Sbjct  238410  TGTCAAGTACAAGCCTCAGCTCCACATCTCGTACGGCTGCCACCCGTATGCTGCAGTTCA  238469

Query  189     GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAG-GACGGCGAATGCA  247
                   || || ||    |  || || ||| |||||   || ||||   || || || || |
Sbjct  238470  AGCTGACGGGTCGGCAAGTGGTGGCCTCGAGTGGTCAGG-CCGCGTTGATGGAGACTGTA  238528

Query  248     CAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGG  307
               | |||||  |  | ||||| ||| | ||  | ||||| |  |||    |||||  |||||
Sbjct  238529  CGGGCTCTCAATTGGGCTCGCAGGTGTATTCGCGCTCGGACTGGTACCATGACAAGTGGG  238588

Query  308     CCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCA  367
               ||||||||||||||||||| ||||| || ||| ||       | || |||          
Sbjct  238589  CCATCATGTACGCCTGGTACTTCCCTAAGGGCCGA-------TACCACTT----------  238631

Query  368     CCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCA  427
                  ||      || ||||||||  ||||||||||||  ||||| ||||  |||| |||||
Sbjct  238632  -GGGT------GGCCACCGTCACTACTGGGAGTACGCTATTGTCTGGACGGACAGCCCCA  238684

Query  428     AGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTACGCTAGCC  487
                |   |  |||||| ||||||  || || || ||||| ||||  || || |||| ||   
Sbjct  238685  CGTCTAGTAACTCGTCCATTCAGGGAGTGTCCATGTCTGCTGGTGTTGGCTACGGTAAAG  238744

Query  488     AGACGCCCCCTGAAGC-GATGTATGTGGATGGCGACAGTGTCAAGCTCGAGTACTACTAC  546
                 || || || || ||  | |||  | || ||| ||||| ||||| |||| |   ||| |
Sbjct  238745  CTACTCCTCC-GATGCTTAAGTACATTGACGGCAACAGTATCAAGTTCGACTCGCACTTC  238803

Query  547     AACCATCTCTTAGGCAGCA---CATCCCTGCAGCTCACGGAAGACACGGGGGAATTCCAG  603
               | |   || || |||| ||   |  | || || || ||  | ||  | || ||    |||
Sbjct  238804  AGC---CTTTTGGGCAACAAGGCTGCTCTTCAACTTACCAAGGAAGCTGGAGAGCGTCAG  238860

Query  604     GACCTCATTACATGGGACGAA  624
               |||||||| ||||||||| ||
Sbjct  238861  GACCTCATCACATGGGACCAA  238881

 Score = 112 bits (123),  Expect = 3e-22
 Identities = 222/323 (69%), Gaps = 17/323 (5%)
 Strand=Plus/Plus

Query  160     GACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAG  219
               ||||| ||||||||||||||||||||||||  ||| ||  || |||  |  ||  | |||
Sbjct  210449  GACGGATGTCACCCGTACCCTGCCGTTCAGGCGGACGGAGCCGTTAGTGCTGGATTGAAG  210508

Query  220     TGGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCT  279
               |||  |||  |      |||  ||||||  |||||  | || || |||||  | ||| | 
Sbjct  210509  TGGGCTGGTTCAGTTAGCGGTCAATGCAAGGGCTCTGATCTGGGATCTCAAGTATACTCG  210568

Query  280     CGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
               || ||||  |  ||| | |||  |||||| || |||||||||||||| ||||| ||||| 
Sbjct  210569  CGTTCCGACT-TGTGCAAGACAAGTGGGCGATTATGTACGCCTGGTACTTCCCTAAAGGT  210627

Query  340     AGAGGGGCAGTCCCTCTTCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAG  399
                ||    |||| | |    |||| |  |||   ||||  || ||||||||   ||||  |
Sbjct  210628  CGA----CAGTACAT----CTCTAAGTACC--GCTTT--GGTCACCGTCACTTCTGGTCG  210675

Query  400     TACGTCATTGTGTGGATCGACAACCCCAAGAGC--AAAAACTCGACCATTCTTGGCGTAT  457
               || |  ||||||||||| ||||     | | ||   | |||||||||||||| || || |
Sbjct  210676  TATGCTATTGTGTGGATGGACA--GTGATGTGCCTGACAACTCGACCATTCTCGGAGTCT  210733

Query  458     CGATGTCGGCTGCAGTCGGGTAC  480
               | ||||| ||||  || || |||
Sbjct  210734  CTATGTCTGCTGGTGTTGGCTAC  210756

 Score = 104 bits (115),  Expect = 4e-20
 Identities = 191/280 (68%), Gaps = 0/280 (0%)
 Strand=Plus/Plus

Query  63      CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
               ||||| |||||||   ||   ||||||||| || || || |||   || | ||| || ||
Sbjct  250436  CATCGACCACGACACCGTCAAGCCATTCCCCCAACCGAAACCCAAGACGGACTCGGAGAA  250495

Query  123     GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
               ||||||||| ||||  ||||| || ||     || |  ||||||||||||| ||||||||
Sbjct  250496  GGCAGCAGTCAAGTACAAACCCCAACTCCTCGTCTCTTACGGGTGTCACCCATACCCTGC  250555

Query  183     CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
                || ||    ||||| ||| | |  |  || |||||  | | ||||||    | ||| ||
Sbjct  250556  TGTACAAGCTGATGGGTCCGTGAGTGCTGGACTCAAAGGAACTGGACCAGCTGCCGGAGA  250615

Query  243     ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
               |||    || ||    ||||| |||||  ||||  | || || |  |||   || |||  
Sbjct  250616  ATGTGGGGGTTCCGCTCTCGGTTCTCAAGTCTATTCGCGTTCGGATTGGTACAAGGACAA  250675

Query  303     GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGA  342
               |||||| |||||||||  ||||||| | || || || |||
Sbjct  250676  GTGGGCTATCATGTACAGCTGGTATCTGCCAAAGGGAAGA  250715

 Score = 100 bits (110),  Expect = 5e-19
 Identities = 259/397 (65%), Gaps = 16/397 (4%)
 Strand=Plus/Minus

Query  70      CACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCA  129
               |||||||| || | ||| ||| | |||||  | ||   ||||| ||| || ||  | || 
Sbjct  257596  CACGACCAAGTGCAGCCGTTCACCCAGCCTGAACCAACCACCGACTCGGAGAAATCTGCC  257537

Query  130     GTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAG  189
               || ||||  || || || ||  | ||  | ||||| |||||||| |||||||| || || 
Sbjct  257536  GTCAAGTACAAGCCGCAACTCCACATTTCGGACGGATGTCACCCATACCCTGCAGTCCAA  257477

Query  190     AAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACA  249
                 | | || ||  |||  || ||||| || |||  ||||  |   || || || || |  
Sbjct  257476  GCGAACGGATCTGTTAGTGGGGGTCTGAAATGGGCTGGAAGGTCTGATGGAGACTGTAAG  257417

Query  250     GGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCC  309
                | ||     | ||||| || |||||  | || ||||  |||   || |||  |||||| 
Sbjct  257416  CGTTCTGCTTTGGGCTCCCAAATCTATTCACGTTCCGATTGGCATAACGACAAGTGGGCG  257357

Query  310     ATCATGTACGCCTGGTATTTCCCGAAAGGCA--GAGGGGCAGTCCCTCTTCCTCTTATCA  367
               ||||||||||||||||| ||||| ||||| |  |||   ||| |    |||         
Sbjct  257356  ATCATGTACGCCTGGTACTTCCCCAAAGGAAATGAGTTCCAGGCGAATTTC---------  257306

Query  368     CCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCA  427
                      || ||| ||||||||  |||||  |||||  || |||||||  | ||  || |
Sbjct  257305  -----GATTCCGGCCACCGTCACTACTGGTCGTACGCGATCGTGTGGACTGGCAGTCCAA  257251

Query  428     AGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTC  464
               |     | ||||||||  ||||||| || ||||||||
Sbjct  257250  ACCCAGAGAACTCGACTGTTCTTGGTGTGTCGATGTC  257214

 Score = 90.6 bits (99),  Expect = 1e-15
 Identities = 184/271 (68%), Gaps = 2/271 (1%)
 Strand=Plus/Minus

Query  69      CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCG-TCACCGTCTCCGACAAGGCAG  127
               ||||||| ||||   ||||||| | ||||| |  |||  | || || || ||  | || |
Sbjct  260979  CCACGACAAGGTGAAGCCATTCGCTCAGCCGATACCCACTAACAGTTTC-GAGGAAGCTG  260921

Query  128     CAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTC  187
               |||| ||||  |||||  |||||    || || | || ||||||||||||||||| || |
Sbjct  260920  CAGTCAAGTACAAACCGGAGCTTTTCGTCTCCTATGGTTGTCACCCGTACCCTGCAGTAC  260861

Query  188     AGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCA  247
               ||    |||| ||  | |  |  |||||| |  | || || ||  | || || || || |
Sbjct  260860  AGGCCAATGGATCTGTGAGTGCTGGTCTCGAAGGAAGCGGCCCAGACGATGGAGAGTGTA  260801

Query  248     CAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGG  307
                 || ||    |||||||||||  | ||  | || || |  |||   ||||||  |||||
Sbjct  260800  AGGGATCTCGTCTCGGCTCTCAAGTGTATTCACGTTCGGACTGGTACAATGACAAGTGGG  260741

Query  308     CCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               | ||||||||| |||||||  | || |||||
Sbjct  260740  CTATCATGTACACCTGGTACCTGCCTAAAGG  260710

 Score = 81.5 bits (89),  Expect = 5e-13
 Identities = 179/259 (69%), Gaps = 21/259 (8%)
 Strand=Plus/Plus

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCT  354
               || |||  |||||| ||||||||||||||||| ||||| |||||  ||    |||| | |
Sbjct  236647  AAGGACAAGTGGGCGATCATGTACGCCTGGTACTTCCCTAAAGGTCGA----CAGTACAT  236702

Query  355     CTTCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGG  414
               | |||   ||    ||| ||||  || ||||||||  |||||   || |  |||||||||
Sbjct  236703  C-TCCAAGTA----CCG-CTTT--GGTCACCGTCACTACTGGTCATATGCTATTGTGTGG  236754

Query  415     ATCGACAACCCCAAGAGC--AAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAG  472
               || ||||     | | ||   | |||||||||||||| || || || ||||| ||||  |
Sbjct  236755  ATGGACA--GTGATGTGCCTGACAACTCGACCATTCTCGGAGTCTCTATGTCTGCTGGTG  236812

Query  473     TCGGGTAC-GCTAGCCAGACGCCCCCTGAAGCGATGTA---TGTGGATGGCGACAGTGTC  528
               | || ||| || ||  | ||||| ||  |  | | |||   ||| ||||||   | ||| 
Sbjct  236813  TTGGCTACAGCAAG-GAAACGCCTCCAAAGTCCAAGTACGTTGTTGATGGCACTACTGTT  236871

Query  529     AAGCTCGAGTACTACTACA  547
               ||| ||||||  ||| |||
Sbjct  236872  AAGTTCGAGTCGTACCACA  236890

 Score = 63.5 bits (69),  Expect = 1e-07
 Identities = 96/137 (70%), Gaps = 0/137 (0%)
 Strand=Plus/Plus

Query  69      CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
               ||||||||| || | ||| ||| | |||||  ||||    |||   || || ||  | ||
Sbjct  236050  CCACGACCAAGTGCAGCCGTTCGCCCAGCCTGAGCCAACAACCAATTCAGAGAAATCCGC  236109

Query  129     AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
                || || |  || || || ||  | ||  | ||||| |||||||||||||||||||||||
Sbjct  236110  TGTTAAATACAAGCCGCAACTCCACATTTCGGACGGATGTCACCCGTACCCTGCCGTTCA  236169

Query  189     GAAGGATGGCTCCATTA  205
               |  ||| ||  || |||
Sbjct  236170  GGCGGACGGAGCCGTTA  236186

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 40/44 (91%), Gaps = 0/44 (0%)
 Strand=Plus/Plus

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               || || |||||||||||||||||| ||||||| |||||||||||
Sbjct  198089  AAGGATGTGTGGGCCATCATGTACTCCTGGTACTTCCCGAAAGG  198132

 Score = 42.8 bits (46),  Expect = 0.13
 Identities = 32/38 (84%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCC  332
               || |||  |||||| ||||||||||||||||| | |||
Sbjct  237405  AAGGACAAGTGGGCGATCATGTACGCCTGGTACTACCC  237442

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  601     CAGGACCTCATTACATGGGACGAACT  626
               ||||||||||||||||||||  ||||
Sbjct  250950  CAGGACCTCATTACATGGGAGCAACT  250975

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 42/56 (75%), Gaps = 0/56 (0%)
 Strand=Plus/Plus

Query  700     ATGCCGCTGAAGGACGGGGTGTTCCAGGAGCTACTAGACAAGGCATGGCCGTTTTA  755
               |||||  ||||||||||||| ||| || ||  |||  |  | || ||||| |||||
Sbjct  251049  ATGCCTTTGAAGGACGGGGTTTTCGAGAAGAGACTGAAAGATGCGTGGCCATTTTA  251104

>PHIF:NW_003303754.1 Phytophthora infestans T30-4 supercont1.5 
genomic scaffold, whole genome shotgun sequence
Length=4768765

 Score = 123 bits (136),  Expect = 5e-26
 Identities = 234/345 (68%), Gaps = 6/345 (2%)
 Strand=Plus/Plus

Query  1        ATGAACTTTCGGATCGTCCTCCTCGTCCTCGTCGCTTCGCTTGCAGGAGCCCAGGCTCAA  60
                |||||| | ||   | ||||| ||| |  ||||||||| || || | |||| | ||| ||
Sbjct  2561183  ATGAACCTCCGCGCCTTCCTCATCGCCGCCGTCGCTTCCCTAGCTGTAGCCAATGCTAAA  2561242

Query  61       GTCATCGG------CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTC  114
                |||| | |      ||||||  | || | ||| ||| | || ||    ||  |||||| |
Sbjct  2561243  GTCAGCCGAGTCAACCACGATGAAGTGCAGCCGTTCACCCAACCGCTACCGATCACCGAC  2561302

Query  115      TCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCG  174
                ||  | ||| | || || ||||  ||||| |||||  | ||  |  | || |||||||||
Sbjct  2561303  TCACAGAAGTCTGCTGTCAAGTACAAACCCCAGCTCCACATATCGTATGGATGTCACCCG  2561362

Query  175      TACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAG  234
                |||||||| ||  |     | |||||   ||  || |||||| | |||  ||||||    
Sbjct  2561363  TACCCTGCTGTCGAACCCAACGGCTCTGCTAGTGGCGGTCTCGAATGGTCTGGACCTGCT  2561422

Query  235      GACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
                || || || ||||| |||||    || ||||| ||  | ||| |||| || |  |||   
Sbjct  2561423  GATGGAGACTGCACGGGCTCCCCACTGGGCTCACAAGTGTACTCTCGTTCGGATTGGTAC  2561482

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
                ||  ||  |||||||||||||||||| ||||| ||||| ||||||
Sbjct  2561483  AAGAACAAGTGGGCCATCATGTACGCTTGGTACTTCCCCAAAGGC  2561527

 Score = 116 bits (128),  Expect = 7e-24
 Identities = 191/272 (70%), Gaps = 4/272 (1%)
 Strand=Plus/Minus

Query  69       CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
                ||| ||||| || | ||| |||  ||||  ||| || | ||| | ||| || ||| | ||
Sbjct  2638135  CCATGACCAAGTGCAGCCGTTCGAGCAGATAAAACCAGCCACAGACTCGGAGAAGTCTGC  2638076

Query  129      AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
                  | ||||  || || || ||  | ||| | ||||| ||||| ||||||||||| || ||
Sbjct  2638075  CATCAAGTACAAGCCGCAACTGCATATCTCGGACGGATGTCATCCGTACCCTGCTGTCCA  2638016

Query  189      GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCAC  248
                ||   | ||||| || |  |||||| | || |||   ||   |    |||| || |||| 
Sbjct  2638015  GAGCAACGGCTCAATCAGTGGAGGTTTGAAATGGTCCGGTAAGGCCAACGGTGACTGCAA  2637956

Query  249      AG-GCTCGAAGCTCGGC-TCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGG  306
                || ||  |  ||| ||  || ||| ||||| | |||||||| ||| | || | |  ||||
Sbjct  2637955  AGAGCCTG--GCTTGGGGTCCCAGGTCTACTCGCGCTCCGCCTGGTTCAAGGGCAAGTGG  2637898

Query  307      GCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                |||||||||||||| ||||| |||||||| ||
Sbjct  2637897  GCCATCATGTACGCTTGGTACTTCCCGAAGGG  2637866

 Score = 105 bits (116),  Expect = 1e-20
 Identities = 230/345 (67%), Gaps = 6/345 (2%)
 Strand=Plus/Minus

Query  1        ATGAACTTTCGGATCGTCCTCCTCGTCCTCGTCGCTTCGCTTGCAGGAGCCCAGGCTCAA  60
                |||||| | ||   | ||||  ||| |  |||||||||  |  | |  ||| | ||| ||
Sbjct  2233933  ATGAACCTCCGCGCCTTCCTTATCGCCGCCGTCGCTTCCATAACTGTTGCCAATGCTAAA  2233874

Query  61       GTCATCGG------CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTC  114
                |||| | |      ||||||  | || | ||| ||| | |||||    ||  |||||| |
Sbjct  2233873  GTCAGCCGAGTCAACCACGATGAAGTGCAGCCGTTCGCCCAGCCGCTACCAATCACCGAC  2233814

Query  115      TCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCG  174
                ||  | ||| | || || ||||  ||||| |||||  | ||  |  | || |||||||||
Sbjct  2233813  TCACAGAAGTCTGCTGTCAAGTACAAACCCCAGCTCCACATATCGTATGGATGTCACCCG  2233754

Query  175      TACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAG  234
                |||||||||||  ||    |  |||    ||  || |||||| | |||   |||||    
Sbjct  2233753  TACCCTGCCGTCGAGCCCAACAGCTATGCTAGTGGCGGTCTCGAATGGCCAGGACCTGCT  2233694

Query  235      GACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
                || || || ||||| |||||   ||| ||||| ||  | ||| |||| || |  |||   
Sbjct  2233693  GATGGAGACTGCACGGGCTCTCCGCTGGGCTCACAAGTGTACTCTCGTTCGGATTGGTAC  2233634

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
                ||  ||   ||||||||||||||||| ||||| ||||| ||||||
Sbjct  2233633  AAGAACAAATGGGCCATCATGTACGCTTGGTACTTCCCCAAAGGC  2233589

 Score = 97.8 bits (107),  Expect = 7e-18
 Identities = 187/276 (68%), Gaps = 0/276 (0%)
 Strand=Plus/Minus

Query  63       CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
                ||||  ||||||| | ||    || ||  ||||||| || ||    |||| ||| ||   
Sbjct  2510748  CATCAACCACGACGAAGTCAAACCGTTTGCGCAGCCCAAACCAACGACCGACTCGGAGGT  2510689

Query  123      GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
                ||| || || || |  || || |||||  |  || |  |||| |||| |||||| || ||
Sbjct  2510688  GGCCGCCGTCAAATACAAGCCTCAGCTCTACGTCTCGTACGGCTGTCGCCCGTATCCGGC  2510629

Query  183      CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
                ||| |||   || || ||| | |  |  ||||||||  | ||||||||   ||| |||||
Sbjct  2510628  CGTGCAGGCTGACGGGTCCGTAAGTGCTGGTCTCAAAGGAAGTGGACCAATGGATGGCGA  2510569

Query  243      ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
                 |||   ||||||  | | ||||||||| | ||  |||| ||  | |||    | |||  
Sbjct  2510568  GTGCGAGGGCTCGCCGTTGGGCTCTCAGGTGTATTCTCGTTCGACCTGGTATGAGGACAA  2510509

Query  303      GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                ||||||||||||||| || |||||  | || |||||
Sbjct  2510508  GTGGGCCATCATGTATGCGTGGTACCTTCCCAAAGG  2510473

 Score = 77.9 bits (85),  Expect = 6e-12
 Identities = 152/225 (68%), Gaps = 0/225 (0%)
 Strand=Plus/Plus

Query  114      CTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCC  173
                ||| || ||||| || || || |  || ||  | ||  |  || || |||| ||||||||
Sbjct  2123463  CTCGGAGAAGGCCGCTGTCAAATACAAGCCGAAACTCTACGTCTCCTACGGCTGTCACCC  2123522

Query  174      GTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCA  233
                ||| || ||||| |||    |||| |   | |  |  || || ||  |||||||||||  
Sbjct  2123523  GTATCCCGCCGTGCAGGCCAATGGATTTGTAAGTGCTGGACTTAAAGGGAGTGGACCGAT  2123582

Query  234      GGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGT  293
                 || ||||| |||   |||||    || ||||||||  | ||  |||| ||   ||||  
Sbjct  2123583  AGATGGCGAGTGCGAGGGCTCATCTCTGGGCTCTCAAGTGTATTCTCGTTCGATGTGGTA  2123642

Query  294      GAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                  | |||  |||||| |||||||| ||||||||  |||| |||||
Sbjct  2123643  CGAGGACAAGTGGGCTATCATGTATGCCTGGTACCTCCCAAAAGG  2123687

 Score = 77.9 bits (85),  Expect = 6e-12
 Identities = 152/225 (68%), Gaps = 0/225 (0%)
 Strand=Plus/Minus

Query  114      CTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCC  173
                ||| || ||  | || || ||||||||||||||  || |  |  |    || ||||||||
Sbjct  2536917  CTCGGATAAATCTGCTGTCAAGTTTAAACCACAATTTCACGTTTCTCGGGGATGTCACCC  2536858

Query  174      GTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCA  233
                 |||||||| ||||||    | || || || |  |||||| | ||||||  |||||  | 
Sbjct  2536857  TTACCCTGCAGTTCAGGCTAACGGATCGATCAGTGGAGGTTTAAAGTGGTCTGGACGTCC  2536798

Query  234      GGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGT  293
                  |||| || |||| | |  |     | || |||||  ||||| | || || |  ||| |
Sbjct  2536797  CAACGGTGACTGCAAAAGTCCTGCTTTAGGGTCTCAAGTCTACTCGCGATCGGACTGGTT  2536738

Query  294      GAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                 || |     |||||||| |||||||| |||||  ||||||||||
Sbjct  2536737  CAAGGGGAAATGGGCCATTATGTACGCTTGGTACCTCCCGAAAGG  2536693

 Score = 60.8 bits (66),  Expect = 5e-07
 Identities = 141/213 (66%), Gaps = 0/213 (0%)
 Strand=Plus/Minus

Query  114      CTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCC  173
                ||| || ||||| || || || |  || ||  ||||  |  || || |||| ||||||||
Sbjct  2124645  CTCGGAGAAGGCCGCTGTCAAATACAAGCCGAAGCTCTACGTCTCCTACGGCTGTCACCC  2124586

Query  174      GTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCA  233
                ||| || ||||| |||    |||| |   | |  |  || || ||  |||||||||||  
Sbjct  2124585  GTATCCCGCCGTGCAGGCCAATGGATTTGTAAGTGCTGGACTTAAAGGGAGTGGACCGAT  2124526

Query  234      GGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGT  293
                 || ||||| |||   |||||    || ||||||||  | ||  |||| ||   ||||  
Sbjct  2124525  AGATGGCGAGTGCGAGGGCTCATCTCTGGGCTCTCAAGTGTATTCTCGTTCGATGTGGTA  2124466

Query  294      GAATGACGTGTGGGCCATCATGTACGCCTGGTA  326
                  | ||   ||||||||||||  | || |||||
Sbjct  2124465  CGAGGATAAGTGGGCCATCATAAATGCTTGGTA  2124433

 Score = 53.6 bits (58),  Expect = 7e-05
 Identities = 74/104 (71%), Gaps = 0/104 (0%)
 Strand=Plus/Minus

Query  379      GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAAC  438
                || ||||||||| |||||||||||||| | || ||||  || | ||| | |   |  |||
Sbjct  2233573  GGCCACCGTCATTACTGGGAGTACGTCGTCGTCTGGACAGATACCCCTACGTCGACCAAC  2233514

Query  439      TCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTACGC  482
                ||  | || |  ||||| || ||||| || |  |||||  ||||
Sbjct  2233513  TCATCAATCCAGGGCGTGTCCATGTCTGCGGGTGTCGGTCACGC  2233470

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 73/104 (70%), Gaps = 0/104 (0%)
 Strand=Plus/Plus

Query  379      GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAAC  438
                || ||||||||| |||||||||||||| | || |||   |||| | | | |   |  |||
Sbjct  2561543  GGCCACCGTCATTACTGGGAGTACGTCGTCGTCTGGGCAGACAGCTCTACGTCTACCAAC  2561602

Query  439      TCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTACGC  482
                ||  | || |  ||||| || ||||| || |  |||||  ||||
Sbjct  2561603  TCATCAATCCAGGGCGTGTCCATGTCTGCGGGTGTCGGTCACGC  2561646

>PHIF:NW_003303731.1 Phytophthora infestans T30-4 supercont1.28 
genomic scaffold, whole genome shotgun sequence
Length=2122445

 Score = 123 bits (136),  Expect = 5e-26
 Identities = 424/657 (65%), Gaps = 32/657 (5%)
 Strand=Plus/Minus

Query  78       GGTTCGGCCATTCCCGCAGCCAAAGCCCGTC-ACCGTCTCCGACAAGGCAGCAGTAAAGT  136
                ||||||||||||||| |||| ||  |||| | || | | |  | |||||     | ||||
Sbjct  1208607  GGTTCGGCCATTCCCCCAGC-AAGTCCCGACCACTGACGCTCAAAAGGCTATTCTCAAGT  1208549

Query  137      TTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATG  196
                  || || ||||| ||||| |  || ||||| ||||||||||| || || || ||||| |
Sbjct  1208548  ACAAGCCCCAGCTAAAAATTGAGGAGGGGTGCCACCCGTACCCGGCAGTACAAAAGGACG  1208489

Query  197      GCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGA  256
                |  |||| |   | |||||||           ||| |  ||  ||  ||||  ||| |  
Sbjct  1208488  GTGCCATCAGTAGTGGTCTCAG----------CCGAACAACATCGGGTGCAAGGGCCCAT  1208439

Query  257      AGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGT  316
                  || ||| |||| || |||||||| ||  | ||| |||| | |  ||||||| | ||||
Sbjct  1208438  CTCTGGGCGCTCAAATTTACGCTCGTTCGACTTGGTTGAAGGGCAAGTGGGCCGTGATGT  1208379

Query  317      ACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCACCCGTCTTT  376
                |||| ||||| || || || ||  | | | || |||||   ||       || |  || |
Sbjct  1208378  ACGCTTGGTACTTTCCTAAGGGGCGTGCGCCAATCCCTGCCCC-------ACGCTCCTAT  1208326

Query  377      TCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAA  436
                  || || || ||   ||||||||| |   | || ||| | | | |  | | | || || 
Sbjct  1208325  --GGCCATCGCCACGGCTGGGAGTATGCGGTCGTCTGGCTGGGCGAAGCTA-GTGCCAAT  1208269

Query  437      ACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTACGCTAGCCAGACGCCCC  496
                 |  ||||||||||||   ||| ||||| || ||  |||| |  || |   |  | ||  
Sbjct  1208268  GC--GACCATTCTTGGTACATCCATGTCAGCAGCCATCGGATGGGCGAAGGAATCCCCGA  1208211

Query  497      CTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGAGTACTACTACAACCA----T  552
                ||  |  |  |||| |||||||  ||||| | | | | |  ||||||| |||| |    |
Sbjct  1208210  CTCCAAAGGAGTATCTGGATGGTAACAGTTTGATGGTTGCATACTACTTCAACGACGATT  1208151

Query  553      CTCTTAGGCAGCACATCCCTGCAGCTCACGGAAGACACGGGGGAATTCCAGGACCTCATT  612
                || |    ||  ||  |  |  |   ||| || ||| | || || ||||| ||||| || 
Sbjct  1208150  CTAT----CAATACCGCGGTCAAATACACTGAGGACGCTGGTGAGTTCCAAGACCTTATC  1208095

Query  613      ACATGGGACGAACTCTCGAAGCTGGCACGATACTCTCTGAACCACACAGACTGGGACGAG  672
                ||||||||| | || ||| | || || ||  || ||||     | ||||| ||||| |||
Sbjct  1208094  ACATGGGACCAGCTTTCGGATCTTGCTCGGGACGCTCTAGTTAAGACAGATTGGGATGAG  1208035

Query  673      ACTCTGTTCGACTTGGCAGGCCTCAAGATGCCGCTGAAGGACGGGGTGTTCCAGGAG  729
                || || ||| |  | ||  || ||||||||||| ||||||| || || |||  ||||
Sbjct  1208034  ACGCTTTTCAATGTAGCTCGCGTCAAGATGCCGATGAAGGATGGAGTCTTCGTGGAG  1207978

>PHSO:scaffold_5
Length=6830280

 Score = 119 bits (131),  Expect = 2e-24
 Identities = 245/364 (67%), Gaps = 23/364 (6%)
 Strand=Plus/Minus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                || || || ||| ||||   ||| |||  ||||||  ||||||| ||  |||| ||    
Sbjct  3638262  ATTGGACATGACGAGGTCGTGCCGTTCAAGCAGCCCGAGCCCGTGACGATCTCTGAACGA  3638203

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                || || || ||||| ||||| |||||  | ||| || |||| |||||| |||| ||||| 
Sbjct  3638202  GCCGCGGTCAAGTTCAAACCGCAGCTCCACATCTCCAACGGCTGTCACGCGTATCCTGCT  3638143

Query  184      GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
                ||  |  ||   ||    |  | ||| |||||||||   |  ||  ||| |  |  | | 
Sbjct  3638142  GTGAACGAGCTCGGAGAGACCAGCGGCGGTCTCAAGAAAACGGGCGCGCCGAGCTCCAAG  3638083

Query  244      TGCACAGGCTCGAAGCTCGG-CTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
                |||| ||| ||   ||| || ||||||  | ||||  || ||  | |||   |||| |||
Sbjct  3638082  TGCAAAGGTTCTG-GCTGGGGCTCTCAAGTGTACGGCCGATCTACCTGGTACAATGGCGT  3638024

Query  303      GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCT  362
                 ||||||||||||||| | ||||| |||||||||| |          || | | ||||||
Sbjct  3638023  CTGGGCCATCATGTACTCGTGGTACTTCCCGAAAGAC----------TCGC-CGTCCTCT  3637975

Query  363      TATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAA  422
                   |          |||| ||||| ||  |||||||| ||||||||||||||||||||||
Sbjct  3637974  GGCC----------TCGGCCACCGCCACGACTGGGAGCACGTCATTGTGTGGATCGACAA  3637925

Query  423      CCCC  426
                ||||
Sbjct  3637924  CCCC  3637921

 Score = 113 bits (125),  Expect = 8e-23
 Identities = 197/280 (70%), Gaps = 10/280 (4%)
 Strand=Plus/Plus

Query  61       GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCC--CGTCACCGTCTCCG  118
                ||||||| ||||||||||||   ||| ||| | ||||| |  ||  | ||  ||||||  
Sbjct  6417759  GTCATCGACCACGACCAGGTCGTGCCGTTCGCACAGCCCACACCGACCTCGACGTCTCAA  6417818

Query  119      ACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACC  178
                ||   || || || || || || || |||||  | ||| |  |||| || ||||||||||
Sbjct  6417819  ACC--GCTGCGGTCAAATTCAAGCCCCAGCTCCACATCACGAACGGCTGCCACCCGTACC  6417876

Query  179      CTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCG--CAGGA  236
                |||| ||  |   ||| |||  ||  | ||| ||||||||   ||  ||  ||  |||  
Sbjct  6417877  CTGCTGTCGATGCGGACGGCAACACCAGCGGTGGTCTCAACCCGACGGGGTCGTCCAG--  6417934

Query  237      CGGCGAATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGA  295
                ||  |  |||| |||||||  ||| ||||   ||||||||||  |||||  |||||   |
Sbjct  6417935  CGCTGGCTGCAAAGGCTCGG-GCTACGGCAGCCAGATCTACGGACGCTCGACGTGGTACA  6417993

Query  296      ATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                | | ||| ||||||||||||||| ||||||| ||||| ||
Sbjct  6417994  ACGGCGTCTGGGCCATCATGTACTCCTGGTACTTCCCCAA  6418033

 Score = 110 bits (121),  Expect = 1e-21
 Identities = 195/279 (70%), Gaps = 8/279 (3%)
 Strand=Plus/Plus

Query  61       GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGAC  120
                || ||| | |||||||| ||    || ||| |||| ||  ||||||||||  |||| || 
Sbjct  6421913  GTTATCAGTCACGACCAAGTGGCCCCCTTCGCGCAACCTGAGCCCGTCACGATCTCTGAG  6421972

Query  121      AAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCT  180
                ||||| || || ||||| || || || ||  | ||  || |||| |||||||||||||| 
Sbjct  6421973  AAGGCTGCGGTCAAGTTCAAGCCCCAACTGCACATTTCCAACGGATGTCACCCGTACCCC  6422032

Query  181      GCCGTTCA-GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGG---ACCGCAGGA  236
                |||||  | |||| | ||   ||     || |||||   |   | |||   ||| |||  
Sbjct  6422033  GCCGTGAACGAAGCA-GGAGACACCGATGGCGGTCTATCGAACACTGGGGCACC-CAG--  6422088

Query  237      CGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAA  296
                 ||| | |||| ||||||    || ||||| ||| ||||||  ||||| |  |||   ||
Sbjct  6422089  TGGCAAGTGCAAAGGCTCAGGTCTTGGCTCGCAGGTCTACGGACGCTCAGGCTGGCACAA  6422148

Query  297      TGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                 || |||||| ||||||||||||| ||||| ||||| ||
Sbjct  6422149  GGATGTGTGGACCATCATGTACGCGTGGTACTTCCCCAA  6422187

 Score = 92.4 bits (101),  Expect = 3e-16
 Identities = 240/364 (66%), Gaps = 23/364 (6%)
 Strand=Plus/Minus

Query  63       CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
                |||| |||||||||| ||  |||||||  | |||||  |||| |||||  | ||||| | 
Sbjct  6408112  CATCAGCCACGACCAAGTGAGGCCATTTGCCCAGCCCGAGCCTGTCACGATTTCCGAGAG  6408053

Query  123      GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
                ||| || || ||||| || || || ||  |  || |  |||| || ||||||||||||||
Sbjct  6408052  GGCCGCCGTGAAGTTCAAGCCCCAACTGCACGTCACTAACGGATGCCACCCGTACCCTGC  6407993

Query  183      CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
                 ||  |  | |  |||   |  | ||| || || |||      ||| | |    ||  | 
Sbjct  6407992  AGTCAATGACGCAGGCGAGACCAGCGGCGGCCTGAAGACATCAGGAGCTCCCAGCGCTGG  6407933

Query  243      ATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACG  301
                 ||||  || ||   |||  || |||||| |||||| ||||||| | |||   |  ||||
Sbjct  6407932  CTGCAAGGGATC-TGGCTGGGGTTCTCAGGTCTACGGTCGCTCCACTTGGCACAGAGACG  6407874

Query  302      TGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTC  361
                | |||||||| |||||| | ||||| ||||| ||          | | || | | ||  |
Sbjct  6407873  TCTGGGCCATTATGTACTCGTGGTACTTCCCCAA----------GGACTCGC-CGTCGAC  6407825

Query  362      TTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACA  421
                |        | |   | || ||||| ||  |||||||| ||||||||||||||||| |||
Sbjct  6407824  T--------GGC--CTGGGCCACCGCCACGACTGGGAGCACGTCATTGTGTGGATCAACA  6407775

Query  422      ACCC  425
                ||||
Sbjct  6407774  ACCC  6407771

 Score = 88.7 bits (97),  Expect = 3e-15
 Identities = 193/285 (68%), Gaps = 22/285 (8%)
 Strand=Plus/Plus

Query  62       TCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACA  121
                |||||||||||||||| ||    || ||||||||| |  |||||  |||| ||    |||
Sbjct  6403406  TCATCGGCCACGACCAAGTCGTTCCGTTCCCGCAGTCCCAGCCCACCACCATCAGTAACA  6403465

Query  122      AGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTG  181
                |||| ||| | ||||| ||||| |||||    |||  | | || || |||||||||||||
Sbjct  6403466  AGGCCGCACTCAAGTTCAAACCGCAGCTCTGGATCAACAATGGCTGCCACCCGTACCCTG  6403525

Query  182      CCGTTCAGAA------GGATGGCTCCATTACCGGAGGTCTCAAG----TGGAGTGGACCG  231
                 |||   |||      || || | ||  |   || |||||||||      |  |   |||
Sbjct  6403526  TCGT---GAACGCTGCGGGTGACACCGGT---GGCGGTCTCAAGACCCACGGCTCCTCCG  6403579

Query  232      CAGGACGGCGAATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTG  290
                | | | ||    |||| | ||||   ||| ||| || ||| ||||||  || ||  | ||
Sbjct  6403580  CTGCAGGG----TGCAGATGCTC-CGGCTACGGTTCGCAGGTCTACGGGCGATCTACCTG  6403634

Query  291      GGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                |   |||| ||| |||||||||||||||  |||||| ||||| ||
Sbjct  6403635  GTACAATGGCGTCTGGGCCATCATGTACTGCTGGTACTTCCCCAA  6403679

 Score = 80.6 bits (88),  Expect = 5e-13
 Identities = 178/266 (67%), Gaps = 1/266 (0%)
 Strand=Plus/Plus

Query  70       CACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCA  129
                || ||| |||| | ||||||||| |||||    ||| |||||| ||| || ||||| || 
Sbjct  1316436  CATGACAAGGTGCAGCCATTCCCTCAGCCGGTTCCCATCACCGCCTCGGAGAAGGCTGCC  1316495

Query  130      GTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAG  189
                 | ||||| |||||    ||  | || | | | || || ||||||||||||| |||| | 
Sbjct  1316496  ATCAAGTTCAAACCGAGTCTCCAGATAGTCAAAGGATGCCACCCGTACCCTGTCGTTAAT  1316555

Query  190      AAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACA  249
                  ||  ||    |  | ||| || || ||  | | |||    |  ||||||||||||| |
Sbjct  1316556  GCGGCGGGTGAGACGAGCGGGGGGCTGAAAGGAACTGGGAAACCCGACGGCGAATGCAAA  1316615

Query  250      GGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCC  309
                || || |  || || || ||  | | ||  ||| | |  |||   || | |  ||  |||
Sbjct  1316616  GGATCAAGTCTTGGGTCGCAAGTGT-CGGCCGCGCTGACTGGTACAAGGGCAAGTTTGCC  1316674

Query  310      ATCATGTACGCCTGGTATTTCCCGAA  335
                ||| ||||||| ||||||||||| ||
Sbjct  1316675  ATCCTGTACGCGTGGTATTTCCCTAA  1316700

 Score = 75.2 bits (82),  Expect = 2e-11
 Identities = 71/91 (78%), Gaps = 0/91 (0%)
 Strand=Plus/Plus

Query  242      AATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACG  301
                || |||  || |||||||| ||||| ||  |||||| ||||||||| ||| |   |   |
Sbjct  3602133  AAAGCAAGGGTTCGAAGCTGGGCTCGCAAGTCTACGGTCGCTCCGCTTGGTTCGGTCGGG  3602192

Query  302      TGTGGGCCATCATGTACGCCTGGTATTTCCC  332
                ||||||| ||||||||||||||||  |||||
Sbjct  3602193  TGTGGGCTATCATGTACGCCTGGTGCTTCCC  3602223

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 92/126 (73%), Gaps = 2/126 (2%)
 Strand=Plus/Plus

Query  61       GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCG-TCTCCGA  119
                || |||  ||||||||||||   ||||||| | ||||| | |||    |||| ||||| |
Sbjct  6419144  GTTATCAACCACGACCAGGTCGTGCCATTCACCCAGCCGACGCCTACGACCGCTCTCCAA  6419203

Query  120      CAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCC  179
                |||| | || || ||||  || || ||  |  | |||  | |||| || |||||||||||
Sbjct  6419204  CAAG-CGGCCGTCAAGTACAAGCCTCAAATCCACATCAGCAACGGCTGCCACCCGTACCC  6419262

Query  180      TGCCGT  185
                ||||||
Sbjct  6419263  TGCCGT  6419268

 Score = 61.7 bits (67),  Expect = 5e-07
 Identities = 89/126 (71%), Gaps = 0/126 (0%)
 Strand=Plus/Plus

Query  60       AGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGA  119
                ||| |||| ||| |||   |||  ||| ||||||||||||| |||   ||||  |  | |
Sbjct  6420584  AGTTATCGCCCATGACGCTGTTGTGCCGTTCCCGCAGCCAACGCCAAACACCACCATCCA  6420643

Query  120      CAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCC  179
                 |  |  || || ||||| ||||| ||| |  | |||  | |||| || |||||||||||
Sbjct  6420644  GACCGTCGCTGTCAAGTTCAAACCCCAGATCTACATCAACAACGGATGCCACCCGTACCC  6420703

Query  180      TGCCGT  185
                ||| ||
Sbjct  6420704  TGCAGT  6420709

 Score = 61.7 bits (67),  Expect = 5e-07
 Identities = 139/203 (68%), Gaps = 6/203 (3%)
 Strand=Plus/Minus

Query  127      GCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTT  186
                || || ||||| || || ||| |  | |||||| ||||||| ||||| ||||| ||||| 
Sbjct  6425493  GCGGTCAAGTTCAAGCCGCAGATCTACATCGCCAACGGGTGCCACCCATACCCGGCCGTC  6425434

Query  187      CAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATG-  245
                 |  | || ||   ||  | ||| || ||||||   | ||| | ||  ||   ||  |  
Sbjct  6425433  GACGAAGACGGTAACACCAGCGGCGGCCTCAAGCCTACTGG-CAGCGAGAGTTCGGGTTA  6425375

Query  246      CACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGT--GAATGACGTG  303
                ||| || || |  ||||||  ||||||||||| |||| ||| | | ||  ||| |  || 
Sbjct  6425374  CACTGGGTCAAGCCTCGGCAGTCAGATCTACGGTCGCGCCGTG-GAGTACGAA-GGGGTC  6425317

Query  304      TGGGCCATCATGTACGCCTGGTA  326
                |  ||| |||||||| |||||||
Sbjct  6425316  TACGCCTTCATGTACTCCTGGTA  6425294

 Score = 59.0 bits (64),  Expect = 2e-06
 Identities = 41/47 (87%), Gaps = 0/47 (0%)
 Strand=Plus/Plus

Query  379      GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
                || ||||| ||  |||||||| ||||||| |||||||||||||||||
Sbjct  6406942  GGCCACCGCCACGACTGGGAGCACGTCATCGTGTGGATCGACAACCC  6406988

 Score = 54.5 bits (59),  Expect = 7e-05
 Identities = 61/82 (74%), Gaps = 0/82 (0%)
 Strand=Plus/Plus

Query  63       CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
                |||||  |||||| |||| | ||| ||| | |||||  || |   |||||||||||| ||
Sbjct  2869267  CATCGATCACGACAAGGTGCAGCCGTTCGCACAGCCCGAGGCGACCACCGTCTCCGAGAA  2869326

Query  123      GGCAGCAGTAAAGTTTAAACCA  144
                ||| || || ||||  || |||
Sbjct  2869327  GGCTGCTGTCAAGTGCAAGCCA  2869348

 Score = 54.5 bits (59),  Expect = 7e-05
 Identities = 40/47 (85%), Gaps = 0/47 (0%)
 Strand=Plus/Plus

Query  379      GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
                || || || ||  |||||||| ||||||| |||||||||||||||||
Sbjct  6403702  GGCCATCGCCACGACTGGGAGCACGTCATCGTGTGGATCGACAACCC  6403748

 Score = 43.7 bits (47),  Expect = 0.13
 Identities = 34/41 (83%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                |||||  | | ||||||||||||||| |||||||| || ||
Sbjct  2866334  AATGATCTCTAGGCCATCATGTACGCGTGGTATTTTCCCAA  2866294

 Score = 43.7 bits (47),  Expect = 0.13
 Identities = 28/31 (90%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  307      GCCATCATGTACGCCTGGTATTTCCCGAAAG  337
                || ||||||||||||||||| ||||||| ||
Sbjct  3344491  GCTATCATGTACGCCTGGTACTTCCCGAGAG  3344521

 Score = 43.7 bits (47),  Expect = 0.13
 Identities = 28/31 (90%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  307      GCCATCATGTACGCCTGGTATTTCCCGAAAG  337
                || ||||||||||||||||| ||||||| ||
Sbjct  6499340  GCTATCATGTACGCCTGGTACTTCCCGAGAG  6499370

 Score = 42.8 bits (46),  Expect = 0.13
 Identities = 65/93 (70%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  243      ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
                |||||  |||||    || ||||| ||  | ||||  ||  |||  |||   |||||  |
Sbjct  2869430  ATGCAAGGGCTCAGGTCTGGGCTCCCAAGTGTACGGCCGAGCCGTTTGGCACAATGATCT  2869489

Query  303      GTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                 | ||||||||||||||  ||| ||||||| ||
Sbjct  2869490  CTAGGCCATCATGTACGTGTGGAATTTCCCCAA  2869522

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 37/47 (79%), Gaps = 0/47 (0%)
 Strand=Plus/Plus

Query  379      GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
                || ||||| ||  |||||||| ||| | |  | ||||||||||||||
Sbjct  6422210  GGCCACCGCCACGACTGGGAGCACGCCGTCATTTGGATCGACAACCC  6422256

>PHSO:scaffold_3
Length=10773376

 Score = 119 bits (131),  Expect = 2e-24
 Identities = 190/273 (70%), Gaps = 0/273 (0%)
 Strand=Plus/Plus

Query  63       CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
                ||||| ||||||| |||| | ||| ||||| |||||    || |||||||| ||||| ||
Sbjct  8883664  CATCGACCACGACAAGGTGCAGCCGTTCCCACAGCCTGGCCCAGTCACCGTGTCCGAGAA  8883723

Query  123      GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
                ||| || || ||||  || ||| | ||    |||  ||||| ||| ||||||||||||||
Sbjct  8883724  GGCCGCCGTTAAGTACAAGCCAAATCTCCTCATCCTCGACGCGTGCCACCCGTACCCTGC  8883783

Query  183      CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
                 ||  |    |  ||    |  | |||||| |||||  | | |||   ||  || || | 
Sbjct  8883784  TGTCAACGCCGCGGGTGAGACGAGCGGAGGGCTCAAAGGAACTGGCAAGCGCGATGGAGC  8883843

Query  243      ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
                 ||||  |||||   ||| ||||| ||  ||||||  ||  | |  |||    | ||| |
Sbjct  8883844  CTGCAAGGGCTCAGGGCTGGGCTCGCAAGTCTACGGCCGAGCTGGTTGGCACGACGACAT  8883903

Query  303      GTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                |||||||||||||||||| ||||||||||| ||
Sbjct  8883904  GTGGGCCATCATGTACGCGTGGTATTTCCCCAA  8883936

 Score = 104 bits (115),  Expect = 4e-20
 Identities = 252/380 (66%), Gaps = 25/380 (7%)
 Strand=Plus/Plus

Query  49       GCCCAGGCTCAAGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTC  108
                || || ||| |  |||||| ||||||||| ||   ||| ||| | |||||  |  | |||
Sbjct  8280280  GCTCAAGCTGAGATCATCGACCACGACCAAGTCGTGCCGTTCGCTCAGCCTGAAGCTGTC  8280339

Query  109      ACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGT  168
                ||  ||||| | ||||| ||||| ||||| || || ||| || | ||| || ||||||||
Sbjct  8280340  ACGATCTCCCAGAAGGCCGCAGTCAAGTTCAAGCCGCAGATTCACATCACCAACGGGTGT  8280399

Query  169      CACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGA  228
                ||||||||||| || |   |  ||| ||||   |  | ||| || |||||    |  |||
Sbjct  8280400  CACCCGTACCCCGCAGCGAACGAGGCTGGCCAGACCAGCGGCGGACTCAAACCCACAGGA  8280459

Query  229      --CCGCAGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCG  286
                  || |||  | ||   |||| ||||||       || || ||  |||||| ||||||  
Sbjct  8280460  GCCCCCAG--CAGCTCGTGCAAAGGCTCTGGTTGGGGTTCGCAAGTCTACGGTCGCTCGA  8280517

Query  287      CGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGG  346
                | |||   |  | |  |||||| ||||||||| | ||||| ||||| ||          |
Sbjct  8280518  CCTGGTACAGCGGCAGGTGGGCTATCATGTACTCGTGGTACTTCCCCAA----------G  8280567

Query  347      CAGTCCCTCTTCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCA  406
                 | || | | ||| ||        | |   | || ||||| ||  |||||||| ||||| 
Sbjct  8280568  GACTCGC-CGTCCACT--------GGC--CTGGGTCACCGCCACGACTGGGAGCACGTCG  8280616

Query  407      TTGTGTGGATCGACAACCCC  426
                | ||||||||||||||||||
Sbjct  8280617  TCGTGTGGATCGACAACCCC  8280636

 Score = 104 bits (114),  Expect = 4e-20
 Identities = 194/278 (70%), Gaps = 13/278 (5%)
 Strand=Plus/Minus

Query  63       CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
                ||||| | ||||| ||||   ||| ||||| || ||||  || |||||||| ||||| ||
Sbjct  1713776  CATCGACTACGACAAGGTGGAGCCGTTCCCTCAACCAAGCCCGGTCACCGTTTCCGAGAA  1713717

Query  123      GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACG-GGTGTCACCCGTACCCTG  181
                ||| || || || || |||||||  ||    |||||||||| ||| |||  ||| || | 
Sbjct  1713716  GGCCGCGGTCAAATTCAAACCACGACTGCTTATCGCCGACGAGGTTTCATGCGTTCCGTT  1713657

Query  182      CC--GTTCAGAAGGATG---GCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGA  236
                ||  ||   ||| | ||   ||   | |  ||| || |||||| ||| ||| | |||  |
Sbjct  1713656  CCTCGTCGTGAACGCTGCAGGCGAGACTGGCGGTGGGCTCAAGGGGAATGG-CGGCA--A  1713600

Query  237      CGGCGAATGCACAG--GCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
                || ||  |||   |  |||| |   | ||  | ||| ||||||  || ||  |||||   
Sbjct  1713599  CGACGGCTGCGAGGTTGCTCCAT--TGGGGGCGCAGGTCTACGGCCGATCTTCGTGGCAC  1713542

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCC  332
                || ||||| ||||||||||||||||||||||| |||||
Sbjct  1713541  AACGACGTCTGGGCCATCATGTACGCCTGGTACTTCCC  1713504

 Score = 100 bits (110),  Expect = 5e-19
 Identities = 157/223 (70%), Gaps = 4/223 (2%)
 Strand=Plus/Plus

Query  115      TCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCG  174
                || || ||||| ||||| ||||| ||||| ||||| ||| || || ||  ||| ||||||
Sbjct  3321524  TCAGAGAAGGCCGCAGTCAAGTTCAAACCGCAGCTAAAACTCTCCAACACGTGCCACCCG  3321583

Query  175      TACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGT--GGAGTGGACCGC  232
                ||| | || ||  |   | |||||| ||| | ||| || || || |  | | |  |   |
Sbjct  3321584  TACGCCGCAGTCGACGCGCATGGCTACATCAGCGGTGGCCTGAATTCCGAACTTCATATC  3321643

Query  233      AGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGG  292
                 | |   | | |||  ||| ||  |  | ||| | ||||||||||||||||| |||||| 
Sbjct  3321644  CGAAA--CAACTGCGGAGGTTCCGACTTGGGCGCGCAGATCTACGCTCGCTCTGCGTGGC  3321701

Query  293      TGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                  |  |||||||||||||   ||||||| ||||||||||| ||
Sbjct  3321702  ACAGCGACGTGTGGGCCACTGTGTACGCGTGGTATTTCCCCAA  3321744

 Score = 83.3 bits (91),  Expect = 1e-13
 Identities = 186/273 (68%), Gaps = 5/273 (2%)
 Strand=Plus/Minus

Query  65       TCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGG  124
                ||| ||||||| |||| | ||| ||||| || ||  | ||||||||  || | || ||||
Sbjct  8509472  TCGACCACGACAAGGTACAGCCGTTCCCTCACCCTGA-CCCGTCACGATCGCTGAGAAGG  8509414

Query  125      CAGCAGTAAAGTTTAAACCACAGCTTAAAATCGC-CGACGGGTGTCACCCGTACCCTGCC  183
                | ||| | ||||| || || ||||| |   |||  ||| || ||||| ||||| ||||| 
Sbjct  8509413  CCGCAATCAAGTTCAAGCCCCAGCTCAGC-TCGAACGATGGATGTCAGCCGTATCCTGCT  8509355

Query  184      GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGAC-CGCAGGACGGCGA  242
                ||  |    |  ||    | || ||  || || ||| | | ||||  ||| |   || ||
Sbjct  8509354  GTCAATGCTGCCGGTAAGACTAACGACGGACTAAAGGGCACTGGAGACGC-GTCTGGAGA  8509296

Query  243      ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
                 ||   ||||||     | ||||| ||| | ||||  ||||| | ||||      ||| |
Sbjct  8509295  CTGTGAAGGCTCACCATTGGGCTCGCAGGTGTACGACCGCTCTGGGTGGTACCGAGACCT  8509236

Query  303      GTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                |||||||||||||||| | ||||||||||| ||
Sbjct  8509235  GTGGGCCATCATGTACACTTGGTATTTCCCCAA  8509203

 Score = 81.5 bits (89),  Expect = 5e-13
 Identities = 172/257 (67%), Gaps = 0/257 (0%)
 Strand=Plus/Minus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                |||| ||||||| |||| | ||| ||| |||||||  |||| |||||| | || || |||
Sbjct  8085787  ATCGACCACGACAAGGTGCAGCCGTTCGCGCAGCCCGAGCCAGTCACCATATCTGAGAAG  8085728

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                 | ||| |  |||| || |     ||  | |||| |   ||||| |||||||||||||||
Sbjct  8085727  ACCGCAATCTAGTTCAAGCTGAGTCTCCAGATCGTCACTGGGTGCCACCCGTACCCTGCC  8085668

Query  184      GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
                ||  |    |  |||   |  |  || || || ||  |||  ||   | | ||||  || 
Sbjct  8085667  GTCAACGCCGCGGGCGAGACGAGTGGCGGGCTGAAAGGGACAGGGGAGAATGACGAAGAC  8085608

Query  244      TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
                ||||| || || |  |||||||||||  | ||||  ||  |||  |||    | ||| | 
Sbjct  8085607  TGCACGGGGTCAACACTCGGCTCTCAAGTGTACGGCCGAGCCGTTTGGTACGAGGACCTT  8085548

Query  304      TGGGCCATCATGTACGC  320
                ||||| |||||||||||
Sbjct  8085547  TGGGCTATCATGTACGC  8085531

 Score = 77.9 bits (85),  Expect = 6e-12
 Identities = 188/279 (67%), Gaps = 12/279 (4%)
 Strand=Plus/Plus

Query  63       CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
                ||||| ||| ||| |||| | ||| ||| | |||||  ||||   ||| || ||||| ||
Sbjct  1279224  CATCGACCATGACAAGGTGCAGCCGTTCGCCCAGCCCGAGCCGACCACGGTATCCGAGAA  1279283

Query  123      GGCAGCAGTAAAGTTTAAACCACAGCTTAA-AATCGCCGA--CGGGTGTCACCCGTACCC  179
                ||| || || ||||| || ||  ||| |   ||||  |||  |||||| |||||||||||
Sbjct  1279284  GGCCGCCGTCAAGTTCAAGCCG-AGCATCCGAATC--CGAAGCGGGTGCCACCCGTACCC  1279340

Query  180      TGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAA---GTGGAGTGGACCGCAGGA  236
                ||| ||  |    |  ||    |  | |||||| || ||    | | | | |||    ||
Sbjct  1279341  TGCGGTGAATGCCGCGGGTGAGACGAGCGGAGGGCTGAAACCATCGGGGGAACC---TGA  1279397

Query  237      CGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAA  296
                ||| || |||| |  ||| |  || ||||| ||  | ||||  ||  ||| ||||   ||
Sbjct  1279398  CGGAGACTGCAAAAACTCTAGCCTGGGCTCGCAAGTGTACGGGCGAGCCGTGTGGTACAA  1279457

Query  297      TGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                 ||| | |||||||| |||||  | ||||||||||| ||
Sbjct  1279458  GGACCTCTGGGCCATTATGTATACGTGGTATTTCCCCAA  1279496

 Score = 77.0 bits (84),  Expect = 6e-12
 Identities = 232/358 (65%), Gaps = 23/358 (6%)
 Strand=Plus/Minus

Query  69       CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
                ||| || || || || |||||| | ||||| ||||| |  || || || || || || ||
Sbjct  5670326  CCATGATCAAGTGCGCCCATTCGCTCAGCCGAAGCCTGCTACTGTATCTGAAAAAGCTGC  5670267

Query  129      AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
                 || ||||| || || ||| |  | ||| |  |||| || || |||||||| |||||  |
Sbjct  5670266  CGTCAAGTTCAACCCCCAGATCCACATCACGAACGGATGCCATCCGTACCCCGCCGTGAA  5670207

Query  189      GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCAC  248
                    | |||    |  |  || || ||  ||  || |||| | |    ||  |  |||| 
Sbjct  5670206  CGCTGCTGGGGAGACGAGTGGCGGCCTTCAGACGAATGGAGCACCCAGCGCTGGCTGCAA  5670147

Query  249      AGGCTCGAAGCTCGGCT-CTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGG  307
                ||||||   ||| || | | ||| ||||||  |||||| | |||   || | |   ||||
Sbjct  5670146  AGGCTCTG-GCTGGGGTTCCCAGGTCTACGGCCGCTCCACCTGGTACAAGGGCCGCTGGG  5670088

Query  308      CCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCA  367
                ||||||||||| | ||||| ||||| ||     ||   || ||||           | ||
Sbjct  5670087  CCATCATGTACTCGTGGTACTTCCCCAA----GGACTCGCCGTCC-----------ACCA  5670043

Query  368      CCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
                |||      | || ||||||||  |||||||  ||||| | |||||||| ||||||||
Sbjct  5670042  CCC------TGGGTCACCGTCACGACTGGGAACACGTCGTCGTGTGGATTGACAACCC  5669991

 Score = 73.4 bits (80),  Expect = 7e-11
 Identities = 70/90 (78%), Gaps = 0/90 (0%)
 Strand=Plus/Plus

Query  249      AGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGC  308
                ||| ||  || | ||||||||  | ||||| || ||  | |||    ||||||| |||||
Sbjct  3315219  AGGTTCCGAGTTGGGCTCTCAAGTGTACGCGCGTTCGACATGGCACGATGACGTCTGGGC  3315278

Query  309      CATCATGTACGCCTGGTATTTCCCGAAAGG  338
                |||||||||||| ||||||||||| |||||
Sbjct  3315279  CATCATGTACGCGTGGTATTTCCCTAAAGG  3315308

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 187/282 (66%), Gaps = 10/282 (4%)
 Strand=Plus/Plus

Query  62       TCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACA  121
                |||||| ||||||||| ||    || ||||||||| |  |||||   ||| || |  |||
Sbjct  3147572  TCATCGACCACGACCAAGTCGTCCCGTTCCCGCAGTCCCAGCCCACTACCATCACGAACA  3147631

Query  122      AGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTG  181
                |||| ||  | ||| | || || | |||    ||   | |||| || |||| | |||| |
Sbjct  3147632  AGGCTGCGCTCAAGCTCAAGCCCCGGCTCTTTATTAACAACGGATGCCACCTGCACCCCG  3147691

Query  182      CCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGA-GTGGACCGCAGGACGGC  240
                | ||  |   | ||||    |  | ||| || || |||   | | || || ||| | || 
Sbjct  3147692  CTGTGAATGCGAATGGTGATACCAGCGGTGGACTTAAGCCCAAGGGGTCCCCAG-AGGGA  3147750

Query  241      GAATGCACAGGCTCGAAGCTC-GGCTCTCAGATCTAC------GCTCGCTCCGCGTGGGT  293
                |  |||| ||||||   |||| ||||| ||  |||||      |  || ||| | |||  
Sbjct  3147751  GGCTGCAGAGGCTCCG-GCTCCGGCTCGCAAGTCTACCGGTACGGCCGATCCACCTGGTA  3147809

Query  294      GAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                 ||||  || ||||||||||||||||||||||| ||||| ||
Sbjct  3147810  CAATGGGGTCTGGGCCATCATGTACGCCTGGTACTTCCCCAA  3147851

 Score = 65.3 bits (71),  Expect = 4e-08
 Identities = 61/78 (78%), Gaps = 0/78 (0%)
 Strand=Plus/Minus

Query  262      GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
                ||||| ||| |||| |  ||| |    ||| | || ||||| ||||||||||||||||||
Sbjct  1701068  GGCTCGCAGGTCTATGGCCGCGCTCGATGGTTCAAGGACGTCTGGGCCATCATGTACGCC  1701009

Query  322      TGGTATTTCCCGAAAGGC  339
                ||||| ||||| || |||
Sbjct  1701008  TGGTACTTCCCCAAGGGC  1700991

 Score = 59.9 bits (65),  Expect = 2e-06
 Identities = 40/45 (89%), Gaps = 0/45 (0%)
 Strand=Plus/Plus

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
                || ||||| ||||||||||||||||||||||| ||||| || |||
Sbjct  1712577  AACGACGTCTGGGCCATCATGTACGCCTGGTACTTCCCCAAGGGC  1712621

 Score = 57.2 bits (62),  Expect = 6e-06
 Identities = 52/66 (79%), Gaps = 0/66 (0%)
 Strand=Plus/Minus

Query  274      TACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCG  333
                |||||||||||||| ||    ||  |  | ||||||||||||||||  ||||| ||||| 
Sbjct  3314215  TACGCTCGCTCCGCTTGATACAACAATATTTGGGCCATCATGTACGTTTGGTACTTCCCA  3314156

Query  334      AAAGGC  339
                ||||||
Sbjct  3314155  AAAGGC  3314150

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 96/139 (69%), Gaps = 2/139 (1%)
 Strand=Plus/Minus

Query  49       GCCCAGGCT-CAAGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGT  107
                ||||||  | |||||| |||  | |||| ||||    || ||| |  | ||  | | |||
Sbjct  3314440  GCCCAGAGTGCAAGTC-TCGAGCCCGACAAGGTCAAACCGTTCGCCGAACCGGAACTCGT  3314382

Query  108      CACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTG  167
                |||  |||||||| |||  |  || ||||| || || ||||| ||| || |||     ||
Sbjct  3314381  CACGATCTCCGACTAGGTCGTCGTCAAGTTCAAGCCGCAGCTCAAACTCTCCGGAACATG  3314322

Query  168      TCACCCGTACCCTGCCGTT  186
                 ||||||||||| || |||
Sbjct  3314321  CCACCCGTACCCGGCAGTT  3314303

 Score = 44.6 bits (48),  Expect = 0.036
 Identities = 36/44 (82%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  382      CACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
                ||||| ||| |||||| |   ||| | |||||||||||||||||
Sbjct  8509168  CACCGCCATGACTGGGCGAGTGTCGTCGTGTGGATCGACAACCC  8509125

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  394      TGGGAGTACGTCATTGTGTGGATCGACAACCC  425
                |||||||||| |||  | ||||||||||||||
Sbjct  3314119  TGGGAGTACGCCATCATCTGGATCGACAACCC  3314088

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  94       CAGCCAAAGCCCGTCACCGTCTCCGA  119
                |||||| |||||| ||||||||||||
Sbjct  1712379  CAGCCAGAGCCCGCCACCGTCTCCGA  1712404

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  392      ACTGGGAGTACGTCATTGTGTGGATCGACAACCCC  426
                ||||| |||  || || || |||||||||||||||
Sbjct  3315338  ACTGGAAGTTTGTTATCGTCTGGATCGACAACCCC  3315372

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  14       TCGTCCTCCTCGTCCTCGTC  33
                ||||||||||||||||||||
Sbjct  7486877  TCGTCCTCCTCGTCCTCGTC  7486896

>PHRA:scaffold_9
Length=727265

 Score = 117 bits (129),  Expect = 7e-24
 Identities = 196/277 (71%), Gaps = 10/277 (4%)
 Strand=Plus/Minus

Query  64     ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
              ||||| |||||| | ||   ||||||||| |||||  ||||||||||  |||||||||||
Sbjct  69579  ATCGGTCACGACGAAGTGAAGCCATTCCCTCAGCCTGAGCCCGTCACGATCTCCGACAAG  69520

Query  124    GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGC  182
              || |  || ||||| || || ||| |  | |||   |||||| ||| | |||||||| ||
Sbjct  69519  GCTGGTGTCAAGTTCAAGCCTCAGATCCAGATC-AGGACGGGATGTAATCCGTACCCCGC  69461

Query  183    CGTTCAGAAGGA---TGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCG-CAGGACG  238
              |||   ||| ||    ||     ||   || |||||||||  ||| |||  | |  || |
Sbjct  69460  CGT---GAACGAATTCGGTGAGGTTGGTGGTGGTCTCAAGACGAGCGGAAAGTCCAGA-G  69405

Query  239    GCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
              || | ||| |||||||    |  ||||| ||  ||||||  |||||  | |||   ||  
Sbjct  69404  GCAATTGCGCAGGCTCTGGTCATGGCTCGCAAGTCTACGGGCGCTCAACCTGGCACAACC  69345

Query  299    ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
              | |||||||||||||||||| ||||||| ||||| ||
Sbjct  69344  AGGTGTGGGCCATCATGTACTCCTGGTACTTCCCCAA  69308

 Score = 104 bits (114),  Expect = 4e-20
 Identities = 193/277 (70%), Gaps = 10/277 (4%)
 Strand=Plus/Minus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               ||||| |||||| | ||   ||||||||| |||||  ||||||||||  |||||||||||
Sbjct  119783  ATCGGTCACGACGAAGTGAAGCCATTCCCTCAGCCTGAGCCCGTCACGATCTCCGACAAG  119724

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGC  182
               || |  || ||||| || || ||| |  | |||   |||||| ||| | |||||||| ||
Sbjct  119723  GCTGGTGTCAAGTTCAAGCCTCAGATCCAGATC-AGGACGGGATGTAATCCGTACCCCGC  119665

Query  183     CGTTCAGAAGGA---TGGCTCCATTACCGGAGGTCTCAAGTGGAGTGG-ACCGCAGGACG  238
               |||   ||| ||    ||     ||   || |||||||||  ||  || |   |  || |
Sbjct  119664  CGT---GAACGAATTCGGTGAGGTTGGTGGTGGTCTCAAGCCGACCGGCAAATCGAGA-G  119609

Query  239     GCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
               || ||||| |||||||    |  ||||| ||  ||||||  |||||  | |||   ||  
Sbjct  119608  GCAAATGCGCAGGCTCTGGTCATGGCTCGCAAGTCTACGGGCGCTCAACCTGGCACAACT  119549

Query  299     ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                 ||||||| |||||||||| ||||||| ||||| ||
Sbjct  119548  CGGTGTGGGTCATCATGTACTCCTGGTACTTCCCCAA  119512

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 170/254 (67%), Gaps = 6/254 (2%)
 Strand=Plus/Plus

Query  85     CCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCA  144
              ||||| || |||||  ||||| ||||  ||||||| ||||| |  || || || || || 
Sbjct  32280  CCATTTCCTCAGCCTGAGCCCATCACGATCTCCGAGAAGGCTGGCGTCAAATTCAAGCCC  32339

Query  145    CAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCAT  203
              ||| |  | |||   ||| || |||   ||||| || |||||  |  |    |||   | 
Sbjct  32340  CAGATCCAGATCAG-GACTGGATGTGTGCCGTATCCCGCCGTCAATGAACTCGGCGAGAC  32398

Query  204    TACCGGAGGTCTCAAGTGGAGTGGA--CCGCAGGACGGCGAATGCACAGGCTCGAAGCTC  261
              ||  || || ||| ||  |  |||   ||  |||  || |  |||| ||||||    | |
Sbjct  32399  TAGTGGCGGCCTCCAGACGTCTGGCAGCCCTAGG--GGAGGGTGCAGAGGCTCTGGTCAC  32456

Query  262    GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
              || || ||| ||||||  || ||| | |||   ||  | |||||||||||||||||| ||
Sbjct  32457  GGTTCGCAGGTCTACGGGCGATCCACCTGGTACAACCAGGTGTGGGCCATCATGTACTCC  32516

Query  322    TGGTATTTCCCGAA  335
              ||||| ||||| ||
Sbjct  32517  TGGTACTTCCCCAA  32530

>PHCA:scaffold_146 PHYCAscaffold_146
Length=47772

 Score = 117 bits (129),  Expect = 7e-24
 Identities = 278/414 (67%), Gaps = 16/414 (4%)
 Strand=Plus/Minus

Query  69     CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
              ||||||||| || | ||| ||| | || ||  | ||   ||||   || || ||  | ||
Sbjct  46548  CCACGACCAAGTGCAGCCGTTCGCCCAACCTGAACCAACCACCAATTCAGAGAAATCCGC  46489

Query  129    AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
               || || |  || || || ||  | ||  | ||||| |||||| ||||||||||||||||
Sbjct  46488  TGTTAAATACAAGCCGCAACTCCACATTTCGGACGGATGTCACTCGTACCCTGCCGTTCA  46429

Query  189    GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCAC  248
              |  ||| ||  || |||  |  ||  | ||||||  |||  |      |||  |||||| 
Sbjct  46428  GGCGGACGGAGCCGTTAGTGCTGGATTGAAGTGGGCTGGTTCAGTTAGCGGTCAATGCAA  46369

Query  249    AGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGC  308
               |||||    || || |||||  | ||  | || ||||  |||   || |||  ||||||
Sbjct  46368  GGGCTCCGGACTGGGATCTCAAGTGTATTCACGTTCCGACTGGTACAAGGACAAGTGGGC  46309

Query  309    CATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCAC  368
               ||||||||||||||||| ||||| |||||  ||    |||| | || |||   ||    
Sbjct  46308  GATCATGTACGCCTGGTACTTCCCTAAAGGTCGA----CAGTACATC-TCCAAGTA----  46258

Query  369    CCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAA  428
              ||| ||||  || ||||||||   ||||  ||| |  ||||||||||| ||||   | | 
Sbjct  46257  CCG-CTTT--GGTCACCGTCACTTCTGGTCGTATGCTATTGTGTGGATGGACA--GCGAT  46203

Query  429    GAGC--AAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTAC  480
              | ||   | |||||||||||||| || || || ||||| ||||  || || |||
Sbjct  46202  GTGCCTGACAACTCGACCATTCTCGGAGTCTCTATGTCTGCTGGTGTTGGCTAC  46149

>PHPA:scaffold_48 NW_008649034.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.48, whole genome shotgun 
sequence
Length=510763

 Score = 113 bits (124),  Expect = 8e-23
 Identities = 201/289 (70%), Gaps = 6/289 (2%)
 Strand=Plus/Plus

Query  52      CAGGCTCAAGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACC  111
               || |||  |||||||| ||| |||||||||  ||| ||| ||||||| |  ||   | ||
Sbjct  407675  CAAGCTGCAGTCATCGACCATGACCAGGTTGTGCCGTTCGCGCAGCCTACACCGACCTCC  407734

Query  112     GTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCAC  171
               |||||| | |  || ||| | || ||||| || |||||  | ||| |  |||| || |||
Sbjct  407735  GTCTCCCAGATCGCGGCATTCAACTTTAAGCCGCAGCTCCACATCACGAACGGCTGCCAC  407794

Query  172     CCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCG  231
               |||||||| || ||  | |  || ||    | ||  || || |||||   || |||  ||
Sbjct  407795  CCGTACCCGGCGGTCGACACAGACGGTAATACTAGTGGCGGCCTCAACCCGACTGGGTCG  407854

Query  232     --CAGGACGGCGAATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCG  288
                 |||   | || ||||| ||| |||  ||| ||||  ||| || ||||  |||||  | 
Sbjct  407855  TCCAG--TGCCGGATGCAAAGGTTCG-GGCTACGGCAGTCAAATTTACGGACGCTCAACC  407911

Query  289     TGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
               |||   || | ||| |||||||| |||||| | ||||||||||| ||||
Sbjct  407912  TGGTACAACGGCGTCTGGGCCATAATGTACTCATGGTATTTCCCCAAAG  407960

 Score = 108 bits (119),  Expect = 4e-21
 Identities = 193/278 (69%), Gaps = 8/278 (3%)
 Strand=Plus/Minus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               ||||||||||| || ||   ||| ||| |||||||  | || |||||  |||| || | |
Sbjct  401975  ATCGGCCACGATCAAGTGAAGCCCTTCGCGCAGCCCCAACCGGTCACGATCTCGGAGAGG  401916

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
               || ||  | ||||||||||| ||  |  | ||||  ||||| || |||||||||||||| 
Sbjct  401915  GCTGCTATCAAGTTTAAACCCCAAATACACATCGGTGACGGATGCCACCCGTACCCTGCA  401856

Query  184     GTTCAGAAGGA---TGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC  240
               ||   ||| ||   ||||   |    ||| ||||| |||   |  ||| | |    || |
Sbjct  401855  GT---GAACGATATTGGCGAGACGGGCGGCGGTCTGAAGACTACCGGATCCCCCACCGCC  401799

Query  241     GAATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGA  299
               | |||||  |||||   |||  ||||| ||| | ||||  |||||  |||||   |  ||
Sbjct  401798  GGATGCAAGGGCTC-TGGCTGGGGCTCACAGGTGTACGGCCGCTCAACGTGGCATAGAGA  401740

Query  300     CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
                || ||||||||||||||| | |||||||| || ||||
Sbjct  401739  TGTTTGGGCCATCATGTACTCTTGGTATTTTCCTAAAG  401702

 Score = 102 bits (112),  Expect = 2e-19
 Identities = 132/180 (73%), Gaps = 2/180 (1%)
 Strand=Plus/Minus

Query  161     ACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGT  220
               |||| || |||||||| ||||||||||||   ||||| ||  | | ||  || || ||  
Sbjct  381319  ACGGTTGCCACCCGTATCCTGCCGTTCAGGCTGATGGTTCGGTCAGCGCTGGGCTTAAAG  381260

Query  221     GGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTC  280
               | | ||||||    || || |||||    |||||| | |||||||||||  | ||| |||
Sbjct  381259  GAACTGGACCAATTGATGGGGAATGTGGCGGCTCGGATCTCGGCTCTCAAGTGTACTCTC  381200

Query  281     GCTCCGCGTGGGTG-AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
               | || | || |||  || | |  ||||||||||||||| || |||||| |||||||||||
Sbjct  381199  GATC-GAGTTGGTACAAGGGCAAGTGGGCCATCATGTATGCTTGGTATCTCCCGAAAGGC  381141

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 30/32 (94%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  306     GGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
               ||||||||||||||||||||| ||||||| ||
Sbjct  365517  GGCCATCATGTACGCCTGGTACTTCCCGAGAG  365486

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 51/67 (76%), Gaps = 0/67 (0%)
 Strand=Plus/Minus

Query  120     CAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCC  179
               |||||  ||| | ||||| || || ||| |  | |||  | |||| ||||||||||||||
Sbjct  365700  CAAGGTCGCACTGAAGTTCAAGCCGCAGTTACATATCAGCAACGGATGTCACCCGTACCC  365641

Query  180     TGCCGTT  186
               ||| |||
Sbjct  365640  TGCTGTT  365634

 Score = 44.6 bits (48),  Expect = 0.036
 Identities = 33/39 (85%), Gaps = 0/39 (0%)
 Strand=Plus/Minus

Query  297     TGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
               ||||  |||||| ||||||||||| ||||| || |||||
Sbjct  508417  TGACAAGTGGGCGATCATGTACGCTTGGTACTTACCGAA  508379

 Score = 42.8 bits (46),  Expect = 0.13
 Identities = 41/53 (77%), Gaps = 0/53 (0%)
 Strand=Plus/Minus

Query  134     AGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTT  186
               ||||||| || || ||     ||| |  ||| |||||||||||||||||||||
Sbjct  361327  AGTTTAAGCCCCAACTCCTCGTCGACACCGGTTGTCACCCGTACCCTGCCGTT  361275

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  307     GCCATCATGTACGCCTGGTATTTCCC  332
               ||||||||||| |||||||| |||||
Sbjct  356978  GCCATCATGTATGCCTGGTACTTCCC  356953

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  307     GCCATCATGTACGCCTGGTATTTCCC  332
               || |||||||||||||||||||| ||
Sbjct  361160  GCTATCATGTACGCCTGGTATTTTCC  361135

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 33/41 (80%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
               |||| ||| |  || ||||||||| | ||||||||||| ||
Sbjct  404389  AATGGCGTCTACGCTATCATGTACTCGTGGTATTTCCCTAA  404429

>PHKE:scaffold_89 scf_22126_89.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_89.1:1:108404:1 
REF
Length=108404

 Score = 112 bits (123),  Expect = 3e-22
 Identities = 190/273 (70%), Gaps = 2/273 (1%)
 Strand=Plus/Plus

Query  64     ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
              ||| | |||  | |||| | |||||||||||||||  ||||  ||||  |||| || | |
Sbjct  46026  ATCAGTCACAGCGAGGTGCAGCCATTCCCGCAGCCCGAGCCTATCACGATCTCTGAAAGG  46085

Query  124    GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
              || || || ||||| || || || ||| | ||| |  |||| |||||| ||||||| |||
Sbjct  46086  GCTGCTGTGAAGTTCAAGCCCCAACTTCACATCTCTAACGGATGTCACGCGTACCCGGCC  46145

Query  184    GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
              ||| |   || |||    |  | ||| ||||| ||    | |||| | |     ||  ||
Sbjct  46146  GTTAACGGGGCTGGTGAAACCAGCGGCGGTCTTAAAACTACTGGAGCTCCTAGTGGGAAA  46205

Query  244    TGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
              ||||  |||||   ||| |||||| ||  | ||||  |||||||  |||   || || ||
Sbjct  46206  TGCAAGGGCTC-TGGCTACGGCTCCCAAGTGTACGGGCGCTCCGGTTGGCACAAGGATGT  46264

Query  303    GTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
               ||||||||||||||| | ||||| ||||| ||
Sbjct  46265  TTGGGCCATCATGTACTCGTGGTACTTCCCTAA  46297

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 47/61 (77%), Gaps = 0/61 (0%)
 Strand=Plus/Minus

Query  272    TCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCC  331
              |||||| |||||| |  | |   || || |  ||||| |||||||| |||||||||||||
Sbjct  48335  TCTACGGTCGCTCTGTTTTGTACAAGGATGCTTGGGCTATCATGTATGCCTGGTATTTCC  48276

Query  332    C  332
              |
Sbjct  48275  C  48275

 Score = 47.3 bits (51),  Expect = 0.010
 Identities = 36/43 (84%), Gaps = 0/43 (0%)
 Strand=Plus/Minus

Query  295    AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
              || ||| | ||| |||||||| || | ||||||||||||||||
Sbjct  42870  AACGACATCTGGACCATCATGCACACTTGGTATTTCCCGAAAG  42828

>PHSO:scaffold_14
Length=1806347

 Score = 111 bits (122),  Expect = 3e-22
 Identities = 136/186 (73%), Gaps = 0/186 (0%)
 Strand=Plus/Minus

Query  69      CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
               ||||||||| ||||| || ||| ||||||   | ||| |||| ||||| || || || ||
Sbjct  187124  CCACGACCAAGTTCGACCGTTCGCGCAGCGTGACCCCATCACAGTCTCTGAAAAAGCGGC  187065

Query  129     AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
                 | ||||| || || || || |   ||  ||| || || ||||| |||||||| || ||
Sbjct  187064  CATCAAGTTCAACCCGCAACTGACTGTCAGCGAAGGATGCCACCCATACCCTGCAGTCCA  187005

Query  189     GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCAC  248
                 |||| ||| |  | | ||| || || |||||||||||   ||| |||||||| |||| 
Sbjct  187004  AGAGGACGGCGCGTTGAGCGGCGGGCTGAAGTGGAGTGGCAAGCAAGACGGCGAGTGCAA  186945

Query  249     AGGCTC  254
               ||||||
Sbjct  186944  AGGCTC  186939

 Score = 63.5 bits (69),  Expect = 1e-07
 Identities = 60/77 (78%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               ||||| ||| ||||| | || ||  | |||   || || ||||||||||| |||||| ||
Sbjct  175497  GGCTCCCAGGTCTACTCCCGTTCGACTTGGTACAACGATGTGTGGGCCATTATGTACACC  175438

Query  322     TGGTATTTCCCGAAAGG  338
               ||||| ||||| |||||
Sbjct  175437  TGGTACTTCCCTAAAGG  175421

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 39/45 (87%), Gaps = 1/45 (2%)
 Strand=Plus/Minus

Query  382     CACCGTCATAA-CTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               || ||||| || |||||| ||||||||||  ||||||||||||||
Sbjct  175389  CATCGTCACAAACTGGGAATACGTCATTGCTTGGATCGACAACCC  175345

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  591     GGGGGAATTCCAGGACCTCATTACATGGGA  620
               ||| || ||||||||||||||||  |||||
Sbjct  922888  GGGCGAGTTCCAGGACCTCATTATGTGGGA  922917

>PHPA:scaffold_68 NW_008649054.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.68, whole genome shotgun 
sequence
Length=307006

 Score = 110 bits (121),  Expect = 1e-21
 Identities = 190/271 (70%), Gaps = 4/271 (1%)
 Strand=Plus/Plus

Query  69     CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
              ||||||||||||||  || ||  |||||||  | || |||||| | || || ||||| ||
Sbjct  90385  CCACGACCAGGTTCAACCTTTTGCGCAGCCTGAACCTGTCACCATTTCGGAGAAGGCCGC  90444

Query  129    AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
               || ||||| ||||| |||||| | ||| |  |||| || || ||||| || || ||  |
Sbjct  90445  CGTCAAGTTCAAACCTCAGCTTCACATCACGAACGGATGCCATCCGTATCCCGCTGTCAA  90504

Query  189    GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGA-CCGCAGGACGGCGAATGCA  247
                  | |||   ||     || || ||||||   |  ||| || || |  ||   |||||
Sbjct  90505  CGCTGCTGGTGACACAGGTGGCGGCCTCAAGCCCACAGGAGCCCCAAG-TGGATCATGCA  90563

Query  248    CAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGG  306
               ||| ||   ||| |||||| ||  ||||||  || ||  ||||| | || | ||| |||
Sbjct  90564  AAGGGTC-TGGCTACGGCTCACAAGTCTACGGACGTTCTACGTGGTTCAACGGCGTCTGG  90622

Query  307    GCCATCATGTACGCCTGGTATTTCCCGAAAG  337
              |||||||||||  | ||||||||||||||||
Sbjct  90623  GCCATCATGTATTCATGGTATTTCCCGAAAG  90653

 Score = 78.8 bits (86),  Expect = 2e-12
 Identities = 64/78 (82%), Gaps = 0/78 (0%)
 Strand=Plus/Plus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               ||||| |||||||||| |||  | | ||||   || ||| ||||||| ||||||||||| 
Sbjct  229248  GGCTCGCAGATCTACGGTCGAGCTGGGTGGTACAACGACCTGTGGGCTATCATGTACGCG  229307

Query  322     TGGTATTTCCCGAAAGGC  339
               ||||| ||||||||||||
Sbjct  229308  TGGTACTTCCCGAAAGGC  229325

>PHRA:scaffold_378
Length=14951

 Score = 108 bits (119),  Expect = 4e-21
 Identities = 241/360 (67%), Gaps = 29/360 (8%)
 Strand=Plus/Plus

Query  70     CACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCA  129
              |||||||| ||  |||||||| | |||||  |||| |||||  |||| || | ||| || 
Sbjct  13774  CACGACCAAGTGAGGCCATTCGCTCAGCCCGAGCCGGTCACGATCTCTGAAAGGGCCGCC  13833

Query  130    GTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAG  189
               | ||||| || || ||||| ||  |   ||| || || |||||||||||||| ||   |
Sbjct  13834  ATGAAGTTCAAGCCCCAGCTCAACGTGATCGATGGATGCCACCCGTACCCTGCTGT---G  13890

Query  190    AAGGAT---GGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGG-CGAATG  245
              || |||   |||    |    || ||||| |||   | |||  |||   |||| || |||
Sbjct  13891  AATGATGCAGGCGAGGTCGGGGGTGGTCTTAAGACTACTGGGTCGC-CTACGGCCGGATG  13949

Query  246    CACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTG  305
              ||  |||||   |   ||||| || || ||||  |||||  |||||      ||  | ||
Sbjct  13950  CAAGGGCTCTGGGTGGGGCTCGCAAATTTACGGGCGCTCGACGTGGCACCGAGATATCTG  14009

Query  306    GGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTAT  365
              ||||||||||||| ||||||| ||||| ||          | | |||| | ||  ||  |
Sbjct  14010  GGCCATCATGTACTCCTGGTACTTCCCCAA----------GGACTCCC-CGTCGACTGGT  14058

Query  366    CACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
              |          | || ||||| ||  |||||||| |||||||||||||||||||||||||
Sbjct  14059  C----------TGGGCCACCGCCACGACTGGGAGCACGTCATTGTGTGGATCGACAACCC  14108

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 62/86 (72%), Gaps = 0/86 (0%)
 Strand=Plus/Minus

Query  133  AAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAG  192
            ||||| || || ||| || | ||| || |||| || |||||||||||||| ||  |  | 
Sbjct  887  AAGTTCAAGCCGCAGATTCACATCTCCAACGGTTGCCACCCGTACCCTGCAGTGGACGAA  828

Query  193  GATGGCTCCATTACCGGAGGTCTCAA  218
            | ||||  ||  | ||| || |||||
Sbjct  827  GCTGGCAACACCAGCGGCGGACTCAA  802

>PHRA:scaffold_196
Length=43483

 Score = 108 bits (119),  Expect = 4e-21
 Identities = 241/360 (67%), Gaps = 29/360 (8%)
 Strand=Plus/Plus

Query  70    CACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCA  129
             |||||||| ||  |||||||| | |||||  |||| |||||  |||| || | ||| || 
Sbjct  1348  CACGACCAAGTGAGGCCATTCGCTCAGCCCGAGCCGGTCACGATCTCTGAAAGGGCCGCC  1407

Query  130   GTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAG  189
              | ||||| || || ||||| ||  |   ||| || || |||||||||||||| ||   |
Sbjct  1408  ATGAAGTTCAAGCCCCAGCTCAACGTGATCGATGGATGCCACCCGTACCCTGCTGT---G  1464

Query  190   AAGGAT---GGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGG-CGAATG  245
             || |||   |||    |    || ||||| |||   | |||  |||   |||| || |||
Sbjct  1465  AATGATGCAGGCGAGGTCGGGGGTGGTCTTAAGACTACTGGGTCGC-CTACGGCCGGATG  1523

Query  246   CACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTG  305
             ||  |||||   |   ||||| || || ||||  |||||  |||||      ||  | ||
Sbjct  1524  CAAGGGCTCTGGGTGGGGCTCGCAAATTTACGGGCGCTCGACGTGGCACCGAGATATCTG  1583

Query  306   GGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTAT  365
             ||||||||||||| ||||||| ||||| ||          | | |||| | ||  ||  |
Sbjct  1584  GGCCATCATGTACTCCTGGTACTTCCCCAA----------GGACTCCC-CGTCGACTGGT  1632

Query  366   CACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
             |          | || ||||| ||  |||||||| |||||||||||||||||||||||||
Sbjct  1633  C----------TGGGCCACCGCCACGACTGGGAGCACGTCATTGTGTGGATCGACAACCC  1682

 Score = 58.1 bits (63),  Expect = 6e-06
 Identities = 119/181 (66%), Gaps = 21/181 (12%)
 Strand=Plus/Minus

Query  262   GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
             ||||| ||| | ||||  || || || |||   || |  || ||||||||||||||  ||
Sbjct  3405  GGCTCGCAGGTTTACGGCCGGTCGGCATGGTACAACGGAGTCTGGGCCATCATGTATTCC  3346

Query  322   TGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCACCCGTCTTTTCGGA  381
             ||||| |||||||||| |  |  |  || |             ||||          || 
Sbjct  3345  TGGTACTTCCCGAAAGACGAACCGCAAGAC------------TTCAC---------TGGG  3307

Query  382   CACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAACTCG  441
             ||||| ||  | |||||| ||||| |||||||||| ||||||||  ||| || |||| ||
Sbjct  3306  CACCGCCACGATTGGGAGCACGTCGTTGTGTGGATTGACAACCCTCAGAACACAAACCCG  3247

Query  442   A  442
             |
Sbjct  3246  A  3246

>PHRA:scaffold_436
Length=12848

 Score = 106 bits (117),  Expect = 1e-20
 Identities = 195/283 (69%), Gaps = 6/283 (2%)
 Strand=Plus/Minus

Query  64    ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
             |||| ||||||| |||| |  |||||| |||| ||  |||| |||||||||||||| |||
Sbjct  3052  ATCGACCACGACAAGGTGCAACCATTCGCGCAACCCGAGCCTGTCACCGTCTCCGAGAAG  2993

Query  124   GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
             || || ||    ||||| ||    ||    |||| | |||| || |||||||||||||| 
Sbjct  2992  GCCGCCGTCCGATTTAAGCCGAGCCTGCGGATCGACCACGGTTGCCACCCGTACCCTGCT  2933

Query  184   GTTCA-GAAG--GATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC  240
             ||  | |  |  | ||   ||| |   |  ||||| ||| | |  ||   ||     || 
Sbjct  2932  GTCAATGCTGCCGGTGAGACCAAT---GCGGGTCTAAAGGGAACAGGTATGCCTAGTGGA  2876

Query  241   GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
             || ||||  || |||   || || || ||| | ||||| ||  |||  |||   |  |||
Sbjct  2875  GATTGCAAGGGGTCGGGCCTGGGTTCGCAGGTGTACGCCCGAGCCGTTTGGCATAGCGAC  2816

Query  301   GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAG  343
              ||||||||||||||||||| |||||||||||||||| || ||
Sbjct  2815  CTGTGGGCCATCATGTACGCGTGGTATTTCCCGAAAGACAAAG  2773

>PYVX:scaffold_884 pve_scaffold_884 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_884:1:10722:1 
REF
Length=10722

 Score = 105 bits (116),  Expect = 1e-20
 Identities = 195/279 (70%), Gaps = 8/279 (3%)
 Strand=Plus/Plus

Query  61     GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCG-A  119
              || |||| |||||| |||||   ||| ||  |||| |||| | | | |  || |  || |
Sbjct  10023  GTGATCGACCACGATCAGGTGGTGCCGTTTGCGCAACCAACGGC-GACCTCGACATCGCA  10081

Query  120    CAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCC  179
              |||||| || || ||||| || || |||||  | ||   ||| || ||||||||||||||
Sbjct  10082  CAAGGCGGCCGTCAAGTTCAAGCCGCAGCTGCATATTAGCGATGGATGTCACCCGTACCC  10141

Query  180    TGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCG--CAGGAC  237
              ||||||  |   |   |||  ||  | ||| || ||||||  |   ||| |   |||  |
Sbjct  10142  TGCCGTCGACTCGAGCGGCAACACGAGCGGCGGGCTCAAGCCGTCGGGATCTTCCAG--C  10199

Query  238    GGCGAATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAA  296
              |  |  |||| ||||||   ||| |||||| ||||||||||  || ||  |||||   ||
Sbjct  10200  GCTGGTTGCAAAGGCTCTG-GCTACGGCTCGCAGATCTACGGGCGATCGACGTGGTACAA  10258

Query  297    TGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
               | ||| ||||||||||||||| ||||||| ||||| ||
Sbjct  10259  CGGCGTCTGGGCCATCATGTACTCCTGGTACTTCCCCAA  10297

>PHSO:scaffold_6
Length=4785000

 Score = 105 bits (116),  Expect = 1e-20
 Identities = 192/278 (69%), Gaps = 10/278 (4%)
 Strand=Plus/Plus

Query  63      CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
               ||||  |||||||   ||   ||| |||||||||||  ||||||||||  |||| || ||
Sbjct  288982  CATCAACCACGACGCAGTGAAGCCGTTCCCGCAGCCGGAGCCCGTCACGATCTCGGAAAA  289041

Query  123     GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
               ||| ||  | ||||| ||||| ||| |   ||| |||   |||||   ||| ||||| ||
Sbjct  289042  GGCCGCGATCAAGTTCAAACCGCAGATCCGAATTGCCACAGGGTGCGTCCCATACCCCGC  289101

Query  183     CGTTCAGAAGGATG---GCTCCATTACCGGAGGTCTCAAGTGGAGTGGA--CCGCAGGAC  237
                ||   ||| ||||   ||   |  | ||| |||||  ||      ||   || || |  
Sbjct  289102  TGT---GAACGATGTGGGCGAGACCAGCGGCGGTCTTCAGACTTCCGGCAGCCCCAAG--  289156

Query  238     GGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAAT  297
               |||| ||||| ||||||    | |||||| ||| ||||||  ||| | |  ||| | |||
Sbjct  289157  GGCGGATGCAGAGGCTCCGGCCACGGCTCGCAGGTCTACGGACGCGCGGGCTGGTTCAAT  289216

Query  298     GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
               ||||| ||||||||||||||| | ||||| ||||| ||
Sbjct  289217  GACGTCTGGGCCATCATGTACTCGTGGTACTTCCCCAA  289254

 Score = 93.3 bits (102),  Expect = 8e-17
 Identities = 192/279 (69%), Gaps = 14/279 (5%)
 Strand=Plus/Minus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               || || |||||| ||||   ||| ||||| |||||  | || || ||  ||||||| |||
Sbjct  275565  ATTGGTCACGACGAGGTGAAGCCCTTCCCTCAGCCTGATCCTGTGACGATCTCCGAGAAG  275506

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGC  182
               || || || |||||||| || ||| |  | |||| | ||||| ||   ||| ||||||||
Sbjct  275505  GCTGCGGTCAAGTTTAAGCCGCAGATCGACATCGTC-ACGGGATGCGTCCCTTACCCTGC  275447

Query  183     CGTTCAGAAGGATG---GCTCCATTACCGGAGGTCTCAAG---TGGAGTGGACCGCAGGA  236
                ||   ||| ||||   ||   |  | ||| |||||  ||   | | |  | || |||| 
Sbjct  275446  TGT---GAACGATGCGGGCGAGACCAGCGGCGGTCTTCAGACTTCGGGCAGCCC-CAGG-  275392

Query  237     CGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAA  296
                ||||  |||   |||||    | |||||| ||  | ||||  |||||  ||||| | ||
Sbjct  275391  -GGCGGTTGCCGTGGCTCCGGTCACGGCTCGCAAGTGTACGGGCGCTCGACGTGGATCAA  275333

Query  297     TGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                | ||| ||||||||||||||| | ||||| ||||| ||
Sbjct  275332  CGGCGTCTGGGCCATCATGTACTCGTGGTACTTCCCCAA  275294

 Score = 60.8 bits (66),  Expect = 5e-07
 Identities = 172/256 (67%), Gaps = 14/256 (5%)
 Strand=Plus/Minus

Query  84      GCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACC  143
               ||||||||| |||||  |||| |||||  |||| || ||||| ||  | ||||| |||||
Sbjct  321463  GCCATTCCCACAGCCTGAGCCTGTCACGATCTCGGAGAAGGCCGCTATCAAGTTCAAACC  321404

Query  144     ACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGAT-GGCT---  199
                ||  ||   || | |  ||| ||   ||||||||| |  ||  || || || |||    
Sbjct  321403  GCAAATTCGTATTGGCTCCGGATGCGTCCCGTACCCCGTTGTG-AGCAGTATCGGCGAGA  321345

Query  200     CCATTACCGGAGGTCTCAAGT--GGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGAA  257
               ||| | | ||   ||  |  |  |||  |  ||| |||| ||    |||| ||||||   
Sbjct  321344  CCAGTGC-GGCCTTCAGACTTCAGGAA-GCCCCGAAGGAGGG----TGCAGAGGCTCTGG  321291

Query  258     GCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTA  317
                | |||||| ||  ||||||  ||  | |  |||   |||||||||||||||||||||||
Sbjct  321290  CCACGGCTCGCACGTCTACGGGCGTGCGGGCTGGCACAATGACGTGTGGGCCATCATGTA  321231

Query  318     CGCCTGG-TATTTCCC  332
               |  |||| | ||||||
Sbjct  321230  CTGCTGGTTCTTTCCC  321215

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 37/43 (86%), Gaps = 0/43 (0%)
 Strand=Plus/Minus

Query  298      GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                ||||| ||||||||||||||||| ||||| ||||| | || ||
Sbjct  1920566  GACGTTTGGGCCATCATGTACGCTTGGTACTTCCCCAGAGACA  1920524

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 37/43 (86%), Gaps = 0/43 (0%)
 Strand=Plus/Plus

Query  298      GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                ||||| ||||||||||||||||| ||||| ||||| | || ||
Sbjct  1955127  GACGTTTGGGCCATCATGTACGCTTGGTACTTCCCCAGAGACA  1955169

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 31/34 (91%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  392     ACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               |||||||| ||||| |||||| ||||||||||||
Sbjct  321177  ACTGGGAGCACGTCGTTGTGTAGATCGACAACCC  321144

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 37/47 (79%), Gaps = 0/47 (0%)
 Strand=Plus/Minus

Query  379     GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               || ||||| ||  |||||||| ||||  | ||||  |||||||||||
Sbjct  275271  GGCCACCGCCACGACTGGGAGCACGTTGTGGTGTTCATCGACAACCC  275225

>PHRA:scaffold_98
Length=165592

 Score = 105 bits (116),  Expect = 1e-20
 Identities = 193/280 (69%), Gaps = 6/280 (2%)
 Strand=Plus/Plus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               |||| ||||||| |||| |  |||||| |||| ||  |||| |||||||||||||| |||
Sbjct  140444  ATCGACCACGACAAGGTGCAACCATTCGCGCAACCCGAGCCTGTCACCGTCTCCGAGAAG  140503

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
               || || ||    ||||| ||    ||    |||| | |||| || |||||||||||||| 
Sbjct  140504  GCCGCCGTCCGATTTAAGCCGAGCCTGCGGATCGACCACGGATGCCACCCGTACCCTGCT  140563

Query  184     GTTCA-GAAG--GATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC  240
               ||  | |  |  | ||   ||| |   |  ||||| ||| | |  || ||   |   || 
Sbjct  140564  GTCAATGCTGCCGGTGAGACCAAT---GCGGGTCTAAAGGGAACAGGCCCATCGAGTGGA  140620

Query  241     GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
               || ||||  || |||   || || || ||| | ||||| ||  | |  |||   |  |||
Sbjct  140621  GATTGCAAGGGGTCGGGCCTGGGTTCGCAGGTGTACGCCCGAGCTGTATGGTATAGCGAC  140680

Query  301     GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                ||||||||||||||||||| |||||||||||||||| ||
Sbjct  140681  CTGTGGGCCATCATGTACGCGTGGTATTTCCCGAAAGACA  140720

 Score = 59.0 bits (64),  Expect = 2e-06
 Identities = 59/77 (77%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  262    GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
              ||||| ||| | ||||  || || |  |||   || || || ||||||||||||||||||
Sbjct  45903  GGCTCGCAGGTTTACGGCCGTTCTGAATGGTACAACGATGTCTGGGCCATCATGTACGCC  45844

Query  322    TGGTATTTCCCGAAAGG  338
              ||||| ||||| || ||
Sbjct  45843  TGGTACTTCCCCAAGGG  45827

>PHIF:NW_003307367.1 Phytophthora infestans T30-4 supercont1.1021 
genomic scaffold, whole genome shotgun sequence
Length=6852

 Score = 105 bits (116),  Expect = 1e-20
 Identities = 230/345 (67%), Gaps = 6/345 (2%)
 Strand=Plus/Plus

Query  1     ATGAACTTTCGGATCGTCCTCCTCGTCCTCGTCGCTTCGCTTGCAGGAGCCCAGGCTCAA  60
             |||||| | ||   | ||||  ||| |  |||||||||  |  | |  ||| | ||| ||
Sbjct  4333  ATGAACCTCCGCGCCTTCCTTATCGCCGCCGTCGCTTCCATAACTGTTGCCAATGCTAAA  4392

Query  61    GTCATCGG------CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTC  114
             |||| | |      ||||||  | || | ||| ||| | |||||    ||  |||||| |
Sbjct  4393  GTCAGCCGAGTCAACCACGATGAAGTGCAGCCGTTCGCCCAGCCGCTACCAATCACCGAC  4452

Query  115   TCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCG  174
             ||  | ||| | || || ||||  ||||| |||||  | ||  |  | || |||||||||
Sbjct  4453  TCACAGAAGTCTGCTGTCAAGTACAAACCCCAGCTCCACATATCGTATGGATGTCACCCG  4512

Query  175   TACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAG  234
             |||||||||||  ||    |  |||    ||  || |||||| | |||   |||||    
Sbjct  4513  TACCCTGCCGTCGAGCCCAACAGCTATGCTAGTGGCGGTCTCGAATGGCCAGGACCTGCT  4572

Query  235   GACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
             || || || ||||| |||||   ||| ||||| ||  | ||| |||| || |  |||   
Sbjct  4573  GATGGAGACTGCACGGGCTCTCCGCTGGGCTCACAAGTGTACTCTCGTTCGGATTGGTAC  4632

Query  295   AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
             ||  ||   ||||||||||||||||| ||||| ||||| ||||||
Sbjct  4633  AAGAACAAATGGGCCATCATGTACGCTTGGTACTTCCCCAAAGGC  4677

 Score = 53.6 bits (58),  Expect = 7e-05
 Identities = 74/104 (71%), Gaps = 0/104 (0%)
 Strand=Plus/Plus

Query  379   GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAAC  438
             || ||||||||| |||||||||||||| | || ||||  || | ||| | |   |  |||
Sbjct  4693  GGCCACCGTCATTACTGGGAGTACGTCGTCGTCTGGACAGATACCCCTACGTCGACCAAC  4752

Query  439   TCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGTACGC  482
             ||  | || |  ||||| || ||||| || |  |||||  ||||
Sbjct  4753  TCATCAATCCAGGGCGTGTCCATGTCTGCGGGTGTCGGTCACGC  4796

>PHRA:scaffold_17
Length=600116

 Score = 104 bits (115),  Expect = 4e-20
 Identities = 246/367 (67%), Gaps = 31/367 (8%)
 Strand=Plus/Plus

Query  64     ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
              |||| ||||||||| |||| ||| ||| |||||||  | ||  ||||  ||||||| |||
Sbjct  55522  ATCGACCACGACCAAGTTCAGCCGTTCGCGCAGCCTGAACCTATCACGATCTCCGAGAAG  55581

Query  124    GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
               | |  || ||||| ||||| ||| || |  || || | || || ||||||||||| || 
Sbjct  55582  TCCGGTGTCAAGTTCAAACCGCAGATTCACGTCACCAATGGATGCCACCCGTACCCCGCT  55641

Query  184    GTT---CAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC  240
              |||    | |||| ||   ||  |   || |||||||||  ||  ||  | |     |  
Sbjct  55642  GTTAACTACAAGGGTGAGACCGGT---GGTGGTCTCAAGACGAAGGGCGCTCCCAGTGCT  55698

Query  241    GAATGCACAGGCTC--GAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
              | |||||  || ||  || |   ||||| ||  | ||||  ||  | || |||      |
Sbjct  55699  GGATGCAAGGGTTCCGGATG--GGGCTCCCAAGTGTACGGGCGTGCGGCATGGCATCGCG  55756

Query  299    ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTC  358
              |||||||||||||||||||| ||||||| ||||| ||||          | || | ||||
Sbjct  55757  ACGTGTGGGCCATCATGTACTCCTGGTACTTCCCCAAAG----------ACTCGC-CTTC  55805

Query  359    CTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCG  418
                  ||     ||   ||| || ||||| ||  |||||||| ||||||| ||||||||||
Sbjct  55806  ----TA-----CG-GGTTTAGGCCACCGCCACGACTGGGAGCACGTCATCGTGTGGATCG  55855

Query  419    ACAACCC  425
              |||||||
Sbjct  55856  ACAACCC  55862

 Score = 104 bits (115),  Expect = 4e-20
 Identities = 244/362 (67%), Gaps = 31/362 (9%)
 Strand=Plus/Plus

Query  69     CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
              ||||||||| ||   ||| ||| | || ||  | ||  ||||  ||||||| ||||| | 
Sbjct  69572  CCACGACCAAGTGAAGCCGTTCGCACAACCTGAACCTATCACGATCTCCGAGAAGGCTGG  69631

Query  129    AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
               || ||||| ||||| ||| || |  || || |||| || |||||||||||||| ||  |
Sbjct  69632  TGTCAAGTTCAAACCGCAGATTCACGTCACCAACGGATGCCACCCGTACCCTGCAGTGAA  69691

Query  189    -GAAG--GATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATG  245
               ||||  | ||   ||  |   || ||||| |||  ||  ||  | |     |  | |||
Sbjct  69692  CGAAGCTGGTGAGACCGGT---GGTGGTCTTAAGACGAAGGGCGCTCCCAGTGCTGGATG  69748

Query  246    CACAGGCTC--GAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
              ||  || ||  || |   ||||||||| | ||||  || ||||  |||    | ||||||
Sbjct  69749  CAAGGGTTCCGGATG--GGGCTCTCAGGTGTACGGACGTTCCGGTTGGTACCAGGACGTG  69806

Query  304    TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTT  363
              ||||||||||||||| ||||||| ||||| ||||          | || | ||||    |
Sbjct  69807  TGGGCCATCATGTACTCCTGGTACTTCCCCAAAG----------ACTCGC-CTTC----T  69851

Query  364    ATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAAC  423
              |     ||   ||| || ||||| ||  |||||||| ||||||| |||||||||||||||
Sbjct  69852  A-----CG-GGTTTAGGCCACCGCCACGACTGGGAGCACGTCATCGTGTGGATCGACAAC  69905

Query  424    CC  425
              ||
Sbjct  69906  CC  69907

 Score = 100 bits (110),  Expect = 5e-19
 Identities = 241/365 (66%), Gaps = 25/365 (7%)
 Strand=Plus/Plus

Query  63     CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
              ||| | ||||||||| ||   ||| ||||| || ||| | || |||||  |||| || ||
Sbjct  52397  CATTGACCACGACCAAGTCAAGCCTTTCCCACAACCAGATCCTGTCACGATCTCTGAGAA  52456

Query  123    GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
              ||| |  || ||||| |||||||| ||  | ||  || | || || ||| | ||||||||
Sbjct  52457  GGCTGGTGTCAAGTTCAAACCACAACTACACATTACCAATGGATGCCACTCATACCCTGC  52516

Query  183    CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
               ||  |  | | |||   ||  |  || ||||| ||   ||  ||  | | |  || || 
Sbjct  52517  GGTGGATGATGCTGGAGACACCAGTGGTGGTCTTAAAACGACGGGTGCTCCGAGCGCCGG  52576

Query  243    ATGCACAGGCTC--GAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
              |||||  || ||  || |   || |||||  | ||||  || || | ||||    | |||
Sbjct  52577  ATGCAAGGGATCTGGATGG--GGTTCTCAAGTGTACGGACGTTCTGGGTGGTACCAAGAC  52634

Query  301    GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCT  360
              |||||||||||||||||| ||||||| |||||  ||||  |||           ||||| 
Sbjct  52635  GTGTGGGCCATCATGTACTCCTGGTACTTCCC-CAAGGACGAG----------CCTTCCA  52683

Query  361    CTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGAC  420
              |          |  | |||| ||||| ||  |||||||  |||| || ||||||||||||
Sbjct  52684  C----------TGGTATCGGCCACCGCCACGACTGGGAACACGTGATCGTGTGGATCGAC  52733

Query  421    AACCC  425
              |||||
Sbjct  52734  AACCC  52738

>PHRA:scaffold_60
Length=327626

 Score = 104 bits (114),  Expect = 4e-20
 Identities = 190/276 (69%), Gaps = 2/276 (1%)
 Strand=Plus/Plus

Query  63      CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
               ||| | ||||||||| || | ||| ||  | || ||| ||||||  ||| | || || ||
Sbjct  293656  CATGGACCACGACCAAGTGCAGCCCTTTGCTCAACCAGAGCCCGCGACCATTTCTGAGAA  293715

Query  123     GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
               ||| |  || ||||| ||||| ||| |  | ||| |  ||||||| ||||||||||||||
Sbjct  293716  GGCCGGTGTCAAGTTCAAACCGCAGATCCACATCACGAACGGGTGCCACCCGTACCCTGC  293775

Query  183     CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
                ||  |   | |||||   |    ||| |||||||||   |  ||| ||| |  | |   
Sbjct  293776  AGTGAACTGGAATGGCGATACGGGCGGCGGTCTCAAGCCCACCGGAGCGCCGAGCAGTTC  293835

Query  243     ATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACG  301
                || |  || ||   |||  ||||| ||| | ||||  |||||| | |||   || | ||
Sbjct  293836  CTGTAAGGGGTC-CGGCTGGGGCTCGCAGGTGTACGGCCGCTCCACCTGGTACAACGGCG  293894

Query  302     TGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
               | ||||||||||||||| | ||||| ||||| ||||
Sbjct  293895  TTTGGGCCATCATGTACTCTTGGTACTTCCCCAAAG  293930

>PHRA:scaffold_1409
Length=4922

 Score = 100 bits (110),  Expect = 5e-19
 Identities = 189/277 (68%), Gaps = 6/277 (2%)
 Strand=Plus/Plus

Query  64    ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
             |||| ||||||| |||| |  |||||| |||| ||  |||| |||||||||||||| |||
Sbjct  3482  ATCGACCACGACAAGGTGCAACCATTCGCGCAACCCGAGCCTGTCACCGTCTCCGAGAAG  3541

Query  124   GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
             || || ||    ||||| ||    ||    |||| |  ||| || |||||||||||||| 
Sbjct  3542  GCCGCCGTCCGATTTAAGCCGAGCCTGCGGATCGACACCGGTTGCCACCCGTACCCTGCT  3601

Query  184   GTTCAGAAGGATGGCTCCATTACC---GGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC  240
             ||    || | || |      |||   || ||||| ||| | |  ||   ||     || 
Sbjct  3602  GT---CAATGCTGCCGGGGAGACCAGTGGGGGTCTAAAGGGAACAGGTATGCCTAGTGGA  3658

Query  241   GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
             || ||||  || |||    | || || ||| | ||||| ||  |||  |||   |  |||
Sbjct  3659  GATTGCAAGGGATCGGGCTTGGGGTCGCAGGTGTACGCCCGAGCCGTTTGGTATAGCGAC  3718

Query  301   GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
              ||||||||||||||||||| ||||||||||||||||
Sbjct  3719  CTGTGGGCCATCATGTACGCGTGGTATTTCCCGAAAG  3755

>PHKE:scaffold_277 scf_22126_277.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_277.1_contig_1:1:48515:1 
REF
Length=48515

 Score = 100 bits (110),  Expect = 5e-19
 Identities = 232/343 (68%), Gaps = 29/343 (8%)
 Strand=Plus/Plus

Query  88     TTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGC-AGCAGTAAAGTTTAAACCACA  146
              ||||| |||||| | ||||||||  | ||||| ||||| ||| || ||||||||||||||
Sbjct  26709  TTCCCTCAGCCAGACCCCGTCACAATTTCCGAGAAGGCTAGC-GTCAAGTTTAAACCACA  26767

Query  147    GCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTAC  206
              |||| | ||| |   ||||| ||||||||| || || ||  |    | ||||   |  | 
Sbjct  26768  GCTTCACATCTCGACCGGGTATCACCCGTATCCGGCAGTGGATGCCGCTGGCGAGACGAG  26827

Query  207    CGGAGGTC-TCAAGTG-GAGTGGACCGCAGGACGGCGAATGCACAGG-CTCGAAGCTCGG  263
               || |||| ||||  | | | || ||  ||  ||  | |||||  ||  ||| |  | ||
Sbjct  26828  TGGTGGTCTTCAACCGAGTGGGGTCCCTAG--CGCTGCATGCAAGGGATTCGGA-TTGGG  26884

Query  264    CTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTG  323
               |||||  | ||||  | |||||  ||| | || | || | |||||||||||||| | ||
Sbjct  26885  TTCTCAAGTGTACGGCCACTCCGACTGGCTCAACGGCGCGCGGGCCATCATGTACTCGTG  26944

Query  324    GTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCACCCGTCTTTTCGGACA  383
              ||| ||| ||||          | | || |         ||||  ||| |   | || ||
Sbjct  26945  GTACTTCGCGAA----------GGATTCTC---------TATCCACCGGC--CTGGGTCA  26983

Query  384    CCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCC  426
               |||||  |||||||| ||| ||||||||||||||||||||||
Sbjct  26984  TCGTCACGACTGGGAGCACGCCATTGTGTGGATCGACAACCCC  27026

 Score = 75.2 bits (82),  Expect = 2e-11
 Identities = 59/71 (83%), Gaps = 0/71 (0%)
 Strand=Plus/Minus

Query  262    GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
              || || |||||||||||||||||| |||||   | ||| || |||| |||| ||||||| 
Sbjct  28081  GGATCGCAGATCTACGCTCGCTCCACGTGGCGTAGTGATGTTTGGGTCATCGTGTACGCG  28022

Query  322    TGGTATTTCCC  332
              |||||||||||
Sbjct  28021  TGGTATTTCCC  28011

>PHIF:NW_003303739.1 Phytophthora infestans T30-4 supercont1.20 
genomic scaffold, whole genome shotgun sequence
Length=2401636

 Score = 99.6 bits (109),  Expect = 2e-18
 Identities = 244/366 (67%), Gaps = 27/366 (7%)
 Strand=Plus/Minus

Query  63       CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
                ||||| |||||| || ||   |||||| || || ||  |||| |||||  |||| || ||
Sbjct  1561568  CATCGACCACGATCAAGTGAAGCCATTTCCTCAACCTCAGCCTGTCACGATCTCTGAAAA  1561509

Query  123      GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
                ||||||||| ||||| ||||| || ||| | ||| |  |||| || ||| |||| |||||
Sbjct  1561508  GGCAGCAGTTAAGTTCAAACCCCAACTTCACATCACGAACGGATGCCACTCGTATCCTGC  1561449

Query  183      CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCA-GGACGGC-  240
                 ||  |  | |  ||    | |   || ||| | ||    |  ||  ||||  ||  || 
Sbjct  1561448  GGTCAACGAAGCCGGTGAGACTGGAGGTGGTTTGAAAATAAAAGG--CGCACCGAGTGCA  1561391

Query  241      GAATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGA  299
                | |||||  ||||| | |||  ||||| ||| | |||| ||| ||    |||    | | 
Sbjct  1561390  GGATGCAAGGGCTC-AGGCTGGGGCTCACAGGTTTACGGTCGATCTAGCTGGTACCAGGG  1561332

Query  300      CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCC  359
                ||| |||||||||||||||   ||||||||||| ||     || | ||||||| ||    
Sbjct  1561331  CGTTTGGGCCATCATGTACTGTTGGTATTTCCCTAA----GGACGAGCAGTCCTTC----  1561280

Query  360      TCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGA  419
                    |  |         |||| || || ||  |||||||| ||||||| |||||||||||
Sbjct  1561279  ----AAAA---------TCGGCCATCGCCACGACTGGGAGCACGTCATCGTGTGGATCGA  1561233

Query  420      CAACCC  425
                ||||||
Sbjct  1561232  CAACCC  1561227

 Score = 92.4 bits (101),  Expect = 3e-16
 Identities = 192/280 (69%), Gaps = 11/280 (4%)
 Strand=Plus/Plus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                |||| ||||||||| ||   ||||||  | || ||  ||||  | ||  |||| || |||
Sbjct  1537375  ATCGACCACGACCAAGTCAAGCCATTTTCTCAACCGGAGCCTCTGACAATCTCAGAGAAG  1537434

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                |||||||| ||||| || || ||| || |  || |  | || || |||||||||||||| 
Sbjct  1537435  GCAGCAGTCAAGTTCAAGCCTCAGATTCACGTCACAAATGGATGCCACCCGTACCCTGCG  1537494

Query  184      GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGA---GTGGACCGCAGGACGGC  240
                ||  |  | |  |||   |  | | | |||||||||  ||   |||  || |||  ||  
Sbjct  1537495  GTGAACGAAGCCGGCGAGACCAGCAGTGGTCTCAAGACGAAGGGTGCTCC-CAG--CGCT  1537551

Query  241      GAATGCACAGG--CTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
                |  ||||  ||  || || |   || |||||| | ||||  || ||  |||||||  |||
Sbjct  1537552  GGGTGCAAGGGATCTGGATG--GGGTTCTCAGGTGTACGGCCGATCAACGTGGGTCGATG  1537609

Query  299      ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                  || |||||||| |||||| | ||||||||||| |||||
Sbjct  1537610  GTGTCTGGGCCATTATGTACTCGTGGTATTTCCC-AAAGG  1537648

>PHIF:NW_003303758.1 Phytophthora infestans T30-4 supercont1.1 
genomic scaffold, whole genome shotgun sequence
Length=6928287

 Score = 98.7 bits (108),  Expect = 2e-18
 Identities = 246/372 (66%), Gaps = 29/372 (8%)
 Strand=Plus/Minus

Query  62       TCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACA  121
                |||||| ||||||   |||   ||| |||   ||  |  |||| |||||  | || || |
Sbjct  4076532  TCATCGACCACGATGCGGTGGTGCCGTTCAAACAAACGGAGCCTGTCACGATTTCGGAAA  4076473

Query  122      AGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTG  181
                | || || || ||||||||||| |||||| | ||| ||| ||||||||| ||||||||||
Sbjct  4076472  AAGCTGCCGTGAAGTTTAAACCCCAGCTTCACATCACCGGCGGGTGTCATCCGTACCCTG  4076413

Query  182      CCGTTCAGAAGG---ATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACG  238
                | ||   ||| |    |||    | ||  || |||||||||  ||| ||  | |     |
Sbjct  4076412  CAGT---GAACGCAATTGGACAGACTAGTGGCGGTCTCAAGACGAGCGGTGCTCCTAGTG  4076356

Query  239      GCGAATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAAT  297
                 ||  || | ||| |    |||  || || ||| ||||||  || ||  |||||   |||
Sbjct  4076355  CCGGTTGTA-AGGGTTCTGGCTGGGGTTCCCAGGTCTACGGACGGTCAACGTGGTACAAT  4076297

Query  298      GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTT  357
                | ||| ||||||||||||||| | ||||| ||||| ||        || |   || ||| 
Sbjct  4076296  GGCGTCTGGGCCATCATGTACTCGTGGTACTTCCCCAA--------GGACTCGCCATCT-  4076246

Query  358      CCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATC  417
                         ||| |||   | || || |||||  |||||||  |||| || |||||||||
Sbjct  4076245  ---------ACCGGTC---TGGGTCATCGTCACGACTGGGAACACGTGATCGTGTGGATC  4076198

Query  418      GACAACCCCAAG  429
                || |||||| ||
Sbjct  4076197  GATAACCCCGAG  4076186

 Score = 67.1 bits (73),  Expect = 1e-08
 Identities = 183/278 (66%), Gaps = 2/278 (1%)
 Strand=Plus/Minus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                ||||  || ||| |||||| ||||||| | |||||  | ||  |||||| |  ||| |||
Sbjct  5656226  ATCGATCATGACAAGGTTCAGCCATTCGCACAGCCCCAACCGATCACCGACGTCGAGAAG  5656167

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGC  182
                || || || ||||| || ||    |||  | | |  | | || |||||||||||||||||
Sbjct  5656166  GCTGCCGTCAAGTTCAAGCCTTCACTTGCAGT-GATGTCTGGATGTCACCCGTACCCTGC  5656108

Query  183      CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
                |||  |    | ||||   | ||  |  ||  | ||  | |  ||   ||  ||||| | 
Sbjct  5656107  CGTGAATGCTGCTGGCGAAACTAGTGCCGGCTTGAAAGGAACAGGGGAGCCTGACGGTGG  5656048

Query  243      ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
                 ||   ||| ||  || | || || ||| | ||    || ||  |||||    | | |  
Sbjct  5656047  CTGTGAAGGTTCCGAGTTGGGGTCGCAGGTGTATAGCCGATCAACGTGGTACGAGGGCAG  5655988

Query  303      GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                |||||||||||||||||| ||||||||||| |||| ||
Sbjct  5655987  GTGGGCCATCATGTACGCATGGTATTTCCCTAAAGACA  5655950

 Score = 59.0 bits (64),  Expect = 2e-06
 Identities = 65/85 (76%), Gaps = 4/85 (5%)
 Strand=Plus/Plus

Query  250      GGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGT--GAATGACGTGTGGG  307
                ||||||||  | ||| | ||  |||| | ||||||||| ||| |  | | |  || ||||
Sbjct  4123415  GGCTCGAAATTGGGCACGCAAGTCTATGGTCGCTCCGCCTGGTTCGGCAGG--GTCTGGG  4123472

Query  308      CCATCATGTACGCCTGGTATTTCCC  332
                | ||||||||||||||||| |||||
Sbjct  4123473  CAATCATGTACGCCTGGTACTTCCC  4123497

>PHPA:scaffold_34 NW_008649020.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.34, whole genome shotgun 
sequence
Length=723591

 Score = 96.0 bits (105),  Expect = 2e-17
 Identities = 190/277 (69%), Gaps = 6/277 (2%)
 Strand=Plus/Plus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               |||||||||||  | ||   ||| ||||| |||||  | || |||||  |||| || |||
Sbjct  326296  ATCGGCCACGATGATGTGAAGCCGTTCCCTCAGCCCGAACCGGTCACGATCTCAGAGAAG  326355

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGC  182
               || |  || ||||| ||||| ||| || ||||| | |||||| ||| | |||||||||||
Sbjct  326356  GCTGGTGTCAAGTTCAAACCTCAGATTCAAATC-CGGACGGGATGTGAGCCGTACCCTGC  326414

Query  183     CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGG--ACCGCAGGACGGC  240
               |||  |  |  | ||    |  | ||| ||||| ||      |||  |    |||  |||
Sbjct  326415  CGTGAACGAATACGGGGAGACCAGCGGTGGTCTGAAAACTTCTGGTAAATCTAGG--GGC  326472

Query  241     GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
                | |||   || ||    | |||||| ||| | ||||  || ||  ||||| |  | |  
Sbjct  326473  AATTGCGGTGGATCTGGTCACGGCTCCCAGGTGTACGGCCGTTCGACGTGGATCGAGGGT  326532

Query  301     GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
               |||||||||||||||||| | ||||| ||||||||||
Sbjct  326533  GTGTGGGCCATCATGTACTCGTGGTACTTCCCGAAAG  326569

 Score = 88.7 bits (97),  Expect = 3e-15
 Identities = 190/277 (69%), Gaps = 8/277 (3%)
 Strand=Plus/Minus

Query  63      CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
               ||||||||||||  | ||   ||| ||||| |||||  | || |||||  | || || ||
Sbjct  308530  CATCGGCCACGATGAAGTGAAGCCGTTCCCTCAGCCCGAACCGGTCACGATTTCTGAGAA  308471

Query  123     GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTG  181
               ||| |  || ||||| ||||| ||| || |||||  | ||||| ||    || |||||||
Sbjct  308470  GGCCGGTGTCAAGTTCAAACCTCAGATTCAAATCCGC-ACGGGATGCGTGCCTTACCCTG  308412

Query  182     CCGTTCAGAAGGATGGCTCCATTACCGGAGGTCT-CAAG--TGGAGTGGACCGCAGGACG  238
               ||||  |  ||  |||    |  |  || ||||| |||   |   || | || |  || |
Sbjct  308411  CCGTGAACGAGCTTGGTGAGACCAGTGGCGGTCTTCAAACTTCTGGTAGTCCAC--GA-G  308355

Query  239     GCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
               |||  |||  ||||||    | ||| || ||| | |||| ||| ||  ||||| |  | |
Sbjct  308354  GCGGGTGCCGAGGCTCCGGCCACGGTTCCCAGGTGTACGGTCGTTCAACGTGGATTGAGG  308295

Query  299     ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                 |||||||||||||||||| | ||||||||||||||
Sbjct  308294  GTGTGTGGGCCATCATGTACTCGTGGTATTTCCCGAA  308258

 Score = 88.7 bits (97),  Expect = 3e-15
 Identities = 190/277 (69%), Gaps = 8/277 (3%)
 Strand=Plus/Plus

Query  63      CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
               ||||||||||||  | ||   ||| ||||| |||||  | || |||||  | || || ||
Sbjct  332424  CATCGGCCACGATGAAGTGAAGCCGTTCCCTCAGCCCGAACCGGTCACGATTTCTGAGAA  332483

Query  123     GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTG  181
               ||| |  || ||||| ||||| ||| || |||||  | ||||| ||    || |||||||
Sbjct  332484  GGCCGGTGTCAAGTTCAAACCTCAGATTCAAATCCGC-ACGGGATGCGTGCCTTACCCTG  332542

Query  182     CCGTTCAGAAGGATGGCTCCATTACCGGAGGTCT-CAAG--TGGAGTGGACCGCAGGACG  238
               ||||  |  ||  |||    |  |  || ||||| |||   |   || | || |  || |
Sbjct  332543  CCGTGAACGAGCTTGGTGAGACCAGTGGCGGTCTTCAAACTTCTGGTAGTCCAC--GA-G  332599

Query  239     GCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
               |||  |||  ||||||    | ||| || ||| | |||| ||| ||  ||||| |  | |
Sbjct  332600  GCGGGTGCCGAGGCTCCGGCCACGGTTCCCAGGTGTACGGTCGTTCAACGTGGATTGAGG  332659

Query  299     ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                 |||||||||||||||||| | ||||||||||||||
Sbjct  332660  GTGTGTGGGCCATCATGTACTCGTGGTATTTCCCGAA  332696

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 39/47 (83%), Gaps = 0/47 (0%)
 Strand=Plus/Minus

Query  379     GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               || ||||||||  |||||||  ||| ||||||||  |||||||||||
Sbjct  308235  GGTCACCGTCACGACTGGGAACACGCCATTGTGTTCATCGACAACCC  308189

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 39/47 (83%), Gaps = 0/47 (0%)
 Strand=Plus/Plus

Query  379     GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               || ||||||||  |||||||  ||| ||||||||  |||||||||||
Sbjct  332719  GGTCACCGTCACGACTGGGAACACGCCATTGTGTTCATCGACAACCC  332765

>PHSO:scaffold_33
Length=46552

 Score = 95.1 bits (104),  Expect = 2e-17
 Identities = 184/272 (68%), Gaps = 0/272 (0%)
 Strand=Plus/Plus

Query  64     ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
              |||| ||||||| |||| | ||| ||  |||||||  |||| |||||||| ||||| || 
Sbjct  40509  ATCGACCACGACAAGGTACAGCCGTTTGCGCAGCCCGAGCCAGTCACCGTGTCCGAGAAA  40568

Query  124    GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
               | || ||||| || |||||    ||  | |||| || ||| || |||||||||||||| 
Sbjct  40569  ACCGCTGTAAAATTCAAACCGAGTCTCCAGATCGACGGCGGATGCCACCCGTACCCTGCT  40628

Query  184    GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
              ||  |    |  ||    |  | ||  || || ||  | ||||||||  | |||||  ||
Sbjct  40629  GTCAACGCTGCGGGTGAAACGAGCGCGGGGCTAAAAGGAAGTGGACCTGACGACGGGAAA  40688

Query  244    TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
              ||||  || ||    |||||||| ||  | || |  ||  |    |||   || ||  | 
Sbjct  40689  TGCAAGGGGTCCGGTCTCGGCTCGCAAGTGTATGGACGAGCTATATGGTACAAGGATCTC  40748

Query  304    TGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
              ||||||||| |||||| |||||| ||||| ||
Sbjct  40749  TGGGCCATCGTGTACGGCTGGTACTTCCCCAA  40780

>PHKE:scaffold_309 scf_22126_309.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_309.1:1:43521:1 
REF
Length=43521

 Score = 95.1 bits (104),  Expect = 2e-17
 Identities = 187/275 (68%), Gaps = 4/275 (1%)
 Strand=Plus/Plus

Query  63     CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
              |||||  |||||||| ||    || |||  ||||||  | || |||||  | || || ||
Sbjct  42302  CATCGATCACGACCAAGTGAAACCGTTCGGGCAGCCTGAACCTGTCACGATTTCTGAGAA  42361

Query  123    GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
              ||| |  || ||||| || || ||| || | ||  || | || || ||||||||||||||
Sbjct  42362  GGCTGGTGTCAAGTTCAAGCCCCAGATTCACATTACCAATGGTTGCCACCCGTACCCTGC  42421

Query  183    CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
              |||  |  | | ||||   | || ||| || |||||    |  ||| | |    || || 
Sbjct  42422  CGTCAACGAAGCTGGCGAGACTAGCGGTGGGCTCAAAACCAAGGGAGCTCCTAGCGCCGG  42481

Query  243    ATGCACAGG--CTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
              ||||| |||  || || |   || |||||  | || | ||||||||  |||  ||| || 
Sbjct  42482  ATGCAAAGGTTCTGGATG--GGGTTCTCAAGTGTATGGTCGCTCCGGTTGGAAGAACGAT  42539

Query  301    GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
              || ||||| ||||||||  | ||||||||||| ||
Sbjct  42540  GTCTGGGCTATCATGTATTCGTGGTATTTCCCCAA  42574

 Score = 80.6 bits (88),  Expect = 5e-13
 Identities = 191/282 (68%), Gaps = 9/282 (3%)
 Strand=Plus/Plus

Query  61    GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAG-CCAAAGCC-CGTCACCGTCTCCG  118
             |||||| | |||||||| ||    |||||| ||||| ||   ||| ||||  | |  |  
Sbjct  1912  GTCATCAGTCACGACCAAGTGATCCCATTCGCGCAGTCCGCGGCCACGTC--CATTACGA  1969

Query  119   ACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACC  178
             ||| ||  ||| | |||||||| || ||| ||   |||  | |||| || ||||| ||||
Sbjct  1970  ACACGGTTGCACTCAAGTTTAAGCCTCAGATTTTCATCAACAACGGCTGCCACCCATACC  2029

Query  179   CTGCCGTTCA--GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGA  236
             |||||||  |  |||  | ||   ||  | ||| || |||||   ||||||  |  ||  
Sbjct  2030  CTGCCGTGAATGGAA--ACGGTGACACGAGCGGTGGGCTCAAACCGAGTGGTTCCGAGAG  2087

Query  237   CGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAA  296
              |  |  ||||  |||||      ||| || ||  |||||| ||| ||  | |||   ||
Sbjct  2088  TGCTGGTTGCAAGGGCTCCGGTTACGGTTCGCAAGTCTACGGTCGATCGACCTGGTACAA  2147

Query  297   TGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               |||||||||||||||||||| | ||||||||||| |||||
Sbjct  2148  CAACGTGTGGGCCATCATGTACTCTTGGTATTTCCC-AAAGG  2188

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  733    CTAGACAAGGCATGGCCGTTTTA  755
              ||||||||||| |||||||||||
Sbjct  42927  CTAGACAAGGCGTGGCCGTTTTA  42949

>PHCA:scaffold_87 PHYCAscaffold_87
Length=182599

 Score = 95.1 bits (104),  Expect = 2e-17
 Identities = 191/279 (68%), Gaps = 6/279 (2%)
 Strand=Plus/Plus

Query  60      AGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGA  119
               |||||| ||||||||||||||   ||| ||| | || || | |||     || ||||| |
Sbjct  153128  AGTCATTGGCCACGACCAGGTCGTGCCGTTCGCACAACCGACGCCGACTTCCATCTCCCA  153187

Query  120     CAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCC  179
                |   | || || || || || ||||||||  | ||| || |||| || || ||||| ||
Sbjct  153188  GACTACCGCCGTCAATTTCAAGCCACAGCTCCACATCACCAACGGCTGCCATCCGTATCC  153247

Query  180     TGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCG--CAGGAC  237
                |||||  |   ||||||   ||  |  || || |||||   |   ||  ||  |||   
Sbjct  153248  GGCCGTCGACGCGGATGGTAACACCAGTGGCGGCCTCAATCCGGCCGGTTCGTCCAG--T  153305

Query  238     GGCGAATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAA  296
               | || ||||| |||||||  ||| ||||  ||| |||||||  || || || |||   ||
Sbjct  153306  GCCGGATGCAAAGGCTCG-GGCTACGGCAGTCAAATCTACGGGCGATCGGCTTGGTACAA  153364

Query  297     TGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                | ||| ||||| ||||||||| ||||||| ||||| ||
Sbjct  153365  CGGCGTCTGGGCGATCATGTACTCCTGGTACTTCCCCAA  153403

 Score = 86.0 bits (94),  Expect = 1e-14
 Identities = 92/122 (75%), Gaps = 0/122 (0%)
 Strand=Plus/Minus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               ||||  |||||||| ||   ||| ||||| |||||  |||| |||||| | ||||| | |
Sbjct  164226  ATCGATCACGACCAAGTGAAGCCCTTCCCACAGCCTCAGCCGGTCACCATTTCCGAGAGG  164167

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
               || ||  | ||||| ||||| || ||  |  ||| |||||||||||| || |||||||| 
Sbjct  164166  GCTGCGATGAAGTTCAAACCCCAACTGCACGTCGTCGACGGGTGTCATCCTTACCCTGCT  164107

Query  184     GT  185
               ||
Sbjct  164106  GT  164105

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 126/188 (67%), Gaps = 4/188 (2%)
 Strand=Plus/Plus

Query  34      GCTTCGCTTGCAGGAGCCCAGGCTCAAGTCATCGGCCACGACCAGGTTCGGCCATTCCCG  93
               || ||||||||  | | | | |||   || |||| ||||||||||||    || ||| | 
Sbjct  152142  GCCTCGCTTGCTTGCGTCAATGCTGCTGTTATCGACCACGACCAGGTCGTTCCGTTCGCC  152201

Query  94      CAGCCAAAGCCCGTCAC--CGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTA  151
               || || |  ||   |||  |||  | |||  |  ||| ||  ||| |||||| ||| |  
Sbjct  152202  CAACCGACTCCAACCACGACGTTGCAGAC--GTTAGCCGTCCAGTATAAACCTCAGATCT  152259

Query  152     AAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAG  211
               | |||||| |||| || || |||||||| |||||  |  | ||||||  ||  |  || |
Sbjct  152260  ACATCGCCAACGGCTGCCATCCGTACCCGGCCGTCGACGAAGATGGCAACACCAGTGGTG  152319

Query  212     GTCTCAAG  219
               | ||||||
Sbjct  152320  GGCTCAAG  152327

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 57/76 (75%), Gaps = 0/76 (0%)
 Strand=Plus/Minus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               ||||||||| | || |  |||||  | |||      || || ||||||||||||||| | 
Sbjct  164028  GGCTCTCAGGTGTATGGCCGCTCGACATGGCACCGAGATGTCTGGGCCATCATGTACTCT  163969

Query  322     TGGTATTTCCCGAAAG  337
               ||||||||||| ||||
Sbjct  163968  TGGTATTTCCCTAAAG  163953

>PHPA:scaffold_54 NW_008649040.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.54, whole genome shotgun 
sequence
Length=467981

 Score = 93.3 bits (102),  Expect = 8e-17
 Identities = 190/280 (68%), Gaps = 2/280 (1%)
 Strand=Plus/Plus

Query  59      AAGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCG  118
               |||| || | ||||||  | |||| ||| ||  | || |||  ||| | |||||||||||
Sbjct  359007  AAGT-ATTGTCCACGATAAAGTTCAGCCGTTTGCACAACCAGTGCCAGCCACCGTCTCCG  359065

Query  119     ACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACC  178
               | | ||  ||  | |  || || ||    ||   ||||| |  ||| || ||||||||||
Sbjct  359066  AGACGGTGGCCATCACATTCAAGCCGAGTCTCCGAATCGACAGCGGATGCCACCCGTACC  359125

Query  179     CTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACG  238
               |||||||| |    | |||||  |  |  | ||| |||||| | |  ||  |||     |
Sbjct  359126  CTGCCGTTAATGCTGCTGGCTAAACCAATGCAGGGCTCAAGGGCACCGGGTCGCCCAGTG  359185

Query  239     GCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
               | |  |||| ||| ||  | || |||||||||||||||| |||  | || |||   || |
Sbjct  359186  GAGGCTGCAAAGGATCACACCTGGGCTCTCAGATCTACGGTCGAGCTGCTTGGCATAAGG  359245

Query  299     ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                  | ||||| ||||| ||||| ||||||||||| |||||
Sbjct  359246  GTCTCTGGGCAATCATATACGCATGGTATTTCCC-AAAGG  359284

>PHSO:scaffold_7
Length=4006126

 Score = 92.4 bits (101),  Expect = 3e-16
 Identities = 242/366 (66%), Gaps = 39/366 (11%)
 Strand=Plus/Minus

Query  69      CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
               ||||||| |||| | ||| ||| | |||||  |||| |||||  | ||||| ||||| | 
Sbjct  426750  CCACGACAAGGTGCAGCCGTTCGCTCAGCCGGAGCCTGTCACGATTTCCGAGAAGGCCGG  426691

Query  129     AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
               ||| ||||| ||||| ||  ||   |||    | || || |||||||||||||| ||  |
Sbjct  426690  AGTCAAGTTCAAACCGCAAATTCGCATCATAAATGGATGCCACCCGTACCCTGCGGTGAA  426631

Query  189     GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC--GAATGC  246
                 | |  ||    |  |  |||||||||||         ||  |||| ||||   ||| |
Sbjct  426630  CGAAGCCGGAGAGACGAGTGGAGGTCTCAA--------AACTACAGG-CGGCCACAATTC  426580

Query  247     ACAG-GC--TCGA---AGCTCG-GCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGA  299
               | || ||   |||    ||| |  ||| ||  | |||| ||||||| ||||| |    | 
Sbjct  426579  AAAGAGCAAGCGATCTGGCTGGAACTCGCAAGTGTACGGTCGCTCCACGTGGTTCCGAGG  426520

Query  300     CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCC  359
               ||| ||||||||||||||| | ||||||||||| ||          | | || | |||  
Sbjct  426519  CGTCTGGGCCATCATGTACTCGTGGTATTTCCCCAA----------GGACTCGC-CTT--  426473

Query  360     TCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGA  419
                       ||| |  | | || ||||| ||  |||||||| |||||||||||||||||||
Sbjct  426472  --------CCCATGGTCTGGGCCACCGCCACGACTGGGAGCACGTCATTGTGTGGATCGA  426421

Query  420     CAACCC  425
               ||||||
Sbjct  426420  CAACCC  426415

 Score = 73.4 bits (80),  Expect = 7e-11
 Identities = 186/278 (67%), Gaps = 9/278 (3%)
 Strand=Plus/Minus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                |||| ||| ||| ||||   |||||| || |||||  | ||||| ||| |||| || |||
Sbjct  1821005  ATCGACCATGACAAGGTGGAGCCATTTCCTCAGCCGGATCCCGTGACCATCTCGGAGAAG  1820946

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                || ||||| ||||| || || ||| |    || |  ||||| ||   | | | ||| || 
Sbjct  1820945  GCGGCAGTCAAGTTCAAGCCGCAGTTGCTTATTGAGGACGGATGCGTCTCCTTCCCCGCG  1820886

Query  184      GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGAC-CGCAGGACGGCGA  242
                ||  |    | ||||   |  | |||||| || ||| |||    || ||    |   || 
Sbjct  1820885  GTCAACGCTGCTGGCGAGACCAGCGGAGGACTGAAGGGGA----ACTCGGGAAATTCCGC  1820830

Query  243      ATGC-ACAG-GCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
                |||| | || |||| |  || ||||| ||  | ||||  ||  ||  ||||   || || 
Sbjct  1820829  ATGCGATAGCGCTCCA--CTGGGCTCGCAAGTGTACGGCCGAGCCATGTGGTACAAGGAT  1820772

Query  301      GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                || ||||||||||||||||||||||| ||||| || ||
Sbjct  1820771  GTCTGGGCCATCATGTACGCCTGGTACTTCCCCAAGGG  1820734

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 65/88 (74%), Gaps = 0/88 (0%)
 Strand=Plus/Minus

Query  63       CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
                |||||  ||||||   || |  |||||  | || || || || ||||||||||| || ||
Sbjct  1803987  CATCGATCACGACGCCGTGCAACCATTTGCCCAACCCAACCCTGTCACCGTCTCGGAGAA  1803928

Query  123      GGCAGCAGTAAAGTTTAAACCACAGCTT  150
                ||| ||||| |||||| | || | ||||
Sbjct  1803927  GGCTGCAGTCAAGTTTCAGCCGCTGCTT  1803900

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 32/35 (91%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  304      TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                ||||||||||||||||||||||| ||||| || ||
Sbjct  1803746  TGGGCCATCATGTACGCCTGGTACTTCCCCAAGGG  1803712

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Minus

Query  240      CGAATGCACAGGCTCGAAGCTCGGCTC  266
                |||||||||||||| ||| ||||||||
Sbjct  2437402  CGAATGCACAGGCTTGAA-CTCGGCTC  2437377

>PHRA:scaffold_780
Length=8633

 Score = 92.4 bits (101),  Expect = 3e-16
 Identities = 243/369 (66%), Gaps = 33/369 (9%)
 Strand=Plus/Minus

Query  63    CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
             ||| | ||||||||| ||    || ||||| || ||| | || |||||  |||| || ||
Sbjct  7538  CATTGACCACGACCAAGTCAAACCTTTCCCACAACCAGATCCTGTCACGATCTCTGAAAA  7479

Query  123   GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
             ||| |  || ||||| |||||||| ||  | ||  || | || || ||| | ||||||||
Sbjct  7478  GGCTGGTGTCAAGTTCAAACCACAACTACACATTACCAATGGATGCCACTCATACCCTGC  7419

Query  183   CGTTCAGAAGGATGGCTCCAT-TACC---GGAGGTCTCAAGTGGAGTGGACCGCAGGACG  238
              ||   | | |||| ||  |  ||||   || ||||| ||   ||  ||  | | |  ||
Sbjct  7418  GGT---GGATGATG-CTGGAGATACCAGTGGTGGTCTTAAAACGACGGGTGCTCCGAGCG  7363

Query  239   GCGAATGCACAGGCTC--GAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAA  296
              || |||||  || ||  || |   || |||||  | ||||  || || | ||||    |
Sbjct  7362  CCGGATGCAAGGGATCTGGATGG--GGTTCTCAAGTGTACGGACGTTCTGGGTGGTACCA  7305

Query  297   TGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCT  356
              ||||||||||||||||||||| ||||||| ||||| || | |  |            ||
Sbjct  7304  AGACGTGTGGGCCATCATGTACTCCTGGTACTTCCCCAAGGACGAAC-----------CT  7256

Query  357   TCCTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGAT  416
             ||| ||  |           |||| ||||| ||  |||||||| |||| || ||||||||
Sbjct  7255  TCCACTGGTA----------TCGGCCACCGCCACGACTGGGAGCACGTGATCGTGTGGAT  7206

Query  417   CGACAACCC  425
             |||||||||
Sbjct  7205  CGACAACCC  7197

>PHCA:scaffold_162 PHYCAscaffold_162
Length=48736

 Score = 92.4 bits (101),  Expect = 3e-16
 Identities = 204/302 (68%), Gaps = 12/302 (4%)
 Strand=Plus/Minus

Query  179   CTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACG  238
             ||||||||||   ||| || ||| ||| ||  ||  | ||||||| ||||  |   || |
Sbjct  1167  CTGCCGTTCAAGCGGACGGATCCGTTAGCGCTGGATTGAAGTGGACTGGATGGTCTGATG  1108

Query  239   GCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
             | || ||||  |||||  |  | || |||||  | ||| | || ||||  |||   || |
Sbjct  1107  GAGACTGCAAGGGCTCTGAATTGGGATCTCAAGTGTACTCGCGTTCCGATTGGTACAAGG  1048

Query  299   ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTC  358
             |   |||||| ||||||||||||||||| ||||| || ||  ||    |||| | || ||
Sbjct  1047  ATAAGTGGGCAATCATGTACGCCTGGTACTTCCCTAAGGGTCGA----CAGTACATC-TC  993

Query  359   CTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCG  418
             |   ||    ||| ||||  || ||||| ||  |||||   ||||  ||||||||||| |
Sbjct  992   CAAGTA----CCG-CTTT--GGTCACCGCCACTACTGGTCATACGCTATTGTGTGGATGG  940

Query  419   ACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGT  478
             | |       |  | | |||||||||||||| || || || ||||| ||||  || || |
Sbjct  939   ATAGTGATGTGCCCGACAACTCGACCATTCTCGGAGTCTCTATGTCTGCTGGTGTTGGCT  880

Query  479   AC  480
             ||
Sbjct  879   AC  878

>PYUU:scaffold_1297 scf1117875581297 dna:supercontig supercontig:pug:scf1117875581297:1:515008:1 
REF
Length=515008

 Score = 91.5 bits (100),  Expect = 3e-16
 Identities = 192/280 (69%), Gaps = 5/280 (2%)
 Strand=Plus/Minus

Query  61      GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCA-CCGTCTCCGA  119
               || ||||  || || |||||   ||||||| |  |||||| |||  ||| || | |||||
Sbjct  400571  GTAATCGATCATGATCAGGTCGTGCCATTCGCTGAGCCAACGCCA-TCATCCATTTCCGA  400513

Query  120     CAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCC  179
                ||||| ||  | ||||| || || ||  || | ||| || |||| || |||||||||||
Sbjct  400512  GAAGGCCGCGATCAAGTTCAAGCCGCAAATTCACATCTCCAACGGATGCCACCCGTACCC  400453

Query  180     TGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGG  239
                |||||  |    |  |||  ||  | ||| ||||| |||   || ||  |||||  || 
Sbjct  400452  AGCCGTGGACGCTGCGGGCAACACCAGCGGCGGTCTAAAGCCAAGCGGCTCGCAGAGCGC  400393

Query  240     CGAATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
                |  ||||  || ||   |||  ||  | ||| |||||| ||| || || |||   ||||
Sbjct  400392  TGGCTGCAAGGGATC-TGGCTGGGGAACCCAGGTCTACGGTCGTTCGGCCTGGTACAATG  400334

Query  299     ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                |  |||||| ||||||||| | ||||| ||||| |||||
Sbjct  400333  GCAAGTGGGCGATCATGTACTCGTGGTACTTCCC-AAAGG  400295

 Score = 84.2 bits (92),  Expect = 4e-14
 Identities = 176/256 (69%), Gaps = 5/256 (2%)
 Strand=Plus/Plus

Query  85      CCATTCCCGCAGCCAAAGCCCGTCA-CCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACC  143
               |||||| |  |||||| |||  ||| || | ||||| ||||| ||  | ||||| || ||
Sbjct  421878  CCATTCGCTGAGCCAACGCCA-TCATCCATTTCCGAGAAGGCCGCGATCAAGTTCAAGCC  421936

Query  144     ACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCAT  203
                ||  || | ||| || |||| || ||||||||||| |||||  |    |  |||  || 
Sbjct  421937  GCAAATTCACATCTCCAACGGATGCCACCCGTACCCAGCCGTGGACGCTGCGGGCAACAC  421996

Query  204     TACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGAAGCT-CG  262
                | ||| ||||| |||   || ||  |||||  ||  |  ||||  || ||   |||  |
Sbjct  421997  CAGCGGCGGTCTAAAGCCAAGCGGCTCGCAGAGCGCTGGCTGCAAGGGATC-TGGCTGGG  422055

Query  263     GCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCT  322
               |  | ||| |||||| ||| || || |||   |||| |  |||||| ||||||||| | |
Sbjct  422056  GAACCCAGGTCTACGGTCGTTCGGCCTGGTACAATGGCAAGTGGGCGATCATGTACTCGT  422115

Query  323     GGTATTTCCCGAAAGG  338
               |||| ||||| |||||
Sbjct  422116  GGTACTTCCC-AAAGG  422130

 Score = 60.8 bits (66),  Expect = 5e-07
 Identities = 76/102 (75%), Gaps = 2/102 (2%)
 Strand=Plus/Plus

Query  85      CCATTCCCGCAGCCAAAGCCCGTCA-CCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACC  143
               |||||| |  |||||| |||  ||| || | ||||| ||||| ||  | ||||| || ||
Sbjct  418760  CCATTCGCTGAGCCAACGCCA-TCATCCATTTCCGAGAAGGCCGCGATCAAGTTCAAGCC  418818

Query  144     ACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGT  185
                ||  || | ||| || |||| || ||||||||||| |||||
Sbjct  418819  GCAAATTCACATCTCCAACGGATGCCACCCGTACCCAGCCGT  418860

 Score = 59.0 bits (64),  Expect = 2e-06
 Identities = 44/52 (85%), Gaps = 0/52 (0%)
 Strand=Plus/Plus

Query  377     TCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAA  428
               |||| ||||||||  |||||||  ||||| | ||||||||||||||||| ||
Sbjct  416440  TCGGCCACCGTCACGACTGGGAAAACGTCGTCGTGTGGATCGACAACCCGAA  416491

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 84/117 (72%), Gaps = 2/117 (2%)
 Strand=Plus/Plus

Query  70      CACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCA-CCGTCTCCGACAAGGCAGC  128
               || ||||| ||   ||| ||| |  |||||| |||  ||| |||  | ||| ||    ||
Sbjct  423573  CATGACCAAGTGGTGCCGTTCGCTGAGCCAACGCCT-TCATCCGCTTACGAAAAACTGGC  423631

Query  129     AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGT  185
                || ||||| ||||| ||| || | ||| || |||| || ||||||||||| |||||
Sbjct  423632  GGTCAAGTTCAAACCTCAGATTCACATCTCCAACGGATGCCACCCGTACCCAGCCGT  423688

 Score = 54.5 bits (59),  Expect = 7e-05
 Identities = 43/52 (83%), Gaps = 0/52 (0%)
 Strand=Plus/Plus

Query  377     TCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAA  428
               |||| ||||||||  | |||||| ||||  | ||||||||||||||||| ||
Sbjct  405874  TCGGCCACCGTCACGATTGGGAGCACGTTGTCGTGTGGATCGACAACCCAAA  405925

 Score = 53.6 bits (58),  Expect = 7e-05
 Identities = 84/118 (71%), Gaps = 2/118 (2%)
 Strand=Plus/Plus

Query  69      CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCA-CCGTCTCCGACAAGGCAG  127
               ||||||||| ||    || ||| |  ||||||  || |||  |||  ||||| ||    |
Sbjct  405587  CCACGACCAAGTGGTACCGTTCGCTGAGCCAACACC-GTCGTCCGCTTCCGAAAAACTGG  405645

Query  128     CAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGT  185
               | || ||||| ||||| ||| |  | ||| || |||| || ||||||||||| |||||
Sbjct  405646  CGGTCAAGTTCAAACCTCAGATCCACATCTCCAACGGATGCCACCCGTACCCAGCCGT  405703

 Score = 41.9 bits (45),  Expect = 0.44
 Identities = 39/50 (78%), Gaps = 0/50 (0%)
 Strand=Plus/Plus

Query  376     TTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               || || ||||||||  | |||||| | ||| | || ||||||||||| ||
Sbjct  403504  TTGGGCCACCGTCACGATTGGGAGCATGTCGTCGTCTGGATCGACAATCC  403553

>PHIF:NW_003303719.1 Phytophthora infestans T30-4 supercont1.40 
genomic scaffold, whole genome shotgun sequence
Length=1445775

 Score = 91.5 bits (100),  Expect = 3e-16
 Identities = 190/274 (69%), Gaps = 12/274 (4%)
 Strand=Plus/Minus

Query  63      CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
               |||||  |||||| | ||   ||| || ||| | ||  | || |||||  ||||||| ||
Sbjct  332158  CATCGATCACGACAAAGTCAAGCCGTTTCCGGAACCTGAACCGGTCACGATCTCCGAGAA  332099

Query  123     GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTG  181
               ||||| ||| ||||||||||| ||| || ||||  | |||||| |||   ||  |||| |
Sbjct  332098  GGCAGGAGTCAAGTTTAAACCTCAGATTCAAAT-TCGGACGGGATGTGTGCCTCACCCGG  332040

Query  182     CCGTTCAGAAGGAT--GGCTCCATTACCGGAGGTCT---CAAGTGGAGTGGACCGCAGGA  236
               ||||| ||  | ||  ||    |  | ||| |||||    |  |   || | ||| ||| 
Sbjct  332039  CCGTT-AG-CGAATTCGGGGAGACCAGCGGTGGTCTATAAACCTCTGGTAGTCCG-AGG-  331984

Query  237     CGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAA  296
                ||||  ||   |||||| |    |||||||||| ||||||  || || |||||| | ||
Sbjct  331983  -GGCGGGTGTCGAGGCTCAACTTACGGCTCTCAGGTCTACGGCCGTTCGGCGTGGCTCAA  331925

Query  297     TGACGTGTGGGCCATCATGTACGCCTGGTATTTC  330
                | ||| ||||||||||||||| | ||||| |||
Sbjct  331924  CGGCGTCTGGGCCATCATGTACTCGTGGTACTTC  331891

>PHSO:scaffold_16
Length=803425

 Score = 90.6 bits (99),  Expect = 1e-15
 Identities = 173/252 (69%), Gaps = 5/252 (2%)
 Strand=Plus/Minus

Query  85      CCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCA  144
               ||||||||||| ||| |||| |||||  | ||||| ||||| || || | ||| ||||| 
Sbjct  707647  CCATTCCCGCAACCAGAGCCTGTCACAATTTCCGAAAAGGCTGCCGTCACGTTCAAACCG  707588

Query  145     CAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATT  204
               |||||    ||| |  |||| || ||| |||||||||| ||  |  | |  |||   | |
Sbjct  707587  CAGCTCCTCATCACAAACGGCTGCCACTCGTACCCTGCAGTCAACGAAGCCGGCGAAACT  707528

Query  205     ACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCG-AATGCACAGGCTCGAAGCTCGG  263
               | ||| ||  | |    || ||||  | |  |  ||| |||||   ||||||   |||||
Sbjct  707527  AGCGGTGGATTAAGCCCGACTGGA-GGAACCAGCGCGAAATGCGGTGGCTCGGCCCTCGG  707469

Query  264     CTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTG  323
               ||| ||| | ||||  || |||  ||||   |||||| | |||||   ||||||| | ||
Sbjct  707468  CTCGCAGGTGTACGGCCGTTCCAAGTGGTACAATGACATTTGGGC---CATGTACTCTTG  707412

Query  324     GTATTTCCCGAA  335
               ||| ||||| ||
Sbjct  707411  GTACTTCCCCAA  707400

 Score = 47.3 bits (51),  Expect = 0.010
 Identities = 30/33 (91%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  394     TGGGAGTACGTCATTGTGTGGATCGACAACCCC  426
               |||||| ||||||| || |||||||||||||||
Sbjct  707362  TGGGAGAACGTCATCGTCTGGATCGACAACCCC  707330

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  15      CGTCCTCCTCGTCCTCGTCGCTTCG  39
               || |||||||| |||||||||||||
Sbjct  584749  CGCCCTCCTCGCCCTCGTCGCTTCG  584725

>PHRA:scaffold_2433
Length=3296

 Score = 90.6 bits (99),  Expect = 1e-15
 Identities = 192/281 (68%), Gaps = 7/281 (2%)
 Strand=Plus/Minus

Query  61    GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGAC  120
             |||||| |||||||||| ||    || ||| |  |||||   || |||||  |||| || 
Sbjct  2346  GTCATCAGCCACGACCAAGTAATTCCGTTCGCCGAGCCAGCACCTGTCACGATCTCTGAG  2287

Query  121   AAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCT  180
             ||||| |  || || || || || || ||  | ||| |  |||| || ||| | ||||||
Sbjct  2286  AAGGCGGGCGTCAAATTCAAGCCTCAACTCCATATCTCGAACGGATGCCACTCATACCCT  2227

Query  181   GCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGC--AGGACG  238
             || ||  |  | | |||   || |  ||| |||||||||  |   ||| | |  || |  
Sbjct  2226  GCTGTGAATGAAGCTGGTGACACTGGCGGTGGTCTCAAGACGTCAGGAGCTCCTAGTA--  2169

Query  239   GCGAATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAAT  297
             || | ||||  || ||   ||| |||||| ||||||||||  || || | ||||   | |
Sbjct  2168  GCAAGTGCAAGGGTTCCG-GCTACGGCTCGCAGATCTACGGACGATCTGGGTGGCACAGT  2110

Query  298   GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
             || || ||||| ||||||||||| ||||| || || |||||
Sbjct  2109  GATGTTTGGGCTATCATGTACGCATGGTACTTTCC-AAAGG  2070

>PHRA:scaffold_12
Length=689251

 Score = 90.6 bits (99),  Expect = 1e-15
 Identities = 192/281 (68%), Gaps = 7/281 (2%)
 Strand=Plus/Plus

Query  61      GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGAC  120
               |||||| |||||||||| ||    || ||| |  |||||   || |||||  |||| || 
Sbjct  604194  GTCATCAGCCACGACCAAGTGATTCCGTTCGCCGAGCCAGCACCTGTCACGATCTCTGAG  604253

Query  121     AAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCT  180
               ||||| |  || || || || || || ||  | ||| |  |||| || ||| | ||||||
Sbjct  604254  AAGGCGGGCGTCAAATTCAAGCCTCAACTCCATATCTCGAACGGATGCCACTCATACCCT  604313

Query  181     GCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGC--AGGACG  238
               || ||  |  | | |||   || |  ||| |||||||||  |   ||| | |  || |  
Sbjct  604314  GCTGTGAATGAAGCTGGTGACACTGGCGGTGGTCTCAAGACGTCAGGAGCTCCTAGTA--  604371

Query  239     GCGAATGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAAT  297
               || | ||||  || ||   ||| |||||| ||||||||||  || || | ||||   | |
Sbjct  604372  GCAAGTGCAAGGGTTCCG-GCTACGGCTCGCAGATCTACGGACGATCTGGGTGGCACAGT  604430

Query  298     GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               || || ||||| ||||||||||| ||||| || || |||||
Sbjct  604431  GATGTTTGGGCTATCATGTACGCATGGTACTTTCC-AAAGG  604470

 Score = 54.5 bits (59),  Expect = 7e-05
 Identities = 134/201 (67%), Gaps = 2/201 (1%)
 Strand=Plus/Plus

Query  127     GCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTT  186
               || || ||||| || || ||| |  | |||  | |||| |||||||||||||| || || 
Sbjct  602752  GCTGTCAAGTTCAAGCCGCAGATCTACATCAACAACGGATGTCACCCGTACCCGGCTGTC  602811

Query  187     CAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGC  246
                |  | || |||  ||  | ||| ||||| |||  ||  ||    |||     ||  |||
Sbjct  602812  GATGAAGACGGCAACACCAGCGGCGGTCTAAAGCCGACGGGGAGTCAGAGTTCCGGTTGC  602871

Query  247     ACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCG-CGTGGGTGAATGACGTGTG  305
               || || ||||  ||||||   || |||||||  ||| | | || |   ||| | ||||| 
Sbjct  602872  ACTGGTTCGAGCCTCGGCAGCCAAATCTACGGCCGCGCTGTCGAGTACGAA-GGCGTGTA  602930

Query  306     GGCCATCATGTACGCCTGGTA  326
                ||  |||||||| |||||||
Sbjct  602931  CGCGTTCATGTACTCCTGGTA  602951

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 62/86 (72%), Gaps = 0/86 (0%)
 Strand=Plus/Minus

Query  133     AAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAG  192
               ||||| || || ||| || | ||| || |||| || |||||||||||||| ||  |  | 
Sbjct  611918  AAGTTCAAGCCGCAGATTCACATCTCCAACGGTTGCCACCCGTACCCTGCAGTGGACGAA  611859

Query  193     GATGGCTCCATTACCGGAGGTCTCAA  218
               | ||||  ||  | ||| || |||||
Sbjct  611858  GCTGGCAACACCAGCGGCGGACTCAA  611833

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 38/49 (78%), Gaps = 0/49 (0%)
 Strand=Plus/Plus

Query  493     CCCCCTGAAGCGATGTATGTGGATGGCGACAGTGTCAAGCTCGAGTACT  541
               ||||||||  ||   ||  ||||||||||||| | |||| | |||||||
Sbjct  603097  CCCCCTGACTCGGACTACTTGGATGGCGACAGCGCCAAGATTGAGTACT  603145

>PHIF:NW_003303717.1 Phytophthora infestans T30-4 supercont1.42 
genomic scaffold, whole genome shotgun sequence
Length=1446276

 Score = 90.6 bits (99),  Expect = 1e-15
 Identities = 220/331 (66%), Gaps = 2/331 (1%)
 Strand=Plus/Plus

Query  393     CTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAACTCGACCATTCTTGG  452
               ||||||||||| ||||||||||   ||||  || ||     | | |   |||||||| ||
Sbjct  864454  CTGGGAGTACGCCATTGTGTGGCAAGACAGACCTAACGTGGACAGCGTAACCATTCTAGG  864513

Query  453     CGTATCGATGTCGGCTGCAGTCGGGTACGCTAGCCAGACGCCCCCTGAAGCGATGTATGT  512
                || ||  |||| ||||| || || |  || |   |  | || |||   | || |||  |
Sbjct  864514  AGTGTCCTTGTCAGCTGCGGTTGGCTGGGCGAAAGAATCTCCGCCTCCGGGGAAGTACTT  864573

Query  513     GGATGGCGACAGTGTCAAGCTCGAGTACTACTACAACCATCTCTTAGGCAGCACATCCCT  572
               ||||||    ||  | ||  | | ||||||| |||| ||  | |  | || |||  |  |
Sbjct  864574  GGATGGAACTAGCCTAAATGTGGCGTACTACAACAATCACATTTATGACAACACGACAGT  864633

Query  573     GCAGCTCACGGAAGACACGGGGGAATTCCAGGACCTCATTACATGGGACGAACTCTCGAA  632
               | |   |||||||||  | || || |||||||||||||| || |||  | |||||  | |
Sbjct  864634  GAAATACACGGAAGAGGCTGGTGAGTTCCAGGACCTCATCACGTGGAGCCAACTCAAGGA  864693

Query  633     GCTGGCACGATACTCTCTGAACCACACAGACTGGGACGAGACTCTGTTCGACTTGGCAGG  692
                || || | |   |||||| || | || |  ||||| ||||| | | ||  | | |||  
Sbjct  864694  TCTCGCCCTAGGTTCTCTG-ACAATACTGGTTGGGATGAGACGCCGCTCAGCGTAGCACT  864752

Query  693     CCTCAAGATGCCGCTGAAGGACGGGGTGTTC  723
                ||||| ||||| ||||||||||| ||||||
Sbjct  864753  TCTCAA-ATGCCCCTGAAGGACGGCGTGTTC  864782

>PHPA:scaffold_15 NW_008649001.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.15, whole genome shotgun 
sequence
Length=1176021

 Score = 89.7 bits (98),  Expect = 1e-15
 Identities = 227/342 (66%), Gaps = 29/342 (8%)
 Strand=Plus/Plus

Query  93      GCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAA  152
               ||| ||  |||| |||||  || | || || || ||  | ||||||||||| |||||| |
Sbjct  123615  GCAACCGGAGCCTGTCACGATCGCTGAAAAAGCTGCCATCAAGTTTAAACCGCAGCTTCA  123674

Query  153     AATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA-GAAGGATGGCTC-CATTACCGGA  210
                ||| || | || |||||| |||||||||| ||  | | |||  || ||  | ||  || 
Sbjct  123675  CATCACCAATGGTTGTCACGCGTACCCTGCAGTGAACGTAGG--GGGTCAGACTAGTGGG  123732

Query  211     GGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGG--CTCGAAGCTCGGCTCTC  268
               |||||||||  || |||  | |    || ||  ||||  ||  || || |   || ||||
Sbjct  123733  GGTCTCAAGACGACTGGTGCCCCTAGCGCCGGTTGCAAGGGATCTGGATG--GGGGTCTC  123790

Query  269     AGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATT  328
               || | ||||  |||||  | |||   ||||  || ||||| |||||||||   |||||||
Sbjct  123791  AGGTTTACGGCCGCTCAACTTGGCACAATGGAGTCTGGGCTATCATGTACAGTTGGTATT  123850

Query  329     TCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCACCCGTCTTTTCGGACACCGTC  388
               | |||||        || |  ||| ||          |||  |||   | || |||||||
Sbjct  123851  TTCCGAA--------GGACTCTCCATC----------CACTGGTC---TGGGTCACCGTC  123889

Query  389     ATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGA  430
               |  |||||||  |||| || |||||||| ||||| ||| |||
Sbjct  123890  ACGACTGGGAACACGTGATCGTGTGGATTGACAATCCCGAGA  123931

 Score = 77.0 bits (84),  Expect = 6e-12
 Identities = 154/221 (70%), Gaps = 12/221 (5%)
 Strand=Plus/Plus

Query  118    GACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTAC  177
              || ||||| ||  | ||||| | |||  ||||| |  ||| | ||||||| |||||||||
Sbjct  37314  GAAAAGGCTGCCATCAAGTTCAGACCCAAGCTTCACGTCGTCAACGGGTGCCACCCGTAC  37373

Query  178    CCTGCCGTTCAGAAGGATG--GCTCCA-TTACCGGAGGTCTCAAGTGGAGTGGACCGCA-  233
              ||||||||   ||| | ||  | || | | | |   || ||  ||  | |  ||   || 
Sbjct  37374  CCTGCCGT---GAACGCTGCCGGTCAAGTCAGCAAGGGACTGCAGAAG-GCCGATGCCAC  37429

Query  234    GGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGT  293
              ||||| ||||||||  || |||||| | ||| | ||| |||| | ||| || || ||| |
Sbjct  37430  GGACGCCGAATGCAGTGGATCGAAGTTGGGCACGCAGGTCTATGGTCGTTCTGCCTGGTT  37489

Query  294    --GAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCC  332
                | | |  || ||||| |||||||| |||||||| |||||
Sbjct  37490  CGGCAGG--GTCTGGGCTATCATGTATGCCTGGTACTTCCC  37528

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 88/124 (71%), Gaps = 0/124 (0%)
 Strand=Plus/Minus

Query  62     TCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACA  121
              |||||| |||||||   ||    || |||   |||||| |||| |||||  |||| || |
Sbjct  62758  TCATCGACCACGACGCAGTGGTACCGTTCAAACAGCCAGAGCCTGTCACGATCTCTGAAA  62699

Query  122    AGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTG  181
              | || ||  | ||||||||||| || ||| | ||  || | || |||||  | |||||||
Sbjct  62698  AAGCTGCTATTAAGTTTAAACCCCAACTTCACATTACCAATGGATGTCATGCATACCCTG  62639

Query  182    CCGT  185
              | ||
Sbjct  62638  CAGT  62635

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 106/161 (66%), Gaps = 21/161 (13%)
 Strand=Plus/Minus

Query  265    TCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGG  324
              || ||| | ||||  || ||  |||||   || | ||| |||||||||||||||   |||
Sbjct  62555  TCACAGGTGTACGGACGTTCGACGTGGTACAACGGCGTCTGGGCCATCATGTACAGTTGG  62496

Query  325    TATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCACCCGTCTTTTCGGACAC  384
              |||||||| ||        || |   ||||||          ||  |||   | || || 
Sbjct  62495  TATTTCCCTAA--------GGACTCGCCCTCT----------ACTGGTC---TGGGCCAT  62457

Query  385    CGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
              |||||| |||||||  |||| ||||| ||||| || |||||
Sbjct  62456  CGTCATGACTGGGAACACGTGATTGTATGGATTGATAACCC  62416

>PHPA:scaffold_71 NW_008649057.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.71, whole genome shotgun 
sequence
Length=321883

 Score = 88.7 bits (97),  Expect = 3e-15
 Identities = 191/276 (69%), Gaps = 15/276 (5%)
 Strand=Plus/Minus

Query  69      CCACGACCAGGTTCGGCC-ATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAG  127
               ||||||| |  || | || |||||| |||||  | || |||||| | || || |||||||
Sbjct  223223  CCACGACAAACTTGGACCGATTCCC-CAGCCTGACCCAGTCACCATTTCTGAAAAGGCAG  223165

Query  128     CAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTC  187
               || | ||||||||||| || || || ||||| ||||| ||     ||| ||| || ||  
Sbjct  223164  CAATCAAGTTTAAACCCCAACTAAACATCGCGGACGGATGCGTTTCGTTCCCAGCTGT--  223107

Query  188     AGAAGGATGGC-TCCATT--ACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAAT  244
                ||| ||||||  | |||  | ||| ||  | ||| |||||  |  |||  ||  || ||
Sbjct  223106  -GAACGATGGCGGCGATTTCAGCGGCGGATTGAAGGGGAGT-AATGGCA--ACTCCGCAT  223051

Query  245     GC--ACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
               ||    | |||| ||  | ||||| ||| | ||||  ||  | || |||   || ||   
Sbjct  223050  GCGATGACGCTCCAA--TGGGCTCACAGGTGTACGGACGAGCGGCCTGGTACAACGATAA  222993

Query  303     GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               ||||||||||||||| |||||||  ||||| || ||
Sbjct  222992  GTGGGCCATCATGTATGCCTGGTTCTTCCCCAAGGG  222957

 Score = 57.2 bits (62),  Expect = 6e-06
 Identities = 34/36 (94%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  304     TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
               ||||||||||||||||||||||| |||||||| |||
Sbjct  250162  TGGGCCATCATGTACGCCTGGTACTTCCCGAAGGGC  250127

>PHCA:scaffold_50 PHYCAscaffold_50
Length=475612

 Score = 88.7 bits (97),  Expect = 3e-15
 Identities = 259/391 (66%), Gaps = 20/391 (5%)
 Strand=Plus/Plus

Query  179     CTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACG  238
               ||||||||||   ||| || ||| ||| ||  ||  | ||||||  ||||  |   || |
Sbjct  198713  CTGCCGTTCAAGCGGACGGATCCGTTAGCGCTGGATTGAAGTGGGCTGGATGGTCTGATG  198772

Query  239     GCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
               | || ||||  |||||  |  | || |||||  | ||| | || ||||  |||   || |
Sbjct  198773  GAGACTGCAAGGGCTCTGAATTGGGATCTCAAGTGTACTCGCGTTCCGATTGGTACAAGG  198832

Query  299     ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTC  358
               |   |||||| ||||||||||||||||| ||||| || ||  ||    |||| | || ||
Sbjct  198833  ATAAGTGGGCAATCATGTACGCCTGGTACTTCCCTAAGGGTCGA----CAGTACATC-TC  198887

Query  359     CTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCG  418
               |   ||    ||| ||||  || ||||| ||  |||||   ||||  ||||||||||| |
Sbjct  198888  CAAGTA----CCG-CTTT--GGTCACCGCCACTACTGGTCATACGCTATTGTGTGGATGG  198940

Query  419     ACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCGTATCGATGTCGGCTGCAGTCGGGT  478
               | |       |  | | |||||||||||||| || || || ||||| ||||  || || |
Sbjct  198941  ATAGTGATGTGCCCGACAACTCGACCATTCTCGGAGTCTCTATGTCTGCTGGTGTTGGCT  199000

Query  479     AC-GCTAGCCAGACGCCCCCTGAAGCGATGTA---TGTGGATGGCGACAGTGTCAAGCTC  534
               || || ||  | ||||  ||  |  | | |||   ||| || |||  || ||| ||| | 
Sbjct  199001  ACAGCAAG-GAAACGCTGCCAAAGTCCAAGTACGTTGTTGACGGCACCACTGTTAAGTTT  199059

Query  535     GAGTACTACTACAACCATCTCTTAGGCAGCA  565
               ||||  ||| ||| |    ||| ||||||||
Sbjct  199060  GAGTCGTACAACAGC---TTCTGAGGCAGCA  199087

>HYAP:scaffold_71 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_71:1:332402:1 
REF
Length=332402

 Score = 87.8 bits (96),  Expect = 3e-15
 Identities = 159/229 (69%), Gaps = 8/229 (3%)
 Strand=Plus/Plus

Query  116     CCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGT  175
               |||| ||||| |  |||   || ||||||||| ||||| |||  |||||||||||| |||
Sbjct  158439  CCGAAAAGGCGGGCGTACGATTCAAACCACAGATTAAATTCGTGGACGGGTGTCACTCGT  158498

Query  176     ACCCTGCCGTTCAGAAGGATGGCTCCATTAC--CGGAGGTCTCAAGTGGAGTGGACCGCA  233
               || | || ||   || | |  |   ||| ||  ||| ||||||||    |  ||||  | 
Sbjct  158499  ACGCGGCAGT--GGACGCAGCGGGTCATAACAGCGGTGGTCTCAAACCAAAGGGACAACC  158556

Query  234     GGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGT  293
               ||| ||| |||||| ||| ||     | || |||||||||||||  || || ||   | |
Sbjct  158557  GGAAGGCAAATGCAAAGGATCTGGATTTGGGTCTCAGATCTACGGGCGTTCAGCTCCGTT  158616

Query  294     --GAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                 |||  ||   |||||||| |||||||| | ||| |||||||||| ||
Sbjct  158617  CGGAA--ACAAATGGGCCATTATGTACGCGTTGTACTTCCCGAAAGACA  158663

 Score = 44.6 bits (48),  Expect = 0.036
 Identities = 27/29 (93%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  512     TGGATGGCGACAGTGTCAAGCTCGAGTAC  540
               ||||||| ||||||||||||||| |||||
Sbjct  135148  TGGATGGTGACAGTGTCAAGCTCAAGTAC  135120

 Score = 43.7 bits (47),  Expect = 0.13
 Identities = 70/99 (71%), Gaps = 4/99 (4%)
 Strand=Plus/Minus

Query  244     TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGT--GAATGACG  301
               |||| ||| || | ||   | |||||||||||||  || || ||   |||  |||  || 
Sbjct  135398  TGCAAAGGATCTAGGCATAGGTCTCAGATCTACGGGCGTTCAGCTCCGGTCGGAA--ACA  135341

Query  302     TGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                 |||||||| ||||||||   |||  ||||||||| ||
Sbjct  135340  AATGGGCCATTATGTACGCACTGTACCTCCCGAAAGACA  135302

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 44/58 (76%), Gaps = 1/58 (2%)
 Strand=Plus/Plus

Query  397     GAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCG  454
               ||| ||||||| |||||||||||| ||  |  |  |||| || |||  |||| |||||
Sbjct  158699  GAGCACGTCATCGTGTGGATCGACGACATCGCGCTCAAAGACCCGAAGATTC-TGGCG  158755

>HYAP:scaffold_64 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_64:1:357926:1 
REF
Length=357926

 Score = 87.8 bits (96),  Expect = 3e-15
 Identities = 159/229 (69%), Gaps = 8/229 (3%)
 Strand=Plus/Plus

Query  116   CCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGT  175
             |||| ||||| |  |||   || ||||||||| ||||| |||  |||||||||||| |||
Sbjct  1313  CCGAAAAGGCGGGCGTACGATTCAAACCACAGATTAAATTCGTGGACGGGTGTCACTCGT  1372

Query  176   ACCCTGCCGTTCAGAAGGATGGCTCCATTAC--CGGAGGTCTCAAGTGGAGTGGACCGCA  233
             || | || ||   || | |  |   ||| ||  ||| ||||||||    |  ||||  | 
Sbjct  1373  ACGCGGCAGT--GGACGCAGCGGGTCATAACAGCGGTGGTCTCAAACCAAAGGGACAACC  1430

Query  234   GGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGT  293
             ||| ||| |||||| ||| ||     | || |||||||||||||  || || ||   | |
Sbjct  1431  GGAAGGCAAATGCAAAGGATCTGGATTTGGGTCTCAGATCTACGGGCGTTCAGCTCCGTT  1490

Query  294   --GAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
               |||  ||   |||||||| |||||||| | ||| |||||||||| ||
Sbjct  1491  CGGAA--ACAAATGGGCCATTATGTACGCGTTGTACTTCCCGAAAGACA  1537

 Score = 53.6 bits (58),  Expect = 7e-05
 Identities = 101/143 (71%), Gaps = 7/143 (5%)
 Strand=Plus/Plus

Query  397     GAGTACGTCATTGTGTGGATCGACAACCC--CAAGAGCA-AAAACTCGACCATTCTTGGC  453
               ||| ||||||| |||||||||||| ||||  || | | | |||||| ||| ||||| |  
Sbjct  341055  GAGCACGTCATCGTGTGGATCGACGACCCTGCACGTGGAGAAAACTTGACGATTCTGGCG  341114

Query  454     GTATCGATGTCGGCTGCAGTCGGGTACGCTAGCCAGACG--CCCCCTGAAGCGATGTATG  511
               ||  ||  || ||     | | | ||| || || |   |  || |||||| | | ||| |
Sbjct  341115  GTGACGCCGTGGGGAAACGGCTGTTAC-CT-GCAACTTGTTCCACCTGAACCCAAGTACG  341172

Query  512     TGGATGGCGACAGTGTCAAGCTC  534
               |||| || |||||||||||||||
Sbjct  341173  TGGACGGGGACAGTGTCAAGCTC  341195

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 44/58 (76%), Gaps = 1/58 (2%)
 Strand=Plus/Plus

Query  397   GAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAACTCGACCATTCTTGGCG  454
             ||| ||||||| |||||||||||| ||  |  |  |||| || |||  |||| |||||
Sbjct  1573  GAGCACGTCATCGTGTGGATCGACGACATCGCGCTCAAAGACCCGAAGATTC-TGGCG  1629

>PHRA:scaffold_319
Length=18160

 Score = 86.9 bits (95),  Expect = 1e-14
 Identities = 191/281 (68%), Gaps = 8/281 (3%)
 Strand=Plus/Plus

Query  64     ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
              |||| ||||||| |||| |  |||||| |||| ||  |||| ||||||| |||||| |||
Sbjct  14408  ATCGACCACGACAAGGTGCAACCATTCGCGCAACCCGAGCCTGTCACCGACTCCGAGAAG  14467

Query  124    GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
              || || ||    ||||| ||    ||  | |||  |   || || |||||||||||||| 
Sbjct  14468  GCCGCCGTCCGATTTAAGCCGAGCCTGCAGATCTTCAGTGGTTGCCACCCGTACCCTGCT  14527

Query  184    GTTCA-GAAG--GATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACC-GCAGGACGG  239
              ||  | |  |  | ||   ||| |   |  || || ||| | |  || ||  || |  ||
Sbjct  14528  GTCAATGCTGCCGGTGAGACCAGT---GCGGGCCTAAAGGGAACAGGCCCATCAAG-TGG  14583

Query  240    CGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGA  299
               || ||||  || |||    | || || ||| | ||||| ||  |||  |||   |  ||
Sbjct  14584  AGATTGCAAGGGGTCGGGCTTGGGGTCGCAGGTGTACGCCCGAGCCGTTTGGTATAGCGA  14643

Query  300    CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
              | ||||||||||||||||||| |||||||||||||||| ||
Sbjct  14644  CCTGTGGGCCATCATGTACGCGTGGTATTTCCCGAAAGACA  14684

>PHRA:scaffold_31
Length=507260

 Score = 86.9 bits (95),  Expect = 1e-14
 Identities = 188/276 (68%), Gaps = 8/276 (3%)
 Strand=Plus/Minus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               |||| ||||||| |||| |  |||||| |||| ||  | || ||||||||||| || |||
Sbjct  467733  ATCGACCACGACAAGGTGCAACCATTCGCGCAACCCGATCCTGTCACCGTCTCTGAGAAG  467674

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
               || || ||    ||||| ||    ||    |||| |  ||| || |||||||||||||| 
Sbjct  467673  GCCGCCGTCCGATTTAAGCCGAGCCTGCGGATCGACAGCGGATGCCACCCGTACCCTGCT  467614

Query  184     GTTCA-GAAG--GATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACC-GCAGGACGG  239
               ||  | |  |  | ||   ||| |   |  ||||| ||| | |  || ||  || |  ||
Sbjct  467613  GTCAATGCTGCCGGTGAGACCAGT---GCGGGTCTAAAGGGAACAGGCCCATCAAG-TGG  467558

Query  240     CGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGA  299
                || ||||  || |||    | || || ||| | ||||| ||  |||  |||   |  ||
Sbjct  467557  AGATTGCAAGGGGTCGGGCTTGGGGTCGCAGGTGTACGCCCGAGCCGTTTGGTATAGCGA  467498

Query  300     CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
               | ||||||||||||||||||| ||||||||||||||
Sbjct  467497  CCTGTGGGCCATCATGTACGCGTGGTATTTCCCGAA  467462

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 61/77 (79%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               ||||||||| ||||||  ||  | |  |||   || ||||| ||||||||||||||||||
Sbjct  261110  GGCTCTCAGGTCTACGGCCGTGCAGAATGGTACAACGACGTCTGGGCCATCATGTACGCC  261169

Query  322     TGGTATTTCCCGAAAGG  338
               ||||| ||||| || ||
Sbjct  261170  TGGTACTTCCCCAAGGG  261186

>PHRA:scaffold_29
Length=529199

 Score = 86.9 bits (95),  Expect = 1e-14
 Identities = 191/281 (68%), Gaps = 8/281 (3%)
 Strand=Plus/Minus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
               |||||||||||| |||| |  |||||| |||| ||  | || |||||  ||||||| |||
Sbjct  382630  ATCGGCCACGACAAGGTGCAACCATTCGCGCAACCCGATCCTGTCACTATCTCCGAGAAG  382571

Query  124     GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                | || ||    ||||| ||    ||    |||| | |||| || ||| |||||||||| 
Sbjct  382570  ACCGCCGTCCGCTTTAAGCCGATCCTGCGGATCGACAACGGATGCCACTCGTACCCTGCT  382511

Query  184     GTTCA-GAAG--GATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGC  240
               ||  | |  |  | ||   ||| | | ||   ||| ||| | |  || |  |     || 
Sbjct  382510  GTCAATGCTGCCGGTGAGACCAATGCGGG---TCTAAAGGGAACAGGCCGACCTAGTGGA  382454

Query  241     GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGG-TGAATGA  299
               || ||||  || ||||   | || || ||| | ||||  || ||||  |||  || | ||
Sbjct  382453  GATTGCAAGGGGTCGAGCTTGGGATCGCAGGTGTACGGCCGATCCGTTTGGCATGGA-GA  382395

Query  300     CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
               | ||||||||||||||||||| |||||||||||||||| ||
Sbjct  382394  CCTGTGGGCCATCATGTACGCGTGGTATTTCCCGAAAGACA  382354

>PHPA:scaffold_11 NW_008648997.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.11, whole genome shotgun 
sequence
Length=1562868

 Score = 86.9 bits (95),  Expect = 1e-14
 Identities = 165/242 (68%), Gaps = 6/242 (2%)
 Strand=Plus/Minus

Query  97      CCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATC  156
               || || || || ||  ||||||| ||||| |  || ||||| ||||||||| |     ||
Sbjct  230976  CCTAAACCAGTGACGATCTCCGAGAAGGCTGGTGTTAAGTTCAAACCACAGATCGCTGTC  230917

Query  157     GCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTC  216
                    ||||||    |||||||| || ||  |  ||||||||   |  | ||| ||||||
Sbjct  230916  AAGACCGGGTGCGTTCCGTACCCCGCAGTGAACGAGGATGGCGAAACCAGCGGTGGTCTC  230857

Query  217     AAGTGGA---GTGGACCGCAGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATC  273
                ||  |    || | ||||||| |||   ||||  ||| ||    | ||| || ||| ||
Sbjct  230856  CAGACGTCCGGTAGTCCGCAGGGCGG---ATGCCGAGGATCCGGTCACGGTTCGCAGGTC  230800

Query  274     TACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCG  333
               ||||  |||||  ||||| | || |   ||||||||||||||||| ||||||| ||||| 
Sbjct  230799  TACGGCCGCTCTACGTGGTTCAACGGTCTGTGGGCCATCATGTACTCCTGGTACTTCCCC  230740

Query  334     AA  335
               ||
Sbjct  230739  AA  230738

>PHKE:scaffold_323 scf_22126_323.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_323.1_contig_1:1:42068:1 
REF
Length=42068

 Score = 86.9 bits (95),  Expect = 1e-14
 Identities = 184/275 (67%), Gaps = 0/275 (0%)
 Strand=Plus/Minus

Query  63    CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
             |||| |||||||||| || | ||| ||| | || ||  | || ||  | |   |||| ||
Sbjct  6394  CATCAGCCACGACCAAGTGCAGCCCTTCGCTCAACCCGAACCTGTTTCTGATGCCGAGAA  6335

Query  123   GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
              || || || ||||| || || |||||     |  || |||| ||| | || ||||||||
Sbjct  6334  AGCTGCGGTCAAGTTCAAGCCTCAGCTAGCGGTGACCTACGGCTGTGATCCATACCCTGC  6275

Query  183   CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
              ||  |   | | ||||| || |  |  || || ||||||  |||   ||  || |||||
Sbjct  6274  TGTCGACTCGAACGGCTCAATCAGTGCTGGCCTTAAGTGGGCTGGGAAGCCCGATGGCGA  6215

Query  243   ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
              ||||| || ||   | | || || ||  ||||| ||||| | |  |||    | ||   
Sbjct  6214  TTGCACCGGTTCTCCGTTGGGTTCGCAAGTCTACTCTCGCGCAGACTGGTACGAGGATAA  6155

Query  303   GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
              |||||||||||||| |||||||| ||||| ||||
Sbjct  6154  ATGGGCCATCATGTATGCCTGGTACTTCCCCAAAG  6120

 Score = 80.6 bits (88),  Expect = 5e-13
 Identities = 182/274 (66%), Gaps = 0/274 (0%)
 Strand=Plus/Minus

Query  64    ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
             |||||||||||||| || |  || |||   |||||  | |||||  |||   | || || 
Sbjct  1249  ATCGGCCACGACCAAGTGCAACCTTTCATTCAGCCTGAACCCGTTTCCGCTGCTGAGAAA  1190

Query  124   GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
             || || || || || || |||||  | ||| |  || |||| |||   ||||||||||| 
Sbjct  1189  GCTGCTGTCAAATTCAAGCCACATTTAAAAGTGACCTACGGTTGTACACCGTACCCTGCT  1130

Query  184   GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
             ||  |   ||| ||  | || |  || || || || ||||||||  ||   || || |  
Sbjct  1129  GTCGACGCGGAAGGTGCGATCAATGGCGGCCTGAAATGGAGTGGCGCGGCCGATGGTGGG  1070

Query  244   TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
             ||| |  |  |   | | ||| | || ||||| ||||||||||        |  ||   |
Sbjct  1069  TGCTCTAGTCCCCCGTTGGGCGCACAAATCTATGCTCGCTCCGACCAATATAGAGATAAG  1010

Query  304   TGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
             ||||||||||||||||||||||| || || ||||
Sbjct  1009  TGGGCCATCATGTACGCCTGGTACTTTCCCAAAG  976

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 30/32 (94%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  304   TGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
             ||||||||||||||||||||||| ||||| ||
Sbjct  8030  TGGGCCATCATGTACGCCTGGTACTTCCCCAA  7999

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 51/67 (76%), Gaps = 1/67 (1%)
 Strand=Plus/Minus

Query  571   CTGCAGCTCACGGAAGACACGGGGGAATTCCAGGACCTCATTACATGGGACGAACTCTC-  629
             |||| ||||||||| ||   ||| ||  | |||||||||||   ||||||| ||||| | 
Sbjct  7805  CTGCGGCTCACGGAGGATGAGGGTGAGCTACAGGACCTCATCCAATGGGACCAACTCACA  7746

Query  630   GAAGCTG  636
             || ||||
Sbjct  7745  GATGCTG  7739

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Minus

Query  695   TCAAGATGCCGCTGAAGGACGGGGTGTTC  723
             |||||||||| ||||||||||| || |||
Sbjct  5771  TCAAGATGCCACTGAAGGACGGCGTCTTC  5743

>PHKE:scaffold_242 scf_22126_242.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_242.1:1:53838:1 
REF
Length=53838

 Score = 86.0 bits (94),  Expect = 1e-14
 Identities = 162/231 (70%), Gaps = 12/231 (5%)
 Strand=Plus/Plus

Query  113    TCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACC  172
              ||||||| ||||| ||||| | ||| ||||| |  ||    ||||||  ||||||| |||
Sbjct  25981  TCTCCGAGAAGGCCGCAGTCAGGTTCAAACCGCGACTACGCATCGCCAGCGGGTGTGACC  26040

Query  173    CGTACCCTGCCGTTCAGAAGGATGGCTCCATTACC---GGAGGTCTCAAGTGGAGTGG--  227
              |||||||||| | |||  ||  | |  | |  |||   || ||||| |||   |  ||  
Sbjct  26041  CGTACCCTGCTG-TCAATAGCCTTGGACAA--ACCGGTGGCGGTCTGAAGCCAACCGGAA  26097

Query  228    ACCGCAGGACGGCGAATGCACAGGC-TCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCG  286
              |||  |||  ||  |||||| ||||  ||  || |||| ||||  | |||| ||||||| 
Sbjct  26098  ACCCAAGG--GGGAAATGCAGAGGCAACGGCGC-CGGCGCTCAAGTATACGGTCGCTCCA  26154

Query  287    CGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
               ||||    |||||   |||||||| |||||| | ||||||||||| ||||
Sbjct  26155  GGTGGCATTATGACCGATGGGCCATTATGTACTCGTGGTATTTCCCCAAAG  26205

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 37/47 (79%), Gaps = 0/47 (0%)
 Strand=Plus/Plus

Query  379    GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
              || || || ||  |||||||| | | ||| ||||||||||| |||||
Sbjct  26226  GGCCATCGCCACGACTGGGAGCATGCCATCGTGTGGATCGATAACCC  26272

>PHKE:scaffold_527 scf_22126_527.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_527.1:1:20712:1 
REF
Length=20712

 Score = 85.1 bits (93),  Expect = 4e-14
 Identities = 186/277 (67%), Gaps = 4/277 (1%)
 Strand=Plus/Minus

Query  63    CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
             |||| ||||||||||  |   ||| ||    || ||| | ||||  ||  ||||||| ||
Sbjct  8609  CATCAGCCACGACCAAATCAAGCCGTTTGTTCAACCAGAACCCGCTACGATCTCCGAAAA  8550

Query  123   GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
              || || || || || ||||| |||||  |  |  || |||| || |||| ||| |||||
Sbjct  8549  AGCTGCGGTCAAATTCAAACCTCAGCTGCACGTTACCAACGGATGCCACCTGTATCCTGC  8490

Query  183   CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
              ||  |  | | |||    | || |||  | ||||||  |  |||| |||     | || 
Sbjct  8489  AGTCAACGAAGCTGGTGAAACTAGCGGTAGACTCAAGACGTCTGGAGCGCCCAGTGCCGG  8430

Query  243   ATGCACAGGCTC--GAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
             || || ||| ||  || |   ||||||||  | ||||  |||| |||||||   |  || 
Sbjct  8429  ATACAAAGGTTCTGGATGG--GGCTCTCAAGTGTACGGCCGCTTCGCGTGGCACAGCGAT  8372

Query  301   GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
             || ||||||||||| ||| ||||||| ||||| ||||
Sbjct  8371  GTCTGGGCCATCATATACTCCTGGTACTTCCCCAAAG  8335

 Score = 84.2 bits (92),  Expect = 4e-14
 Identities = 190/282 (67%), Gaps = 8/282 (3%)
 Strand=Plus/Plus

Query  60     AGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGA  119
              ||||||| |||| |||   |||  ||||||| | ||||| |  |||    |||||||| |
Sbjct  16515  AGTCATCAGCCATGACGCCGTTGTGCCATTCGCTCAGCCTACACCCACGTCCGTCTCCCA  16574

Query  120    CAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCC  179
               |  || || || || |||||||| || ||| | ||| || |||| || || || |||||
Sbjct  16575  GATCGCTGCTGTCAACTTTAAACCGCAACTTCACATCACCAACGGCTGCCATCCATACCC  16634

Query  180    TGCCGTTCAGAAG--GATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCG--CAGG  235
              ||| ||  ||| |  ||||||  ||  |  || ||  | ||   ||  ||  ||  ||| 
Sbjct  16635  TGCTGT--AGACGCAGATGGCAACACCAGTGGTGGATTGAACCCGACGGGTTCGTCCAGT  16692

Query  236    ACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGA  295
               | |    |||| ||| ||       |||   || ||||| | ||||||  | |||   |
Sbjct  16693  GCAGGT--TGCAAAGGATCCGGTTATGGCAGCCAAATCTATGGTCGCTCGACCTGGTACA  16750

Query  296    ATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
              ||| ||| ||||||||||||||| | ||||| ||||||||||
Sbjct  16751  ATGGCGTCTGGGCCATCATGTACTCGTGGTACTTCCCGAAAG  16792

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 127/188 (68%), Gaps = 23/188 (12%)
 Strand=Plus/Plus

Query  244   TGCACAGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
             |||| ||| || | ||| ||| || ||| | |||| ||||||  | |||   |||| |||
Sbjct  6520  TGCAGAGGTTC-AGGCTACGGTTCGCAGGTGTACGGTCGCTCGACCTGGTACAATGGCGT  6578

Query  303   GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCT  362
              |||||||| |||||| | ||||| |||||||||| |||         |||  |  |   
Sbjct  6579  CTGGGCCATTATGTACTCGTGGTACTTCCCGAAAGACAG---------CCCAGTGTCGGG  6629

Query  363   TATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAA  422
             |||             || ||||| ||| |||||||| | ||||| ||||||||||| ||
Sbjct  6630  TATG------------GGCCACCGCCATGACTGGGAGCATGTCATCGTGTGGATCGATAA  6677

Query  423   CCCCAAGA  430
              ||| |||
Sbjct  6678  TCCCGAGA  6685

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 45/55 (82%), Gaps = 1/55 (2%)
 Strand=Plus/Plus

Query  295   AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAG  349
             |||| ||| ||||||||||||||| | ||||| ||||| |||||  |||  ||||
Sbjct  4975  AATGGCGTTTGGGCCATCATGTACTCGTGGTACTTCCC-AAAGGACGAGCCGCAG  5028

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 129/192 (67%), Gaps = 6/192 (3%)
 Strand=Plus/Plus

Query  31     GTCGCTTCGCTTGCAGGAGCCCAGGCTCAAGTCATCGGCCACGACCAGGTTCGGCCATTC  90
              || |||||  | ||  | || |||||  | || |||  ||||||||||||    ||||||
Sbjct  12978  GTAGCTTCATTGGCTTGTGCACAGGCCGACGTGATCTCCCACGACCAGGTCGTTCCATTC  13037

Query  91     CCGCAGCCAA-AGCCCGTCACCGTCTCCGACAAG--GCAGCAGTAAAGTTTAAACCACAG  147
               | || || | ||||  |   || ||  | ||||  || |   | ||||| || ||||||
Sbjct  13038  GCACAACCCACAGCCACTA--CGACTTTG-CAAGCTGCGGGCATCAAGTTCAAGCCACAG  13094

Query  148    CTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACC  207
               |  | ||| |  |||| |||||||||||||| || ||  | || |||||    |  | |
Sbjct  13095  ATCCACATCTCAAACGGTTGTCACCCGTACCCAGCAGTCAACAAAGATGGTAATACGAGC  13154

Query  208    GGAGGTCTCAAG  219
              || |||||||||
Sbjct  13155  GGTGGTCTCAAG  13166

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 37/44 (84%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  382   CACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
             ||||| ||  |||||||| || || | |||||||||||||||||
Sbjct  8311  CACCGCCACGACTGGGAGCACATCGTGGTGTGGATCGACAACCC  8268

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 44/59 (75%), Gaps = 0/59 (0%)
 Strand=Plus/Plus

Query  127    GCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGT  185
              || || ||||| ||||| ||  |  | |||  | | |||||||| || |||||||||||
Sbjct  20478  GCTGTCAAGTTCAAACCTCAAATATACATCAACAATGGGTGTCATCCTTACCCTGCCGT  20536

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 40/52 (77%), Gaps = 1/52 (2%)
 Strand=Plus/Plus

Query  378   CGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAA-CCCCAA  428
             ||| || || ||  |||||||| | ||  | ||||||||||| || ||||||
Sbjct  5037  CGGCCATCGCCACGACTGGGAGCATGTTGTCGTGTGGATCGATAATCCCCAA  5088

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 60/84 (71%), Gaps = 2/84 (2%)
 Strand=Plus/Plus

Query  244    TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGT-GAATGACGT  302
              ||||| || || |  |||||   ||||||||||| |||| |||  || ||   | |||||
Sbjct  20595  TGCACCGGGTCAAGCCTCGGGAGTCAGATCTACGGTCGCGCCG-TTGAGTACGAGGACGT  20653

Query  303    GTGGGCCATCATGTACGCCTGGTA  326
               |  ||  |||||||| | |||||
Sbjct  20654  CTACGCTTTCATGTACTCATGGTA  20677

>PHRA:scaffold_2762
Length=2418

 Score = 83.3 bits (91),  Expect = 1e-13
 Identities = 173/253 (68%), Gaps = 5/253 (2%)
 Strand=Plus/Plus

Query  85   CCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCA  144
            || ||| | ||||| | ||||| |||  | ||||| ||||| |  || || || || || 
Sbjct  346  CCTTTCGCCCAGCCCATGCCCGCCACGATTTCCGAAAAGGCCGGCGTCAAATTCAAGCCC  405

Query  145  CAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCAT  203
            ||| |  | |||   |||||| |||  ||||||||| |||||  |  |    ||    | 
Sbjct  406  CAGATCCAGATCAG-GACGGGGTGTGTCCCGTACCCGGCCGTGAACTACCTCGGAGAGAC  464

Query  204  TACCGGAGGTCTCAAGTGGAGTGGA-CCGCAGGACGGCGAATGCACAGGCTCGAAGCTCG  262
            ||  || |||||||||  |   ||  || || |  || |  ||   ||| ||    | ||
Sbjct  465  TAGTGGTGGTCTCAAGACGTCAGGTGCCCCAAG--GGTGGGTGTCGAGGGTCTGGCCACG  522

Query  263  GCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCT  322
            |||| ||| ||||||  |||||||||||| | || || |||||||||||||||||| | |
Sbjct  523  GCTCGCAGGTCTACGGCCGCTCCGCGTGGCTCAACGATGTGTGGGCCATCATGTACTCGT  582

Query  323  GGTATTTCCCGAA  335
            |||| ||||| ||
Sbjct  583  GGTACTTCCCCAA  595

>PHKE:scaffold_523 scf_22126_523.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_523.1:1:20374:1 
REF
Length=20374

 Score = 83.3 bits (91),  Expect = 1e-13
 Identities = 74/93 (80%), Gaps = 0/93 (0%)
 Strand=Plus/Plus

Query  63    CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
             |||||  |||||| |||| | ||| ||||| |||||  |||||||||||||||| || ||
Sbjct  3470  CATCGATCACGACAAGGTGCAGCCGTTCCCTCAGCCCGAGCCCGTCACCGTCTCTGAAAA  3529

Query  123   GGCAGCAGTAAAGTTTAAACCACAGCTTAAAAT  155
             ||| ||| | ||||| ||||| || || || ||
Sbjct  3530  GGCTGCAATCAAGTTCAAACCGCAACTCAACAT  3562

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 35/41 (85%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  385   CGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
             |||||| ||||| || | |||||||| ||||||||||| ||
Sbjct  3768  CGTCATGACTGGAAGAATGTCATTGTATGGATCGACAATCC  3808

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 41/52 (79%), Gaps = 0/52 (0%)
 Strand=Plus/Plus

Query  286   GCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
             ||||||   || ||| | |||||||||||||| || ||||| || || ||||
Sbjct  3690  GCGTGGTACAACGACATTTGGGCCATCATGTATGCTTGGTACTTTCCAAAAG  3741

>PHPA:scaffold_88 NW_008649074.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.88, whole genome shotgun 
sequence
Length=212242

 Score = 82.4 bits (90),  Expect = 1e-13
 Identities = 180/270 (67%), Gaps = 0/270 (0%)
 Strand=Plus/Plus

Query  69    CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
             ||| ||||| || |  || ||  | || ||| | ||   ||| |  || || ||| | ||
Sbjct  5267  CCATGACCAAGTGCAACCGTTTTCTCAACCAGAACCAACCACGGATTCAGAGAAGTCTGC  5326

Query  129   AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
              || || |  ||||| |||||  | ||| |  |||| |||||||||||  |||| || ||
Sbjct  5327  TGTCAAATACAAACCGCAGCTCCATATCTCGTACGGCTGTCACCCGTATGCTGCTGTACA  5386

Query  189   GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCAC  248
             |  |||||||||| | |  |||||||| ||  ||  |||   |    |||| ||  ||| 
Sbjct  5387  GGCGGATGGCTCCGTAAGTGGAGGTCTAAACCGGTCTGGTTGGGCCAACGGTGACCGCAA  5446

Query  249   AGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGC  308
             ||||||  |  | || || ||| ||||  | || ||||  |||   |  |     |||||
Sbjct  5447  AGGCTCTGACTTGGGGTCCCAGGTCTATTCGCGATCCGACTGGTACAGGGGGAAATGGGC  5506

Query  309   CATCATGTACGCCTGGTATTTCCCGAAAGG  338
             |||| ||||||| ||||| | |||||| ||
Sbjct  5507  CATCGTGTACGCTTGGTACTACCCGAAGGG  5536

>PHPA:scaffold_36 NW_008649022.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.36, whole genome shotgun 
sequence
Length=670734

 Score = 81.5 bits (89),  Expect = 5e-13
 Identities = 239/365 (65%), Gaps = 29/365 (8%)
 Strand=Plus/Plus

Query  65      TCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGG  124
               || ||||||| || || || ||||||   |||||    || ||  |||||||||| ||||
Sbjct  425270  TCAGCCACGATCAAGTCCGTCCATTCGGTCAGCCCTCACCTGTGTCCGTCTCCGAGAAGG  425329

Query  125     CAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCG  184
               | || ||||| |||||||| |||||| | ||| || |||| || ||||| || || || |
Sbjct  425330  CTGCCGTAAAATTTAAACCCCAGCTTCACATCACCAACGGATGCCACCCATATCCCGCAG  425389

Query  185     TTCAGAAGGATGGCTCCATTACCGGAGGTCT---CAAGTGGAGTGGACCGCAGGACGGCG  241
               |  |    |  ||    |  |  || || ||   |||  |  | | |||  ||  || ||
Sbjct  425390  TAAACGCTGCCGGAGAGACGAGTGGTGGCCTGGCCAAAAGTGGCGCACCT-AG--CGCCG  425446

Query  242     AATGCACAGGCTCGAAGCTCGGC-TCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGAC  300
                 ||||  || ||   ||| ||  || ||  |||||| ||||||| | |||   || | |
Sbjct  425447  GTTGCAAGGGATCCG-GCTGGGGATCGCAAGTCTACGGTCGCTCCACCTGGCACAAAGGC  425505

Query  301     GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCT  360
                  ||||||||||||||| | ||||| || ||||| | |  |        || ||     
Sbjct  425506  CGCTGGGCCATCATGTACTCATGGTACTTTCCGAAGGACTCA--------CCGTC-----  425552

Query  361     CTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGAC  420
                    |||  ||||    || ||||| ||  |||||||| ||||||| ||||||||||||
Sbjct  425553  -----CACGGGTCTG---GGCCACCGCCACGACTGGGAGCACGTCATCGTGTGGATCGAC  425604

Query  421     AACCC  425
               |||||
Sbjct  425605  AACCC  425609

 Score = 66.2 bits (72),  Expect = 1e-08
 Identities = 174/259 (67%), Gaps = 14/259 (5%)
 Strand=Plus/Minus

Query  84      GCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACC  143
               |||||| || |||||  |||| || ||  | ||||| ||||| |  || ||||| |||||
Sbjct  612419  GCCATTTCCTCAGCCCGAGCCGGTGACGATTTCCGAGAAGGCCGGTGTCAAGTTCAAACC  612360

Query  144     ACAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGCCGTTCAGAAGGA---TGGCT  199
                ||  || |||||   |||||| ||| | ||||||||||| ||   ||| ||    ||| 
Sbjct  612359  TCAAATTCAAATCAG-GACGGGATGTGAGCCGTACCCTGCTGT---GAATGAATTCGGCG  612304

Query  200     CCATTACCGGAGG---TCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGA  256
                 | ||  || ||   || ||  |   ||  | | ||||  ||| | |||   || ||  
Sbjct  612303  AAACTAGTGGCGGCCTTCACACTTCTGGTAAATC-CAGG--GGCAAGTGCGGTGGGTCTG  612247

Query  257     AGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGT  316
                 |  ||||| ||  | ||||  ||||| || ||| |||| |  || |||| ||||||||
Sbjct  612246  GCCATGGCTCCCAAGTATACGGCCGCTCAGCCTGGTTGAAGGGTGTCTGGGTCATCATGT  612187

Query  317     ACGCCTGGTATTTCCCGAA  335
               || | ||||| ||||||||
Sbjct  612186  ACTCGTGGTACTTCCCGAA  612168

>PHIF:NW_003303746.1 Phytophthora infestans T30-4 supercont1.13 
genomic scaffold, whole genome shotgun sequence
Length=3221495

 Score = 81.5 bits (89),  Expect = 5e-13
 Identities = 176/255 (69%), Gaps = 19/255 (7%)
 Strand=Plus/Minus

Query  88       TTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAG  147
                ||||| |||||  | || |||||  ||||||| ||||| |  || ||||| ||||| |||
Sbjct  2501483  TTCCCTCAGCCCGAACCTGTCACGATCTCCGAGAAGGCCGGCGTCAAGTTCAAACCTCAG  2501424

Query  148      CTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGCCGTTCAGAAGGAT---GGCTCCAT  203
                 || ||||| |  || || ||    || ||||||| |||   ||| ||    ||    | 
Sbjct  2501423  ATTCAAATC-CGTACTGGATGCGTACCTTACCCTGTCGT---GAACGAATTGGGGGAGAC  2501368

Query  204      TACCGGAGGTCT-CAAG----TGGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGAAG  258
                || ||| ||||| |||     ||||    ||  |||   || | ||||| ||||||    
Sbjct  2501367  TAGCGGCGGTCTTCAAACTTCTGGAA---ACTCCAGA--GGTGGATGCAGAGGCTCCGGC  2501313

Query  259      CTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTAC  318
                | ||| |||||| ||||||  |||||  ||||| || | | ||| |||||||||||||||
Sbjct  2501312  CACGGTTCTCAGGTCTACGGCCGCTCGACGTGGATGGAAGGCGTCTGGGCCATCATGTAC  2501253

Query  319      GCCTGGTA-TTTCCC  332
                 | ||||| ||||||
Sbjct  2501252  TCATGGTACTTTCCC  2501238

 Score = 73.4 bits (80),  Expect = 7e-11
 Identities = 191/279 (68%), Gaps = 27/279 (10%)
 Strand=Plus/Plus

Query  63       CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
                ||| ||||| ||| | ||   ||| ||||| |||||  | || |||||  ||||||| ||
Sbjct  2492509  CATTGGCCATGACGATGTGAAGCCGTTCCCTCAGCCCGAACCTGTCACGATCTCCGAGAA  2492568

Query  123      GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTG  181
                ||| |  || ||||| ||||| ||| || ||||| |  || || ||    || |||||||
Sbjct  2492569  GGCCGGCGTCAAGTTCAAACCTCAGATTCAAATC-CGTACTGGATGCGTACCTTACCCTG  2492627

Query  182      CCGTTCA-GAAGGATGGCTCC-ATTACCGGAGGTCT-CAAG----TGGAGTGGACCGCAG  234
                ||||  | |||  ||||     | || ||| ||||| |||     ||||    | | |  
Sbjct  2492628  CCGTGAACGAA--ATGGGGGAGACTAGCGGCGGTCTTCAAACCTCTGGA----AGCTCCA  2492681

Query  235      GACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
                || || | ||||| ||||||      ||||   ||| | ||||  |||||  ||||| ||
Sbjct  2492682  GA-GGTGGATGCAGAGGCTC------CGGC---CAG-TGTACGGCCGCTCGACGTGGATG  2492730

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTA-TTTCCC  332
                 | | ||| ||||||||||||||| | ||||| ||||||
Sbjct  2492731  GAAGGCGTCTGGGCCATCATGTACTCATGGTACTTTCCC  2492769

 Score = 73.4 bits (80),  Expect = 7e-11
 Identities = 190/280 (68%), Gaps = 20/280 (7%)
 Strand=Plus/Minus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                || ||||| ||| | ||   ||| ||||| |||||  | || |||||  |||| || |||
Sbjct  2522276  ATTGGCCATGACGATGTGAAGCCGTTCCCTCAGCCCGAACCTGTCACGATCTCTGAGAAG  2522217

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGC  182
                || |  || ||||| ||||| ||| || ||||| |  || || ||    || ||||||||
Sbjct  2522216  GCCGGCGTCAAGTTCAAACCTCAGATTCAAATC-CGTACTGGATGCGTACCTTACCCTGC  2522158

Query  183      CGTTCAGAAGGAT---GGCTCCATTACCGGAGGTCT-CAAG----TGGAGTGGACCGCAG  234
                |||   ||| ||    ||    | || ||| ||||| |||     ||||    ||  |||
Sbjct  2522157  CGT---GAACGAATTGGGGGAGACTAGCGGCGGTCTTCAAACTTCTGGAA---ACTCCAG  2522104

Query  235      GACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
                   || | ||||| ||||||    | ||| |||||| ||| ||  | |||  ||||| ||
Sbjct  2522103  A--GGTGGATGCAGAGGCTCCGGCCACGGTTCTCAGGTCTTCGGCCACTCGACGTGGATG  2522046

Query  295      AATGACGTGTGGGCCATCATGTACGC-CTGGTA-TTTCCC  332
                 | | ||| ||||||||||||||| |  ||||| ||||||
Sbjct  2522045  GAAGGCGTCTGGGCCATCATGTACTCAATGGTACTTTCCC  2522006

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 59/77 (77%), Gaps = 1/77 (1%)
 Strand=Plus/Minus

Query  262      GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
                ||||| ||| | || |  || ||  ||||| | || || || ||||||||||||||| | 
Sbjct  2408643  GGCTCCCAGGTATATGGCCGGTCGACGTGGATTAACGATGTCTGGGCCATCATGTACTCT  2408584

Query  322      TGGTATTTCCCGAAAGG  338
                ||||| ||||| |||||
Sbjct  2408583  TGGTACTTCCC-AAAGG  2408568

 Score = 54.5 bits (59),  Expect = 7e-05
 Identities = 82/117 (70%), Gaps = 0/117 (0%)
 Strand=Plus/Minus

Query  69       CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
                ||| ||||| || || || |||   |||||    || ||  |  ||||||| || || ||
Sbjct  1624053  CCATGACCAAGTCCGTCCGTTCGGTCAGCCTTCACCTGTGTCTATCTCCGAGAAAGCGGC  1623994

Query  129      AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGT  185
                 || || || || || || ||  | ||| |  |||| ||||||||||||||||| ||
Sbjct  1623993  CGTCAAATTCAAGCCCCAACTCCACATCTCTAACGGATGTCACCCGTACCCTGCTGT  1623937

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 57/74 (77%), Gaps = 2/74 (3%)
 Strand=Plus/Minus

Query  113      TCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGAC-GGGTGTCAC  171
                ||||||| ||||| || || ||||||||||| ||  |  ||||  |  || |||||| | 
Sbjct  2408792  TCTCCGAGAAGGCTGCTGTCAAGTTTAAACCTCAAGTCCAAAT-TCGAACGGGGTGTGAG  2408734

Query  172      CCGTACCCTGCCGT  185
                || |||||||||||
Sbjct  2408733  CCTTACCCTGCCGT  2408720

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 52/68 (76%), Gaps = 3/68 (4%)
 Strand=Plus/Minus

Query  272      TCTACGCTCGCTCCGCGTGGGTGAATG-ACGTGTGGGCCATCATGTACGCCTGGTATTTC  330
                |||||| ||||||  | |||   || | |||  |||||||||||||||   ||||| |||
Sbjct  1623850  TCTACGGTCGCTCTACCTGGCACAAAGGACGA-TGGGCCATCATGTACTAATGGTACTTC  1623792

Query  331      CCGAAAGG  338
                || |||||
Sbjct  1623791  CC-AAAGG  1623785

>PHKE:scaffold_192 scf_22126_192.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_192.1:1:65168:1 
REF
Length=65168

 Score = 78.8 bits (86),  Expect = 2e-12
 Identities = 251/385 (65%), Gaps = 26/385 (7%)
 Strand=Plus/Minus

Query  70     CACGACCAGGTTCGGCCATTCCCGCAGCCA-AAGCCCGTCACCGTCTCCGACAAGGCAGC  128
              |||||||| |||   |||||  | |||||  ||||   | ||| | ||||| ||||| ||
Sbjct  24352  CACGACCAAGTTGTCCCATTTGCCCAGCCTGAAGCTACT-ACCATTTCCGAGAAGGCTGC  24294

Query  129    AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
               || ||||| ||||| ||| || |  || || |||| ||||| ||||||||||||||  |
Sbjct  24293  CGTCAAGTTCAAACCTCAGATTCATGTCACCAACGGATGTCATCCGTACCCTGCCGTCAA  24234

Query  189    GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCAC  248
                  | ||||  ||  |  || || |||||    | |||| | |     ||    |||| 
Sbjct  24233  CTCAGCTGGCGACACAAGTGGCGGCCTCAAACCCACTGGAGCACCAAGTGGTTCGTGCAA  24174

Query  249    AGGCTCGAAGCT-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGG  307
               || ||   ||| |||||||||| | || |  || ||  | |||   | || |  |||||
Sbjct  24173  GGGATC-TGGCTACGGCTCTCAGGTGTATGGCCGTTCGACTTGGTACAGTGGCAGGTGGG  24115

Query  308    CCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCA  367
              |||||||||||   ||||| ||||| ||        || |  ||| |||          |
Sbjct  24114  CCATCATGTACAGTTGGTACTTCCCCAA--------GGACTCTCCATCT----------A  24073

Query  368    CCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCA  427
              |  |   ||| || ||||||||  | |||||| ||||  | ||||||||||| |||||  
Sbjct  24072  CAGG---TTTGGGCCACCGTCACGATTGGGAGCACGTTGTCGTGTGGATCGATAACCCAG  24016

Query  428    AGAGCAAAAACTCGACCATTCTTGG  452
              |   | ||||| ||| || ||||||
Sbjct  24015  ACGTCGAAAACCCGA-CAATCTTGG  23992

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 30/36 (83%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  304    TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
              ||||| ||||  ||||| || ||||||||||| |||
Sbjct  32825  TGGGCAATCACCTACGCGTGATATTTCCCGAAGGGC  32790

>PHSO:scaffold_2
Length=11587142

 Score = 77.9 bits (85),  Expect = 6e-12
 Identities = 186/279 (67%), Gaps = 2/279 (1%)
 Strand=Plus/Plus

Query  64        ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                 |||| ||||||| |||| | ||||||  | || ||   ||| |||||| ||||||| |||
Sbjct  10046472  ATCGTCCACGACAAGGTGCAGCCATTTGCCCAACCCGCGCCGGTCACCATCTCCGAGAAG  10046531

Query  124       GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                 |  || || ||||| || ||    ||    ||    ||   ||| |||||||||||||||
Sbjct  10046532  GTTGCCGTCAAGTTCAAGCCGAGTCTCGCCATTCGTGAAACGTGCCACCCGTACCCTGCC  10046591

Query  184       GTTCAGAAGGATGGCTCCATTACCGGAGGTCTC-AAGTGGAGTGGACCGCAGGACGGCGA  242
                 ||  |    |  |||   |  | | |||| ||| ||| |||| ||    |  ||  |  |
Sbjct  10046592  GTCAATGCCGCCGGCGAGACGAGCAGAGGGCTCAAAGGGGAG-GGTAAACCCGAGAGTAA  10046650

Query  243       ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
                 |||||  || ||| |||| || || ||  | ||||  ||  |  | |||   || | | |
Sbjct  10046651  ATGCAGGGGGTCGGAGCTGGGGTCGCAAGTGTACGGCCGAGCTACTTGGCACAAGGGCAT  10046710

Query  303       GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAG  341
                 |||||||||||||||||| ||||| ||||| || | |||
Sbjct  10046711  GTGGGCCATCATGTACGCGTGGTACTTCCCCAAGGACAG  10046749

 Score = 77.9 bits (85),  Expect = 6e-12
 Identities = 186/279 (67%), Gaps = 2/279 (1%)
 Strand=Plus/Plus

Query  64        ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                 |||| ||||||| |||| | ||||||  | || ||   ||| |||||| ||||||| |||
Sbjct  10059907  ATCGTCCACGACAAGGTGCAGCCATTTGCCCAACCCGCGCCGGTCACCATCTCCGAGAAG  10059966

Query  124       GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                 |  || || ||||| || ||    ||    ||    ||   ||| |||||||||||||||
Sbjct  10059967  GTTGCCGTCAAGTTCAAGCCGAGTCTCGCCATTCGTGAAACGTGCCACCCGTACCCTGCC  10060026

Query  184       GTTCAGAAGGATGGCTCCATTACCGGAGGTCTC-AAGTGGAGTGGACCGCAGGACGGCGA  242
                 ||  |    |  |||   |  | | |||| ||| ||| |||| ||    |  ||  |  |
Sbjct  10060027  GTCAATGCCGCCGGCGAGACGAGCAGAGGGCTCAAAGGGGAG-GGTAAACCCGAGAGTAA  10060085

Query  243       ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
                 |||||  || ||| |||| || || ||  | ||||  ||  |  | |||   || | | |
Sbjct  10060086  ATGCAGGGGGTCGGAGCTGGGGTCGCAAGTGTACGGCCGAGCTACTTGGCACAAGGGCAT  10060145

Query  303       GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAG  341
                 |||||||||||||||||| ||||| ||||| || | |||
Sbjct  10060146  GTGGGCCATCATGTACGCGTGGTACTTCCCCAAGGACAG  10060184

 Score = 61.7 bits (67),  Expect = 5e-07
 Identities = 62/81 (77%), Gaps = 0/81 (0%)
 Strand=Plus/Plus

Query  259      CTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTAC  318
                || ||||| ||| ||||||  ||  || | |||   || ||||| |||||||||||||||
Sbjct  1883340  CTAGGCTCGCAGGTCTACGGACGGGCCACCTGGTACAAGGACGTCTGGGCCATCATGTAC  1883399

Query  319      GCCTGGTATTTCCCGAAAGGC  339
                || ||||| |  |||||| ||
Sbjct  1883400  GCGTGGTACTATCCGAAAAGC  1883420

 Score = 58.1 bits (63),  Expect = 6e-06
 Identities = 60/79 (76%), Gaps = 0/79 (0%)
 Strand=Plus/Plus

Query  260      TCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACG  319
                |||| || ||| | ||||  ||| | ||||||   || ||  |||  |||||| ||||||
Sbjct  1132028  TCGGGTCCCAGGTTTACGGGCGCGCGGCGTGGCACAACGATCTGTACGCCATCGTGTACG  1132087

Query  320      CCTGGTATTTCCCGAAAGG  338
                ||||||| ||||| |||||
Sbjct  1132088  CCTGGTACTTCCCAAAAGG  1132106

 Score = 53.6 bits (58),  Expect = 7e-05
 Identities = 59/79 (75%), Gaps = 0/79 (0%)
 Strand=Plus/Minus

Query  260      TCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACG  319
                |||| || ||| | ||||   || | ||||||   || ||  |||  |||||| ||||||
Sbjct  1153075  TCGGGTCCCAGGTTTACGGGTGCGCGGCGTGGCACAACGATCTGTACGCCATCGTGTACG  1153016

Query  320      CCTGGTATTTCCCGAAAGG  338
                ||||||| ||||| |||||
Sbjct  1153015  CCTGGTACTTCCCAAAAGG  1152997

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 29/32 (91%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  307      GCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                |||||| ||||||||||||| ||||| |||||
Sbjct  1246868  GCCATCCTGTACGCCTGGTACTTCCCCAAAGG  1246899

 Score = 42.8 bits (46),  Expect = 0.13
 Identities = 29/33 (88%), Gaps = 0/33 (0%)
 Strand=Plus/Plus

Query  307      GCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
                |||||  ||||||| |||||||||||||| |||
Sbjct  1155509  GCCATTTTGTACGCATGGTATTTCCCGAATGGC  1155541

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  592       GGGGAATTCCAGGACCTCATTACATGGGA  620
                 || |||||||||||||||||||  |||||
Sbjct  10047030  GGAGAATTCCAGGACCTCATTATGTGGGA  10047058

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 26/29 (90%), Gaps = 0/29 (0%)
 Strand=Plus/Plus

Query  592       GGGGAATTCCAGGACCTCATTACATGGGA  620
                 || |||||||||||||||||||  |||||
Sbjct  10060465  GGAGAATTCCAGGACCTCATTATGTGGGA  10060493

>PLHA:NW_020189861.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_2956, whole genome shotgun sequence
Length=1921269

 Score = 77.0 bits (84),  Expect = 6e-12
 Identities = 177/258 (69%), Gaps = 8/258 (3%)
 Strand=Plus/Plus

Query  84      GCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACC  143
               |||||||  |||||||||||| ||||| ||| | ||  | ||||| || |||||||| ||
Sbjct  322511  GCCATTCAAGCAGCCAAAGCCTGTCACGGTCGCTGAACACGCAGCTGTGAAGTTTAAGCC  322570

Query  144     ACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCAT  203
                ||| |||| || |   | || ||||| || ||||| || ||  |      |||    ||
Sbjct  322571  CCAGATTAACATTGTTAATGGTTGTCATCCATACCCAGCAGTCAATGCCACTGGAGAGAT  322630

Query  204     TACCGGAGGTCTCAAGTGG--AGTGGACCGCAGGACGGCGAATGCACAGGCTC-GAAGCT  260
               ||  || || ||||||  |  || ||| | |  || |  | |||||  || || |||  |
Sbjct  322631  TAGTGGCGGACTCAAGGCGTCAG-GGAGCTC-TGATGCAGGATGCAAGGGATCTGAATAT  322688

Query  261     CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGA-ATGACGTGTGGGCCATCATGTACG  319
                ||||||||| |||| |  || ||  |||||   | | ||| | ||||| ||||||||  
Sbjct  322689  -GGCTCTCAGGTCTATGGACGTTCAACGTGGCACAGAGGAC-TATGGGCTATCATGTATT  322746

Query  320     CCTGGTATTTCCCGAAAG  337
               | |||||||| || ||||
Sbjct  322747  CGTGGTATTTTCCCAAAG  322764

>PHRA:scaffold_2309
Length=3569

 Score = 77.0 bits (84),  Expect = 6e-12
 Identities = 90/122 (74%), Gaps = 0/122 (0%)
 Strand=Plus/Minus

Query  64   ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
            |||| ||||||| |||| |  |||||| |||| ||  |||| ||||||| |||||| |||
Sbjct  596  ATCGACCACGACAAGGTGCAACCATTCGCGCAACCCGAGCCTGTCACCGACTCCGAGAAG  537

Query  124  GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
            || || ||    ||||| ||    ||  | |||| |  ||| || |||||||||||||| 
Sbjct  536  GCCGCCGTCCGATTTAAGCCGAGCCTGCAGATCGACACCGGTTGCCACCCGTACCCTGCT  477

Query  184  GT  185
            ||
Sbjct  476  GT  475

>PHCA:scaffold_16 PHYCAscaffold_16
Length=1020712

 Score = 77.0 bits (84),  Expect = 6e-12
 Identities = 182/273 (67%), Gaps = 3/273 (1%)
 Strand=Plus/Plus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                || || |||||| | || |  |||||| | || ||  | ||||| || ||||| || || 
Sbjct  1013611  ATTGGGCACGACAAAGTACAACCATTCGCCCAACCTGACCCCGTGACGGTCTCTGAGAAA  1013670

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                |||||||| ||||  || ||||| ||  | ||  ||||| | |||    | |  || |||
Sbjct  1013671  GCAGCAGTCAAGTACAAGCCACAACTCCAGATATCCGACAGCTGTGTTTCATTTCCAGCC  1013730

Query  184      GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
                ||  |    | |||    || || ||||| |||||| |||    |  |||   || || |
Sbjct  1013731  GTGAATGCTGCTGGAGAAATCACTGGAGGCCTCAAGGGGACAAAAG-GCAC--CGACGGA  1013787

Query  244      TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
                || || |   ||   || || |||||  ||||||  |||||  | |||    | |||  |
Sbjct  1013788  TGTACTGAAGCGCCTCTGGGGTCTCAAGTCTACGGCCGCTCGACCTGGTATCAAGACAAG  1013847

Query  304      TGGGCCATCATGTACGCCTGGTATTTCCCGAAA  336
                |||||||| |||| ||| |||||||||||||||
Sbjct  1013848  TGGGCCATGATGTTCGCGTGGTATTTCCCGAAA  1013880

 Score = 68.9 bits (75),  Expect = 3e-09
 Identities = 185/278 (67%), Gaps = 9/278 (3%)
 Strand=Plus/Minus

Query  62      TCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACA  121
               |||| ||||||||  | || | ||||||| | || ||  | || |||||  ||||||| |
Sbjct  997378  TCATTGGCCACGATAAAGTGCAGCCATTCGCCCAACCTGACCCGGTCACGATCTCCGAGA  997319

Query  122     AGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTG  181
               | |||||||| ||||  || ||||| ||    ||   |||  | ||   | | |  || |
Sbjct  997318  AAGCAGCAGTCAAGTACAAGCCACAACTCGTGATTTTCGATAGCTGCGTCTCATTTCCAG  997259

Query  182     CCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGA---GTGGACCGCAGGACG  238
               ||||  |    | |||   ||| || ||||| |||||| |||   ||||  | ||| |||
Sbjct  997258  CCGTAAACGCCGCTGGAGACATCACTGGAGGCCTCAAGGGGACAAGTGG--CACAG-ACG  997202

Query  239     GCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
                ||  | |  |||| |    || || |||||  ||||||  || ||  | |||    | |
Sbjct  997201  -CGTGTACCAAGGCACCT--CTGGGGTCTCAAGTCTACGGCCGGTCGACCTGGTATCAAG  997145

Query  299     ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAA  336
                |  ||||||||| |||| ||| |||||||||||||||
Sbjct  997144  GCAAGTGGGCCATGATGTTCGCGTGGTATTTCCCGAAA  997107

 Score = 67.1 bits (73),  Expect = 1e-08
 Identities = 41/44 (93%), Gaps = 0/44 (0%)
 Strand=Plus/Plus

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               || || |||||||||||||||||| |||||||||||||||||||
Sbjct  221650  AAGGATGTGTGGGCCATCATGTACTCCTGGTATTTCCCGAAAGG  221693

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 40/44 (91%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               || || |||||||||||||||||| | |||||||||||||||||
Sbjct  619051  AAGGATGTGTGGGCCATCATGTACTCGTGGTATTTCCCGAAAGG  619008

 Score = 59.9 bits (65),  Expect = 2e-06
 Identities = 181/278 (65%), Gaps = 9/278 (3%)
 Strand=Plus/Minus

Query  62      TCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACA  121
               |||| |  |||||| | || | ||||||| | || ||  |||| || ||  ||||||| |
Sbjct  952098  TCATTGATCACGACAAAGTGCAGCCATTCGCCCAACCTGAGCCGGTAACGATCTCCGAGA  952039

Query  122     AGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTG  181
               | |||||||| ||||  || ||||| ||    ||   |||  | ||   | | |  || |
Sbjct  952038  AAGCAGCAGTGAAGTACAAGCCACAACTCGTGATTTTCGATAGCTGCGTCTCATTTCCAG  951979

Query  182     CCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGA---GTGGACCGCAGGACG  238
               ||||  |    | |||   ||| || ||||| |||||| |||   ||||    ||  |  
Sbjct  951978  CCGTAAACGCCGTTGGAGACATCACTGGAGGCCTCAAGGGGACAAGTGG----CACAAAC  951923

Query  239     GCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
               |||  | |  |||| |    || || |||||  ||||||  || ||  | |||    | |
Sbjct  951922  GCGTGTACGGAGGCACCT--CTGGGGTCTCAAGTCTACGGCCGGTCGACCTGGTATCAAG  951865

Query  299     ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAA  336
                |  ||||||||| |||| ||| |||||||||||||||
Sbjct  951864  GCAAGTGGGCCATGATGTTCGCGTGGTATTTCCCGAAA  951827

 Score = 59.0 bits (64),  Expect = 2e-06
 Identities = 35/37 (95%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  302     TGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               ||||||||||||||||||||||||| || ||||||||
Sbjct  437846  TGTGGGCCATCATGTACGCCTGGTACTTTCCGAAAGG  437882

 Score = 58.1 bits (63),  Expect = 6e-06
 Identities = 39/44 (89%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               || ||| ||||||||||||||||| ||||||| || ||||||||
Sbjct  381461  AAGGACCTGTGGGCCATCATGTACTCCTGGTACTTTCCGAAAGG  381418

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 175/268 (65%), Gaps = 5/268 (2%)
 Strand=Plus/Minus

Query  70       CACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCA  129
                |||||  | || | |||||||   |||||  | || || || |||||||| || ||||||
Sbjct  1017684  CACGATAAAGTGCAGCCATTCAAACAGCCCGACCCGGTGACGGTCTCCGAGAAAGCAGCA  1017625

Query  130      GTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAG  189
                || ||||  || ||||| ||    || |     || |||    | |  ||||||||  | 
Sbjct  1017624  GTCAAGTACAAGCCACAACTGGTGATTGGAAGTGGCTGTGTTTCATTTCCTGCCGTAAAT  1017565

Query  190      AAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCA-GGACGGCGAATGCAC  248
                   | |||   ||| || ||||| |||||  |||    |  ||| ||||||   ||| ||
Sbjct  1017564  GCTGCTGGAGACATCACTGGAGGGCTCAAAGGGACAAAAA-GCACGGACGG---ATGTAC  1017509

Query  249      AGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGC  308
                 |   |    || || |||||  |||||| ||| ||  | |||    | |||   |||||
Sbjct  1017508  TGAAGCACCCCTGGGGTCTCAAGTCTACGGTCGGTCGACCTGGTATCAAGACAAATGGGC  1017449

Query  309      CATCATGTACGCCTGGTATTTCCCGAAA  336
                ||| |||| ||| |||||||||||||||
Sbjct  1017448  CATGATGTTCGCGTGGTATTTCCCGAAA  1017421

 Score = 54.5 bits (59),  Expect = 7e-05
 Identities = 34/37 (92%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  302     TGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               |||||| |||||||||||||||||| || ||||||||
Sbjct  362199  TGTGGGTCATCATGTACGCCTGGTACTTTCCGAAAGG  362235

 Score = 53.6 bits (58),  Expect = 7e-05
 Identities = 38/44 (86%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               || || |||||||||||||||||| ||||||| || || |||||
Sbjct  330428  AAGGATGTGTGGGCCATCATGTACTCCTGGTACTTTCCAAAAGG  330385

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 30/32 (94%), Gaps = 0/32 (0%)
 Strand=Plus/Minus

Query  304     TGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
               ||||||||||||||||| ||||||||||| ||
Sbjct  910494  TGGGCCATCATGTACGCGTGGTATTTCCCCAA  910463

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 31/35 (89%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTT  329
               || || |||||||||||||||||| ||||||| ||
Sbjct  334902  AAGGATGTGTGGGCCATCATGTACTCCTGGTACTT  334868

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 31/35 (89%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTT  329
               || || |||||||||||||||||| ||||||| ||
Sbjct  339366  AAGGATGTGTGGGCCATCATGTACTCCTGGTACTT  339332

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 31/35 (89%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  304     TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               ||||||||||||||| ||||||| || ||||| ||
Sbjct  391576  TGGGCCATCATGTACTCCTGGTACTTTCCGAAGGG  391610

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 31/35 (89%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  304     TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               ||||||||||||||| ||||||| || ||||| ||
Sbjct  404289  TGGGCCATCATGTACTCCTGGTACTTTCCGAAGGG  404255

 Score = 41.9 bits (45),  Expect = 0.44
 Identities = 30/35 (86%), Gaps = 0/35 (0%)
 Strand=Plus/Plus

Query  392     ACTGGGAGTACGTCATTGTGTGGATCGACAACCCC  426
               ||||| || | ||| |||||||||||||||| |||
Sbjct  327514  ACTGGAAGAATGTCGTTGTGTGGATCGACAATCCC  327548

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  392     ACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               ||||| || | ||| |||||||||||||||| ||
Sbjct  221729  ACTGGAAGAATGTCGTTGTGTGGATCGACAATCC  221762

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  392     ACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               ||||| || || || |||||||||||||||| ||
Sbjct  391646  ACTGGAAGAACATCGTTGTGTGGATCGACAATCC  391679

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  392     ACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               ||||| || | ||| |||||||||||||||| ||
Sbjct  618972  ACTGGAAGAATGTCGTTGTGTGGATCGACAATCC  618939

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  308     CCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               ||||||||||| ||||||| || || |||||
Sbjct  340464  CCATCATGTACTCCTGGTACTTTCCAAAAGG  340434

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 34/43 (79%), Gaps = 0/43 (0%)
 Strand=Plus/Plus

Query  101     AGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACC  143
               ||||  |||||||||| || || || ||  | |||||||||||
Sbjct  362016  AGCCTATCACCGTCTCGGAAAAAGCTGCCATCAAGTTTAAACC  362058

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 29/35 (83%), Gaps = 0/35 (0%)
 Strand=Plus/Minus

Query  303      GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
                |||| | || |||||  ||||| ||||||||||||
Sbjct  1018429  GTGGACTATGATGTATTCCTGGCATTTCCCGAAAG  1018395

>PHIF:NW_003303757.1 Phytophthora infestans T30-4 supercont1.2 
genomic scaffold, whole genome shotgun sequence
Length=5928454

 Score = 74.3 bits (81),  Expect = 7e-11
 Identities = 63/78 (81%), Gaps = 0/78 (0%)
 Strand=Plus/Plus

Query  262      GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
                || |||||| |||||| |||  | |  |||   || ||| ||||||||||||||||||| 
Sbjct  5833033  GGGTCTCAGGTCTACGGTCGAGCTGGATGGTACAAGGACCTGTGGGCCATCATGTACGCT  5833092

Query  322      TGGTATTTCCCGAAAGGC  339
                ||||| ||||||||||||
Sbjct  5833093  TGGTACTTCCCGAAAGGC  5833110

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 26/29 (90%), Gaps = 2/29 (7%)
 Strand=Plus/Plus

Query  238     GGCGAATGCA--CAGGCTCGAAGCTCGGC  264
               ||||||||||  || ||||||||||||||
Sbjct  871181  GGCGAATGCATGCAAGCTCGAAGCTCGGC  871209

>PHIF:NW_003303732.1 Phytophthora infestans T30-4 supercont1.27 
genomic scaffold, whole genome shotgun sequence
Length=2178769

 Score = 74.3 bits (81),  Expect = 7e-11
 Identities = 75/98 (77%), Gaps = 0/98 (0%)
 Strand=Plus/Minus

Query  238      GGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAAT  297
                |||| ||||| ||| ||    | |||||| ||||||||||  |||||  ||||| | || 
Sbjct  1051711  GGCGGATGCAGAGGATCCGGCCACGGCTCGCAGATCTACGGCCGCTCTACGTGGTTTAAC  1051652

Query  298      GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                |   | ||||||||||||||| ||||||| ||||| ||
Sbjct  1051651  GGTCTCTGGGCCATCATGTACTCCTGGTACTTCCCCAA  1051614

 Score = 68.9 bits (75),  Expect = 3e-09
 Identities = 182/277 (66%), Gaps = 1/277 (0%)
 Strand=Plus/Plus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                ||||  || |||  ||| | ||||||| | || ||| ||||  |||||| | | || || 
Sbjct  1392283  ATCGATCATGACACGGTGCAGCCATTCGCACAACCAGAGCCGATCACCGACGCTGAGAAA  1392342

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                || ||  | ||||| || |||   |||  | ||   || || || ||||||||||| | |
Sbjct  1392343  GCTGCCATCAAGTTCAAGCCATCACTTGCAGTCAAGGATGGATGCCACCCGTACCCCGTC  1392402

Query  184      GTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
                ||  | |  |  |||  ||  |  |  ||  | ||  | |  || ||    |||||||| 
Sbjct  1392403  GTA-ATACAGCCGGCGACACGAATGATGGCTTAAAAGGTACAGGCCCCTCTGACGGCGAC  1392461

Query  244      TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
                ||   ||||||   | | ||||| ||| | |||  ||| ||  ||||| |  | | |  |
Sbjct  1392462  TGTGAAGGCTCTCCGTTGGGCTCGCAGGTGTACAGTCGATCAACGTGGTTTGAGGGCAAG  1392521

Query  304      TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                ||||| ||||||||||| ||| ||||||| |||| ||
Sbjct  1392522  TGGGCTATCATGTACGCATGGAATTTCCCTAAAGACA  1392558

 Score = 66.2 bits (72),  Expect = 1e-08
 Identities = 78/106 (74%), Gaps = 0/106 (0%)
 Strand=Plus/Minus

Query  235      GACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
                |||||||| ||   ||||||   | | ||||| ||| | |||  ||| ||  ||||| | 
Sbjct  1405760  GACGGCGACTGTGAAGGCTCTCCGTTGGGCTCGCAGGTGTACAGTCGATCAACGTGGTTT  1405701

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                 | | |  |||||| ||||||||||| ||||||||||| |||| ||
Sbjct  1405700  GAGGGCAAGTGGGCTATCATGTACGCATGGTATTTCCCTAAAGACA  1405655

 Score = 54.5 bits (59),  Expect = 7e-05
 Identities = 78/109 (72%), Gaps = 6/109 (6%)
 Strand=Plus/Plus

Query  235      GACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
                ||||| ||||| || |||||     | ||||| ||| | |||  ||| ||  | |   ||
Sbjct  1435446  GACGGTGAATGTACGGGCTCTCCCTTAGGCTCGCAGGTGTACAGTCGATCGACTT---TG  1435502

Query  295      AATGA---CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                 ||||   |  |||||||||||||||||| |||||||| || |||| ||
Sbjct  1435503  TATGAGAACAAGTGGGCCATCATGTACGCATGGTATTTTCCAAAAGACA  1435551

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 80/116 (69%), Gaps = 0/116 (0%)
 Strand=Plus/Minus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                ||||  || |||  ||| | ||||||| | || ||| ||||  |||||| | | || || 
Sbjct  1405921  ATCGATCATGACACGGTGCAGCCATTCGCACAACCAGAGCCGATCACCGACGCTGAGAAA  1405862

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCC  179
                || ||  | ||||| || |||   |||  | ||   || || || |||||||||||
Sbjct  1405861  GCTGCCATCAAGTTCAAGCCATCACTTGCAGTCAAGGATGGATGCCACCCGTACCC  1405806

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 55/77 (71%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  578      TCACGGAAGACACGGGGGAATTCCAGGACCTCATTACATGGGACGAACTCTCGAAGCTGG  637
                ||||  | ||| | || || ||||||||||| ||||  |||||| || | ||  | ||||
Sbjct  1051395  TCACCAAGGACGCTGGCGAGTTCCAGGACCTGATTATGTGGGACCAAATGTCCGATCTGG  1051336

Query  638      CACGATACTCTCTGAAC  654
                | ||     ||||||||
Sbjct  1051335  CGCGCAGAGCTCTGAAC  1051319

>PHRA:scaffold_1828
Length=3762

 Score = 72.5 bits (79),  Expect = 3e-10
 Identities = 89/122 (73%), Gaps = 0/122 (0%)
 Strand=Plus/Plus

Query  64   ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
            |||| ||||||| |||| |  |||||| |||| ||  | || |||||||||||||| |||
Sbjct  444  ATCGACCACGACAAGGTGCAACCATTCGCGCAACCCGATCCTGTCACCGTCTCCGAGAAG  503

Query  124  GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
            || || ||    ||||| ||    ||    |||| |  ||| || |||||||||||||| 
Sbjct  504  GCCGCCGTCCGATTTAAGCCGAGCCTGCGGATCGACAGCGGATGCCACCCGTACCCTGCT  563

Query  184  GT  185
            ||
Sbjct  564  GT  565

 Score = 65.3 bits (71),  Expect = 4e-08
 Identities = 40/43 (93%), Gaps = 0/43 (0%)
 Strand=Plus/Plus

Query  298   GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
             ||| ||||||||||||||||||| |||||||||||||||| ||
Sbjct  1398  GACCTGTGGGCCATCATGTACGCGTGGTATTTCCCGAAAGACA  1440

>PHCA:scaffold_51 PHYCAscaffold_51
Length=529628

 Score = 72.5 bits (79),  Expect = 3e-10
 Identities = 156/228 (68%), Gaps = 8/228 (4%)
 Strand=Plus/Plus

Query  109     ACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGT  168
               |||||  | || ||||| ||  | |||||   |||  |||||||| ||| | ||||||| 
Sbjct  273861  ACCGTGACTGAAAAGGCTGCTATTAAGTTCCGACCGAAGCTTAAAGTCGTCAACGGGTGC  273920

Query  169     CACCCGTACCCTGCCGTTCAGAAGGATGGCT-CCATTACCGGA--GGTCTCAAGTGGAGT  225
               |||||||||||||| ||    || | || |  |||   | | |  ||| |  ||  | | 
Sbjct  273921  CACCCGTACCCTGCTGTA---AACGCTGCCGGCCAGGTCAGCAACGGTTTGGAGGTG-GC  273976

Query  226     GGACCGCAGGACGGC-GAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTC  284
               |||||  | |   || |  ||||  ||||| ||||| ||| ||||  | ||||  || ||
Sbjct  273977  GGACCCTACGGGAGCTGCTTGCAAGGGCTCAAAGCTTGGCACTCAAGTGTACGGGCGTTC  274036

Query  285     CGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCC  332
                || ||| |      ||| ||||||||||||||||||||||| |||||
Sbjct  274037  GGCCTGGTTCGGCCGCGTTTGGGCCATCATGTACGCCTGGTACTTCCC  274084

 Score = 72.5 bits (79),  Expect = 3e-10
 Identities = 71/92 (77%), Gaps = 0/92 (0%)
 Strand=Plus/Plus

Query  94      CAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAA  153
               |||||  | ||||||||  | ||||| || || ||  | ||||||||||| |||||| | 
Sbjct  306817  CAGCCGGAACCCGTCACTATTTCCGATAAAGCTGCGATTAAGTTTAAACCGCAGCTTCAT  306876

Query  154     ATCGCCGACGGGTGTCACCCGTACCCTGCCGT  185
               ||| || |||| ||||| ||||| ||||| ||
Sbjct  306877  ATCACCAACGGATGTCATCCGTATCCTGCAGT  306908

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 58/78 (74%), Gaps = 0/78 (0%)
 Strand=Plus/Plus

Query  259     CTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTAC  318
               || || |||||  ||||||  || || || |||    | |||   |||||||| |||| |
Sbjct  383501  CTGGGGTCTCAAGTCTACGGCCGATCGGCCTGGTACCAAGACAAATGGGCCATGATGTTC  383560

Query  319     GCCTGGTATTTCCCGAAA  336
               || |||||||||||||||
Sbjct  383561  GCGTGGTATTTCCCGAAA  383578

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 174/268 (65%), Gaps = 5/268 (2%)
 Strand=Plus/Plus

Query  70      CACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCA  129
               |||||  | || | |||||||   |||||  | || || || |||||||| |||||||||
Sbjct  384806  CACGATAAAGTGCAGCCATTCAAACAGCCCGACCCGGTGACAGTCTCCGAGAAGGCAGCA  384865

Query  130     GTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAG  189
                | ||||  || || |||||    || |  |  || |||    | |  ||||||||  | 
Sbjct  384866  CTCAAGTACAAGCCGCAGCTGGTCATTGGAGGTGGCTGTGTTTCATTTCCTGCCGTAAAT  384925

Query  190     AAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCA-GGACGGCGAATGCAC  248
                  | |||   ||| || ||||| |||||  |||    |  ||| ||||||   ||| ||
Sbjct  384926  GCTGCTGGAGACATCACTGGAGGGCTCAAAGGGACAAAAA-GCACGGACGG---ATGTAC  384981

Query  249     AGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGC  308
                |   |    || || |||||   |||||  || ||  | |||    | |||   |||||
Sbjct  384982  TGAAGCACCCCTGGGGTCTCAAGCCTACGGCCGGTCGACCTGGTATCAAGACAAATGGGC  385041

Query  309     CATCATGTACGCCTGGTATTTCCCGAAA  336
               ||| |||| ||| |||||||||||||||
Sbjct  385042  CATGATGTTCGCGTGGTATTTCCCGAAA  385069

>PHPA:scaffold_5 NW_008648991.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.5, whole genome shotgun 
sequence
Length=2147012

 Score = 71.6 bits (78),  Expect = 3e-10
 Identities = 188/282 (67%), Gaps = 14/282 (5%)
 Strand=Plus/Minus

Query  65      TCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGG  124
               ||| ||| ||| | |||   || || || || ||  || | |||||||||||||| || |
Sbjct  221340  TCGACCATGACAAAGTTGAACCTTTGCCTCAACCCGAGGCGGTCACCGTCTCCGAAAAAG  221281

Query  125     CAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACC---CGTACCCTG  181
               | ||  | ||||| || ||||||||| | ||  | ||   |  |  |    |||| || |
Sbjct  221280  CTGCCATCAAGTTCAAGCCACAGCTTTACATTCCAGAGATGGTTTGCGTATCGTATCCCG  221221

Query  182     CCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCG  241
               ||||  |    |  ||     | || ||||| |||||| |||   ||  | |  ||| ||
Sbjct  221220  CCGTAAATGCTGCCGGTGAGGTCACTGGAGGGCTCAAGGGGAC--GAATGGAA-ACGACG  221164

Query  242     AATGCAC--AGGCTCGAAGCTC--GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAAT  297
                |||||   | ||||    |||  ||||| ||  |||||| |||  | | ||||   || 
Sbjct  221163  CATGCAAGTATGCTC----CTCAGGGCTCCCAAGTCTACGGTCGAGCTGGGTGGTACAAG  221108

Query  298     GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
               ||  ||||||||||||||||||| ||||| ||||||||||||
Sbjct  221107  GATCTGTGGGCCATCATGTACGCTTGGTACTTCCCGAAAGGC  221066

 Score = 69.8 bits (76),  Expect = 9e-10
 Identities = 62/78 (79%), Gaps = 0/78 (0%)
 Strand=Plus/Plus

Query  262      GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
                || || ||| |||||| |||  | | ||||   || ||| ||||||||||||||||||| 
Sbjct  1501519  GGATCACAGGTCTACGGTCGAGCTGGGTGGCACAAGGACATGTGGGCCATCATGTACGCT  1501578

Query  322      TGGTATTTCCCGAAAGGC  339
                ||||| ||||| ||||||
Sbjct  1501579  TGGTACTTCCCAAAAGGC  1501596

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 53/68 (78%), Gaps = 0/68 (0%)
 Strand=Plus/Plus

Query  259     CTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTAC  318
               |||||||| ||| | |||| |||  |  |||||   || |  || |||||||||||||||
Sbjct  424305  CTCGGCTCACAGGTTTACGGTCGTGCTACGTGGTACAAGGGAGTCTGGGCCATCATGTAC  424364

Query  319     GCCTGGTA  326
               ||||||||
Sbjct  424365  GCCTGGTA  424372

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 35/41 (85%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  385      CGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
                |||||| ||||| || ||||  |||||||||||||||| ||
Sbjct  1501621  CGTCATGACTGGAAGAACGTTGTTGTGTGGATCGACAATCC  1501661

>PHKE:scaffold_219 scf_22126_219.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_219.1:1:59035:1 
REF
Length=59035

 Score = 71.6 bits (78),  Expect = 3e-10
 Identities = 69/89 (78%), Gaps = 0/89 (0%)
 Strand=Plus/Plus

Query  244    TGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTG  303
              |||| ||| ||  |  | |||||||||||||||||||| |||  || |   | ||| || 
Sbjct  36608  TGCAGAGGTTCAGACTTGGGCTCTCAGATCTACGCTCGTTCCAAGTAGCATAGTGATGTT  36667

Query  304    TGGGCCATCATGTACGCCTGGTATTTCCC  332
              ||||||||||||||| | |||||||| ||
Sbjct  36668  TGGGCCATCATGTACACTTGGTATTTTCC  36696

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 46/59 (78%), Gaps = 0/59 (0%)
 Strand=Plus/Plus

Query  118    GACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTA  176
              |||||| | || || ||||||||||| ||||  |||||| | |  | |||||| |||||
Sbjct  36484  GACAAGCCTGCGGTCAAGTTTAAACCGCAGCGCAAAATCTCGGGTGCGTGTCATCCGTA  36542

>PHPA:scaffold_6 NW_008648992.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.6, whole genome shotgun 
sequence
Length=2202294

 Score = 70.7 bits (77),  Expect = 9e-10
 Identities = 64/81 (79%), Gaps = 0/81 (0%)
 Strand=Plus/Minus

Query  259     CTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTAC  318
               || || |||||||| |||| |||  | | ||||   || |||   |||||||||||||||
Sbjct  279084  CTTGGATCTCAGATTTACGGTCGAGCTGGGTGGCACAACGACCGCTGGGCCATCATGTAC  279025

Query  319     GCCTGGTATTTCCCGAAAGGC  339
               || ||||| ||||||||||||
Sbjct  279024  GCGTGGTACTTCCCGAAAGGC  279004

>PHIF:NW_003303741.1 Phytophthora infestans T30-4 supercont1.18 
genomic scaffold, whole genome shotgun sequence
Length=2518706

 Score = 70.7 bits (77),  Expect = 9e-10
 Identities = 103/146 (71%), Gaps = 0/146 (0%)
 Strand=Plus/Minus

Query  70      CACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCA  129
               || ||||| ||||| || ||| | ||||| ||  | |  |||  |   || ||||| || 
Sbjct  495112  CATGACCAAGTTCGCCCTTTCGCACAGCCCAATGCTGCTACCACCAAGGAAAAGGCTGCT  495053

Query  130     GTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAG  189
               || || |  || || |||||| | ||||  ||||| || ||||||||||| || ||| ||
Sbjct  495052  GTCAAATACAAGCCTCAGCTTTACATCGAGGACGGATGCCACCCGTACCCCGCTGTTGAG  494993

Query  190     AAGGATGGCTCCATTACCGGAGGTCT  215
                |||||||  | || | || ||| ||
Sbjct  494992  GAGGATGGGACAATCAGCGCAGGACT  494967

 Score = 47.3 bits (51),  Expect = 0.010
 Identities = 33/38 (87%), Gaps = 0/38 (0%)
 Strand=Plus/Minus

Query  307     GCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGG  344
               |||||||||||||| ||||| ||||| ||||| | |||
Sbjct  494875  GCCATCATGTACGCATGGTACTTCCCTAAAGGGAAAGG  494838

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 28/32 (88%), Gaps = 0/32 (0%)
 Strand=Plus/Plus

Query  307     GCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               |||||||||||||| ||||| || || |||||
Sbjct  493478  GCCATCATGTACGCATGGTACTTTCCCAAAGG  493509

>PHRA:scaffold_2258
Length=3407

 Score = 69.8 bits (76),  Expect = 9e-10
 Identities = 62/78 (79%), Gaps = 0/78 (0%)
 Strand=Plus/Plus

Query  262   GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
             ||||| ||| ||||||  ||  | |  |||   || ||||| ||||||||||||||||||
Sbjct  2560  GGCTCACAGGTCTACGGCCGTGCTGAATGGCACAACGACGTCTGGGCCATCATGTACGCC  2619

Query  322   TGGTATTTCCCGAAAGGC  339
             ||||| |||||||| |||
Sbjct  2620  TGGTACTTCCCGAAGGGC  2637

>PHRA:scaffold_516
Length=11046

 Score = 69.8 bits (76),  Expect = 9e-10
 Identities = 62/78 (79%), Gaps = 0/78 (0%)
 Strand=Plus/Minus

Query  262   GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
             ||||| ||| ||||||  ||  | |  |||   || ||||| ||||||||||||||||||
Sbjct  8287  GGCTCACAGGTCTACGGCCGTGCTGAATGGCACAACGACGTCTGGGCCATCATGTACGCC  8228

Query  322   TGGTATTTCCCGAAAGGC  339
             ||||| |||||||| |||
Sbjct  8227  TGGTACTTCCCGAAGGGC  8210

>PHRA:scaffold_512
Length=11141

 Score = 69.8 bits (76),  Expect = 9e-10
 Identities = 62/78 (79%), Gaps = 0/78 (0%)
 Strand=Plus/Minus

Query  262  GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
            ||||| ||| ||||||  ||  | |  |||   || ||||| ||||||||||||||||||
Sbjct  110  GGCTCACAGGTCTACGGCCGTGCTGAATGGCACAACGACGTCTGGGCCATCATGTACGCC  51

Query  322  TGGTATTTCCCGAAAGGC  339
            ||||| |||||||| |||
Sbjct  50   TGGTACTTCCCGAAGGGC  33

>PHRA:scaffold_19
Length=590304

 Score = 69.8 bits (76),  Expect = 9e-10
 Identities = 62/78 (79%), Gaps = 0/78 (0%)
 Strand=Plus/Minus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               ||||| ||| ||||||  ||  | |  |||   || ||||| ||||||||||||||||||
Sbjct  149601  GGCTCGCAGGTCTACGGCCGTGCTGAATGGTACAACGACGTCTGGGCCATCATGTACGCC  149542

Query  322     TGGTATTTCCCGAAAGGC  339
               ||||| |||||||| |||
Sbjct  149541  TGGTACTTCCCGAAGGGC  149524

 Score = 69.8 bits (76),  Expect = 9e-10
 Identities = 62/78 (79%), Gaps = 0/78 (0%)
 Strand=Plus/Minus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               ||||| ||| ||||||  ||  | |  |||   || ||||| ||||||||||||||||||
Sbjct  331572  GGCTCACAGGTCTACGGCCGTGCTGAATGGTACAACGACGTCTGGGCCATCATGTACGCC  331513

Query  322     TGGTATTTCCCGAAAGGC  339
               ||||| |||||||| |||
Sbjct  331512  TGGTACTTCCCGAAGGGC  331495

>PHRA:scaffold_1415
Length=4047

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 61/77 (79%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  262   GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
             ||||| ||| ||||||  ||  | |  |||   || ||||| ||||||||||||||||||
Sbjct  1456  GGCTCACAGGTCTACGGCCGTGCTGGCTGGTACAACGACGTCTGGGCCATCATGTACGCC  1397

Query  322   TGGTATTTCCCGAAAGG  338
             ||||| ||||| |||||
Sbjct  1396  TGGTACTTCCCCAAAGG  1380

 Score = 59.9 bits (65),  Expect = 2e-06
 Identities = 178/273 (65%), Gaps = 9/273 (3%)
 Strand=Plus/Plus

Query  69    CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
             ||||||| | || | ||| ||||| || ||    || || ||  ||||||| || || | 
Sbjct  2665  CCACGACAAAGTACAGCCGTTCCCTCAACCGGCCCCTGTTACTATCTCCGAAAAAGCTGG  2724

Query  129   AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
              || ||||| || || ||||| |  |||   | ||||||   ||||||||| |||||   
Sbjct  2725  TGTCAAGTTCAAGCCGCAGCTCACTATCAAAGCCGGGTGCTTCCCGTACCCCGCCGT---  2781

Query  189   GAAGGATG---GCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATG  245
             ||| | ||   |    |  | |||||| || ||  | |  |||    | ||   ||| ||
Sbjct  2782  GAATGCTGCGGGTGAGACCAGCGGAGGCCTAAAAGGAAACGGAG---ATGAACTCGACTG  2838

Query  246   CACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTG  305
              | |   ||     | ||||| ||| ||||||  ||  | |  |||   || | ||| ||
Sbjct  2839  TATACTTTCTTTATTGGGCTCGCAGGTCTACGGCCGTGCTGGCTGGTACAACGGCGTCTG  2898

Query  306   GGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
             ||||||||||||||| ||||| ||||| |||||
Sbjct  2899  GGCCATCATGTACGCTTGGTACTTCCCTAAAGG  2931

>PHRA:scaffold_407
Length=13753

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 61/77 (79%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  262   GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
             ||||| ||| ||||||  ||  |||  |||   || ||||| ||||||||||||||||||
Sbjct  7814  GGCTCACAGGTCTACGGCCGTGCCGAATGGTACAACGACGTCTGGGCCATCATGTACGCC  7755

Query  322   TGGTATTTCCCGAAAGG  338
             ||||| ||||| || ||
Sbjct  7754  TGGTACTTCCCCAAGGG  7738

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 33/41 (80%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  385   CGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
             |||||| |||||    | ||  |||||||||||||||||||
Sbjct  7712  CGTCATGACTGGTCAAATGTTGTTGTGTGGATCGACAACCC  7672

>PHRA:scaffold_108
Length=150424

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 61/77 (79%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  262    GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
              ||||| ||| ||||||  ||  | |  |||   || ||||| ||||||||||||||||||
Sbjct  93803  GGCTCACAGGTCTACGGCCGTGCTGGCTGGTACAACGACGTCTGGGCCATCATGTACGCC  93862

Query  322    TGGTATTTCCCGAAAGG  338
              ||||| ||||| |||||
Sbjct  93863  TGGTACTTCCCCAAAGG  93879

 Score = 59.0 bits (64),  Expect = 2e-06
 Identities = 59/77 (77%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  262    GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
              ||||| ||| ||||||  ||  | |  |||   || | ||| ||||||||||||||||| 
Sbjct  92037  GGCTCGCAGGTCTACGGCCGTGCTGGCTGGTACAACGGCGTCTGGGCCATCATGTACGCT  91978

Query  322    TGGTATTTCCCGAAAGG  338
              ||||| ||||| |||||
Sbjct  91977  TGGTACTTCCCTAAAGG  91961

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 57/75 (76%), Gaps = 0/75 (0%)
 Strand=Plus/Plus

Query  264    CTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTG  323
              ||| ||| ||||||  ||  | |  |||   || | ||| ||||||||||||||||||||
Sbjct  31292  CTCGCAGGTCTACGGCCGAGCTGGCTGGTGCAACGGCGTCTGGGCCATCATGTACGCCTG  31351

Query  324    GTATTTCCCGAAAGG  338
              ||| ||||| || ||
Sbjct  31352  GTACTTCCCCAATGG  31366

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 57/77 (74%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  262    GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
              ||||| ||| ||||||  ||  | |  |||   || ||||| |  ||||||||||| |||
Sbjct  37369  GGCTCGCAGGTCTACGGCCGTGCTGGCTGGCACAACGACGTCTATGCCATCATGTATGCC  37428

Query  322    TGGTATTTCCCGAAAGG  338
              ||||| ||||| || ||
Sbjct  37429  TGGTACTTCCCTAAGGG  37445

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 57/77 (74%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  262    GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
              ||||| ||| ||||||  ||  | |  |||   || ||||| |  ||||||||||| |||
Sbjct  68537  GGCTCGCAGGTCTACGGCCGTGCTGGCTGGCACAACGACGTCTATGCCATCATGTATGCC  68478

Query  322    TGGTATTTCCCGAAAGG  338
              ||||| ||||| || ||
Sbjct  68477  TGGTACTTCCCTAAGGG  68461

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 83/118 (70%), Gaps = 2/118 (2%)
 Strand=Plus/Plus

Query  69     CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
              ||||||| | || | ||| || || || ||    || || ||  ||||||| || || | 
Sbjct  37179  CCACGACAAAGTACAGCCGTTTCCTCAACCGGCCCCTGTTACTATCTCCGAAAAAGCTGG  37238

Query  129    AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACC-CGTACCCTGCCGT  185
               || ||||| || || || ||  | ||| ||  |||||| |||| | |||||||||||
Sbjct  37239  TGTCAAGTTCAAGCCGCAACTCCATATCACCACCGGGTG-CACCTCATACCCTGCCGT  37295

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 56/77 (73%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  262    GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
              ||||| ||| ||||||  ||    |  |||   || ||||| |  ||||||||||| |||
Sbjct  46933  GGCTCGCAGGTCTACGGCCGTGTTGGCTGGCACAACGACGTCTATGCCATCATGTATGCC  46874

Query  322    TGGTATTTCCCGAAAGG  338
              ||||| ||||| || ||
Sbjct  46873  TGGTACTTCCCTAAGGG  46857

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 34/42 (81%), Gaps = 0/42 (0%)
 Strand=Plus/Plus

Query  385    CGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCC  426
              |||||| |||||    |||   ||||||||||||||||||||
Sbjct  37471  CGTCATGACTGGTCAAACGCTGTTGTGTGGATCGACAACCCC  37512

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 34/42 (81%), Gaps = 0/42 (0%)
 Strand=Plus/Minus

Query  385    CGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCC  426
              |||||| |||||    |||   ||||||||||||||||||||
Sbjct  46831  CGTCATGACTGGTCAAACGCTGTTGTGTGGATCGACAACCCC  46790

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 34/42 (81%), Gaps = 0/42 (0%)
 Strand=Plus/Minus

Query  385    CGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCC  426
              |||||| |||||    |||   ||||||||||||||||||||
Sbjct  68435  CGTCATGACTGGTCAAACGCTGTTGTGTGGATCGACAACCCC  68394

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  407    TTGTGTGGATCGACAACCCC  426
              ||||||||||||||||||||
Sbjct  31414  TTGTGTGGATCGACAACCCC  31433

>PHRA:scaffold_91
Length=158530

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 61/77 (79%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               ||||| ||| ||||||  ||  |||  |||   || ||||| ||||||||||||||||||
Sbjct  149204  GGCTCACAGGTCTACGGCCGTGCCGAATGGTACAACGACGTCTGGGCCATCATGTACGCC  149145

Query  322     TGGTATTTCCCGAAAGG  338
               ||||| ||||| || ||
Sbjct  149144  TGGTACTTCCCCAAGGG  149128

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 33/41 (80%), Gaps = 0/41 (0%)
 Strand=Plus/Minus

Query  385     CGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               |||||| |||||    | ||  |||||||||||||||||||
Sbjct  149102  CGTCATGACTGGTCAAATGTTGTTGTGTGGATCGACAACCC  149062

>PHIF:NW_003303734.1 Phytophthora infestans T30-4 supercont1.25 
genomic scaffold, whole genome shotgun sequence
Length=2165783

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 61/77 (79%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  261      CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGC  320
                |||||| ||| |||||| |||  | | ||||    | ||| |||||||||||||||||||
Sbjct  1444954  CGGCTCGCAGGTCTACGGTCGAGCTGGGTGGCACCAGGACATGTGGGCCATCATGTACGC  1445013

Query  321      CTGGTATTTCCCGAAAG  337
                 ||||| || |||||||
Sbjct  1445014  TTGGTACTTTCCGAAAG  1445030

 Score = 68.0 bits (74),  Expect = 3e-09
 Identities = 61/77 (79%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  261      CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGC  320
                |||||| ||| |||||| |||  | | ||||    | ||| |||||||||||||||||||
Sbjct  1461912  CGGCTCGCAGGTCTACGGTCGAGCTGGGTGGCACCAGGACATGTGGGCCATCATGTACGC  1461853

Query  321      CTGGTATTTCCCGAAAG  337
                 ||||| || |||||||
Sbjct  1461852  TTGGTACTTTCCGAAAG  1461836

>PHIF:NW_003303749.1 Phytophthora infestans T30-4 supercont1.10 
genomic scaffold, whole genome shotgun sequence
Length=3761764

 Score = 67.1 bits (73),  Expect = 1e-08
 Identities = 59/74 (80%), Gaps = 0/74 (0%)
 Strand=Plus/Plus

Query  263      GCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCT  322
                |||||||| |||||| ||   ||  ||||   || ||||||||||| ||||||||||| |
Sbjct  2342514  GCTCTCAGGTCTACGGTCTAACCAGGTGGCACAAGGACGTGTGGGCGATCATGTACGCTT  2342573

Query  323      GGTATTTCCCGAAA  336
                ||||||| || |||
Sbjct  2342574  GGTATTTTCCAAAA  2342587

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 31/38 (82%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  388      CATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
                ||| ||||| ||  ||| ||||||||||| ||||| ||
Sbjct  2342618  CATGACTGGAAGAGCGTTATTGTGTGGATTGACAATCC  2342655

>PHRA:scaffold_2136
Length=3667

 Score = 66.2 bits (72),  Expect = 1e-08
 Identities = 60/76 (79%), Gaps = 0/76 (0%)
 Strand=Plus/Plus

Query  263  GCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCT  322
            |||||||| ||||||  ||  | |  |||   || ||||| |||||||||||||||||||
Sbjct  795  GCTCTCAGGTCTACGGCCGTGCAGAATGGTACAACGACGTCTGGGCCATCATGTACGCCT  854

Query  323  GGTATTTCCCGAAAGG  338
            |||| ||||| || ||
Sbjct  855  GGTACTTCCCCAAGGG  870

>PHKE:scaffold_899 scf_22126_899.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_899.1_contig_1:1:6079:1 
REF
Length=6079

 Score = 66.2 bits (72),  Expect = 1e-08
 Identities = 59/73 (81%), Gaps = 1/73 (1%)
 Strand=Plus/Minus

Query  266   CTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGT  325
             ||||| |||||| ||| ||  | |||   |||||  ||||||||||||||||||| || |
Sbjct  3797  CTCAGGTCTACGGTCGATCAACCTGGTACAATGATATGTGGGCCATCATGTACGCTTGAT  3738

Query  326   ATTTCCCGAAAGG  338
             ||||||| |||||
Sbjct  3737  ATTTCCC-AAAGG  3726

 Score = 53.6 bits (58),  Expect = 7e-05
 Identities = 56/74 (76%), Gaps = 0/74 (0%)
 Strand=Plus/Minus

Query  262   GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
             ||||| ||  ||||||  || || || |||   ||  | || ||||| ||||||||||| 
Sbjct  2776  GGCTCGCAAGTCTACGGGCGTTCAGCATGGCACAACAATGTATGGGCAATCATGTACGCA  2717

Query  322   TGGTATTTCCCGAA  335
             ||||| ||||||||
Sbjct  2716  TGGTACTTCCCGAA  2703

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 32/39 (82%), Gaps = 0/39 (0%)
 Strand=Plus/Minus

Query  387   TCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
             ||| || |||||  || |  |||||||||||||||||||
Sbjct  2690  TCACAATTGGGAAAACATTGTTGTGTGGATCGACAACCC  2652

>PHCA:scaffold_25 PHYCAscaffold_25
Length=841216

 Score = 66.2 bits (72),  Expect = 1e-08
 Identities = 228/347 (66%), Gaps = 33/347 (10%)
 Strand=Plus/Minus

Query  85      CCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCA  144
               || ||||| |||||    || || ||  |||| || ||||| |  || ||||| ||||| 
Sbjct  234590  CCGTTCCCTCAGCCCGTACCGGTGACGATCTCTGAGAAGGCTGGCGTCAAGTTCAAACCT  234531

Query  145     CAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGCCGTTCAGAAGGAT--GGCTCC  201
               ||| || | ||  | |||||| |||   || |||||||| ||  | | | ||  ||    
Sbjct  234530  CAGATTCAGATT-CGGACGGGATGTGTGCCTTACCCTGCTGT--AAATGAATTCGGAGAG  234474

Query  202     ATTACCGGAGGTCTCAAGTGGAGTGG--ACCGCAGGACGGCGAATGCACAGGCTCGAAGC  259
               | ||  || ||||| ||    | |||  |||  |||  || |  |||  ||||||   ||
Sbjct  234473  ACTAGTGGTGGTCTAAAACCTACTGGTAACCCGAGG--GGTGGCTGCCGAGGCTCTG-GC  234417

Query  260     T-CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTAC  318
               | |||||| ||| | |||| ||| ||  ||||| |    |  || |||||||| ||||||
Sbjct  234416  TACGGCTCCCAGGTTTACGGTCGTTCTACGTGGATCCGAGGTGTCTGGGCCATTATGTAC  234357

Query  319     GCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCACCCGTCTTTTC  378
                ||||||||||||| ||          | | || | ||        ||||| |   ||| 
Sbjct  234356  TCCTGGTATTTCCCCAA----------GGATTCGC-CT--------TCACCGG--GTTTA  234318

Query  379     GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               || ||||||||  |||||||| ||| ||||||||  || ||||||||
Sbjct  234317  GGCCACCGTCACGACTGGGAGCACGCCATTGTGTTCATTGACAACCC  234271

>PHCA:scaffold_11 PHYCAscaffold_11
Length=1076090

 Score = 66.2 bits (72),  Expect = 1e-08
 Identities = 90/126 (71%), Gaps = 0/126 (0%)
 Strand=Plus/Minus

Query  60      AGTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGA  119
               ||||||  |||||||||| ||    || ||||   |||||   ||||||||  ||||| |
Sbjct  503888  AGTCATTAGCCACGACCAAGTGGCTCCTTTCCTTAAGCCAGTACCCGTCACAATCTCCCA  503829

Query  120     CAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCC  179
                || || | |||||| || ||||| ||| |  | ||| || | |  || ||| | |||||
Sbjct  503828  GAAAGCTGGAGTAAAATTCAAACCCCAGTTCCACATCTCCAATGTATGCCACACTTACCC  503769

Query  180     TGCCGT  185
               ||||||
Sbjct  503768  TGCCGT  503763

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 56/78 (72%), Gaps = 1/78 (1%)
 Strand=Plus/Minus

Query  259     CTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATG-TA  317
               || || || ||||| ||||  ||  | |  |||   || ||||| ||||  || ||| ||
Sbjct  503689  CTTGGGTCGCAGATTTACGGACGTGCTGGTTGGCACAACGACGTATGGGTAATTATGGTA  503630

Query  318     CGCCTGGTATTTCCCGAA  335
               || |||||||||||| ||
Sbjct  503629  CGTCTGGTATTTCCCCAA  503612

>PHKE:scaffold_562 scf_22126_562.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_562.1:1:18673:1 
REF
Length=18673

 Score = 65.3 bits (71),  Expect = 4e-08
 Identities = 112/165 (68%), Gaps = 21/165 (13%)
 Strand=Plus/Plus

Query  261   CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGC  320
             |||||| ||  | ||||  ||||| |  |||   |  || |||||||||||||||||| |
Sbjct  3608  CGGCTCGCAAGTTTACGGCCGCTCGGTATGGTACAGCGATGTGTGGGCCATCATGTACTC  3667

Query  321   CTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCACCCGTCTTTTCGG  380
              ||||| ||||||||        || |  ||| || |          | ||||   | ||
Sbjct  3668  GTGGTACTTCCCGAA--------GGACTCTCCGTCGT----------CGCGTC---TAGG  3706

Query  381   ACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
             |||||| ||| |||||||| ||||  | |||||||| ||||||||
Sbjct  3707  ACACCGCCATGACTGGGAGCACGTTGTGGTGTGGATTGACAACCC  3751

>PYIR:scaffold_4 pir_scaffold_4 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_4:1:128628:1 
REF
Length=128628

 Score = 64.4 bits (70),  Expect = 4e-08
 Identities = 180/274 (66%), Gaps = 2/274 (1%)
 Strand=Plus/Plus

Query  63     CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
              |||||  ||||||   ||   ||| ||| ||||||||| ||| |||||  |     | ||
Sbjct  32552  CATCGCTCACGACGCCGTCGTGCCGTTCGCGCAGCCAACGCCTGTCACGCTTGAGCAGAA  32611

Query  123    GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
              ||  ||  | ||||| || || ||| || | ||| |  |||| || ||||||||||| ||
Sbjct  32612  GGTGGCGCTCAAGTTCAAGCCGCAGATTCACATCTCGAACGGATGCCACCCGTACCCAGC  32671

Query  183    CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
               ||| |    |  ||   ||  | |||||||||||||   || ||| | |||  || || 
Sbjct  32672  GGTTGACGCCGCCGGTAACACCAGCGGAGGTCTCAAGCCAAGCGGATCCCAGAGCGCCGG  32731

Query  243    ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGT-GAATGACG  301
               ||||  || ||       ||  | ||| ||||||  ||| |||| ||  |  || || |
Sbjct  32732  TTGCAAGGGTTCTGGTTGGGGAACCCAGGTCTACGGACGCGCCGC-TGCCTACAAGGATG  32790

Query  302    TGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
              | |  ||  |||||||| | ||||| ||||||||
Sbjct  32791  TCTACGCGCTCATGTACTCATGGTACTTCCCGAA  32824

 Score = 61.7 bits (67),  Expect = 5e-07
 Identities = 192/297 (65%), Gaps = 23/297 (8%)
 Strand=Plus/Plus

Query  133    AAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAG  192
              ||||| || || ||| | || ||| |  |||| ||   ||||||||| || ||  |    
Sbjct  35631  AAGTTCAAGCCGCAGATCAACATCTCAAACGGCTGCAGCCCGTACCCAGCGGTGGACTCC  35690

Query  193    GATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGGC  252
              | ||||  ||  | |||||| |||||   ||||||| | |||  ||  |  ||||  |||
Sbjct  35691  GCTGGCAACACGAGCGGAGGCCTCAAACCGAGTGGATCCCAGAGCGCTGGCTGCAAGGGC  35750

Query  253    TCGAAGCTCGGCT-CTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCAT  311
              ||   ||| ||   | ||| | |||| |||| | ||   |   || ||||  |  | |||
Sbjct  35751  TCCG-GCTGGGGAACCCAGGTGTACGGTCGCGCGGCTCAGTACAAGGACGCCTATGGCAT  35809

Query  312    CATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCACCCG  371
              ||||||| | ||||| |||||||| | |  |               || ||   |||| |
Sbjct  35810  CATGTACTCGTGGTACTTCCCGAAGGACTCA---------------CCACT---CACCGG  35851

Query  372    TCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAA  428
               ||   ||| ||||| ||  |||||||| ||||| | ||||||||||||||||| ||
Sbjct  35852  ACT---CGGCCACCGCCACGACTGGGAGCACGTCGTGGTGTGGATCGACAACCCGAA  35905

 Score = 44.6 bits (48),  Expect = 0.036
 Identities = 39/49 (80%), Gaps = 0/49 (0%)
 Strand=Plus/Minus

Query  377    TCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
              |||| || |||||  | |||||| ||||  | || ||||||||||||||
Sbjct  30369  TCGGTCATCGTCACGATTGGGAGCACGTTGTCGTCTGGATCGACAACCC  30321

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 42/56 (75%), Gaps = 0/56 (0%)
 Strand=Plus/Minus

Query  130    GTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGT  185
              || ||||| || || ||| |  | ||| |  |||| || |||||||||||||| ||
Sbjct  30595  GTGAAGTTCAAGCCGCAGATCCACATCTCGAACGGCTGCCACCCGTACCCTGCAGT  30540

>PHKE:scaffold_1562 scf_22126_1562.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_1562.1:1:1478:1 
REF
Length=1478

 Score = 64.4 bits (70),  Expect = 4e-08
 Identities = 180/276 (65%), Gaps = 3/276 (1%)
 Strand=Plus/Plus

Query  63    CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
             ||||| ||||||| |||| | ||||||  | |||||| | || || || ||  |||| ||
Sbjct  1129  CATCGACCACGACAAGGTCCAGCCATTTGCCCAGCCAGAACCTGTTACTGTTGCCGAGAA  1188

Query  123   GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
             ||| || || ||||| || ||   | | | |||||     || |||  | ||||||||||
Sbjct  1189  GGCTGCTGTCAAGTTCAAGCCGACGTTCATAATCGAAAGTGGTTGTGCCTCGTACCCTGC  1248

Query  183   CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
              ||  |    |  ||    || ||||| ||  | ||| ||| ||||         |||  
Sbjct  1249  TGTAAATGCCGCAGGTGAAATCACCGGTGGATTGAAGGGGACTGGATTTACATCGGGC--  1306

Query  243   ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
              || | ||  |||    | || || ||  | ||||  || || |  |||   || || ||
Sbjct  1307  -TGTAAAGTTTCGCTCATGGGTTCACAAGTGTACGGCCGATCTGTTTGGTACAACGATGT  1365

Query  303   GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
              ||||||||||||||||| ||||| |||||||| ||
Sbjct  1366  TTGGGCCATCATGTACGCATGGTACTTCCCGAAGGG  1401

 Score = 44.6 bits (48),  Expect = 0.036
 Identities = 30/34 (88%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  392   ACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
             ||||||   |||||||||||||||||||||| ||
Sbjct  1434  ACTGGGCAAACGTCATTGTGTGGATCGACAATCC  1467

>PHCA:scaffold_46 PHYCAscaffold_46
Length=525601

 Score = 64.4 bits (70),  Expect = 4e-08
 Identities = 239/367 (65%), Gaps = 31/367 (8%)
 Strand=Plus/Plus

Query  64      ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCA-AAGCC-CGTCACCGTCTCCGACA  121
               ||||  ||| |||||||    || ||| | || ||  ||||| ||  ||  ||||| | |
Sbjct  434630  ATCGATCACAACCAGGTCGTTCCCTTCGCTCAACCGGAAGCCACG--ACGATCTCCCAGA  434687

Query  122     AGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTG  181
               |||| ||  | ||||| || || ||  |  | ||| || | || |||||||| ||||| |
Sbjct  434688  AGGCTGCGATCAAGTTCAAGCCCCAAATCCACATCACCAATGGATGTCACCCCTACCCAG  434747

Query  182     CCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGC--AGGACGG  239
               ||||  |  | |  ||    |  | ||| || || |||   |||||  | |  || |   
Sbjct  434748  CCGTGAACGAAGCCGGAGAGACCAGCGGTGGACTGAAGACTAGTGGGGCTCCAAGTAGCT  434807

Query  240     CGAATGCACAGGCTCGAAGCTCGGC-TCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
               ||  || | ||||||   ||| ||  || ||  ||||||  || ||| | |||   ||||
Sbjct  434808  CG--TGTAAAGGCTCTG-GCTGGGGGTCGCAAGTCTACGGACGTTCCACTTGGTACAATG  434864

Query  299     ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTC  358
                |   ||||||||||||||| | ||||||||||| || | |          || | ||||
Sbjct  434865  GCAAATGGGCCATCATGTACTCGTGGTATTTCCCCAAGGAC----------TCGC-CTTC  434913

Query  359     CTCTTATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCG  418
                       ||  |||||   |||||||||||  |||||||| ||||| | |||||||| |
Sbjct  434914  A-------ACGGGTCTT---GGACACCGTCACGACTGGGAGCACGTCGTGGTGTGGATTG  434963

Query  419     ACAACCC  425
               |||||||
Sbjct  434964  ACAACCC  434970

>PHRA:scaffold_67
Length=286994

 Score = 63.5 bits (69),  Expect = 1e-07
 Identities = 60/77 (78%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               ||||| ||| ||||||  ||  | |  |||   || ||||| ||||||||||||||||||
Sbjct  114026  GGCTCGCAGGTCTACGGCCGTGCTGAATGGTACAACGACGTCTGGGCCATCATGTACGCC  114085

Query  322     TGGTATTTCCCGAAAGG  338
               ||||| ||||| || ||
Sbjct  114086  TGGTACTTCCCCAAGGG  114102

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 40/44 (91%), Gaps = 0/44 (0%)
 Strand=Plus/Minus

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               || ||||| ||||||||||||||||||||||| ||||| |||||
Sbjct  265284  AACGACGTCTGGGCCATCATGTACGCCTGGTACTTCCCCAAAGG  265241

>PHPA:scaffold_24 NW_008649010.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.24, whole genome shotgun 
sequence
Length=888348

 Score = 63.5 bits (69),  Expect = 1e-07
 Identities = 60/77 (78%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               || || ||| |||| | |||  | | ||||   || || || ||||||||||||||||| 
Sbjct  767130  GGGTCCCAGGTCTATGGTCGAGCTGGGTGGTATAAGGATGTATGGGCCATCATGTACGCT  767189

Query  322     TGGTATTTCCCGAAAGG  338
               ||||| |||||||||||
Sbjct  767190  TGGTACTTCCCGAAAGG  767206

 Score = 59.0 bits (64),  Expect = 2e-06
 Identities = 53/67 (79%), Gaps = 0/67 (0%)
 Strand=Plus/Plus

Query  272     TCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCC  331
               |||| | |||  | | ||||   || || || ||||||||||||||||| ||||| ||||
Sbjct  778183  TCTATGGTCGAGCTGGGTGGTATAAGGATGTATGGGCCATCATGTACGCTTGGTACTTCC  778242

Query  332     CGAAAGG  338
               |||||||
Sbjct  778243  CGAAAGG  778249

 Score = 54.5 bits (59),  Expect = 7e-05
 Identities = 34/37 (92%), Gaps = 0/37 (0%)
 Strand=Plus/Minus

Query  302     TGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
               ||||||||||||||||||| ||||| ||||| |||||
Sbjct  582384  TGTGGGCCATCATGTACGCTTGGTACTTCCCAAAAGG  582348

 Score = 42.8 bits (46),  Expect = 0.13
 Identities = 32/38 (84%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  388     CATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               ||| ||||| ||  |||| |||||||||||||||| ||
Sbjct  778278  CATGACTGGAAGAGCGTCGTTGTGTGGATCGACAATCC  778315

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 32/39 (82%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  388     CATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCC  426
               ||| ||||| ||   ||| |||||||||||||||| |||
Sbjct  767235  CATGACTGGAAGAGTGTCGTTGTGTGGATCGACAATCCC  767273

>PHKE:scaffold_211 scf_22126_211.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_211.1_contig_1:1:59949:1 
REF
Length=59949

 Score = 63.5 bits (69),  Expect = 1e-07
 Identities = 181/275 (66%), Gaps = 19/275 (7%)
 Strand=Plus/Minus

Query  67     GGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCA  126
              ||||||||| || |   ||| ||  |  |||   | ||| ||||  ||||||| || |  
Sbjct  11914  GGCCACGACGAGTTGAAGCCCTTTGCTTAGCTGGAACCCATCACGATCTCCGAAAAAGTT  11855

Query  127    GCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTT  186
              || || ||||| ||||| ||| || | ||| || | ||||  |||||||| ||||| || 
Sbjct  11854  GCCGTTAAGTTCAAACCCCAGATTCATATCACCAATGGGTACCACCCGTATCCTGCTGT-  11796

Query  187    CAGAAGGAT---GGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAA  243
                ||| |||   ||    |  | ||| || |||||         ||| |||  |    ||
Sbjct  11795  --GAACGATATCGGACAGACAAGCGGCGGACTCAA---------ACCCCAGCTCAA--AA  11749

Query  244    TGCACAGGCTCGAAGCTCGGC-TCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
              ||||  |||||   ||| ||  || ||  ||||||  |||||  | |||   | ||  ||
Sbjct  11748  TGCAAGGGCTCTG-GCTGGGGATCACAAGTCTACGGCCGCTCGACATGGTACAGTGGTGT  11690

Query  303    GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
              |||||||||||||||  | ||||| || |||||||
Sbjct  11689  GTGGGCCATCATGTATTCGTGGTACTTTCCGAAAG  11655

>PHSO:scaffold_8
Length=3549547

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 184/280 (66%), Gaps = 13/280 (5%)
 Strand=Plus/Plus

Query  61       GTCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGAC  120
                ||||||| | ||||||||||   ||| |||||  |||    ||||   ||  ||||||| 
Sbjct  3215978  GTCATCGACTACGACCAGGTGGAGCCTTTCCCCGAGCTGGGGCCCAAAACGATCTCCGAG  3216037

Query  121      AAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCT  180
                ||||| ||  | ||||| ||||||   ||    |||   ||||| |||||||| ||| ||
Sbjct  3216038  AAGGCCGCTATCAAGTTCAAACCAACTCTGTTCATCAAGGACGGATGTCACCCTTACGCT  3216097

Query  181      GCCGTTCAGAAGGATGGCTC---CATTACCGGAGGTCTCAAGTGGAGTGGACCGCAG--G  235
                || ||   ||| | || |     ||  | |||||| ||    ||||   ||  ||    |
Sbjct  3216098  GCAGT---GAACGCTGCCGGTGACACGAGCGGAGG-CT----TGGACCCGAAGGCGTCCG  3216149

Query  236      ACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGA  295
                |||  |||||||  || |||| | | || || ||  | |||   |||||  |||||    
Sbjct  3216150  ACGATGAATGCAAGGGGTCGACGTTGGGTTCGCAAGTTTACAGCCGCTCTACGTGGTACC  3216209

Query  296      ATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                   ||   ||||||| ||||||||||||||| ||||| ||
Sbjct  3216210  GCAACACCTGGGCCACCATGTACGCCTGGTACTTCCCCAA  3216249

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 37/43 (86%), Gaps = 0/43 (0%)
 Strand=Plus/Plus

Query  298      GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                ||||| ||||||||||||||||| ||||| ||||| | || ||
Sbjct  3245040  GACGTTTGGGCCATCATGTACGCTTGGTACTTCCCCAGAGACA  3245082

 Score = 43.7 bits (47),  Expect = 0.13
 Identities = 28/31 (90%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  305      GGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                |||||| ||||||||||||||| ||||| ||
Sbjct  3217598  GGGCCACCATGTACGCCTGGTACTTCCCCAA  3217628

>PHRA:scaffold_159
Length=54555

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 37/39 (95%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  299    ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
              || ||||||||||||||||||| ||||||||||||||||
Sbjct  36260  ACCTGTGGGCCATCATGTACGCGTGGTATTTCCCGAAAG  36298

>PHKE:scaffold_1552 scf_22126_1552.1_contig_1 dna:supercontig 
supercontig:PhyKer238_432v1:scf_22126_1552.1_contig_1:1:1491:1 
REF
Length=1491

 Score = 62.6 bits (68),  Expect = 1e-07
 Identities = 183/277 (66%), Gaps = 9/277 (3%)
 Strand=Plus/Minus

Query  63   CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
            ||||| ||||||| |||| |   | || || |||||  | || ||||| | |||||| ||
Sbjct  970  CATCGACCACGACAAGGTGCAATCGTTTCCTCAGCCTGAACCTGTCACTGACTCCGAAAA  911

Query  123  GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
            ||| || || ||||| |||||||| || |  ||   |   || |||   || ||||||||
Sbjct  910  GGCTGCCGTCAAGTTCAAACCACAACTCACCATTCACATTGGTTGTGCTCCCTACCCTGC  851

Query  183  CGTTCA-GAAGGATGGCT--CCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGG  239
             ||  | | ||   ||    ||| |   |||||  | ||| ||| |  |  ||   || |
Sbjct  850  TGTAAACGCAGCCGGGGAGACCAGT---GGAGGGTTGAAGGGGACTAAAG-GCGCTACTG  795

Query  240  CGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGA  299
               ||| | || |||     | || || ||||| ||||  ||  | ||||||   || ||
Sbjct  794  G--ATGTAAAGTCTCTCTTTTGGGTTCGCAGATATACGGGCGAGCTGCGTGGCACAACGA  737

Query  300  CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAA  336
            | | |||||||||||||| |||||||| || || |||
Sbjct  736  CATTTGGGCCATCATGTATGCCTGGTACTTTCCAAAA  700

>PHIF:NW_003303745.1 Phytophthora infestans T30-4 supercont1.14 
genomic scaffold, whole genome shotgun sequence
Length=3113719

 Score = 61.7 bits (67),  Expect = 5e-07
 Identities = 59/76 (78%), Gaps = 0/76 (0%)
 Strand=Plus/Plus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               || |||||  |||||| |||  | | ||||   || ||  ||||||||||||||||||| 
Sbjct  127994  GGATCTCAAGTCTACGGTCGAGCTGGGTGGTACAAAGATCTGTGGGCCATCATGTACGCT  128053

Query  322     TGGTATTTCCCGAAAG  337
               ||||| ||||| ||||
Sbjct  128054  TGGTACTTCCCAAAAG  128069

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 37/45 (82%), Gaps = 0/45 (0%)
 Strand=Plus/Plus

Query  381     ACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               |||||||||| ||||| |    ||| |||||||||||||||| ||
Sbjct  126511  ACACCGTCATGACTGGAAAAGTGTCGTTGTGTGGATCGACAATCC  126555

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  14       TCGTCCTCCTCGTCCTCGTC  33
                ||||||||||||||||||||
Sbjct  1647480  TCGTCCTCCTCGTCCTCGTC  1647499

>PHIF:NW_003303722.1 Phytophthora infestans T30-4 supercont1.37 
genomic scaffold, whole genome shotgun sequence
Length=1588622

 Score = 61.7 bits (67),  Expect = 5e-07
 Identities = 59/76 (78%), Gaps = 0/76 (0%)
 Strand=Plus/Plus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               || |||||  |||||| |||  | | ||||   || ||  ||||||||||||||||||| 
Sbjct  772402  GGATCTCAAGTCTACGGTCGAGCTGGGTGGTACAAAGATCTGTGGGCCATCATGTACGCT  772461

Query  322     TGGTATTTCCCGAAAG  337
               ||||| ||||| ||||
Sbjct  772462  TGGTACTTCCCAAAAG  772477

 Score = 59.0 bits (64),  Expect = 2e-06
 Identities = 59/77 (77%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               |||||||| ||||||  |||  | | |||    || ||  | ||||||||||||||||| 
Sbjct  893833  GGCTCTCAAATCTACAGTCGAGCTGGGTGATATAAGGATATATGGGCCATCATGTACGCT  893892

Query  322     TGGTATTTCCCGAAAGG  338
               |||||||| || |||||
Sbjct  893893  TGGTATTTTCCTAAAGG  893909

 Score = 57.2 bits (62),  Expect = 6e-06
 Identities = 58/76 (76%), Gaps = 0/76 (0%)
 Strand=Plus/Plus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               || |||||| |||||| |||  | | ||||   || ||    ||||||||||||||||| 
Sbjct  770834  GGGTCTCAGGTCTACGGTCGAGCGGGGTGGCACAAGGATCGATGGGCCATCATGTACGCT  770893

Query  322     TGGTATTTCCCGAAAG  337
               ||||| ||||| ||||
Sbjct  770894  TGGTACTTCCCAAAAG  770909

 Score = 53.6 bits (58),  Expect = 7e-05
 Identities = 56/74 (76%), Gaps = 0/74 (0%)
 Strand=Plus/Minus

Query  266      CTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGT  325
                ||||| |||||| |||  |    |||   || |||   ||||| ||||||||||| ||||
Sbjct  1368617  CTCAGGTCTACGGTCGAGCTCGATGGTACAAGGACCAATGGGCTATCATGTACGCTTGGT  1368558

Query  326      ATTTCCCGAAAGGC  339
                ||||||||||| ||
Sbjct  1368557  ATTTCCCGAAAAGC  1368544

 Score = 53.6 bits (58),  Expect = 7e-05
 Identities = 56/74 (76%), Gaps = 0/74 (0%)
 Strand=Plus/Minus

Query  266      CTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGT  325
                ||||| |||||| |||  |    |||   || |||   ||||| ||||||||||| ||||
Sbjct  1380606  CTCAGGTCTACGGTCGAGCTCGATGGTACAAGGACCAATGGGCTATCATGTACGCTTGGT  1380547

Query  326      ATTTCCCGAAAGGC  339
                ||||||||||| ||
Sbjct  1380546  ATTTCCCGAAAAGC  1380533

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 37/45 (82%), Gaps = 0/45 (0%)
 Strand=Plus/Plus

Query  381     ACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               |||||||||| ||||| |    ||| |||||||||||||||| ||
Sbjct  770932  ACACCGTCATGACTGGAAAAGTGTCGTTGTGTGGATCGACAATCC  770976

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 37/45 (82%), Gaps = 0/45 (0%)
 Strand=Plus/Plus

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
                || || |||||||| ||||||||||| ||||| || || || |||
Sbjct  1268648  AAGGATGTGTGGGCGATCATGTACGCTTGGTACTTTCCAAAGGGC  1268692

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 61/87 (70%), Gaps = 1/87 (1%)
 Strand=Plus/Minus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                ||||  |||||| | |||  |||  | || || ||   ||| |||||  ||||| | || 
Sbjct  1368820  ATCGATCACGACAAAGTTGAGCCCATTCCTCAACCTGCGCCGGTCACTATCTCCAAAAAA  1368761

Query  124      GCAG-CAGTAAAGTTTAAACCACAGCT  149
                || | |  | |||||||||||||| ||
Sbjct  1368760  GCCGGCCATCAAGTTTAAACCACAACT  1368734

>PHKE:scaffold_364 scf_22126_364.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_364.1:1:35790:1 
REF
Length=35790

 Score = 60.8 bits (66),  Expect = 5e-07
 Identities = 179/274 (65%), Gaps = 3/274 (1%)
 Strand=Plus/Plus

Query  63    CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
             |||||  || ||| |||| | ||| || || |||||  | ||  |||| | |||||| ||
Sbjct  1177  CATCGATCATGACAAGGTGCAGCCGTTTCCTCAGCCTGAACCTATCACTGACTCCGAAAA  1236

Query  123   GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
             ||| || || || || |||||||| ||    || | ||  || |||   || ||||||||
Sbjct  1237  GGCTGCCGTCAAATTCAAACCACAACTCTGCATTGACGTTGGTTGTGCTCCCTACCCTGC  1296

Query  183   CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGA  242
              ||  |    | |||    |  |  |||||  | ||| ||| | ||  |||   | |   
Sbjct  1297  TGTAAACGCAGCTGGGGAGACCAGTGGAGGGTTGAAGGGGACTAGAG-GCACTTCTGG--  1353

Query  243   ATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGT  302
             ||| | || |||     | || || ||||| ||||   |  | ||||||   || ||| |
Sbjct  1354  ATGTAAAGTCTCTTTTTTGGGTTCGCAGATATACGGGTGAGCTGCGTGGTATAACGACAT  1413

Query  303   GTGGGCCATCATGTACGCCTGGTATTTCCCGAAA  336
              |||||||||||||| |||||||| || || |||
Sbjct  1414  TTGGGCCATCATGTATGCCTGGTACTTTCCAAAA  1447

>HYAP:scaffold_149 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_149:1:161935:1 
REF
Length=161935

 Score = 60.8 bits (66),  Expect = 5e-07
 Identities = 71/95 (75%), Gaps = 1/95 (1%)
 Strand=Plus/Plus

Query  375    TTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGG-ATCGACAACCCCAAGAGCA  433
              ||| || ||||||||| |||||||| | ||||| || ||| |||||||||||  |     
Sbjct  89260  TTTAGGCCACCGTCATGACTGGGAGCATGTCATCGTTTGGGATCGACAACCCTGAACTGG  89319

Query  434    AAAACTCGACCATTCTTGGCGTATCGATGTCGGCT  468
              ||||| |||  | ||| |  || |||| |||||||
Sbjct  89320  AAAACCCGAAGACTCTGGCAGTGTCGACGTCGGCT  89354

>PHCA:scaffold_53 PHYCAscaffold_53
Length=465517

 Score = 59.9 bits (65),  Expect = 2e-06
 Identities = 177/269 (66%), Gaps = 7/269 (3%)
 Strand=Plus/Minus

Query  69      CCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGC  128
               ||| ||||| ||   ||| ||||  |||||  ||||||||||| | || || || |||||
Sbjct  388992  CCATGACCAAGTGAAGCCTTTCCGACAGCCGGAGCCCGTCACCATATCTGAGAAAGCAGC  388933

Query  129     AGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCA  188
               ||| || |  || ||||  || |  || |  || || |||    ||| ||| || ||  |
Sbjct  388932  AGTCAAATACAAGCCACTACTGAGCATTGGGGATGGATGTGTTTCGTTCCCAGCGGTAAA  388873

Query  189     GAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCAC  248
                |  | |||    || ||||| ||||||||  ||| |  |   || || |  || |||||
Sbjct  388872  TACAGCTGGAGAAATCACCGGGGGTCTCAAAGGGACT-AAAAACACGAAG--GACTGCAC  388816

Query  249     --AGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGG  306
                 | ||||    ||||| |||||  | ||||   | || ||||||    | ||   ||||
Sbjct  388815  GGAAGCTC--CTCTCGGGTCTCAAGTGTACGGCAGATCGGCGTGGTACCAAGATAAGTGG  388758

Query  307     GCCATCATGTACGCCTGGTATTTCCCGAA  335
               || || |||||  ||||||| ||||| ||
Sbjct  388757  GCGATGATGTATACCTGGTACTTCCCTAA  388729

 Score = 57.2 bits (62),  Expect = 6e-06
 Identities = 55/71 (77%), Gaps = 0/71 (0%)
 Strand=Plus/Minus

Query  85      CCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCA  144
               || ||| | |||||  ||||||||||| | || || || |||||||| ||||  ||||||
Sbjct  386962  CCTTTCGCCCAGCCGGAGCCCGTCACCATATCTGAGAAAGCAGCAGTCAAGTACAAACCA  386903

Query  145     CAGCTTAAAAT  155
               || || || ||
Sbjct  386902  CAACTGAACAT  386892

 Score = 53.6 bits (58),  Expect = 7e-05
 Identities = 92/134 (69%), Gaps = 0/134 (0%)
 Strand=Plus/Minus

Query  85      CCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCA  144
               || ||||| |||||  ||||||||||| | || || || |||||||| ||||  || |||
Sbjct  408898  CCTTTCCCACAGCCTGAGCCCGTCACCATATCTGAGAAAGCAGCAGTCAAGTACAAGCCA  408839

Query  145     CAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATT  204
               |  || |  || |   | ||||||    ||| ||| || ||  |    | |||    || 
Sbjct  408838  CTACTGAGCATTGGGAATGGGTGTGTTTCGTTCCCAGCGGTGAATGCAGCTGGAGAAATC  408779

Query  205     ACCGGAGGTCTCAA  218
               ||||||||||||||
Sbjct  408778  ACCGGAGGTCTCAA  408765

>PHCA:scaffold_27 PHYCAscaffold_27
Length=705730

 Score = 59.9 bits (65),  Expect = 2e-06
 Identities = 49/60 (82%), Gaps = 0/60 (0%)
 Strand=Plus/Plus

Query  274     TACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCG  333
               ||||  |||||  | |||   || || |||||||||||||||||||| ||||||||||||
Sbjct  137590  TACGTGCGCTCGACATGGTATAAAGATGTGTGGGCCATCATGTACGCTTGGTATTTCCCG  137649

>PHSO:scaffold_21
Length=320622

 Score = 58.1 bits (63),  Expect = 6e-06
 Identities = 60/79 (76%), Gaps = 0/79 (0%)
 Strand=Plus/Plus

Query  260     TCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACG  319
               |||| || ||| | ||||  ||| | ||||||   || ||  |||  |||||| ||||||
Sbjct  276014  TCGGGTCCCAGGTTTACGGGCGCGCGGCGTGGCACAACGATCTGTACGCCATCGTGTACG  276073

Query  320     CCTGGTATTTCCCGAAAGG  338
               ||||||| ||||| |||||
Sbjct  276074  CCTGGTACTTCCCAAAAGG  276092

 Score = 58.1 bits (63),  Expect = 6e-06
 Identities = 60/79 (76%), Gaps = 0/79 (0%)
 Strand=Plus/Minus

Query  260     TCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACG  319
               |||| || ||| | ||||  ||| | ||||||   || ||  |||  |||||| ||||||
Sbjct  294366  TCGGGTCCCAGGTTTACGGGCGCGCGGCGTGGCACAACGATCTGTACGCCATCGTGTACG  294307

Query  320     CCTGGTATTTCCCGAAAGG  338
               ||||||| ||||| |||||
Sbjct  294306  CCTGGTACTTCCCAAAAGG  294288

>PHIF:NW_003303698.1 Phytophthora infestans T30-4 supercont1.61 
genomic scaffold, whole genome shotgun sequence
Length=734189

 Score = 58.1 bits (63),  Expect = 6e-06
 Identities = 60/79 (76%), Gaps = 0/79 (0%)
 Strand=Plus/Minus

Query  259     CTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTAC  318
               |||||||| ||  |||| |  ||  |  |||||   || | ||| |||||||||||||||
Sbjct  216202  CTCGGCTCGCAAGTCTATGGACGTGCTACGTGGTACAAGGGCGTCTGGGCCATCATGTAC  216143

Query  319     GCCTGGTATTTCCCGAAAG  337
               |||||||| | ||| ||||
Sbjct  216142  GCCTGGTACTACCCTAAAG  216124

>PHCA:scaffold_17 PHYCAscaffold_17
Length=985188

 Score = 58.1 bits (63),  Expect = 6e-06
 Identities = 33/34 (97%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  302     TGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
               ||||||||||||||||||||||||| ||||||||
Sbjct  206021  TGTGGGCCATCATGTACGCCTGGTACTTCCCGAA  206054

>PHPA:scaffold_324 NW_008649310.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.324, whole genome 
shotgun sequence
Length=8854

 Score = 57.2 bits (62),  Expect = 6e-06
 Identities = 34/36 (94%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  304   TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
             ||||||||||||||||||||||| |||||||| |||
Sbjct  7782  TGGGCCATCATGTACGCCTGGTACTTCCCGAAGGGC  7817

>PHIF:NW_003305543.1 Phytophthora infestans T30-4 supercont1.3127 
genomic scaffold, whole genome shotgun sequence
Length=2643

 Score = 57.2 bits (62),  Expect = 6e-06
 Identities = 58/76 (76%), Gaps = 0/76 (0%)
 Strand=Plus/Minus

Query  262   GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
             || |||||| |||||| |||  | | ||||   || ||    ||||||||||||||||| 
Sbjct  1405  GGGTCTCAGGTCTACGGTCGAGCGGGGTGGCACAAGGATCGATGGGCCATCATGTACGCT  1346

Query  322   TGGTATTTCCCGAAAG  337
             ||||| ||||| ||||
Sbjct  1345  TGGTACTTCCCAAAAG  1330

>PHCA:scaffold_547 PHYCAscaffold_547
Length=3140

 Score = 57.2 bits (62),  Expect = 6e-06
 Identities = 183/278 (66%), Gaps = 11/278 (4%)
 Strand=Plus/Minus

Query  62    TCATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACA  121
             |||| | ||||||| | || | ||||||| | || ||    || |||||| ||||||| |
Sbjct  1146  TCATTGACCACGACAAAGTACAGCCATTCGCCCAACCCGTTCCAGTCACCATCTCCGAGA  1087

Query  122   AGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTG  181
             |||||||||  ||||  || || || ||  | ||   || | | |||    | |  ||||
Sbjct  1086  AGGCAGCAGACAAGTACAAGCCGCAACTGGAGATTTACGGCAGCTGTGTTTCATTTCCTG  1027

Query  182   CCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGG-ACGG-  239
             ||||  |    | |||   ||| || || || || ||    || |  ||| ||| |||| 
Sbjct  1026  CCGTGAATGCTGCTGGAGACATCACTGGGGGGCTAAA----AG-GTTCCGAAGGGACGGA  972

Query  240   CGAATGCAC--AGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAAT  297
             ||  |||||  | || |    || || || ||  ||||||  || || || |||    | 
Sbjct  971   CGGGTGCACTAAAGCACCT--CTGGGGTCCCAAGTCTACGGCCGATCGGCCTGGTACCAA  914

Query  298   GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
             |||  |||||| || |||| ||| ||||||||||||||
Sbjct  913   GACAAGTGGGCTATGATGTTCGCGTGGTATTTCCCGAA  876

>PHCA:scaffold_37 PHYCAscaffold_37
Length=577888

 Score = 57.2 bits (62),  Expect = 6e-06
 Identities = 85/123 (69%), Gaps = 21/123 (17%)
 Strand=Plus/Plus

Query  304     TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTT  363
               ||||||||||||||| | ||||||||||| || |                ||| ||||| 
Sbjct  141103  TGGGCCATCATGTACTCTTGGTATTTCCCCAAGGAT--------------TCTCCCTCT-  141147

Query  364     ATCACCCGTCTTTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAAC  423
                  ||  ||||    || || || ||  |||||||| ||||||| |||||||||||||||
Sbjct  141148  ---ACGGGTCTG---GGTCATCGCCACGACTGGGAGCACGTCATCGTGTGGATCGACAAC  141201

Query  424     CCC  426
               |||
Sbjct  141202  CCC  141204

>PHPA:scaffold_42 NW_008649028.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.42, whole genome shotgun 
sequence
Length=594358

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 35/38 (92%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  303     GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
               |||||||||||||||||| ||||||||||| |||| ||
Sbjct  376873  GTGGGCCATCATGTACGCGTGGTATTTCCCTAAAGACA  376910

>PHPA:scaffold_22 NW_008649008.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.22, whole genome shotgun 
sequence
Length=998868

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 35/38 (92%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  302     TGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
               ||||||||||||||||| | ||||| ||||||||||||
Sbjct  508408  TGTGGGCCATCATGTACACTTGGTACTTCCCGAAAGGC  508445

>PHIF:NW_003303150.1 Phytophthora infestans T30-4 supercont1.629 
genomic scaffold, whole genome shotgun sequence
Length=20827

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 76/105 (72%), Gaps = 6/105 (6%)
 Strand=Plus/Plus

Query  235    GACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
              ||||| ||||| || |||||     | ||||| ||| | |||  ||| ||  | |   ||
Sbjct  12693  GACGGTGAATGTACGGGCTCTCCCTTAGGCTCGCAGGTGTACAGTCGATCGACTT---TG  12749

Query  295    AATGA---CGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAA  336
               ||||   |  |||||||||||||||||| ||||||||||| |||
Sbjct  12750  TATGAGAACAAGTGGGCCATCATGTACGCATGGTATTTCCCAAAA  12794

>PHCA:scaffold_77 PHYCAscaffold_77
Length=232015

 Score = 56.3 bits (61),  Expect = 2e-05
 Identities = 38/43 (88%), Gaps = 0/43 (0%)
 Strand=Plus/Plus

Query  295     AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
               || ||| ||||||||||||||||| ||||||| ||||||| ||
Sbjct  207457  AAGGACCTGTGGGCCATCATGTACTCCTGGTACTTCCCGATAG  207499

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  392     ACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
               ||||| || | ||| |||||||||||||||| ||
Sbjct  207527  ACTGGAAGAATGTCGTTGTGTGGATCGACAATCC  207560

>PHCA:scaffold_178 PHYCAscaffold_178
Length=18388

 Score = 55.4 bits (60),  Expect = 2e-05
 Identities = 170/259 (66%), Gaps = 17/259 (7%)
 Strand=Plus/Plus

Query  84     GCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACC  143
              ||||||| |||| ||| ||||  ||||||| ||||| ||||  || || | ||| |||||
Sbjct  9784   GCCATTCGCGCAACCAGAGCCTATCACCGTGTCCGATAAGGTCGCCGTCAGGTTCAAACC  9843

Query  144    ACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCAT  203
               |||||   |||    ||||| || || |||||||| |||||  |  | | |||    ||
Sbjct  9844   CCAGCTCCGAATTAAAGACGGATGCCATCCGTACCCGGCCGTCAATGAAGCTGGTGATAT  9903

Query  204    TACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAAT------GCACAGGCTCGAA  257
              || |     |||  ||  || |   | || ||  || || |      || | || ||  |
Sbjct  9904   TAGC-----TCTGGAGCTGATTC--CGGCTGG--GGTGATTCATCTTGCTCTGGTTCTGA  9954

Query  258    GCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGG-GTGAATGACGTGTGGGCCATCATGT  316
                | || || ||  |||||| ||| || || ||| |||  ||  || ||||  || ||||
Sbjct  9955   TGTTGGTTCCCAAGTCTACGGTCGTTCGGCTTGGTGTGG-TGGTGTTTGGGGAATGATGT  10013

Query  317    ACGCCTGGTATTTCCCGAA  335
              | || ||||||||||| ||
Sbjct  10014  ATGCATGGTATTTCCCCAA  10032

>PHRA:scaffold_214
Length=39087

 Score = 54.5 bits (59),  Expect = 7e-05
 Identities = 34/37 (92%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  301    GTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
              |||||||||||||||||| ||||||| ||||| ||||
Sbjct  35608  GTGTGGGCCATCATGTACTCCTGGTACTTCCCAAAAG  35644

>PHIF:NW_003303715.1 Phytophthora infestans T30-4 supercont1.44 
genomic scaffold, whole genome shotgun sequence
Length=1227050

 Score = 54.5 bits (59),  Expect = 7e-05
 Identities = 177/271 (65%), Gaps = 7/271 (3%)
 Strand=Plus/Plus

Query  70       CACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCA  129
                |||||  | || | ||| ||| | |||||  | || |||||| ||||||| ||||| || 
Sbjct  1054465  CACGATAAAGTGCAGCCTTTCGCTCAGCCCGACCCAGTCACCATCTCCGAAAAGGCTGCT  1054524

Query  130      GTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAG  189
                || ||||| || ||||| ||| | |||| |   || |||    | |  || |  ||  | 
Sbjct  1054525  GTCAAGTTCAAGCCACAACTTCACATCGACAGAGGTTGTGTTTCCTTTCCGGTTGTAAAT  1054584

Query  190      AAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGACCGCAGGA-CGG-CGAATGCA  247
                   | |||    ||  ||||||| |||||| |||    ||   |||| ||| ||  || |
Sbjct  1054585  GCTGCTGGTGAAATCTCCGGAGGACTCAAG-GGA----ACAAAAGGAACGGACGGGTGTA  1054639

Query  248      CAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGG  307
                  |  ||   ||| |||||||| |  ||   ||| || || |||    | |||  |||||
Sbjct  1054640  GGGAATCACCGCTAGGCTCTCAAACGTATAGTCGATCGGCATGGTACCAGGACAGGTGGG  1054699

Query  308      CCATCATGTACGCCTGGTATTTCCCGAAAGG  338
                ||||  |||  || ||||| |||||||||||
Sbjct  1054700  CCATTGTGTTTGCTTGGTACTTCCCGAAAGG  1054730

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 57/81 (70%), Gaps = 0/81 (0%)
 Strand=Plus/Minus

Query  259     CTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTAC  318
               || || ||||| || || | ||| || || |||    | |||   ||||||||  | |  
Sbjct  785167  CTGGGATCTCAAATATATGGTCGATCAGCATGGTATCAGGACAAATGGGCCATGCTTTTT  785108

Query  319     GCCTGGTATTTCCCGAAAGGC  339
               || ||||| ||||||||||||
Sbjct  785107  GCTTGGTACTTCCCGAAAGGC  785087

>PHRA:scaffold_66
Length=301783

 Score = 53.6 bits (58),  Expect = 7e-05
 Identities = 53/69 (77%), Gaps = 0/69 (0%)
 Strand=Plus/Plus

Query  264    CTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTG  323
              ||||||  |||||   || ||| ||| |   |  ||||| ||||||||||||||||| ||
Sbjct  63828  CTCTCAAGTCTACAGCCGATCCACGTTGTACAGGGACGTCTGGGCCATCATGTACGCTTG  63887

Query  324    GTATTTCCC  332
               ||||||||
Sbjct  63888  ATATTTCCC  63896

>PHKE:scaffold_495 scf_22126_495.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_495.1_contig_1:1:23437:1 
REF
Length=23437

 Score = 53.6 bits (58),  Expect = 7e-05
 Identities = 182/281 (65%), Gaps = 11/281 (4%)
 Strand=Plus/Plus

Query  63   CATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAA  122
            ||||| ||||||| |||| | ||||||  | |||||| | ||   ||||  ||| || ||
Sbjct  161  CATCGACCACGACAAGGTACAGCCATTTGCCCAGCCAGAACCGACCACCAACTCTGAAAA  220

Query  123  GGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGC  182
            ||| | | | || || ||||| || || || || |     || ||  |  | ||||||||
Sbjct  221  GGCTGGAATCAAATTCAAACCGCAACTCAACATTGTAAGAGGATGCGATTCATACCCTGC  280

Query  183  CGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAGTGGAC---CG-CAGGACG  238
             ||  |  | |  ||    || |||||||| || |   ||| ||||    || |||| | 
Sbjct  281  AGTGAACGACGCAGGAGAAATCACCGGAGGGCTTAGAGGGACTGGATATACGTCAGG-CT  339

Query  239  GCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATG  298
            | ||| |  |  | |      | ||||| ||  | ||||  ||  |  |||||   || |
Sbjct  340  GTGAAGGACCCCGTT------TAGGCTCACAAGTTTACGGCCGAGCTACGTGGCACAACG  393

Query  299  ACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
            |  | ||||| ||||||||||| ||||||||||| || |||
Sbjct  394  ATATCTGGGCGATCATGTACGCTTGGTATTTCCCCAAGGGC  434

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 36/41 (88%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  295    AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
              || ||||| |||||||||||| |||| ||||||||||| ||
Sbjct  20207  AACGACGTCTGGGCCATCATGCACGCTTGGTATTTCCCAAA  20247

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 33/37 (89%), Gaps = 0/37 (0%)
 Strand=Plus/Plus

Query  295    AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCC  331
              |||||| |||||||||||||||||  |||||| ||||
Sbjct  16407  AATGACATGTGGGCCATCATGTACATCTGGTACTTCC  16443

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 163/251 (65%), Gaps = 5/251 (2%)
 Strand=Plus/Plus

Query  89     TCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGC-AGCAGTAAAGTTTAAACCACAG  147
              |||| |||||| | || || ||||| || || ||||| ||| || || || ||||| |||
Sbjct  15210  TCCCTCAGCCAGAACCTGTGACCGTATCAGAGAAGGCCAGC-GTCAAATTCAAACCGCAG  15268

Query  148    CTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACC  207
              || | ||||    | || ||     | |||||||||||  |    || |||  ||  |  
Sbjct  15269  CTCACAATCAAGCAGGGATGCGCTTCATACCCTGCCGTGAATGTTGAGGGCAACACAAGT  15328

Query  208    GGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCT  267
              ||||| || |||   |  |||  ||||   |||   |||| | || |     | | ||| 
Sbjct  15329  GGAGGGCTGAAGCCAACCGGATGGCAGACAGGC---TGCAAAAGCCCTGTCTTGGACTCC  15385

Query  268    CAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTAT  327
              ||  | |||| |||  |  | |||   || ||  | ||||||||||||||||| ||| | 
Sbjct  15386  CAAGTTTACGGTCGAGCAACATGGCACAACGATATCTGGGCCATCATGTACGCTTGGCAC  15445

Query  328    TTCCCGAAAGG  338
              || ||||| ||
Sbjct  15446  TTTCCGAAGGG  15456

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  403    GTCATTGTGTGGATCGACAACCC  425
              ||| |||||||||||||||||||
Sbjct  15500  GTCGTTGTGTGGATCGACAACCC  15522

>PHKE:scaffold_1389 scf_22126_1389.1_contig_1 dna:supercontig 
supercontig:PhyKer238_432v1:scf_22126_1389.1_contig_1:1:1982:1 
REF
Length=1982

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 36/41 (88%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  298   GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGG  338
             ||||| |||||||||||||| |||||||| || || |||||
Sbjct  1617  GACGTTTGGGCCATCATGTATGCCTGGTACTTTCCAAAAGG  1657

>PHKE:scaffold_333 scf_22126_333.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_333.1:1:41401:1 
REF
Length=41401

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 54/71 (76%), Gaps = 0/71 (0%)
 Strand=Plus/Plus

Query  265    TCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGG  324
              || ||| | ||||  || || ||||||   || ||||||||||| || |||||| | |||
Sbjct  40536  TCACAGGTATACGGGCGTTCTGCGTGGCACAACGACGTGTGGGCTATTATGTACACATGG  40595

Query  325    TATTTCCCGAA  335
              || ||||| ||
Sbjct  40596  TACTTCCCCAA  40606

>PHIF:NW_003303513.1 Phytophthora infestans T30-4 supercont1.246 
genomic scaffold, whole genome shotgun sequence
Length=90049

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 33/36 (92%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  304    TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
              ||||| ||||||||||| ||||||||||||||| ||
Sbjct  55443  TGGGCTATCATGTACGCTTGGTATTTCCCGAAAAGC  55408

>HYAP:scaffold_53 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_53:1:399428:1 
REF
Length=399428

 Score = 52.7 bits (57),  Expect = 2e-04
 Identities = 117/176 (66%), Gaps = 0/176 (0%)
 Strand=Plus/Plus

Query  161    ACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGT  220
              |||| || || ||||||||||| ||  |  ||  |||    | ||  || ||||||||| 
Sbjct  86573  ACGGATGCCAACCGTACCCTGCAGTGAACGAGTTTGGTCAGACTAGTGGCGGTCTCAAGC  86632

Query  221    GGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTC  280
                |  |||   ||  | ||  | ||||  |||||   || ||| |||||  ||||||| |
Sbjct  86633  CTACCGGAGATCACAATGGTCATTGCAAGGGCTCTGGGCACGGGTCTCAAGTCTACGCGC  86692

Query  281    GCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAA  336
              | || || ||| |    |||   |||||||| |||| |||||  || ||||| |||
Sbjct  86693  GTTCAGCTTGGTTCGGGGACAAATGGGCCATTATGTTCGCCTATTACTTCCCAAAA  86748

>PHPA:scaffold_343 NW_008649329.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.343, whole genome 
shotgun sequence
Length=6988

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 52/68 (76%), Gaps = 0/68 (0%)
 Strand=Plus/Minus

Query  264   CTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTG  323
             ||||||| ||||||  ||  | |  |||   || || || ||||||||||||||||| ||
Sbjct  1506  CTCTCAGGTCTACGGCCGAGCTGGATGGCACAAGGATGTATGGGCCATCATGTACGCTTG  1447

Query  324   GTATTTCC  331
             ||| ||||
Sbjct  1446  GTACTTCC  1439

>PHPA:scaffold_1 NW_008634126.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.1, whole genome shotgun 
sequence
Length=4724858

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 34/38 (89%), Gaps = 0/38 (0%)
 Strand=Plus/Plus

Query  303      GTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                ||||||||||||||| || ||||||||||| |||| ||
Sbjct  1825275  GTGGGCCATCATGTATGCTTGGTATTTCCCTAAAGACA  1825312

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 38/45 (84%), Gaps = 0/45 (0%)
 Strand=Plus/Minus

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
                || ||||| |||||||||||||| |||||||| || || || |||
Sbjct  2078079  AACGACGTCTGGGCCATCATGTATGCCTGGTACTTTCCCAAGGGC  2078035

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 74/106 (70%), Gaps = 0/106 (0%)
 Strand=Plus/Minus

Query  235      GACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTG  294
                ||||| |||||   ||||||     | || || ||| | |||  ||| ||  |||||   
Sbjct  1864783  GACGGTGAATGTGAAGGCTCTCCCTTAGGGTCACAGGTGTACAGTCGATCTACGTGGTAC  1864724

Query  295      AATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                 | | |  |||||| |||||||| || ||||||||||| |||| ||
Sbjct  1864723  GAGGGCAAGTGGGCAATCATGTATGCTTGGTATTTCCCTAAAGACA  1864678

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 83/122 (68%), Gaps = 0/122 (0%)
 Strand=Plus/Plus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                |||| ||| ||| | || | ||||||| | || ||  | ||  |||| | | |||| || 
Sbjct  1825036  ATCGACCATGACAAAGTGCAGCCATTCGCACAACCCGAACCGATCACGGACGCCGAGAAA  1825095

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                || || || ||||| || ||    ||   | |    |  || ||||||||||||||||||
Sbjct  1825096  GCTGCCGTCAAGTTCAAGCCGTCACTCGCAGTAAAGGCTGGATGTCACCCGTACCCTGCC  1825155

Query  184      GT  185
                ||
Sbjct  1825156  GT  1825157

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 83/122 (68%), Gaps = 0/122 (0%)
 Strand=Plus/Minus

Query  64       ATCGGCCACGACCAGGTTCGGCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAG  123
                |||| ||| ||| |||| | ||||||| | |||||  | ||  |||| | | |||| || 
Sbjct  1864954  ATCGACCATGACAAGGTCCAGCCATTCGCACAGCCCGAACCGATCACGGACGCCGAGAAA  1864895

Query  124      GCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCC  183
                || ||  | ||||  || ||    ||   | |    |  || ||||||||||||||||||
Sbjct  1864894  GCCGCCATCAAGTACAAGCCGTCACTCGCAGTAAAGGCTGGATGTCACCCGTACCCTGCC  1864835

Query  184      GT  185
                ||
Sbjct  1864834  GT  1864833

>PYIW:scaffold_2677 piw_scaffold_2677 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_2677:1:4419:1 
REF
Length=4419

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 41/50 (82%), Gaps = 0/50 (0%)
 Strand=Plus/Minus

Query  379   GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAA  428
             || ||||| ||  |||||||  ||||| | ||||||||||||||||| ||
Sbjct  2706  GGCCACCGCCACGACTGGGAACACGTCGTCGTGTGGATCGACAACCCTAA  2657

>PHPA:scaffold_8 NW_008648994.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.8, whole genome shotgun 
sequence
Length=1889443

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 58/77 (75%), Gaps = 1/77 (1%)
 Strand=Plus/Minus

Query  262     GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
               || || ||| | |||| |||  |   ||||   || ||| |||||||||| |||||| | 
Sbjct  860766  GGTTCACAGGTTTACGGTCGGGCACGGTGGCACAAGGACCTGTGGGCCATTATGTACACG  860707

Query  322     TGGTATTTCCCGAAAGG  338
               ||||||||||| |||||
Sbjct  860706  TGGTATTTCCC-AAAGG  860691

>PHKE:scaffold_104 scf_22126_104.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_104.1:1:101703:1 
REF
Length=101703

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 35/40 (88%), Gaps = 0/40 (0%)
 Strand=Plus/Plus

Query  298    GACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
              ||||| ||||  ||||||||||| ||||| ||||||||||
Sbjct  31330  GACGTTTGGGTTATCATGTACGCGTGGTACTTCCCGAAAG  31369

>PHIF:NW_003303696.1 Phytophthora infestans T30-4 supercont1.63 
genomic scaffold, whole genome shotgun sequence
Length=711656

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 86/125 (69%), Gaps = 0/125 (0%)
 Strand=Plus/Plus

Query  105     CGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGG  164
               ||||||||   |  | ||||| ||  | ||||  || |  || || |||||||  |||||
Sbjct  107686  CGTCACCGATGCTCAAAAGGCTGCTCTCAAGTGCAAGCTTCAACTCAAAATCGAGGACGG  107745

Query  165     GTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATTACCGGAGGTCTCAAGTGGAG  224
               |||||||  ||| ||||  || | ||| || ||  | || | | | || ||||| |||  
Sbjct  107746  GTGTCACTTGTATCCTGTAGTCCCGAAAGACGGTGCTATCAGCAGTGGCCTCAAATGGTT  107805

Query  225     TGGAC  229
               |||||
Sbjct  107806  TGGAC  107810

>HYAP:scaffold_73 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_73:1:324626:1 
REF
Length=324626

 Score = 50.9 bits (55),  Expect = 8e-04
 Identities = 56/75 (75%), Gaps = 0/75 (0%)
 Strand=Plus/Minus

Query  94      CAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAA  153
               |||||||||||  |||||  ||| ||||| || ||  | |||| |||||||||| |  | 
Sbjct  250998  CAGCCAAAGCCAATCACCACCTCTGACAAAGCTGCCCTCAAGTATAAACCACAGTTGTAC  250939

Query  154     ATCGCCGACGGGTGT  168
                ||||  |||| |||
Sbjct  250938  GTCGCAAACGGCTGT  250924

>PHPA:scaffold_60 NW_008649046.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.60, whole genome shotgun 
sequence
Length=386225

 Score = 50.0 bits (54),  Expect = 8e-04
 Identities = 57/77 (74%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  262    GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
              ||||| |||||||||| |||    | ||||   || ||  | ||||| ||||||||||| 
Sbjct  93263  GGCTCGCAGATCTACGGTCGAGGTGGGTGGTACAAGGATATCTGGGCAATCATGTACGCG  93204

Query  322    TGGTATTTCCCGAAAGG  338
              || ||  |||| |||||
Sbjct  93203  TGTTACCTCCCAAAAGG  93187

>PHRA:scaffold_140
Length=80602

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 148/224 (66%), Gaps = 5/224 (2%)
 Strand=Plus/Minus

Query  85    CCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCA  144
             || ||| | ||||| | ||||| |||  | ||||| ||||| |  || || || || || 
Sbjct  5725  CCTTTCGCCCAGCCCATGCCCGCCACGATTTCCGAAAAGGCCGGCGTCAAATTCAAGCCC  5666

Query  145   CAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCAT  203
             ||| |  | |||   |||||| |||  ||||||||| |||||  |  |    ||    | 
Sbjct  5665  CAGATCCAGATCAG-GACGGGGTGTGTCCCGTACCCGGCCGTGAACTACCTCGGAGAGAC  5607

Query  204   TACCGGAGGTCTCAAGTGGAGTGGA-CCGCAGGACGGCGAATGCACAGGCTCGAAGCTCG  262
             ||  || |||||||||  |   ||  || || |  || |  ||   ||| ||    | ||
Sbjct  5606  TAGTGGTGGTCTCAAGACGTCAGGTGCCCCAAG--GGTGGGTGTCGAGGGTCTGGCCACG  5549

Query  263   GCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGG  306
             |||| ||| ||||||  |||||||||||| | || || ||||||
Sbjct  5548  GCTCGCAGGTCTACGGCCGCTCCGCGTGGCTCAACGATGTGTGG  5505

>PHIF:NW_003303713.1 Phytophthora infestans T30-4 supercont1.46 
genomic scaffold, whole genome shotgun sequence
Length=1163948

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 58/79 (73%), Gaps = 0/79 (0%)
 Strand=Plus/Minus

Query  259     CTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTAC  318
               |||||||| ||||| |||| |||| |  |       || |||  ||  ||||||||||||
Sbjct  392514  CTCGGCTCACAGATGTACGGTCGCGCAACAACCTACAAGGACTCGTACGCCATCATGTAC  392455

Query  319     GCCTGGTATTTCCCGAAAG  337
                ||||||| ||||||| ||
Sbjct  392454  TCCTGGTACTTCCCGAGAG  392436

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 55/75 (73%), Gaps = 0/75 (0%)
 Strand=Plus/Minus

Query  261     CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGC  320
               ||||  |||||||||||  ||   |||   |   || | |||||  |||||||||||| |
Sbjct  435958  CGGCAGTCAGATCTACGGCCGAGTCGCCACGTACAACGGCGTGTTCGCCATCATGTACTC  435899

Query  321     CTGGTATTTCCCGAA  335
                ||||||||||| ||
Sbjct  435898  GTGGTATTTCCCTAA  435884

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 50/67 (75%), Gaps = 0/67 (0%)
 Strand=Plus/Minus

Query  119     ACAAGGCAGCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACC  178
               ||||||  ||| ||||||| || || |||||  | |||  |  ||| ||||||||||| |
Sbjct  419242  ACAAGGTCGCACTAAAGTTCAAGCCTCAGCTACACATCAGCAGCGGATGTCACCCGTATC  419183

Query  179     CTGCCGT  185
               | || ||
Sbjct  419182  CGGCTGT  419176

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 40/53 (75%), Gaps = 0/53 (0%)
 Strand=Plus/Minus

Query  133     AAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGT  185
               ||||| || || ||| |  | ||| |  |||| || |||||||||||||| ||
Sbjct  436086  AAGTTCAAGCCCCAGATCCACATCTCGAACGGCTGCCACCCGTACCCTGCAGT  436034

>PHCA:scaffold_139 PHYCAscaffold_139
Length=29350

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 61/84 (73%), Gaps = 0/84 (0%)
 Strand=Plus/Plus

Query  133   AAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAG  192
             |||||  | || || || || ||||||  ||| ||||| || |||||||||||| |    
Sbjct  5650  AAGTTCCAGCCTCAACTCAACATCGCCAGCGGTTGTCATCCATACCCTGCCGTTGACGCC  5709

Query  193   GATGGCTCCATTACCGGAGGTCTC  216
             ||||||  || || | | ||||||
Sbjct  5710  GATGGCAACACTAACAGCGGTCTC  5733

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 26/26 (100%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  307   GCCATCATGTACGCCTGGTATTTCCC  332
             ||||||||||||||||||||||||||
Sbjct  5818  GCCATCATGTACGCCTGGTATTTCCC  5843

>HYAP:scaffold_78 dna:scaffold scaffold:HyaAraEmoy2_2.0:scaffold_78:1:302119:1 
REF
Length=302119

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 31/34 (91%), Gaps = 0/34 (0%)
 Strand=Plus/Plus

Query  304     TGGGCCATCATGTACGCCTGGTATTTCCCGAAAG  337
               ||||||||||||||||| ||||| ||||| ||||
Sbjct  126209  TGGGCCATCATGTACGCATGGTACTTCCCAAAAG  126242

 Score = 41.9 bits (45),  Expect = 0.44
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  396   GGAGTACGTCATTGTGTGGATCGACAACCC  425
             |||| | ||||||||||||| |||||||||
Sbjct  8733  GGAGCATGTCATTGTGTGGACCGACAACCC  8762

>PHKE:scaffold_993 scf_22126_993.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_993.1:1:4606:1 
REF
Length=4606

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 32/36 (89%), Gaps = 0/36 (0%)
 Strand=Plus/Plus

Query  304   TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
             ||||||||||||||||| |||| || ||| ||||||
Sbjct  2853  TGGGCCATCATGTACGCGTGGTTTTCCCCAAAAGGC  2888

>PHKE:scaffold_819 scf_22126_819.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_819.1:1:7712:1 
REF
Length=7712

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 35/41 (85%), Gaps = 0/41 (0%)
 Strand=Plus/Plus

Query  385   CGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
             |||||| ||||| |  |||| ||||| ||||||||||||||
Sbjct  7410  CGTCATGACTGGAAAAACGTGATTGTATGGATCGACAACCC  7450

>PHKE:scaffold_564 scf_22126_564.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_564.1:1:18646:1 
REF
Length=18646

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 29/31 (94%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  304  TGGGCCATCATGTACGCCTGGTATTTCCCGA  334
            ||||| ||||||||||| |||||||||||||
Sbjct  731  TGGGCTATCATGTACGCTTGGTATTTCCCGA  761

>PHCA:scaffold_38 PHYCAscaffold_38
Length=550336

 Score = 48.2 bits (52),  Expect = 0.003
 Identities = 32/36 (89%), Gaps = 0/36 (0%)
 Strand=Plus/Minus

Query  304     TGGGCCATCATGTACGCCTGGTATTTCCCGAAAGGC  339
               ||||||||||||||||| |||||||| || || |||
Sbjct  450114  TGGGCCATCATGTACGCTTGGTATTTTCCTAAGGGC  450079

>PYUU:scaffold_1981 scf1117875581981 dna:supercontig supercontig:pug:scf1117875581981:1:580909:1 
REF
Length=580909

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 40/50 (80%), Gaps = 0/50 (0%)
 Strand=Plus/Plus

Query  379    GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAA  428
              || |||| |||  |||||||  ||||  | ||||||||||||||||| ||
Sbjct  95635  GGCCACCATCACGACTGGGAACACGTTGTCGTGTGGATCGACAACCCGAA  95684

>PHRA:scaffold_271
Length=25029

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 37/45 (82%), Gaps = 0/45 (0%)
 Strand=Plus/Plus

Query  375   TTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGA  419
             |||||| ||||| || | ||||||| || | || |||||||||||
Sbjct  3311  TTTCGGCCACCGCCACAGCTGGGAGCACATTATCGTGTGGATCGA  3355

>PHIF:NW_003306740.1 Phytophthora infestans T30-4 supercont1.1923 
genomic scaffold, whole genome shotgun sequence
Length=3486

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 58/80 (73%), Gaps = 0/80 (0%)
 Strand=Plus/Minus

Query  385   CGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCCCAAGAGCAAAAACTCGACC  444
             || ||| ||||| || | ||| |||| ||||| || ||||||  |    || |  | |  
Sbjct  1567  CGACATGACTGGAAGAATGTCGTTGTATGGATTGATAACCCCGGGTTAGAAGAGCCAAAG  1508

Query  445   ATTCTTGGCGTATCGATGTC  464
             |||||||| |||||||||||
Sbjct  1507  ATTCTTGGGGTATCGATGTC  1488

>PHIF:NW_003303458.1 Phytophthora infestans T30-4 supercont1.301 
genomic scaffold, whole genome shotgun sequence
Length=99585

 Score = 46.4 bits (50),  Expect = 0.010
 Identities = 37/45 (82%), Gaps = 0/45 (0%)
 Strand=Plus/Minus

Query  381    ACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
              |||||||||| ||||| |    ||| |||||||||||||||| ||
Sbjct  50022  ACACCGTCATGACTGGAAAAGTGTCGTTGTGTGGATCGACAATCC  49978

>PLHA:NW_020187575.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_658, whole genome shotgun sequence
Length=2021493

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 56/77 (73%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  261      CGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGC  320
                ||| || ||||| ||| | || ||||  |||      | | |||||||||||||||||||
Sbjct  1739283  CGGTTCCCAGATATACTCGCGATCCGATTGGTACCGAGGCATGTGGGCCATCATGTACGC  1739342

Query  321      CTGGTATTTCCCGAAAG  337
                 |||||  | |||| ||
Sbjct  1739343  GTGGTACCTTCCGAGAG  1739359

 Score = 43.7 bits (47),  Expect = 0.13
 Identities = 40/51 (78%), Gaps = 0/51 (0%)
 Strand=Plus/Plus

Query  148     CTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGC  198
               ||| | |||||| | || ||| ||||||||||||| ||| | || | ||||
Sbjct  569758  CTTTACATCGCCAATGGCTGTTACCCGTACCCTGCAGTTAATAAAGCTGGC  569808

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  302     TGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
               ||||||||||| |||| |  ||||| ||||||||
Sbjct  512590  TGTGGGCCATCGTGTATGTTTGGTACTTCCCGAA  512557

>PLHA:NW_020187213.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_292, whole genome shotgun sequence
Length=1316030

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 42/51 (82%), Gaps = 2/51 (4%)
 Strand=Plus/Plus

Query  136      TTTAAACCACAGCTTAAAATCGCCGACGGG-TGTCACCCGTACCCTGCCGT  185
                |||||||| |||||| | |||| | ||||| ||||  ||||||||||| ||
Sbjct  1300527  TTTAAACCCCAGCTTGACATCGTC-ACGGGATGTCTGCCGTACCCTGCTGT  1300576

>PHRA:scaffold_75
Length=257998

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 65/92 (71%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  127     GCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTT  186
               || || ||| | || || ||| |  | || ||| ||||||||||||||||||| || || 
Sbjct  136213  GCTGTCAAGCTCAAGCCGCAGATCTACATTGCCAACGGGTGTCACCCGTACCCAGCTGTC  136154

Query  187     CAGAAGGATGGCTCCATTACCGGAGGTCTCAA  218
                |  | || |||  ||  | ||| ||||| ||
Sbjct  136153  GATGAAGACGGCAACACCAGCGGCGGTCTAAA  136122

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 65/92 (71%), Gaps = 0/92 (0%)
 Strand=Plus/Minus

Query  127     GCAGTAAAGTTTAAACCACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTT  186
               || || ||| | || || ||| |  | || ||| ||||||||||||||||||| || || 
Sbjct  145099  GCTGTCAAGCTCAAGCCGCAGATCTACATTGCCAACGGGTGTCACCCGTACCCAGCTGTC  145040

Query  187     CAGAAGGATGGCTCCATTACCGGAGGTCTCAA  218
                |  | || |||  ||  | ||| ||||| ||
Sbjct  145039  GATGAAGACGGCAACACCAGCGGCGGTCTAAA  145008

>PHPA:scaffold_330 NW_008649316.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.330, whole genome 
shotgun sequence
Length=10465

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 50/67 (75%), Gaps = 0/67 (0%)
 Strand=Plus/Plus

Query  84    GCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACC  143
             ||||||| | |||||    || |||||  |  |||| ||||| || || | |||||||||
Sbjct  5759  GCCATTCGCTCAGCCCGTCCCAGTCACGATTGCCGAAAAGGCTGCTGTCATGTTTAAACC  5818

Query  144   ACAGCTT  150
             ||| |||
Sbjct  5819  ACAACTT  5825

>PHPA:scaffold_9 NW_008648995.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.9, whole genome shotgun 
sequence
Length=1651025

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 50/67 (75%), Gaps = 0/67 (0%)
 Strand=Plus/Minus

Query  84      GCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACC  143
               ||||||| | |||||    || |||||  |  |||| ||||| || || | |||||||||
Sbjct  334587  GCCATTCGCTCAGCCCGTCCCAGTCACGATTGCCGAAAAGGCTGCTGTCATGTTTAAACC  334528

Query  144     ACAGCTT  150
               ||| |||
Sbjct  334527  ACAACTT  334521

>PHPA:scaffold_7 NW_008648993.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.7, whole genome shotgun 
sequence
Length=2078921

 Score = 45.5 bits (49),  Expect = 0.036
 Identities = 56/77 (73%), Gaps = 0/77 (0%)
 Strand=Plus/Plus

Query  262      GGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCC  321
                || || || || || |  || ||| ||||| |  | |||  |||||||||  |||| || 
Sbjct  1078040  GGGTCGCAAATGTATGGCCGATCCACGTGGTTTCAAGACAAGTGGGCCATGGTGTATGCA  1078099

Query  322      TGGTATTTCCCGAAAGG  338
                ||||||||||| | |||
Sbjct  1078100  TGGTATTTCCCCACAGG  1078116

>PYIW:scaffold_3359 piw_scaffold_3359 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_3359:1:3265:1 
REF
Length=3265

 Score = 44.6 bits (48),  Expect = 0.036
 Identities = 213/341 (62%), Gaps = 21/341 (6%)
 Strand=Plus/Plus

Query  85    CCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACCA  144
             ||||||||| |||||  |||    | | ||||  ||| ||| ||  | ||||| || || 
Sbjct  1877  CCATTCCCGGAGCCAGCGCCAACGAGCCTCTCGCACACGGCTGCGCTCAAGTTCAAGCCG  1936

Query  145   CAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGTTCAGAAGGATGGCTCCATT  204
             ||| |  | ||| |  |||| || |||||||| || || ||  |   ||  ||   || |
Sbjct  1937  CAGATCCACATCTCGAACGGCTGCCACCCGTATCCGGCGGTCGACGCGGCCGGTAACACT  1996

Query  205   ACCGGAGGTCTCAAGTGGAGTGGACCGCAGGACGGCGAATGCACAGGCTCGAAGCTCGGC  264
                || || ||||||   || ||  |||||  ||  |  ||||  |||||       |||
Sbjct  1997  GGTGGCGGCCTCAAGCCCAGCGGCTCGCAGAGCGCTGGTTGCAAGGGCTCTGGTTGGGGC  2056

Query  265   TCTCAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGG  324
              | ||| |||| |  |||||  ||||| | || |    |||||| ||||||||| | |||
Sbjct  2057  ACCCAGGTCTATGGCCGCTCGACGTGGTTCAACGGTAAGTGGGCGATCATGTACTCGTGG  2116

Query  325   TATTTCCCGAAAGGCAGAGGGGCAGTCCCTCTTCCTCTTATCACCCGTCTTTTCGGACAC  384
             || ||||| || | |      || ||              ||||  | ||    || |||
Sbjct  2117  TACTTCCCCAAGGACTC----GCCGT--------------TCACGGGCCTG---GGCCAC  2155

Query  385   CGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
             || ||  |||||||  ||||  | |||||||||||||| ||
Sbjct  2156  CGCCACGACTGGGAACACGTTGTCGTGTGGATCGACAATCC  2196

>PHPA:scaffold_4 NW_008648990.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.4, whole genome shotgun 
sequence
Length=2787191

 Score = 44.6 bits (48),  Expect = 0.036
 Identities = 33/39 (85%), Gaps = 0/39 (0%)
 Strand=Plus/Plus

Query  297      TGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                ||||  |||||| ||||||||||| ||||| || |||||
Sbjct  1066128  TGACAAGTGGGCGATCATGTACGCTTGGTACTTGCCGAA  1066166

>PHKE:scaffold_183 scf_22126_183.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_183.1_contig_1:1:67272:1 
REF
Length=67272

 Score = 44.6 bits (48),  Expect = 0.036
 Identities = 41/51 (80%), Gaps = 1/51 (2%)
 Strand=Plus/Plus

Query  375    TTTCGGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
              ||| || ||||| || |||||| || || | | ||||||||||||||| ||
Sbjct  55347  TTTTGGGCACCGCCACAACTGG-AGCACATTACTGTGTGGATCGACAATCC  55396

>SAPA:scaffold_104 supercont2.104 dna:supercontig supercontig:ASM15154v2:supercont2.104:1:114646:1 
REF
Length=114646

 Score = 42.8 bits (46),  Expect = 0.13
 Identities = 34/39 (87%), Gaps = 3/39 (8%)
 Strand=Plus/Minus

Query  8      TTCGGATCGTCCTCCTCGTCCTCGTCGCTTCGCT-TGCA  45
              |||||| ||||||| ||||||||||||  ||||| ||||
Sbjct  61235  TTCGGAGCGTCCTCATCGTCCTCGTCG--TCGCTGTGCA  61199

>PYVX:scaffold_177 pve_scaffold_177 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_177:1:41112:1 
REF
Length=41112

 Score = 42.8 bits (46),  Expect = 0.13
 Identities = 23/23 (100%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  14     TCGTCCTCCTCGTCCTCGTCGCT  36
              |||||||||||||||||||||||
Sbjct  18103  TCGTCCTCCTCGTCCTCGTCGCT  18125

>PYAR:scaffold_1401 par_scaffold_1401 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_1401:1:8658:1 
REF
Length=8658

 Score = 41.9 bits (45),  Expect = 0.44
 Identities = 24/25 (96%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  14    TCGTCCTCCTCGTCCTCGTCGCTTC  38
             ||||||||||| |||||||||||||
Sbjct  8644  TCGTCCTCCTCATCCTCGTCGCTTC  8620

>PLHA:NW_020187243.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_322, whole genome shotgun sequence
Length=1809241

 Score = 41.9 bits (45),  Expect = 0.44
 Identities = 27/30 (90%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  311      TCATGTACGCCTGGTATTTCCCGAAAGGCA  340
                |||||||||||||||||||||| | || ||
Sbjct  1561913  TCATGTACGCCTGGTATTTCCCAAGAGACA  1561942

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  306      GGCCATCATGTACGCCTGGTATTTCCC  332
                ||| ||||||||||| |||||||||||
Sbjct  1543971  GGCAATCATGTACGCTTGGTATTTCCC  1543945

>PHKE:scaffold_563 scf_22126_563.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_563.1_contig_1:1:18668:1 
REF
Length=18668

 Score = 41.9 bits (45),  Expect = 0.44
 Identities = 69/100 (69%), Gaps = 0/100 (0%)
 Strand=Plus/Minus

Query  236    ACGGCGAATGCACAGGCTCGAAGCTCGGCTCTCAGATCTACGCTCGCTCCGCGTGGGTGA  295
              ||||  | |||| ||| || |  |||||  | ||| | ||||  |||||  | |||   |
Sbjct  13992  ACGGAAAGTGCAAAGGGTCAAGCCTCGGTCCCCAGGTGTACGTCCGCTCTTCCTGGTACA  13933

Query  296    ATGACGTGTGGGCCATCATGTACGCCTGGTATTTCCCGAA  335
                 || ||||||| |||||| |  | ||||||||||| ||
Sbjct  13932  GGAACCTGTGGGCTATCATGCATTCGTGGTATTTCCCCAA  13893

>SADI:scaffold_77 supercont1.77 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.77:1:267713:1 
REF
Length=267713

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  14     TCGTCCTCCTCGTCCTCGTCG-CTTCGCT  41
              ||||||||||||||||| ||| |||||||
Sbjct  50803  TCGTCCTCCTCGTCCTCCTCGTCTTCGCT  50831

>PYVX:scaffold_360 pve_scaffold_360 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_360:1:28086:1 
REF
Length=28086

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 25/27 (93%), Gaps = 0/27 (0%)
 Strand=Plus/Minus

Query  10   CGGATCGTCCTCCTCGTCCTCGTCGCT  36
            ||| ||||| |||||||||||||||||
Sbjct  333  CGGGTCGTCGTCCTCGTCCTCGTCGCT  307

>PYUU:scaffold_1242 scf1117875581242 dna:supercontig supercontig:pug:scf1117875581242:1:870537:1 
REF
Length=870537

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  15      CGTCCTCCTCGTCCTCGTCGCT-TCGCTT  42
               |||||||||| ||||||||||| ||||||
Sbjct  716573  CGTCCTCCTCATCCTCGTCGCTCTCGCTT  716601

>PYIW:scaffold_934 piw_scaffold_934 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_934:1:12489:1 
REF
Length=12489

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand=Plus/Plus

Query  10     CGGA-TCGTCCTCCTCGTCCTCGTCGCTT  37
              |||| ||||| ||||||||||||||||||
Sbjct  10815  CGGACTCGTCTTCCTCGTCCTCGTCGCTT  10843

>PHKE:scaffold_893 scf_22126_893.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_893.1_contig_1:1:6146:1 
REF
Length=6146

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 37/47 (79%), Gaps = 0/47 (0%)
 Strand=Plus/Minus

Query  379   GGACACCGTCATAACTGGGAGTACGTCATTGTGTGGATCGACAACCC  425
             || || |||||  | |||||| |||| || ||||||||||| || ||
Sbjct  1007  GGCCATCGTCACGATTGGGAGCACGTTATCGTGTGGATCGATAATCC  961

>PHKE:scaffold_656 scf_22126_656.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_656.1:1:13201:1 
REF
Length=13201

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 40/52 (77%), Gaps = 0/52 (0%)
 Strand=Plus/Minus

Query  576   GCTCACGGAAGACACGGGGGAATTCCAGGACCTCATTACATGGGACGAACTC  627
             ||| ||| ||||  | ||  | || ||||||||||| || |||||| |||||
Sbjct  8933  GCTAACGAAAGAGGCTGGCAAGTTGCAGGACCTCATCACTTGGGACCAACTC  8882

>PHIF:NW_003303721.1 Phytophthora infestans T30-4 supercont1.38 
genomic scaffold, whole genome shotgun sequence
Length=1642046

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 70/102 (69%), Gaps = 0/102 (0%)
 Strand=Plus/Minus

Query  84       GCCATTCCCGCAGCCAAAGCCCGTCACCGTCTCCGACAAGGCAGCAGTAAAGTTTAAACC  143
                ||| ||| | |||||  | ||   ||||| | |||| || || ||||| || || || ||
Sbjct  1544914  GCCGTTCGCACAGCCGGAACCGACCACCGACGCCGAGAAAGCTGCAGTCAAATTCAAGCC  1544855

Query  144      ACAGCTTAAAATCGCCGACGGGTGTCACCCGTACCCTGCCGT  185
                    |||  | |     | || ||||||||||||||||||||
Sbjct  1544854  TTCACTTGCAGTAAAGTATGGATGTCACCCGTACCCTGCCGT  1544813

>PHIF:NW_003303555.1 Phytophthora infestans T30-4 supercont1.204 
genomic scaffold, whole genome shotgun sequence
Length=150214

 Score = 41.0 bits (44),  Expect = 0.44
 Identities = 55/77 (71%), Gaps = 0/77 (0%)
 Strand=Plus/Minus

Query  578    TCACGGAAGACACGGGGGAATTCCAGGACCTCATTACATGGGACGAACTCTCGAAGCTGG  637
              ||||  | ||| | || || ||||||||||| ||||  |||||| || | ||  | ||||
Sbjct  80194  TCACCAAGGACGCTGGCGAGTTCCAGGACCTGATTATGTGGGACCAAATGTCCGATCTGG  80135

Query  638    CACGATACTCTCTGAAC  654
              | ||     ||||||||
Sbjct  80134  CGCGCAGAGCTCTGAAC  80118

>SAPA:scaffold_14 supercont2.14 dna:supercontig supercontig:ASM15154v2:supercont2.14:1:615410:1 
REF
Length=615410

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Plus

Query  14     TCGTCCTCCTCGTCCTCGTCGCTT  37
              ||||| ||||||||||||||||||
Sbjct  25666  TCGTCGTCCTCGTCCTCGTCGCTT  25689

>SAPA:scaffold_4 supercont2.4 dna:supercontig supercontig:ASM15154v2:supercont2.4:1:1210272:1 
REF
Length=1210272

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 29/34 (85%), Gaps = 0/34 (0%)
 Strand=Plus/Minus

Query  8       TTCGGATCGTCCTCCTCGTCCTCGTCGCTTCGCT  41
               ||| ||||||| |||||||||||| ||  |||||
Sbjct  381280  TTCCGATCGTCTTCCTCGTCCTCGGCGGGTCGCT  381247

>SAPA:scaffold_3 supercont2.3 dna:supercontig supercontig:ASM15154v2:supercont2.3:1:1275006:1 
REF
Length=1275006

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 28/31 (90%), Gaps = 1/31 (3%)
 Strand=Plus/Plus

Query  14      TCGTCCTCCTCGTCCTCGTCG-CTTCGCTTG  43
               || || ||||||||||||||| |||||||||
Sbjct  957127  TCATCTTCCTCGTCCTCGTCGTCTTCGCTTG  957157

>PYVX:scaffold_742 pve_scaffold_742 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_742:1:14367:1 
REF
Length=14367

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 33/38 (87%), Gaps = 2/38 (5%)
 Strand=Plus/Minus

Query  13    ATCGTCCTCCTCGTCCTCGTCG-CTTCG-CTTGCAGGA  48
             ||||||||| |||||||||||| ||||| | | |||||
Sbjct  5832  ATCGTCCTCATCGTCCTCGTCGTCTTCGTCGTCCAGGA  5795

>PYVX:scaffold_174 pve_scaffold_174 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_174:1:41413:1 
REF
Length=41413

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  10     CGGATCGTCCTCCTCGTCCTCGTC  33
              |||||||||||||||||| |||||
Sbjct  21569  CGGATCGTCCTCCTCGTCGTCGTC  21546

>PYVX:scaffold_168 pve_scaffold_168 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_168:1:41890:1 
REF
Length=41890

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 34/40 (85%), Gaps = 3/40 (8%)
 Strand=Plus/Minus

Query  3      GAACTTTC-GGATCGTCCTCCTCGTCCTCGTCGCTTCGCT  41
              ||||| || || ||||| |||||||||||||||  |||||
Sbjct  19735  GAACTCTCCGGGTCGTCGTCCTCGTCCTCGTCG--TCGCT  19698

>PYUU:scaffold_2028 scf1117875582028 dna:supercontig supercontig:pug:scf1117875582028:1:960197:1 
REF
Length=960197

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  698     AGATGCCGCTGAAGGACGGGGTGT  721
               ||||||||| ||||||||||||||
Sbjct  910921  AGATGCCGCCGAAGGACGGGGTGT  910898

>PYAP:scaffold_1161 pag1_scaffold_1161 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_1161:1:6079:1 
REF
Length=6079

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 44/59 (75%), Gaps = 0/59 (0%)
 Strand=Plus/Minus

Query  268  CAGATCTACGCTCGCTCCGCGTGGGTGAATGACGTGTGGGCCATCATGTACGCCTGGTA  326
            ||| ||||||| ||||| |    |   |||| || ||  ||||||||||| ||||||||
Sbjct  444  CAGGTCTACGCCCGCTCAGGCACGTACAATGGCGCGTACGCCATCATGTATGCCTGGTA  386

>PYAP:scaffold_50 pag1_scaffold_50 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_50:1:82938:1 
REF
Length=82938

 Score = 40.1 bits (43),  Expect = 1.5
 Identities = 23/24 (96%), Gaps = 0/24 (0%)
 Strand=Plus/Minus

Query  13     ATCGTCCTCCTCGTCCTCGTCGCT  36
              ||||||||| ||||||||||||||
Sbjct  23735  ATCGTCCTCATCGTCCTCGTCGCT  23712

>SADI:scaffold_84 supercont1.84 dna:supercontig supercontig:Sap_diclina_VS20_V1:supercont1.84:1:196955:1 
REF
Length=196955

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 31/35 (89%), Gaps = 2/35 (6%)
 Strand=Plus/Minus

Query  14     TCGTCCTCCTCGTCCTCGTCG-CTTC-GCTTGCAG  46
              |||||||| |||||||||||| | || ||||||||
Sbjct  32849  TCGTCCTCTTCGTCCTCGTCGTCGTCGGCTTGCAG  32815

>PYVX:scaffold_108 pve_scaffold_108 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_108:1:52221:1 
REF
Length=52221

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Minus

Query  14     TCGTCCTCCTCGTCCTCGTCGCTTCGCTTGC  44
              ||||| || ||||||||||||||| ||| ||
Sbjct  34216  TCGTCATCTTCGTCCTCGTCGCTTAGCTCGC  34186

>PYVX:scaffold_27 pve_scaffold_27 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_27:1:84392:1 
REF
Length=84392

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  15     CGTCCTCCTCGTCCTCGTCGC  35
              |||||||||||||||||||||
Sbjct  35638  CGTCCTCCTCGTCCTCGTCGC  35618

>PYUU:scaffold_2039 scf1117875582039 dna:supercontig supercontig:pug:scf1117875582039:1:1829366:1 
REF
Length=1829366

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  14       TCGTCCTCCTCGTCCTCGTCG  34
                |||||||||||||||||||||
Sbjct  1542856  TCGTCCTCCTCGTCCTCGTCG  1542876

>PYIW:scaffold_1469 piw_scaffold_1469 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_1469:1:8739:1 
REF
Length=8739

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  14    TCGTCCTCCTCGTCCTCGTCG  34
             |||||||||||||||||||||
Sbjct  3007  TCGTCCTCCTCGTCCTCGTCG  2987

>PYIW:scaffold_685 piw_scaffold_685 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_685:1:15239:1 
REF
Length=15239

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 26/28 (93%), Gaps = 1/28 (4%)
 Strand=Plus/Plus

Query  13    ATCGTCCTCCTCGTCCTCGTCG-CTTCG  39
             |||||||||||| ||||||||| |||||
Sbjct  6284  ATCGTCCTCCTCATCCTCGTCGTCTTCG  6311

>PHRA:scaffold_81
Length=216085

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  14      TCGTCCTCCTCGTCCTCGTCG  34
               |||||||||||||||||||||
Sbjct  126089  TCGTCCTCCTCGTCCTCGTCG  126069

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Minus

Query  14      TCGTCCTCCTCGTCCTCGTCG  34
               |||||||||||||||||||||
Sbjct  202729  TCGTCCTCCTCGTCCTCGTCG  202709

>PHPA:scaffold_49 NW_008649035.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.49, whole genome shotgun 
sequence
Length=457145

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 21/21 (100%), Gaps = 0/21 (0%)
 Strand=Plus/Plus

Query  13      ATCGTCCTCCTCGTCCTCGTC  33
               |||||||||||||||||||||
Sbjct  390142  ATCGTCCTCCTCGTCCTCGTC  390162

>PHCA:scaffold_368 PHYCAscaffold_368
Length=5572

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Minus

Query  666   GGACGAGACTCTGTTCGACTTGGCAG  691
             || |||||||| ||||||||||||||
Sbjct  1343  GGTCGAGACTCGGTTCGACTTGGCAG  1318

>APAS:scaffold_53 supercont1.53 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.53:1:427435:1 
REF
Length=427435

 Score = 39.2 bits (42),  Expect = 1.5
 Identities = 24/26 (92%), Gaps = 0/26 (0%)
 Strand=Plus/Plus

Query  8       TTCGGATCGTCCTCCTCGTCCTCGTC  33
               ||||||||||| ||||||||||| ||
Sbjct  158086  TTCGGATCGTCGTCCTCGTCCTCTTC  158111

>PYVX:scaffold_281 pve_scaffold_281 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_281:1:31851:1 
REF
Length=31851

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  14   TCGTCCTCCTCGTCCTCGTCGCT  36
            ||||||| |||||||||||||||
Sbjct  118  TCGTCCTGCTCGTCCTCGTCGCT  96

>PYUU:scaffold_2035 scf1117875582035 dna:supercontig supercontig:pug:scf1117875582035:1:696189:1 
REF
Length=696189

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  14      TCGTCCTCCTCGTCCTCGTCGCT  36
               |||||||||||||| ||||||||
Sbjct  388541  TCGTCCTCCTCGTCGTCGTCGCT  388563

>PYUU:scaffold_2023 scf1117875582023 dna:supercontig supercontig:pug:scf1117875582023:1:1683196:1 
REF
Length=1683196

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  14      TCGTCCTCCTCGTCCTCGTCGCT  36
               ||||||||||| |||||||||||
Sbjct  476260  TCGTCCTCCTCCTCCTCGTCGCT  476282

>PYIW:scaffold_786 piw_scaffold_786 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_786:1:14152:1 
REF
Length=14152

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  14    TCGTCCTCCTCGTCCTCGTCGCT  36
             |||| ||||||||||||||||||
Sbjct  3746  TCGTTCTCCTCGTCCTCGTCGCT  3768

>PYIW:scaffold_560 piw_scaffold_560 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_560:1:16693:1 
REF
Length=16693

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  14    TCGTCCTCCTCGTCCTCGTCGCT  36
             ||||| |||||||||||||||||
Sbjct  4262  TCGTCATCCTCGTCCTCGTCGCT  4240

>PYIR:scaffold_257 pir_scaffold_257 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_257:1:36238:1 
REF
Length=36238

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  14     TCGTCCTCCTCGTCCTCGTCGCT  36
              |||||||| ||||||||||||||
Sbjct  17357  TCGTCCTCGTCGTCCTCGTCGCT  17335

>PYAR:scaffold_140 par_scaffold_140 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_140:1:29254:1 
REF
Length=29254

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  14    TCGTCCTCCTCGTCCTCGTCGCT  36
             ||||| |||||||||||||||||
Sbjct  9404  TCGTCGTCCTCGTCCTCGTCGCT  9382

>PLHA:NW_020189964.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_3060, whole genome shotgun sequence
Length=3267112

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  14       TCGTCCTCCTCGTCCTCGTCGCT  36
                ||||| |||||||||||||||||
Sbjct  2982104  TCGTCGTCCTCGTCCTCGTCGCT  2982082

>PHSO:scaffold_13
Length=2041583

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 24/25 (96%), Gaps = 1/25 (4%)
 Strand=Plus/Plus

Query  16       GTCCTCCTCGTCCTCGTCG-CTTCG  39
                ||||||||||||||||||| |||||
Sbjct  1426075  GTCCTCCTCGTCCTCGTCGTCTTCG  1426099

>PHRA:scaffold_77
Length=226713

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  14     TCGTCCTCCTCGTCCTCGTCGCT  36
              ||||| |||||||||||||||||
Sbjct  97553  TCGTCGTCCTCGTCCTCGTCGCT  97531

>PHPA:scaffold_120 NW_008649106.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.120, whole genome 
shotgun sequence
Length=94489

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 24/25 (96%), Gaps = 1/25 (4%)
 Strand=Plus/Plus

Query  16     GTCCTCCTCGTCCTCGTCG-CTTCG  39
              ||||||||||||||||||| |||||
Sbjct  51993  GTCCTCCTCGTCCTCGTCGTCTTCG  52017

>PHKE:scaffold_106 scf_22126_106.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_106.1_contig_1:1:100946:1 
REF
Length=100946

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  571    CTGCAGCTCACGGAAGACACGGG  593
              ||||||||||||||||| |||||
Sbjct  83425  CTGCAGCTCACGGAAGAAACGGG  83447

>PHIF:NW_003303753.1 Phytophthora infestans T30-4 supercont1.6 
genomic scaffold, whole genome shotgun sequence
Length=4722445

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  103      CCCGTCACCGTCTCCGACAAGGCAGCAG  130
                || |||| ||||||||||||| ||||||
Sbjct  4629109  CCAGTCATCGTCTCCGACAAGCCAGCAG  4629136

>PHIF:NW_003303730.1 Phytophthora infestans T30-4 supercont1.29 
genomic scaffold, whole genome shotgun sequence
Length=2113949

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Plus

Query  11      GGATCGTCCTCCTCGTCCTCGTC  33
               |||||||| ||||||||||||||
Sbjct  401753  GGATCGTCGTCCTCGTCCTCGTC  401775

>PHIF:NW_003303725.1 Phytophthora infestans T30-4 supercont1.34 
genomic scaffold, whole genome shotgun sequence
Length=1799396

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  103     CCCGTCACCGTCTCCGACAAGGCAGCAG  130
               || |||| ||||||||||||| ||||||
Sbjct  104592  CCAGTCATCGTCTCCGACAAGCCAGCAG  104565

>PHIF:NW_003303718.1 Phytophthora infestans T30-4 supercont1.41 
genomic scaffold, whole genome shotgun sequence
Length=1405213

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  103      CCCGTCACCGTCTCCGACAAGGCAGCAG  130
                || |||| ||||||||||||| ||||||
Sbjct  1339704  CCAGTCATCGTCTCCGACAAGCCAGCAG  1339731

>PHIF:NW_003303690.1 Phytophthora infestans T30-4 supercont1.69 
genomic scaffold, whole genome shotgun sequence
Length=660613

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  103     CCCGTCACCGTCTCCGACAAGGCAGCAG  130
               || |||| ||||||||||||| ||||||
Sbjct  113396  CCAGTCATCGTCTCCGACAAGCCAGCAG  113369

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Plus

Query  103     CCCGTCACCGTCTCCGACAAGGCAGCAG  130
               || |||| ||||||||||||| ||||||
Sbjct  651149  CCAGTCATCGTCTCCGACAAGCCAGCAG  651176

>PHIF:NW_003302786.1 Phytophthora infestans T30-4 supercont1.1099 
genomic scaffold, whole genome shotgun sequence
Length=8125

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 25/28 (89%), Gaps = 0/28 (0%)
 Strand=Plus/Minus

Query  103   CCCGTCACCGTCTCCGACAAGGCAGCAG  130
             || |||| ||||||||||||| ||||||
Sbjct  7954  CCAGTCATCGTCTCCGACAAGCCAGCAG  7927

>ALLA:FR824660 dna:supercontig supercontig:ENA1:FR824660:1:8039:1 
REF
Length=8039

 Score = 38.3 bits (41),  Expect = 5.3
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  510   TGTGGATGGCGACAGTGTCAAGC  532
             ||| |||||||||||||||||||
Sbjct  6911  TGTAGATGGCGACAGTGTCAAGC  6889

>SAPA:scaffold_376 supercont2.376 dna:supercontig supercontig:ASM15154v2:supercont2.376:1:10263:1 
REF
Length=10263

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 28/32 (88%), Gaps = 1/32 (3%)
 Strand=Plus/Plus

Query  11    GGATCGTCCTCCTCGTCCTCGTCG-CTTCGCT  41
             || ||||| || |||||||||||| |||||||
Sbjct  8469  GGCTCGTCGTCGTCGTCCTCGTCGTCTTCGCT  8500

>SAPA:scaffold_36 supercont2.36 dna:supercontig supercontig:ASM15154v2:supercont2.36:1:340295:1 
REF
Length=340295

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  14      TCGTCCTCCTCGTCCTCGTC  33
               ||||||||||||||||||||
Sbjct  263707  TCGTCCTCCTCGTCCTCGTC  263726

>PYVX:scaffold_898 pve_scaffold_898 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_898:1:10407:1 
REF
Length=10407

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  14    TCGTCCTCCTCGTCCTCGTC  33
             ||||||||||||||||||||
Sbjct  4281  TCGTCCTCCTCGTCCTCGTC  4262

>PYVX:scaffold_782 pve_scaffold_782 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_782:1:13298:1 
REF
Length=13298

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  14   TCGTCCTCCTCGTCCTCGTCGCTTCGCTTG  43
            ||||||||||||||||| ||||   |||||
Sbjct  438  TCGTCCTCCTCGTCCTCCTCGCCCAGCTTG  409

>PYVX:scaffold_682 pve_scaffold_682 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_682:1:15893:1 
REF
Length=15893

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  10    CGGATCGTCCTCCTCGTCCTCGTCG  34
             || ||||||||| ||||||||||||
Sbjct  5042  CGCATCGTCCTCGTCGTCCTCGTCG  5018

>PYVX:scaffold_561 pve_scaffold_561 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_561:1:19650:1 
REF
Length=19650

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  14    TCGTCCTCCTCGTCCTCGTC  33
             ||||||||||||||||||||
Sbjct  5047  TCGTCCTCCTCGTCCTCGTC  5028

>PYVX:scaffold_407 pve_scaffold_407 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_407:1:26090:1 
REF
Length=26090

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  12     GATCGTCCTCCTCGTCCTCGTCGCT  36
              || || |||||||||||||||||||
Sbjct  23312  GAGCGGCCTCCTCGTCCTCGTCGCT  23336

>PYVX:scaffold_352 pve_scaffold_352 dna:supercontig supercontig:pve_scaffolds_v1:pve_scaffold_352:1:28559:1 
REF
Length=28559

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  14     TCGTCCTCCTCGTCCTCGTC  33
              ||||||||||||||||||||
Sbjct  14387  TCGTCCTCCTCGTCCTCGTC  14368

>PYUU:scaffold_1381 scf1117875581381 dna:supercontig supercontig:pug:scf1117875581381:1:502691:1 
REF
Length=502691

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  14      TCGTCCTCCTCGTCCTCGTC  33
               ||||||||||||||||||||
Sbjct  132768  TCGTCCTCCTCGTCCTCGTC  132787

>PYIW:scaffold_2994 piw_scaffold_2994 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_2994:1:3841:1 
REF
Length=3841

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 26/30 (87%), Gaps = 0/30 (0%)
 Strand=Plus/Minus

Query  49    GCCCAGGCTCAAGTCATCGGCCACGACCAG  78
             |||||||||||||||  || |||||| |||
Sbjct  1246  GCCCAGGCTCAAGTCCACGACCACGATCAG  1217

>PYIW:scaffold_2971 piw_scaffold_2971 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_2971:1:3865:1 
REF
Length=3865

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 28/32 (88%), Gaps = 1/32 (3%)
 Strand=Plus/Plus

Query  6     CTTTCGG-ATCGTCCTCCTCGTCCTCGTCGCT  36
             ||||||  |||||| |||||||||||||| ||
Sbjct  3302  CTTTCGCCATCGTCGTCCTCGTCCTCGTCACT  3333

>PYIW:scaffold_873 piw_scaffold_873 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_873:1:13057:1 
REF
Length=13057

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  14    TCGTCCTCCTCGTCCTCGTC  33
             ||||||||||||||||||||
Sbjct  5216  TCGTCCTCCTCGTCCTCGTC  5235

>PYIW:scaffold_95 piw_scaffold_95 dna:supercontig supercontig:piw_scaffolds_v1:piw_scaffold_95:1:31709:1 
REF
Length=31709

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  401   ACGTCATTGTGTGGATCGACAACCC  425
             ||||||||| ||||||||||| |||
Sbjct  5440  ACGTCATTGCGTGGATCGACACCCC  5416

>PYIR:scaffold_1841 pir_scaffold_1841 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_1841:1:4794:1 
REF
Length=4794

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  10    CGGATCGTCCTCCTCGTCCTCGTCG  34
             |||||| ||||| ||||||||||||
Sbjct  3677  CGGATCTTCCTCGTCGTCCTCGTCG  3701

>PYIR:scaffold_102 pir_scaffold_102 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_102:1:54126:1 
REF
Length=54126

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  14   TCGTCCTCCTCGTCCTCGTCGCTTC  38
            ||||||||||||| ||| |||||||
Sbjct  233  TCGTCCTCCTCGTTCTCCTCGCTTC  209

>PYIR:scaffold_16 pir_scaffold_16 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_16:1:92613:1 
REF
Length=92613

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  13     ATCGTCCTCCTCGTCCTCGT  32
              ||||||||||||||||||||
Sbjct  57373  ATCGTCCTCCTCGTCCTCGT  57354

>PYAR:scaffold_4338 par_scaffold_4338 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_4338:1:2313:1 
REF
Length=2313

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  229   CCGCAGGACGGCGAATGCACAGGCT  253
             || ||||||||||||||||| ||||
Sbjct  1817  CCCCAGGACGGCGAATGCACTGGCT  1841

>PYAR:scaffold_915 par_scaffold_915 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_915:1:12010:1 
REF
Length=12010

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Minus

Query  14    TCGTCCTCCTCGTCCTCGTCGCTTCGC  40
             |||||||| |||||||||||| |||||
Sbjct  1452  TCGTCCTCGTCGTCCTCGTCG-TTCGC  1427

>PYAR:scaffold_695 par_scaffold_695 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_695:1:14246:1 
REF
Length=14246

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  14    TCGTCCTCCTCGTCCTCGTC  33
             ||||||||||||||||||||
Sbjct  6245  TCGTCCTCCTCGTCCTCGTC  6264

>PYAR:scaffold_580 par_scaffold_580 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_580:1:16103:1 
REF
Length=16103

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  14    TCGTCCTCCTCGTCCTCGTCGCTTC  38
             |||||||| ||||||||||||| ||
Sbjct  8717  TCGTCCTCGTCGTCCTCGTCGCCTC  8741

>PYAR:scaffold_143 par_scaffold_143 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_143:1:28947:1 
REF
Length=28947

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Minus

Query  14     TCGTCCTCCTCGTCCTCGTC  33
              ||||||||||||||||||||
Sbjct  26890  TCGTCCTCCTCGTCCTCGTC  26871

>PYAP:scaffold_325 pag1_scaffold_325 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_325:1:32769:1 
REF
Length=32769

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 36/44 (82%), Gaps = 2/44 (5%)
 Strand=Plus/Plus

Query  491    CGCCCCCTGAAGCGATGTA-TGTGGATGGCGACAGTGTCAAGCT  533
              |||||| |||| || | || |||||  | |||||||||||||||
Sbjct  23314  CGCCCCTTGAATCGCTCTAATGTGGC-GTCGACAGTGTCAAGCT  23356

>PYAP:scaffold_35 pag1_scaffold_35 dna:supercontig supercontig:pag1_scaffolds_v1:pag1_scaffold_35:1:98671:1 
REF
Length=98671

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  564    CACATCCCTGCAGCTCACGGAAGAC  588
              |||||| ||||||||||| ||||||
Sbjct  44843  CACATCGCTGCAGCTCACCGAAGAC  44867

>PHPA:scaffold_61 NW_008649047.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.61, whole genome shotgun 
sequence
Length=361441

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Minus

Query  420    CAACCCCAAGAGCAAAAACTCGACC  444
              |||||||||||||||| ||||| ||
Sbjct  27446  CAACCCCAAGAGCAAATACTCGGCC  27422

>PHKE:scaffold_147 scf_22126_147.1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_147.1:1:78312:1 
REF
Length=78312

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Minus

Query  14     TCGTCCTCCTCGTCCTCGTCG-CTTCG  39
              || |||||||||||||||||| |||||
Sbjct  36829  TCTTCCTCCTCGTCCTCGTCGTCTTCG  36803

>PHIF:NW_003303755.1 Phytophthora infestans T30-4 supercont1.4 
genomic scaffold, whole genome shotgun sequence
Length=5137561

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 23/25 (92%), Gaps = 0/25 (0%)
 Strand=Plus/Plus

Query  11       GGATCGTCCTCCTCGTCCTCGTCGC  35
                || ||||| ||||||||||||||||
Sbjct  4179947  GGTTCGTCGTCCTCGTCCTCGTCGC  4179971

>PHIF:NW_003303708.1 Phytophthora infestans T30-4 supercont1.51 
genomic scaffold, whole genome shotgun sequence
Length=1174903

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Plus

Query  13      ATCGTCCTCCTCGTCCTCGTCG-CTTC  38
               ||| |||||||||||||||||| ||||
Sbjct  868600  ATCATCCTCCTCGTCCTCGTCGTCTTC  868626

>PHCA:scaffold_47 PHYCAscaffold_47
Length=556112

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Plus

Query  14      TCGTCCTCCTCGTCCTCGTC-GCTTCG  39
               |||||||| ||||||||||| ||||||
Sbjct  357844  TCGTCCTCGTCGTCCTCGTCAGCTTCG  357870

>APIN:scaffold_13 supercont1.13 dna:supercontig supercontig:Apha_inva_NJM9701_V1:supercont1.13:1:1515874:1 
REF
Length=1515874

 Score = 37.4 bits (40),  Expect = 5.3
 Identities = 25/27 (93%), Gaps = 1/27 (4%)
 Strand=Plus/Plus

Query  14       TCGTCCTCCTCGTCCTCGTCG-CTTCG  39
                |||||||| |||||||||||| |||||
Sbjct  1112322  TCGTCCTCGTCGTCCTCGTCGTCTTCG  1112348

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 937944542688

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2