Note:

Full BLAST raw output including alignments follows below the summary table

Hit Name Hit Start Hit End HSP Length HSP Score HSP Significance
ALCA:scaffold_62285152906354910980.0
ALLA:FR82421526489270375525722e-144
PHPA:scaffold_63261880262002123924e-14
PHIF:NW_003303697.1492727492848122895e-13
PYAR:scaffold_2945484652105856e-12
PHKE:scaffold_987854978652104832e-11
SAPA:scaffold_1181214334121721e-08
PYIR:scaffold_88934489478135704e-08
SAPA:scaffold_1221261612718103562e-04
PYUU:scaffold_203230490230493938530.003
PLHA:NW_020187567.148495648498631421.4
PYUU:scaffold_1984411434116523414.9
APAS:scaffold_1327396327399533414.9
PHPA:scaffold_3344766244768120404.9
BLASTN 2.9.0+

Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.

Database: OGOB_genomes.fna
           64,241 sequences; 1,297,559,224 total letters

Query= CCI44113

Length=699
                                                                      Score        E
Sequences producing significant alignments:                          (Bits)     Value

ALCA:scaffold_62 AcNc2_CONTIG_62_length_96346 dna:supercontig sup...  991        0.0   
ALLA:FR824215 dna:supercontig supercontig:ENA1:FR824215:1:55297:1...  517        2e-144
PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 ...  84.2       4e-14 
PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 ge...  81.5       5e-13 
PYAR:scaffold_29 par_scaffold_29 dna:supercontig supercontig:par_...  77.9       6e-12 
PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercon...  76.1       2e-11 
SAPA:scaffold_1181 supercont2.1181 dna:supercontig supercontig:AS...  66.2       1e-08 
PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_sc...  64.4       4e-08 
SAPA:scaffold_122 supercont2.122 dna:supercontig supercontig:ASM1...  51.8       2e-04 
PYUU:scaffold_2032 scf1117875582032 dna:supercontig supercontig:p...  49.1       0.003 
PLHA:NW_020187567.1 Plasmopara halstedii genome assembly, contig:...  39.2       1.4   
PYUU:scaffold_1984 scf1117875581984 dna:supercontig supercontig:p...  38.3       4.9   
APAS:scaffold_13 supercont1.13 dna:supercontig supercontig:Apha_a...  38.3       4.9   
PHPA:scaffold_33 NW_008649019.1 Phytophthora parasitica INRA-310 ...  37.4       4.9   

>ALCA:scaffold_62 AcNc2_CONTIG_62_length_96346 dna:supercontig 
supercontig:ASM107853v1:AcNc2_CONTIG_62_length_96346:1:96346:1 
REF
Length=96346

 Score = 991 bits (1098),  Expect = 0.0
 Identities = 549/549 (100%), Gaps = 0/549 (0%)
 Strand=Plus/Plus

Query  151    GGCGCTGATAACTTGACCAGATCAATATCTTCGTTCTCACTTGTGGTCAAACATGGCGTA  210
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  28515  GGCGCTGATAACTTGACCAGATCAATATCTTCGTTCTCACTTGTGGTCAAACATGGCGTA  28574

Query  211    GATAACCTGGTGGTCGATGGAGATACCTTTGCATCGTCTGACTCGTCCTCTGAGAAATTT  270
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  28575  GATAACCTGGTGGTCGATGGAGATACCTTTGCATCGTCTGACTCGTCCTCTGAGAAATTT  28634

Query  271    GTGGATTGTGTAGCCAAGGTAGAGGGACCAGCCGATAGTTTCATAATCGCGTCCACTTCT  330
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  28635  GTGGATTGTGTAGCCAAGGTAGAGGGACCAGCCGATAGTTTCATAATCGCGTCCACTTCT  28694

Query  331    TTTTGCAAAGCAATCTCGGATCGCACCGCTTTGGCTCTATCTTTGCAGATTCGAAATAAC  390
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  28695  TTTTGCAAAGCAATCTCGGATCGCACCGCTTTGGCTCTATCTTTGCAGATTCGAAATAAC  28754

Query  391    TCCTCGTTGATTTGGAGTTTGTTCCCGAGCAACCATCCCCAGACTCGTCCTCGTAACTCC  450
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  28755  TCCTCGTTGATTTGGAGTTTGTTCCCGAGCAACCATCCCCAGACTCGTCCTCGTAACTCC  28814

Query  451    TTTGGAATCCCAGCAAAACAGAGTGCTACAACCGATTTTATATCACTAGGCATAGGCCGG  510
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  28815  TTTGGAATCCCAGCAAAACAGAGTGCTACAACCGATTTTATATCACTAGGCATAGGCCGG  28874

Query  511    GGCAAAATATCTTCGATCCAGGTATCTGTAAAGGACTTGCTCATTCTTCTCAATTTGACA  570
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  28875  GGCAAAATATCTTCGATCCAGGTATCTGTAAAGGACTTGCTCATTCTTCTCAATTTGACA  28934

Query  571    CGCTTTCGCTCTTCCTTCCGAGTTTTCGACAATTTGTTTCGCTGCTTCCGTGTGTCCCCC  630
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  28935  CGCTTTCGCTCTTCCTTCCGAGTTTTCGACAATTTGTTTCGCTGCTTCCGTGTGTCCCCC  28994

Query  631    TTGATGACAGTCGACCATGTATGTGCACTTTCAAAGGAGATATTGGAGTTGTTTACTATG  690
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  28995  TTGATGACAGTCGACCATGTATGTGCACTTTCAAAGGAGATATTGGAGTTGTTTACTATG  29054

Query  691    CACGTATGA  699
              |||||||||
Sbjct  29055  CACGTATGA  29063

 Score = 275 bits (304),  Expect = 1e-71
 Identities = 152/152 (100%), Gaps = 0/152 (0%)
 Strand=Plus/Plus

Query  1      ATGCAGGAAAAGTTTCCATGTGTAAGCAGATGGATGCAGCAAGATAACTCATGCCTAAAG  60
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  28186  ATGCAGGAAAAGTTTCCATGTGTAAGCAGATGGATGCAGCAAGATAACTCATGCCTAAAG  28245

Query  61     GAAAAGCATAGTCGAGTCAGTAAAATCAGCGCTCATTTGATACTCTTGAATGATGCAGAG  120
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  28246  GAAAAGCATAGTCGAGTCAGTAAAATCAGCGCTCATTTGATACTCTTGAATGATGCAGAG  28305

Query  121    CAAAACCTTGTACATATCCAAGATCAGGTCGG  152
              ||||||||||||||||||||||||||||||||
Sbjct  28306  CAAAACCTTGTACATATCCAAGATCAGGTCGG  28337

>ALLA:FR824215 dna:supercontig supercontig:ENA1:FR824215:1:55297:1 
REF
Length=55297

 Score = 517 bits (572),  Expect = 2e-144
 Identities = 446/552 (81%), Gaps = 3/552 (1%)
 Strand=Plus/Plus

Query  147    GGTCGGCGCTGATAACTTGACCAGATCAATATCTTCGTTCTCACTTGTGGTCAAACATGG  206
              ||| ||||  | || | ||| || ||| || ||||| || |||||||  |||||||||||
Sbjct  26489  GGTAGGCGGGGGTAGCCTGATCATATCGATCTCTTCATTTTCACTTGCCGTCAAACATGG  26548

Query  207    CGTAGATAACCTGGTGGTCGATGGAGATACCTTTGCATCGTCTGACTCGTCCTCTGAGAA  266
               || |||| ||||||||||||||  ||| | || | ||| |||| ||| |||||||||||
Sbjct  26549  TGTCGATAGCCTGGTGGTCGATGATGATGCTTTCGTATCATCTGCCTCATCCTCTGAGAA  26608

Query  267    ATTTGTGGATTGTGTAGCCAAGGTAGAGGGACCAGCCGATAGTTTCATAATCGCGTCCAC  326
              || ||||||||| ||||| || |  ||  ||||||| || ||||||||||| || |||||
Sbjct  26609  ATCTGTGGATTGCGTAGCTAATGCCGATAGACCAGCTGAGAGTTTCATAATTGCATCCAC  26668

Query  327    TTCTTTTTGCAAAGCAATCTCGGATCGCACCGCTTTGGCTCTATCTTTGCAGATTCGAAA  386
              |||||||||||||||||||||||| ||||||||||  |||||||||||||| |||   ||
Sbjct  26669  TTCTTTTTGCAAAGCAATCTCGGAACGCACCGCTTCAGCTCTATCTTTGCATATTATGAA  26728

Query  387    TAACTCCTCGTTGATTTGGAGTTTGTTCCCGAGCAACCATCCCCAGACTCGTCCTCGTAA  446
              ||  || || || ||||| ||||| |||||||||||||||||||||||||||||||||| 
Sbjct  26729  TAGTTCTTCATTTATTTGTAGTTTATTCCCGAGCAACCATCCCCAGACTCGTCCTCGTAG  26788

Query  447    CTCCTTTGGAATCCCAGCAAAACAGAGTGCTACAACCGATTTTATATCACTAGGCATAGG  506
              ||| || ||||| ||||||||||| |||||| |||||  |||   |||| |||  | |||
Sbjct  26789  CTCTTTGGGAATACCAGCAAAACAAAGTGCTTCAACCAGTTTCGAATCAGTAGATAGAGG  26848

Query  507    CCGGGGCAAAATATCTTCGATCCAGGTATCTGTAAAGGACTTGCTCATTCTTCTCAATTT  566
               ||||  ||||||||||| |||||||||||||||||||| ||||||| | || | |  ||
Sbjct  26849  TCGGGCTAAAATATCTTCAATCCAGGTATCTGTAAAGGATTTGCTCAATTTTTTAAGCTT  26908

Query  567    GACACGCTTTCGCTCTTCCTTCCGAGTTTTCGACAATTTGTTTCGCTGCTTCCGTGTGTC  626
              ||||||||| ||||||||  ||||||||||||||| |||||| ||||| || ||||||| 
Sbjct  26909  GACACGCTTCCGCTCTTCTCTCCGAGTTTTCGACACTTTGTTCCGCTGATTACGTGTGT-  26967

Query  627    CCCCTTGATGACAGTCGACCATGTATGTGCACTTTCAAAGGAGATATTGGAGTTGTTTAC  686
                ||||||| | ||| | ||||  ||| |  |||||  |||||| |||||| |||  |||
Sbjct  26968  --CCTTGATAAAAGTGGGCCATACATGCGTGCTTTCCGAGGAGAGATTGGAATTGACTAC  27025

Query  687    TATGCACGTATG  698
              | | || |||||
Sbjct  27026  TTTACAAGTATG  27037

 Score = 89.7 bits (98),  Expect = 9e-16
 Identities = 111/151 (74%), Gaps = 11/151 (7%)
 Strand=Plus/Plus

Query  3      GCAGGAAAAGTTTCCATGTGTAAGCAGATGGATGCAGCAAGATAACTCATGCCT-AAAGG  61
              || || ||||| ||||||||||||||||| | |||||| ||||||||||| |||   || 
Sbjct  26175  GCCGGGAAAGTGTCCATGTGTAAGCAGATAGCTGCAGCTAGATAACTCATCCCTGTGAGA  26234

Query  62     AAAAGCATAGTCGAGTCAGTAAAATCAGCGCTCATTTGATACTCTTGAATGATGCAGAGC  121
              ||||||| ||||||||||| ||| |  | |    |  ||| ||         |||| |  
Sbjct  26235  AAAAGCAAAGTCGAGTCAGCAAATTTGGGGTGGGTAAGATCCT---------TGCA-ATT  26284

Query  122    AAAACCTTGTACATATCCAAGATCAGGTCGG  152
               | ||||||||||||||||||||| || |||
Sbjct  26285  GAGACCTTGTACATATCCAAGATCCGGGCGG  26315

>PHPA:scaffold_63 NW_008649049.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.63, whole genome shotgun 
sequence
Length=342508

 Score = 84.2 bits (92),  Expect = 4e-14
 Identities = 93/123 (76%), Gaps = 1/123 (1%)
 Strand=Plus/Plus

Query  364     GCTCTATCTTTGCAGATTCGAAATAACTCCTCGTTGATTTGGAGTTTGTTCCCGAGCAAC  423
               |||| | ||||||| |||  ||| || || ||||| | ||| ||  |||||||||| | |
Sbjct  261880  GCTCGAGCTTTGCATATTTTAAACAAATCTTCGTTCACTTGAAGCGTGTTCCCGAGTATC  261939

Query  424     CATCCCCAGACTCGTCCTCGTAACTCCTTTGGAATCCCAGCAAAACAGAGTGC-TACAAC  482
               ||  ||||  |||| || || | |||||||||||| || ||||| || ||||| | ||||
Sbjct  261940  CAAGCCCAAGCTCGACCACGAAGCTCCTTTGGAATACCCGCAAAGCACAGTGCATCCAAC  261999

Query  483     CGA  485
                ||
Sbjct  262000  AGA  262002

>PHIF:NW_003303697.1 Phytophthora infestans T30-4 supercont1.62 
genomic scaffold, whole genome shotgun sequence
Length=695754

 Score = 81.5 bits (89),  Expect = 5e-13
 Identities = 91/122 (75%), Gaps = 0/122 (0%)
 Strand=Plus/Plus

Query  355     ACCGCTTTGGCTCTATCTTTGCAGATTCGAAATAACTCCTCGTTGATTTGGAGTTTGTTC  414
               || || | ||||| | ||||||||||| |||| || || ||||| | ||| ||  | || 
Sbjct  492727  ACAGCCTGGGCTCGAGCTTTGCAGATTTGAAACAAATCTTCGTTTACTTGAAGCGTATTT  492786

Query  415     CCGAGCAACCATCCCCAGACTCGTCCTCGTAACTCCTTTGGAATCCCAGCAAAACAGAGT  474
               || || | |||| ||||  | || || |||| ||||||||| || || ||||| || |||
Sbjct  492787  CCAAGTATCCATGCCCATGCCCGGCCACGTAGCTCCTTTGGGATACCCGCAAAGCACAGT  492846

Query  475     GC  476
               ||
Sbjct  492847  GC  492848

>PYAR:scaffold_29 par_scaffold_29 dna:supercontig supercontig:par_scaffolds_v1:par_scaffold_29:1:42963:1 
REF
Length=42963

 Score = 77.9 bits (85),  Expect = 6e-12
 Identities = 80/105 (76%), Gaps = 0/105 (0%)
 Strand=Plus/Minus

Query  373   TTGCAGATTCGAAATAACTCCTCGTTGATTTGGAGTTTGTTCCCGAGCAACCATCCCCAG  432
             ||||||||    || | ||| ||||||||  | ||||| || || |||| |||| |||| 
Sbjct  4652  TTGCAGATATTGAAGAGCTCTTCGTTGATGAGCAGTTTATTGCCCAGCACCCATGCCCAC  4593

Query  433   ACTCGTCCTCGTAACTCCTTTGGAATCCCAGCAAAACAGAGTGCT  477
             || || ||||| | ||| ||||| || || ||||||||||| |||
Sbjct  4592  ACACGCCCTCGCAGCTCTTTTGGGATGCCGGCAAAACAGAGCGCT  4548

>PHKE:scaffold_98 scf_22126_98.1_contig_1 dna:supercontig supercontig:PhyKer238_432v1:scf_22126_98.1_contig_1:1:103693:1 
REF
Length=103693

 Score = 76.1 bits (83),  Expect = 2e-11
 Identities = 79/104 (76%), Gaps = 0/104 (0%)
 Strand=Plus/Plus

Query  373    TTGCAGATTCGAAATAACTCCTCGTTGATTTGGAGTTTGTTCCCGAGCAACCATCCCCAG  432
              ||||| ||| | || |  || || || ||||| ||  |||| || | || |||| |||| 
Sbjct  78549  TTGCAAATTTGGAACAGGTCTTCATTAATTTGCAGAGTGTTTCCCAACATCCATGCCCAC  78608

Query  433    ACTCGTCCTCGTAACTCCTTTGGAATCCCAGCAAAACAGAGTGC  476
               | || ||||||||||||||||| || || ||||| ||||||||
Sbjct  78609  GCACGCCCTCGTAACTCCTTTGGGATACCCGCAAAGCAGAGTGC  78652

>SAPA:scaffold_1181 supercont2.1181 dna:supercontig supercontig:ASM15154v2:supercont2.1181:1:2319:1 
REF
Length=2319

 Score = 66.2 bits (72),  Expect = 1e-08
 Identities = 87/121 (72%), Gaps = 0/121 (0%)
 Strand=Plus/Minus

Query  353  GCACCGCTTTGGCTCTATCTTTGCAGATTCGAAATAACTCCTCGTTGATTTGGAGTTTGT  412
            |||| |||||||| |     ||||||||   ||| | ||  |||||||| ||||| ||||
Sbjct  334  GCACAGCTTTGGCGCGCGTCTTGCAGATCTCAAAGAGCTGTTCGTTGATCTGGAGCTTGT  275

Query  413  TCCCGAGCAACCATCCCCAGACTCGTCCTCGTAACTCCTTTGGAATCCCAGCAAAACAGA  472
            | ||||| | |    ||||  | || || || |  |||||||||||||| ||||| || |
Sbjct  274  TGCCGAGGAGCGCGGCCCACGCACGGCCGCGCACTTCCTTTGGAATCCCCGCAAAGCAAA  215

Query  473  G  473
            |
Sbjct  214  G  214

>PYIR:scaffold_8 pir_scaffold_8 dna:supercontig supercontig:pir_scaffolds_v1:pir_scaffold_8:1:111390:1 
REF
Length=111390

 Score = 64.4 bits (70),  Expect = 4e-08
 Identities = 95/135 (70%), Gaps = 0/135 (0%)
 Strand=Plus/Minus

Query  343    ATCTCGGATCGCACCGCTTTGGCTCTATCTTTGCAGATTCGAAATAACTCCTCGTTGATT  402
              ||||||  |||||| ||    |||||  | ||||||||    || || || ||||| |  
Sbjct  89478  ATCTCGCGTCGCACAGCCAGCGCTCTCGCCTTGCAGATCTTGAACAAATCTTCGTTCACC  89419

Query  403    TGGAGTTTGTTCCCGAGCAACCATCCCCAGACTCGTCCTCGTAACTCCTTTGGAATCCCA  462
              || |  ||||| || |  | |||  ||||  | ||||| || |  |||||||| ||||||
Sbjct  89418  TGCAACTTGTTGCCCAAGATCCACGCCCACGCACGTCCACGCACTTCCTTTGGGATCCCA  89359

Query  463    GCAAAACAGAGTGCT  477
              ||||| ||||| |||
Sbjct  89358  GCAAAGCAGAGCGCT  89344

>SAPA:scaffold_122 supercont2.122 dna:supercontig supercontig:ASM15154v2:supercont2.122:1:95780:1 
REF
Length=95780

 Score = 51.8 bits (56),  Expect = 2e-04
 Identities = 73/103 (71%), Gaps = 0/103 (0%)
 Strand=Plus/Minus

Query  353    GCACCGCTTTGGCTCTATCTTTGCAGATTCGAAATAACTCCTCGTTGATTTGGAGTTTGT  412
              ||||||||||||| |     ||||||||   ||| | ||  |||||||| ||||| ||||
Sbjct  12718  GCACCGCTTTGGCGCGCGTCTTGCAGATCTCAAAGAGCTGTTCGTTGATCTGGAGCTTGT  12659

Query  413    TCCCGAGCAACCATCCCCAGACTCGTCCTCGTAACTCCTTTGG  455
              | ||||| | |    ||||  | || || || |  ||||||||
Sbjct  12658  TGCCGAGGAGCGCGGCCCACGCACGGCCGCGCACTTCCTTTGG  12616

>PYUU:scaffold_2032 scf1117875582032 dna:supercontig supercontig:pug:scf1117875582032:1:863081:1 
REF
Length=863081

 Score = 49.1 bits (53),  Expect = 0.003
 Identities = 35/38 (92%), Gaps = 2/38 (5%)
 Strand=Plus/Plus

Query  565     TTGACACGCTTTCGCTCTTCCTTC-CGAGTTT-TCGAC  600
               ||||||||||| |||||||||||| ||||||| |||||
Sbjct  304902  TTGACACGCTTGCGCTCTTCCTTCTCGAGTTTCTCGAC  304939

>PLHA:NW_020187567.1 Plasmopara halstedii genome assembly, contig: 
Scaffold_650, whole genome shotgun sequence
Length=2891727

 Score = 39.2 bits (42),  Expect = 1.4
 Identities = 27/31 (87%), Gaps = 0/31 (0%)
 Strand=Plus/Plus

Query  15      TCCATGTGTAAGCAGATGGATGCAGCAAGAT  45
               ||| ||||||||||||  ||| |||||||||
Sbjct  484956  TCCTTGTGTAAGCAGACTGATTCAGCAAGAT  484986

>PYUU:scaffold_1984 scf1117875581984 dna:supercontig supercontig:pug:scf1117875581984:1:290057:1 
REF
Length=290057

 Score = 38.3 bits (41),  Expect = 4.9
 Identities = 22/23 (96%), Gaps = 0/23 (0%)
 Strand=Plus/Minus

Query  307    AGTTTCATAATCGCGTCCACTTC  329
              |||||||||||||| ||||||||
Sbjct  41165  AGTTTCATAATCGCATCCACTTC  41143

>APAS:scaffold_13 supercont1.13 dna:supercontig supercontig:Apha_asta_APO3_V1:supercont1.13:1:1183921:1 
REF
Length=1183921

 Score = 38.3 bits (41),  Expect = 4.9
 Identities = 28/33 (85%), Gaps = 0/33 (0%)
 Strand=Plus/Minus

Query  249     TGACTCGTCCTCTGAGAAATTTGTGGATTGTGT  281
               ||||||  ||||||||||||||| ||| | |||
Sbjct  273995  TGACTCACCCTCTGAGAAATTTGAGGAATTTGT  273963

>PHPA:scaffold_33 NW_008649019.1 Phytophthora parasitica INRA-310 
unplaced genomic scaffold supercont2.33, whole genome shotgun 
sequence
Length=679903

 Score = 37.4 bits (40),  Expect = 4.9
 Identities = 20/20 (100%), Gaps = 0/20 (0%)
 Strand=Plus/Plus

Query  178     TCTTCGTTCTCACTTGTGGT  197
               ||||||||||||||||||||
Sbjct  447662  TCTTCGTTCTCACTTGTGGT  447681

Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 864100842504

  Database: OGOB_genomes.fna
    Posted date:  Sep 16, 2018  3:46 PM
  Number of letters in database: 1,297,559,224
  Number of sequences in database:  64,241

Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2